Multiple sequence alignment - TraesCS5D01G028700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G028700 chr5D 100.000 2570 0 0 1 2570 27069257 27066688 0.000000 4747.0
1 TraesCS5D01G028700 chr5D 97.523 2543 57 5 1 2539 406653867 406651327 0.000000 4342.0
2 TraesCS5D01G028700 chr2D 98.229 2541 38 7 1 2539 552882400 552879865 0.000000 4436.0
3 TraesCS5D01G028700 chr2D 97.097 1447 33 6 1 1442 304671651 304673093 0.000000 2431.0
4 TraesCS5D01G028700 chr1D 98.152 2543 38 7 1 2539 69167071 69164534 0.000000 4427.0
5 TraesCS5D01G028700 chr1D 98.942 1701 17 1 870 2570 78958827 78960526 0.000000 3040.0
6 TraesCS5D01G028700 chr7D 97.639 2541 54 6 1 2539 207396143 207393607 0.000000 4355.0
7 TraesCS5D01G028700 chr7D 98.295 1701 28 1 870 2570 86554707 86556406 0.000000 2979.0
8 TraesCS5D01G028700 chr7D 97.965 1720 31 3 822 2539 207213075 207211358 0.000000 2979.0
9 TraesCS5D01G028700 chr7D 97.475 990 21 4 1 987 207213946 207212958 0.000000 1687.0
10 TraesCS5D01G028700 chr7D 98.514 942 10 4 1 939 17734474 17735414 0.000000 1659.0
11 TraesCS5D01G028700 chr6D 98.008 2159 35 5 387 2539 102280032 102277876 0.000000 3742.0
12 TraesCS5D01G028700 chr4D 98.355 1702 25 3 870 2570 167162034 167160335 0.000000 2985.0
13 TraesCS5D01G028700 chr4D 98.514 942 8 6 1 939 529832 530770 0.000000 1657.0
14 TraesCS5D01G028700 chrUn 100.000 34 0 0 2537 2570 130606729 130606762 0.000002 63.9
15 TraesCS5D01G028700 chr4B 100.000 34 0 0 2537 2570 10904889 10904856 0.000002 63.9
16 TraesCS5D01G028700 chr4B 100.000 34 0 0 2537 2570 138927686 138927719 0.000002 63.9
17 TraesCS5D01G028700 chr4B 100.000 34 0 0 2537 2570 178223191 178223224 0.000002 63.9
18 TraesCS5D01G028700 chr4B 100.000 34 0 0 2537 2570 311862417 311862384 0.000002 63.9
19 TraesCS5D01G028700 chr4B 100.000 34 0 0 2537 2570 379063028 379063061 0.000002 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G028700 chr5D 27066688 27069257 2569 True 4747 4747 100.000 1 2570 1 chr5D.!!$R1 2569
1 TraesCS5D01G028700 chr5D 406651327 406653867 2540 True 4342 4342 97.523 1 2539 1 chr5D.!!$R2 2538
2 TraesCS5D01G028700 chr2D 552879865 552882400 2535 True 4436 4436 98.229 1 2539 1 chr2D.!!$R1 2538
3 TraesCS5D01G028700 chr2D 304671651 304673093 1442 False 2431 2431 97.097 1 1442 1 chr2D.!!$F1 1441
4 TraesCS5D01G028700 chr1D 69164534 69167071 2537 True 4427 4427 98.152 1 2539 1 chr1D.!!$R1 2538
5 TraesCS5D01G028700 chr1D 78958827 78960526 1699 False 3040 3040 98.942 870 2570 1 chr1D.!!$F1 1700
6 TraesCS5D01G028700 chr7D 207393607 207396143 2536 True 4355 4355 97.639 1 2539 1 chr7D.!!$R1 2538
7 TraesCS5D01G028700 chr7D 86554707 86556406 1699 False 2979 2979 98.295 870 2570 1 chr7D.!!$F2 1700
8 TraesCS5D01G028700 chr7D 207211358 207213946 2588 True 2333 2979 97.720 1 2539 2 chr7D.!!$R2 2538
9 TraesCS5D01G028700 chr7D 17734474 17735414 940 False 1659 1659 98.514 1 939 1 chr7D.!!$F1 938
10 TraesCS5D01G028700 chr6D 102277876 102280032 2156 True 3742 3742 98.008 387 2539 1 chr6D.!!$R1 2152
11 TraesCS5D01G028700 chr4D 167160335 167162034 1699 True 2985 2985 98.355 870 2570 1 chr4D.!!$R1 1700
12 TraesCS5D01G028700 chr4D 529832 530770 938 False 1657 1657 98.514 1 939 1 chr4D.!!$F1 938

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
643 655 1.002544 GGCTACTGCACTGTCCTTCTT 59.997 52.381 0.0 0.0 41.91 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2528 2695 5.163405 TGCTTTGTTATGTTTGTTGCCCTAA 60.163 36.0 0.0 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 81 7.970061 TCGAAAATGAAGCTATGGAGATTTTTG 59.030 33.333 0.00 0.0 29.33 2.44
643 655 1.002544 GGCTACTGCACTGTCCTTCTT 59.997 52.381 0.00 0.0 41.91 2.52
961 1117 3.583086 TCCCCATCTTCTCGTTCTTCTTT 59.417 43.478 0.00 0.0 0.00 2.52
1141 1297 1.531739 GAATGGGAACTTTGGGCGCA 61.532 55.000 10.83 0.0 0.00 6.09
1160 1316 2.349438 GCAAGTTCGTCAAATGCGAGAA 60.349 45.455 0.00 0.0 39.61 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
379 390 9.442062 TCCATTTATGAGACCTAGTTACCATAA 57.558 33.333 0.00 0.00 0.00 1.90
467 478 3.359033 GGGGTTATTAGGGTTTGACCAC 58.641 50.000 0.00 0.00 41.02 4.16
643 655 1.614850 GGGGCAGATCGTAAAAACCCA 60.615 52.381 0.00 0.00 37.62 4.51
961 1117 2.451490 ACAGAGGAATTGCTCGAGAGA 58.549 47.619 18.75 3.26 39.12 3.10
1141 1297 2.869801 TGTTCTCGCATTTGACGAACTT 59.130 40.909 0.00 0.00 39.39 2.66
1266 1422 3.342377 TGGTGGCATTTCTTCACGATA 57.658 42.857 0.00 0.00 32.65 2.92
1400 1556 2.483197 TATTCCGGACGCGCTGCTA 61.483 57.895 1.83 0.00 0.00 3.49
1746 1902 6.288941 TGATCCAACACTCGAGGTTATTTA 57.711 37.500 18.41 5.08 0.00 1.40
2528 2695 5.163405 TGCTTTGTTATGTTTGTTGCCCTAA 60.163 36.000 0.00 0.00 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.