Multiple sequence alignment - TraesCS5D01G022800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G022800 chr5D 100.000 2608 0 0 1 2608 16176519 16173912 0 4817
1 TraesCS5D01G022800 chr5D 98.899 1635 16 2 1 1635 8250471 8252103 0 2918
2 TraesCS5D01G022800 chr3D 99.083 1635 15 0 1 1635 530288335 530286701 0 2937
3 TraesCS5D01G022800 chr3D 99.021 1635 15 1 1 1635 522531762 522533395 0 2929
4 TraesCS5D01G022800 chr1D 98.960 1635 16 1 1 1635 411212241 411213874 0 2924
5 TraesCS5D01G022800 chr1D 98.898 1634 18 0 2 1635 38762393 38764026 0 2918
6 TraesCS5D01G022800 chr1D 98.777 1635 19 1 1 1635 2184199 2185832 0 2907
7 TraesCS5D01G022800 chr1D 95.082 976 42 4 1636 2608 437862544 437863516 0 1531
8 TraesCS5D01G022800 chr7D 98.899 1635 17 1 1 1635 17198655 17200288 0 2918
9 TraesCS5D01G022800 chr6D 98.838 1635 18 1 1 1635 62913890 62915523 0 2913
10 TraesCS5D01G022800 chr6D 95.483 974 41 3 1636 2608 136088257 136089228 0 1552
11 TraesCS5D01G022800 chr6D 95.478 973 43 1 1636 2608 383852074 383851103 0 1552
12 TraesCS5D01G022800 chr6D 95.175 974 40 6 1636 2608 326479983 326479016 0 1531
13 TraesCS5D01G022800 chr2D 98.716 1635 21 0 1 1635 431410449 431412083 0 2904
14 TraesCS5D01G022800 chr2D 95.375 973 44 1 1636 2608 154718927 154719898 0 1546
15 TraesCS5D01G022800 chr2D 95.184 976 43 2 1636 2608 408295583 408294609 0 1539
16 TraesCS5D01G022800 chr2D 94.980 976 45 2 1636 2608 292091353 292090379 0 1528
17 TraesCS5D01G022800 chr2D 94.969 974 47 2 1636 2608 188234332 188233360 0 1526
18 TraesCS5D01G022800 chr4D 94.974 975 43 5 1636 2608 88222327 88221357 0 1524


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G022800 chr5D 16173912 16176519 2607 True 4817 4817 100.000 1 2608 1 chr5D.!!$R1 2607
1 TraesCS5D01G022800 chr5D 8250471 8252103 1632 False 2918 2918 98.899 1 1635 1 chr5D.!!$F1 1634
2 TraesCS5D01G022800 chr3D 530286701 530288335 1634 True 2937 2937 99.083 1 1635 1 chr3D.!!$R1 1634
3 TraesCS5D01G022800 chr3D 522531762 522533395 1633 False 2929 2929 99.021 1 1635 1 chr3D.!!$F1 1634
4 TraesCS5D01G022800 chr1D 411212241 411213874 1633 False 2924 2924 98.960 1 1635 1 chr1D.!!$F3 1634
5 TraesCS5D01G022800 chr1D 38762393 38764026 1633 False 2918 2918 98.898 2 1635 1 chr1D.!!$F2 1633
6 TraesCS5D01G022800 chr1D 2184199 2185832 1633 False 2907 2907 98.777 1 1635 1 chr1D.!!$F1 1634
7 TraesCS5D01G022800 chr1D 437862544 437863516 972 False 1531 1531 95.082 1636 2608 1 chr1D.!!$F4 972
8 TraesCS5D01G022800 chr7D 17198655 17200288 1633 False 2918 2918 98.899 1 1635 1 chr7D.!!$F1 1634
9 TraesCS5D01G022800 chr6D 62913890 62915523 1633 False 2913 2913 98.838 1 1635 1 chr6D.!!$F1 1634
10 TraesCS5D01G022800 chr6D 136088257 136089228 971 False 1552 1552 95.483 1636 2608 1 chr6D.!!$F2 972
11 TraesCS5D01G022800 chr6D 383851103 383852074 971 True 1552 1552 95.478 1636 2608 1 chr6D.!!$R2 972
12 TraesCS5D01G022800 chr6D 326479016 326479983 967 True 1531 1531 95.175 1636 2608 1 chr6D.!!$R1 972
13 TraesCS5D01G022800 chr2D 431410449 431412083 1634 False 2904 2904 98.716 1 1635 1 chr2D.!!$F2 1634
14 TraesCS5D01G022800 chr2D 154718927 154719898 971 False 1546 1546 95.375 1636 2608 1 chr2D.!!$F1 972
15 TraesCS5D01G022800 chr2D 408294609 408295583 974 True 1539 1539 95.184 1636 2608 1 chr2D.!!$R3 972
16 TraesCS5D01G022800 chr2D 292090379 292091353 974 True 1528 1528 94.980 1636 2608 1 chr2D.!!$R2 972
17 TraesCS5D01G022800 chr2D 188233360 188234332 972 True 1526 1526 94.969 1636 2608 1 chr2D.!!$R1 972
18 TraesCS5D01G022800 chr4D 88221357 88222327 970 True 1524 1524 94.974 1636 2608 1 chr4D.!!$R1 972

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
516 518 5.105756 CCCAAAAGATCGTGCTCCTTAAAAT 60.106 40.0 0.0 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2063 2067 0.393537 CCGGAGCCAAGCTTGAAGAT 60.394 55.0 28.05 10.74 39.88 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
516 518 5.105756 CCCAAAAGATCGTGCTCCTTAAAAT 60.106 40.000 0.00 0.00 0.00 1.82
517 519 6.389906 CCAAAAGATCGTGCTCCTTAAAATT 58.610 36.000 0.00 0.00 0.00 1.82
518 520 6.868339 CCAAAAGATCGTGCTCCTTAAAATTT 59.132 34.615 0.00 0.00 0.00 1.82
519 521 7.384932 CCAAAAGATCGTGCTCCTTAAAATTTT 59.615 33.333 8.75 8.75 0.00 1.82
1004 1006 1.074727 TGTTGTTGTAGGGACCATGGG 59.925 52.381 18.09 0.00 0.00 4.00
1426 1428 1.300963 GCCATGCTGGAGAAGGTCA 59.699 57.895 6.40 0.00 40.96 4.02
1491 1493 2.226330 CCCCGACAACATGTCTTCAAA 58.774 47.619 0.00 0.00 44.85 2.69
1724 1727 0.254747 TTGAAGGGGTTATGCGGGAG 59.745 55.000 0.00 0.00 0.00 4.30
1736 1739 1.005394 GCGGGAGAAGGAACACGAA 60.005 57.895 0.00 0.00 0.00 3.85
1738 1741 0.601558 CGGGAGAAGGAACACGAAGA 59.398 55.000 0.00 0.00 0.00 2.87
1772 1775 0.177373 GCCCCTTACGGTGAAGGTAG 59.823 60.000 10.90 4.79 44.02 3.18
1841 1844 1.141858 GGGAGCTAAACAGCTATGCCT 59.858 52.381 0.00 0.00 46.36 4.75
1869 1873 1.936547 GATGAGATTGTTGTCGCCCTC 59.063 52.381 0.00 0.00 0.00 4.30
2023 2027 5.609533 AATACTGATTGTAACTACGGGCT 57.390 39.130 0.00 0.00 34.45 5.19
2043 2047 3.747708 GCTTTAAGCCATATCCGGGTCTT 60.748 47.826 5.52 0.00 35.11 3.01
2063 2067 2.760378 GCCCATCTCTGGCCCATCA 61.760 63.158 0.00 0.00 43.33 3.07
2071 2075 2.172082 TCTCTGGCCCATCATCTTCAAG 59.828 50.000 0.00 0.00 0.00 3.02
2255 2259 1.125633 GAAGGCCATAACCCGGAGTA 58.874 55.000 5.01 0.00 0.00 2.59
2284 2288 2.598565 CTCTGGACTCCGGATAATCCA 58.401 52.381 23.73 23.73 38.36 3.41
2355 2362 3.831715 ACGGATCTTTGCTTTTACTGC 57.168 42.857 0.00 0.00 0.00 4.40
2362 2369 3.894427 TCTTTGCTTTTACTGCCATTCCA 59.106 39.130 0.00 0.00 0.00 3.53
2377 2384 1.885560 TTCCAAAAATCGAGGCGTCA 58.114 45.000 7.26 0.00 0.00 4.35
2434 2445 1.883084 CGCGCCCACTTATGACCTC 60.883 63.158 0.00 0.00 0.00 3.85
2496 2509 2.507110 CTTCTTCCTCCTCGCGCCAA 62.507 60.000 0.00 0.00 0.00 4.52
2577 2590 4.175337 GGCCGCTGCATCACCCTA 62.175 66.667 1.55 0.00 40.13 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
241 242 0.398522 TACCGATGACCAGATGCCCT 60.399 55.000 0.00 0.00 0.00 5.19
301 302 2.948979 GAGACGAGAGATGTCCATGTCT 59.051 50.000 6.64 6.64 43.17 3.41
517 519 4.305769 AGTAATGCGCTTTGATGCAAAAA 58.694 34.783 17.95 0.00 45.45 1.94
518 520 3.911868 AGTAATGCGCTTTGATGCAAAA 58.088 36.364 17.95 0.00 45.45 2.44
519 521 3.574284 AGTAATGCGCTTTGATGCAAA 57.426 38.095 17.95 0.00 45.45 3.68
1004 1006 0.375106 GTTGTTATGCGCCTCTGAGC 59.625 55.000 4.18 0.00 37.86 4.26
1426 1428 6.599638 GCTTCTAACATATGTCCTTCCAAACT 59.400 38.462 9.23 0.00 0.00 2.66
1491 1493 6.120220 CGAAATACTTACAGGGGGAGAAAAT 58.880 40.000 0.00 0.00 0.00 1.82
1724 1727 6.817140 ACCAGTATAAATCTTCGTGTTCCTTC 59.183 38.462 0.00 0.00 0.00 3.46
1736 1739 2.105993 GGGGCCGAACCAGTATAAATCT 59.894 50.000 0.00 0.00 42.05 2.40
1738 1741 2.132686 AGGGGCCGAACCAGTATAAAT 58.867 47.619 0.00 0.00 42.05 1.40
1772 1775 2.338500 CTCAAACTGGACGTAGGCTTC 58.662 52.381 0.00 0.00 0.00 3.86
1841 1844 2.234661 ACAACAATCTCATCGAGAGCCA 59.765 45.455 0.00 0.00 42.26 4.75
1906 1910 2.685387 CTAAGGGCTGCTAGGCGTCG 62.685 65.000 0.00 0.00 42.43 5.12
1960 1964 6.036191 GTGTAAGGCAAGTATAGTTGAAGAGC 59.964 42.308 21.98 7.59 0.00 4.09
1964 1968 7.898918 TGTAGTGTAAGGCAAGTATAGTTGAA 58.101 34.615 21.98 3.38 0.00 2.69
2005 2009 5.220605 GCTTAAAGCCCGTAGTTACAATCAG 60.221 44.000 0.00 0.00 34.48 2.90
2023 2027 4.504340 GCTAAGACCCGGATATGGCTTAAA 60.504 45.833 0.73 0.00 0.00 1.52
2063 2067 0.393537 CCGGAGCCAAGCTTGAAGAT 60.394 55.000 28.05 10.74 39.88 2.40
2071 2075 4.416738 AGAAGCCCGGAGCCAAGC 62.417 66.667 0.73 0.00 45.47 4.01
2255 2259 1.187087 GGAGTCCAGAGGATGACGTT 58.813 55.000 3.60 0.00 36.61 3.99
2284 2288 0.970937 ATGGAGGATGACGTCACGGT 60.971 55.000 22.71 4.83 33.25 4.83
2355 2362 1.472480 ACGCCTCGATTTTTGGAATGG 59.528 47.619 0.00 0.00 0.00 3.16
2362 2369 1.094785 CCCATGACGCCTCGATTTTT 58.905 50.000 0.00 0.00 0.00 1.94
2577 2590 0.179067 TGCGTTTCTCTGGTCCGTTT 60.179 50.000 0.00 0.00 0.00 3.60


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.