Multiple sequence alignment - TraesCS5D01G011400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G011400 chr5D 100.000 2744 0 0 1 2744 6256936 6254193 0 5068
1 TraesCS5D01G011400 chr5D 97.645 2760 40 7 1 2741 503309839 503312592 0 4713
2 TraesCS5D01G011400 chr5D 97.912 2347 26 7 1 2326 503332455 503334799 0 4041
3 TraesCS5D01G011400 chr5D 97.999 2149 22 3 462 2590 481591752 481593899 0 3711
4 TraesCS5D01G011400 chr5D 98.265 1729 13 1 1033 2744 503336802 503338530 0 3011
5 TraesCS5D01G011400 chr5D 97.937 1454 12 1 1309 2744 481595400 481596853 0 2503
6 TraesCS5D01G011400 chr1D 97.892 2609 32 5 1 2590 254452969 254455573 0 4492
7 TraesCS5D01G011400 chr1D 98.773 1712 20 1 1033 2744 254456798 254458508 0 3044
8 TraesCS5D01G011400 chr3A 98.141 1829 15 2 935 2744 105559698 105557870 0 3171
9 TraesCS5D01G011400 chr1A 97.876 1836 19 2 929 2744 554479513 554481348 0 3157
10 TraesCS5D01G011400 chr1A 97.899 952 14 3 1 946 554478406 554479357 0 1642
11 TraesCS5D01G011400 chr1B 97.762 1832 23 4 929 2744 633714234 633716063 0 3140
12 TraesCS5D01G011400 chr1B 96.944 949 22 5 1 946 633713134 633714078 0 1585
13 TraesCS5D01G011400 chr4A 96.908 1811 54 2 935 2744 309449126 309447317 0 3033
14 TraesCS5D01G011400 chrUn 98.630 1606 19 2 51 1654 385511363 385509759 0 2841
15 TraesCS5D01G011400 chrUn 98.695 996 10 2 523 1516 453036190 453035196 0 1764
16 TraesCS5D01G011400 chr3B 97.857 1213 9 1 1549 2744 101922754 101923966 0 2080
17 TraesCS5D01G011400 chr7B 96.680 1024 30 4 1558 2579 592597075 592598096 0 1700
18 TraesCS5D01G011400 chr7B 97.677 947 21 1 1 946 137682570 137683516 0 1626
19 TraesCS5D01G011400 chr6B 97.998 949 15 4 1 946 18742118 18741171 0 1644


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G011400 chr5D 6254193 6256936 2743 True 5068.0 5068 100.0000 1 2744 1 chr5D.!!$R1 2743
1 TraesCS5D01G011400 chr5D 503309839 503312592 2753 False 4713.0 4713 97.6450 1 2741 1 chr5D.!!$F1 2740
2 TraesCS5D01G011400 chr5D 503332455 503338530 6075 False 3526.0 4041 98.0885 1 2744 2 chr5D.!!$F3 2743
3 TraesCS5D01G011400 chr5D 481591752 481596853 5101 False 3107.0 3711 97.9680 462 2744 2 chr5D.!!$F2 2282
4 TraesCS5D01G011400 chr1D 254452969 254458508 5539 False 3768.0 4492 98.3325 1 2744 2 chr1D.!!$F1 2743
5 TraesCS5D01G011400 chr3A 105557870 105559698 1828 True 3171.0 3171 98.1410 935 2744 1 chr3A.!!$R1 1809
6 TraesCS5D01G011400 chr1A 554478406 554481348 2942 False 2399.5 3157 97.8875 1 2744 2 chr1A.!!$F1 2743
7 TraesCS5D01G011400 chr1B 633713134 633716063 2929 False 2362.5 3140 97.3530 1 2744 2 chr1B.!!$F1 2743
8 TraesCS5D01G011400 chr4A 309447317 309449126 1809 True 3033.0 3033 96.9080 935 2744 1 chr4A.!!$R1 1809
9 TraesCS5D01G011400 chrUn 385509759 385511363 1604 True 2841.0 2841 98.6300 51 1654 1 chrUn.!!$R1 1603
10 TraesCS5D01G011400 chrUn 453035196 453036190 994 True 1764.0 1764 98.6950 523 1516 1 chrUn.!!$R2 993
11 TraesCS5D01G011400 chr3B 101922754 101923966 1212 False 2080.0 2080 97.8570 1549 2744 1 chr3B.!!$F1 1195
12 TraesCS5D01G011400 chr7B 592597075 592598096 1021 False 1700.0 1700 96.6800 1558 2579 1 chr7B.!!$F2 1021
13 TraesCS5D01G011400 chr7B 137682570 137683516 946 False 1626.0 1626 97.6770 1 946 1 chr7B.!!$F1 945
14 TraesCS5D01G011400 chr6B 18741171 18742118 947 True 1644.0 1644 97.9980 1 946 1 chr6B.!!$R1 945

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
79 81 5.594317 CAGCTAAACCTTATTTGGCCACTAT 59.406 40.0 3.88 4.6 36.69 2.12 F
777 781 6.447162 CCACAAGACAAGAACCTTTATTTCC 58.553 40.0 0.00 0.0 0.00 3.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1118 1479 4.440940 CCGAAATGTAAGGGGCCATTTTAC 60.441 45.833 9.46 12.69 40.4 2.01 R
2562 3461 4.513692 CGCCAATATATTCCCGAAAAGTCA 59.486 41.667 8.01 0.00 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 81 5.594317 CAGCTAAACCTTATTTGGCCACTAT 59.406 40.000 3.88 4.60 36.69 2.12
140 142 8.669055 TTTACAAGGGAGATAGGTTAGTTACA 57.331 34.615 0.00 0.00 0.00 2.41
476 478 7.065803 TCCGAAGATGGAATGTCTAATGTTTTC 59.934 37.037 0.00 0.00 34.30 2.29
777 781 6.447162 CCACAAGACAAGAACCTTTATTTCC 58.553 40.000 0.00 0.00 0.00 3.13
1118 1479 7.228507 TGGTCATGGTATTAAGAAATGGAATCG 59.771 37.037 0.00 0.00 0.00 3.34
1493 1855 0.248012 TTGCAAAGGTATCTCGGCGA 59.752 50.000 10.14 10.14 0.00 5.54
1591 1953 1.207811 GTGCCATTTTGGGGATTCCTG 59.792 52.381 2.01 0.00 38.19 3.86
1666 2028 1.328680 CAGCCAACGATGACACTATGC 59.671 52.381 0.00 0.00 0.00 3.14
2042 2939 8.340757 TCCATTAAAACACTCAAGGGGTTATAT 58.659 33.333 0.00 0.00 0.00 0.86
2198 3095 0.392461 CACAAACCATCCCGACCGAT 60.392 55.000 0.00 0.00 0.00 4.18
2562 3461 6.586082 CACAAAACCATTATCGCTTAGCTTTT 59.414 34.615 1.76 0.00 0.00 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 81 4.901197 TGACCATTAACAGTTGCTCCTA 57.099 40.909 0.00 0.00 0.00 2.94
476 478 1.512926 CGATTAATTCCCCAGGCGAG 58.487 55.000 0.00 0.00 0.00 5.03
708 712 6.215841 TGGAATCTGGTACCAACAGGTATAAA 59.784 38.462 17.11 0.00 39.92 1.40
726 730 5.540911 ACGATGCACAAATTTTTGGAATCT 58.459 33.333 2.52 0.00 42.34 2.40
847 856 8.918961 AAAAATTGTTTGTTACGTCAGAATCA 57.081 26.923 0.00 0.00 0.00 2.57
1118 1479 4.440940 CCGAAATGTAAGGGGCCATTTTAC 60.441 45.833 9.46 12.69 40.40 2.01
1493 1855 7.389232 TGGCAATCTCGTCATATATTTGATCT 58.611 34.615 0.00 0.00 0.00 2.75
2042 2939 5.651139 GCCTACTTCTACACCCGATATATCA 59.349 44.000 13.11 0.00 0.00 2.15
2562 3461 4.513692 CGCCAATATATTCCCGAAAAGTCA 59.486 41.667 8.01 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.