Multiple sequence alignment - TraesCS5D01G011600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G011600 chr5D 100.000 2303 0 0 1 2303 6267251 6264949 0.000000e+00 4253.0
1 TraesCS5D01G011600 chr5D 98.437 2303 29 3 1 2303 6168217 6165922 0.000000e+00 4047.0
2 TraesCS5D01G011600 chr3B 98.611 2303 28 2 1 2303 101911452 101909154 0.000000e+00 4072.0
3 TraesCS5D01G011600 chr3B 98.462 65 1 0 3 67 51794077 51794013 5.200000e-22 115.0
4 TraesCS5D01G011600 chr3B 97.917 48 1 0 162 209 699266895 699266848 1.470000e-12 84.2
5 TraesCS5D01G011600 chr1D 97.093 2305 59 5 3 2303 51863342 51861042 0.000000e+00 3879.0
6 TraesCS5D01G011600 chr1D 97.118 1943 45 5 270 2212 246421483 246423414 0.000000e+00 3267.0
7 TraesCS5D01G011600 chr1D 98.717 1325 15 1 979 2303 254444708 254446030 0.000000e+00 2351.0
8 TraesCS5D01G011600 chr4D 96.743 2303 68 4 2 2303 19877187 19879483 0.000000e+00 3831.0
9 TraesCS5D01G011600 chr4D 94.538 2307 100 9 1 2303 207038171 207035887 0.000000e+00 3539.0
10 TraesCS5D01G011600 chr4A 96.494 2025 66 2 1 2025 309481308 309479289 0.000000e+00 3341.0
11 TraesCS5D01G011600 chr3D 95.617 1620 54 9 274 1892 200309286 200307683 0.000000e+00 2582.0
12 TraesCS5D01G011600 chr6A 98.137 1288 20 1 199 1486 592504056 592505339 0.000000e+00 2242.0
13 TraesCS5D01G011600 chr2D 97.797 227 5 0 50 276 59896412 59896638 2.140000e-105 392.0
14 TraesCS5D01G011600 chr2B 93.789 161 10 0 1 161 694062383 694062223 2.290000e-60 243.0
15 TraesCS5D01G011600 chr2A 91.411 163 12 1 1 161 715344976 715344814 2.980000e-54 222.0
16 TraesCS5D01G011600 chr7A 98.148 108 2 0 116 223 167574218 167574325 3.020000e-44 189.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G011600 chr5D 6264949 6267251 2302 True 4253 4253 100.000 1 2303 1 chr5D.!!$R2 2302
1 TraesCS5D01G011600 chr5D 6165922 6168217 2295 True 4047 4047 98.437 1 2303 1 chr5D.!!$R1 2302
2 TraesCS5D01G011600 chr3B 101909154 101911452 2298 True 4072 4072 98.611 1 2303 1 chr3B.!!$R2 2302
3 TraesCS5D01G011600 chr1D 51861042 51863342 2300 True 3879 3879 97.093 3 2303 1 chr1D.!!$R1 2300
4 TraesCS5D01G011600 chr1D 246421483 246423414 1931 False 3267 3267 97.118 270 2212 1 chr1D.!!$F1 1942
5 TraesCS5D01G011600 chr1D 254444708 254446030 1322 False 2351 2351 98.717 979 2303 1 chr1D.!!$F2 1324
6 TraesCS5D01G011600 chr4D 19877187 19879483 2296 False 3831 3831 96.743 2 2303 1 chr4D.!!$F1 2301
7 TraesCS5D01G011600 chr4D 207035887 207038171 2284 True 3539 3539 94.538 1 2303 1 chr4D.!!$R1 2302
8 TraesCS5D01G011600 chr4A 309479289 309481308 2019 True 3341 3341 96.494 1 2025 1 chr4A.!!$R1 2024
9 TraesCS5D01G011600 chr3D 200307683 200309286 1603 True 2582 2582 95.617 274 1892 1 chr3D.!!$R1 1618
10 TraesCS5D01G011600 chr6A 592504056 592505339 1283 False 2242 2242 98.137 199 1486 1 chr6A.!!$F1 1287

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
603 609 7.419711 TTGCTAAGTCCTGCTATTTACTACT 57.58 36.0 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1671 1700 5.100259 CACAAAGAATTTCCTGCTGCTATG 58.9 41.667 0.0 0.0 35.03 2.23 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
373 379 7.649370 TTGCATTTCAATTATTTGCGAAAGA 57.351 28.000 0.00 0.0 36.11 2.52
572 578 7.728847 TGGAATATACCGAATTGTGATCAAG 57.271 36.000 0.00 0.0 36.97 3.02
603 609 7.419711 TTGCTAAGTCCTGCTATTTACTACT 57.580 36.000 0.00 0.0 0.00 2.57
1022 1039 8.839310 AATATGAATCGGAGACTTAATCTTGG 57.161 34.615 0.00 0.0 42.51 3.61
1301 1324 7.435192 GGTAACTCCAACTTCAACTTCAATTTG 59.565 37.037 0.00 0.0 35.97 2.32
1394 1418 1.680735 GACACAAACTGTTCATGGGCA 59.319 47.619 0.00 0.0 31.03 5.36
1694 1723 3.655276 AGCAGCAGGAAATTCTTTGTG 57.345 42.857 0.00 0.0 0.00 3.33
2121 2150 2.281772 AAAAACCCCGGGTTCCACGA 62.282 55.000 22.63 0.0 46.20 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
196 198 6.013379 TCCATTCCGGAGCATCTTAATCTTAT 60.013 38.462 3.34 0.00 39.64 1.73
373 379 6.174720 TCGAGGGTTCTAGCAATTGATATT 57.825 37.500 10.34 0.00 0.00 1.28
592 598 9.562583 GATCTAATTCCGAGCAGTAGTAAATAG 57.437 37.037 0.00 0.00 0.00 1.73
603 609 4.838423 TCCCTTATGATCTAATTCCGAGCA 59.162 41.667 0.00 0.00 0.00 4.26
669 682 1.967319 TTGCTAATTCCGATCTGCCC 58.033 50.000 0.00 0.00 0.00 5.36
670 683 3.565482 TCAATTGCTAATTCCGATCTGCC 59.435 43.478 0.00 0.00 0.00 4.85
671 684 4.818534 TCAATTGCTAATTCCGATCTGC 57.181 40.909 0.00 0.00 0.00 4.26
672 685 9.734620 TTTTTATCAATTGCTAATTCCGATCTG 57.265 29.630 0.00 0.00 0.00 2.90
806 819 6.458232 TCGGGAAAGACAAGAAAATTTCAA 57.542 33.333 8.55 0.00 34.15 2.69
1022 1039 9.601217 ACAAGAATGTATTGTTCTGAGGTATAC 57.399 33.333 0.00 0.00 37.61 1.47
1394 1418 5.359860 CCAGGACCTAAACAACTCACTTTTT 59.640 40.000 0.00 0.00 0.00 1.94
1669 1698 5.125097 ACAAAGAATTTCCTGCTGCTATGAG 59.875 40.000 0.00 0.00 35.03 2.90
1671 1700 5.100259 CACAAAGAATTTCCTGCTGCTATG 58.900 41.667 0.00 0.00 35.03 2.23
1694 1723 5.882557 TCTTCCTGAATACCTTGATTCAAGC 59.117 40.000 19.04 7.31 43.48 4.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.