AutoCloner

Multiple sequence alignment - TraesCS5D01G021400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS5D01G021400	chr5D	100.000	2757	0	0	1	2757	13930632	13927876	0.000000e+00	5092
1	TraesCS5D01G021400	chr5D	89.286	224	23	1	551	773	273066795	273067018	2.090000e-71	279
2	TraesCS5D01G021400	chr5B	88.705	1328	77	29	814	2106	13361939	13360650	0.000000e+00	1554
3	TraesCS5D01G021400	chr5A	90.485	1093	48	22	999	2062	11029542	11028477	0.000000e+00	1391
4	TraesCS5D01G021400	chr7D	98.134	536	6	1	1	532	85332733	85332198	0.000000e+00	931
5	TraesCS5D01G021400	chr7D	86.667	225	24	5	550	773	409618346	409618127	7.630000e-61	244
6	TraesCS5D01G021400	chr3D	97.761	536	8	1	1	532	500898053	500897518	0.000000e+00	920
7	TraesCS5D01G021400	chr2D	97.761	536	8	1	1	532	87683767	87683232	0.000000e+00	920
8	TraesCS5D01G021400	chr2D	87.556	225	24	4	552	773	644101523	644101300	9.800000e-65	257
9	TraesCS5D01G021400	chr2D	84.646	254	28	8	553	797	607558586	607558335	2.740000e-60	243
10	TraesCS5D01G021400	chr6D	97.575	536	9	1	1	532	59311228	59310693	0.000000e+00	915
11	TraesCS5D01G021400	chr4D	97.579	537	8	2	1	532	481902510	481903046	0.000000e+00	915
12	TraesCS5D01G021400	chr4D	87.946	224	25	2	551	773	119398595	119398373	2.110000e-66	263
13	TraesCS5D01G021400	chr1D	97.579	537	8	2	1	532	81077758	81077222	0.000000e+00	915
14	TraesCS5D01G021400	chr1D	97.575	536	9	2	1	532	194107859	194108394	0.000000e+00	915
15	TraesCS5D01G021400	chr1D	97.579	537	8	2	1	532	377231414	377230878	0.000000e+00	915
16	TraesCS5D01G021400	chr1D	97.575	536	9	1	1	532	458814419	458814954	0.000000e+00	915
17	TraesCS5D01G021400	chr1D	87.946	224	21	5	551	772	373099122	373099341	2.720000e-65	259
18	TraesCS5D01G021400	chr1D	86.404	228	25	4	551	772	290798382	290798155	7.630000e-61	244
19	TraesCS5D01G021400	chr1D	84.536	194	18	9	1348	1535	368484989	368485176	6.070000e-42	182
20	TraesCS5D01G021400	chr1A	83.910	578	60	17	1348	1915	557295736	557296290	3.150000e-144	521
21	TraesCS5D01G021400	chr3B	87.611	226	24	4	551	773	245977435	245977211	2.720000e-65	259
22	TraesCS5D01G021400	chr4B	85.590	229	31	2	547	773	181680348	181680120	3.550000e-59	239
23	TraesCS5D01G021400	chr7B	76.238	202	46	2	1548	1748	138607942	138607742	3.760000e-19	106

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS5D01G021400	chr5D	13927876	13930632	2756	True	5092	5092	100.000	1	2757	1	chr5D.!!$R1	2756
1	TraesCS5D01G021400	chr5B	13360650	13361939	1289	True	1554	1554	88.705	814	2106	1	chr5B.!!$R1	1292
2	TraesCS5D01G021400	chr5A	11028477	11029542	1065	True	1391	1391	90.485	999	2062	1	chr5A.!!$R1	1063
3	TraesCS5D01G021400	chr7D	85332198	85332733	535	True	931	931	98.134	1	532	1	chr7D.!!$R1	531
4	TraesCS5D01G021400	chr3D	500897518	500898053	535	True	920	920	97.761	1	532	1	chr3D.!!$R1	531
5	TraesCS5D01G021400	chr2D	87683232	87683767	535	True	920	920	97.761	1	532	1	chr2D.!!$R1	531
6	TraesCS5D01G021400	chr6D	59310693	59311228	535	True	915	915	97.575	1	532	1	chr6D.!!$R1	531
7	TraesCS5D01G021400	chr4D	481902510	481903046	536	False	915	915	97.579	1	532	1	chr4D.!!$F1	531
8	TraesCS5D01G021400	chr1D	81077222	81077758	536	True	915	915	97.579	1	532	1	chr1D.!!$R1	531
9	TraesCS5D01G021400	chr1D	194107859	194108394	535	False	915	915	97.575	1	532	1	chr1D.!!$F1	531
10	TraesCS5D01G021400	chr1D	377230878	377231414	536	True	915	915	97.579	1	532	1	chr1D.!!$R3	531
11	TraesCS5D01G021400	chr1D	458814419	458814954	535	False	915	915	97.575	1	532	1	chr1D.!!$F4	531
12	TraesCS5D01G021400	chr1A	557295736	557296290	554	False	521	521	83.910	1348	1915	1	chr1A.!!$F1	567

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
559	566	0.033228	CGAGCTGCTAGAGGGGATTG	59.967	60.0	0.15	0.0	0.0	2.67	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2193	2255	0.032403	TTGCCATGTGCTGTTTCTGC	59.968	50.0	7.54	0.0	42.0	4.26	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
272	273	5.571784	AAGGTCGAACATGAGTCGTATAA	57.428	39.130	18.41	2.35	0.00	0.98
533	540	9.045223	AGAAAATTTTGTTGAAAGTTGATAGGC	57.955	29.630	8.47	0.00	35.85	3.93
534	541	7.728847	AAATTTTGTTGAAAGTTGATAGGCC	57.271	32.000	0.00	0.00	34.53	5.19
535	542	4.864704	TTTGTTGAAAGTTGATAGGCCC	57.135	40.909	0.00	0.00	0.00	5.80
536	543	3.517296	TGTTGAAAGTTGATAGGCCCA	57.483	42.857	0.00	0.00	0.00	5.36
537	544	3.420893	TGTTGAAAGTTGATAGGCCCAG	58.579	45.455	0.00	0.00	0.00	4.45
538	545	2.128771	TGAAAGTTGATAGGCCCAGC	57.871	50.000	0.00	0.00	0.00	4.85
539	546	1.017387	GAAAGTTGATAGGCCCAGCG	58.983	55.000	0.00	0.00	0.00	5.18
540	547	1.032114	AAAGTTGATAGGCCCAGCGC	61.032	55.000	0.00	0.00	0.00	5.92
541	548	3.272334	GTTGATAGGCCCAGCGCG	61.272	66.667	0.00	0.00	38.94	6.86
542	549	3.466314	TTGATAGGCCCAGCGCGA	61.466	61.111	12.10	0.00	38.94	5.87
543	550	3.445518	TTGATAGGCCCAGCGCGAG	62.446	63.158	12.10	0.00	38.94	5.03
555	562	4.277593	CGCGAGCTGCTAGAGGGG	62.278	72.222	14.15	3.39	43.27	4.79
556	563	2.835431	GCGAGCTGCTAGAGGGGA	60.835	66.667	14.15	0.00	41.73	4.81
557	564	2.206536	GCGAGCTGCTAGAGGGGAT	61.207	63.158	14.15	0.00	41.73	3.85
558	565	1.753368	GCGAGCTGCTAGAGGGGATT	61.753	60.000	14.15	0.00	41.73	3.01
559	566	0.033228	CGAGCTGCTAGAGGGGATTG	59.967	60.000	0.15	0.00	0.00	2.67
560	567	0.250252	GAGCTGCTAGAGGGGATTGC	60.250	60.000	0.15	0.00	0.00	3.56
561	568	1.596477	GCTGCTAGAGGGGATTGCG	60.596	63.158	0.00	0.00	0.00	4.85
562	569	1.596477	CTGCTAGAGGGGATTGCGC	60.596	63.158	0.00	0.00	0.00	6.09
563	570	2.663188	GCTAGAGGGGATTGCGCG	60.663	66.667	0.00	0.00	0.00	6.86
564	571	2.815308	CTAGAGGGGATTGCGCGT	59.185	61.111	8.43	0.00	0.00	6.01
565	572	1.592669	CTAGAGGGGATTGCGCGTG	60.593	63.158	8.43	0.00	0.00	5.34
566	573	3.733344	TAGAGGGGATTGCGCGTGC	62.733	63.158	15.48	15.48	43.20	5.34
603	610	3.647771	GGGACGGTTGGGAGGCTT	61.648	66.667	0.00	0.00	0.00	4.35

Showing 1 to 25 of 700 entries

Previous1 2 3 4 5…28Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
272	273	7.473735	ACATCTCCATGTTGATCGTATCTAT	57.526	36.000	0.00	0.00	40.66	1.98
516	523	3.420893	CTGGGCCTATCAACTTTCAACA	58.579	45.455	4.53	0.00	0.00	3.33
539	546	1.753368	AATCCCCTCTAGCAGCTCGC	61.753	60.000	0.00	0.47	42.91	5.03
540	547	0.033228	CAATCCCCTCTAGCAGCTCG	59.967	60.000	0.00	0.00	0.00	5.03
541	548	0.250252	GCAATCCCCTCTAGCAGCTC	60.250	60.000	0.00	0.00	0.00	4.09
542	549	1.835693	GCAATCCCCTCTAGCAGCT	59.164	57.895	0.00	0.00	0.00	4.24
543	550	1.596477	CGCAATCCCCTCTAGCAGC	60.596	63.158	0.00	0.00	0.00	5.25
544	551	1.596477	GCGCAATCCCCTCTAGCAG	60.596	63.158	0.30	0.00	0.00	4.24
545	552	2.505982	GCGCAATCCCCTCTAGCA	59.494	61.111	0.30	0.00	0.00	3.49
546	553	2.663188	CGCGCAATCCCCTCTAGC	60.663	66.667	8.75	0.00	0.00	3.42
547	554	1.592669	CACGCGCAATCCCCTCTAG	60.593	63.158	5.73	0.00	0.00	2.43
548	555	2.499205	CACGCGCAATCCCCTCTA	59.501	61.111	5.73	0.00	0.00	2.43
586	593	3.623703	GAAGCCTCCCAACCGTCCC	62.624	68.421	0.00	0.00	0.00	4.46
587	594	2.046217	GAAGCCTCCCAACCGTCC	60.046	66.667	0.00	0.00	0.00	4.79
588	595	2.046217	GGAAGCCTCCCAACCGTC	60.046	66.667	0.00	0.00	35.42	4.79
589	596	2.231380	ATGGAAGCCTCCCAACCGT	61.231	57.895	0.00	0.00	41.64	4.83
590	597	1.750399	CATGGAAGCCTCCCAACCG	60.750	63.158	0.00	0.00	41.64	4.44
591	598	0.681243	GTCATGGAAGCCTCCCAACC	60.681	60.000	0.00	0.00	41.64	3.77
592	599	1.026718	CGTCATGGAAGCCTCCCAAC	61.027	60.000	0.00	0.00	41.64	3.77
593	600	1.299648	CGTCATGGAAGCCTCCCAA	59.700	57.895	0.00	0.00	41.64	4.12
594	601	2.669133	CCGTCATGGAAGCCTCCCA	61.669	63.158	0.00	0.00	41.64	4.37
595	602	2.190578	CCGTCATGGAAGCCTCCC	59.809	66.667	0.00	0.00	41.64	4.30
596	603	2.514824	GCCGTCATGGAAGCCTCC	60.515	66.667	0.00	0.00	42.00	4.30
597	604	2.852495	TTCGCCGTCATGGAAGCCTC	62.852	60.000	0.00	0.00	42.00	4.70
598	605	2.859273	CTTCGCCGTCATGGAAGCCT	62.859	60.000	0.00	0.00	42.00	4.58

Showing 1 to 25 of 665 entries

Previous1 2 3 4 5…27Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.