Multiple sequence alignment - TraesCS5D01G011300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G011300 chr5D 100.000 2174 0 0 1 2174 6253289 6255462 0.000000e+00 4015
1 TraesCS5D01G011300 chr5D 97.629 2193 24 4 1 2174 503339427 503337244 0.000000e+00 3736
2 TraesCS5D01G011300 chr5D 97.353 2191 31 3 1 2174 503313489 503311309 0.000000e+00 3699
3 TraesCS5D01G011300 chr5D 97.443 1134 11 1 1059 2174 481593899 481592766 0.000000e+00 1917
4 TraesCS5D01G011300 chr5D 97.011 870 8 2 1323 2174 503334799 503333930 0.000000e+00 1447
5 TraesCS5D01G011300 chr1D 97.930 2174 27 5 1 2174 254459395 254457240 0.000000e+00 3749
6 TraesCS5D01G011300 chr1D 97.305 2189 34 6 1 2174 51831973 51834151 0.000000e+00 3692
7 TraesCS5D01G011300 chr1D 97.531 1134 10 1 1059 2174 254455573 254454440 0.000000e+00 1923
8 TraesCS5D01G011300 chr1D 97.572 1071 8 1 1122 2174 254455569 254456639 0.000000e+00 1818
9 TraesCS5D01G011300 chr3A 97.589 2198 19 5 1 2174 105556970 105559157 0.000000e+00 3735
10 TraesCS5D01G011300 chr1B 97.626 2190 25 4 1 2174 633716958 633714780 0.000000e+00 3731
11 TraesCS5D01G011300 chr3B 97.783 2120 17 4 1 2100 101924863 101922754 0.000000e+00 3627
12 TraesCS5D01G011300 chr4A 95.866 2177 75 6 1 2174 309446421 309448585 0.000000e+00 3507
13 TraesCS5D01G011300 chr1A 97.393 2033 24 3 161 2174 554482083 554480061 0.000000e+00 3434
14 TraesCS5D01G011300 chr4B 95.635 504 4 1 1689 2174 507428889 507429392 0.000000e+00 793
15 TraesCS5D01G011300 chr2A 89.150 341 20 10 1 338 719802322 719801996 2.010000e-110 409


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G011300 chr5D 6253289 6255462 2173 False 4015.0 4015 100.0000 1 2174 1 chr5D.!!$F1 2173
1 TraesCS5D01G011300 chr5D 503311309 503313489 2180 True 3699.0 3699 97.3530 1 2174 1 chr5D.!!$R2 2173
2 TraesCS5D01G011300 chr5D 503333930 503339427 5497 True 2591.5 3736 97.3200 1 2174 2 chr5D.!!$R3 2173
3 TraesCS5D01G011300 chr5D 481592766 481593899 1133 True 1917.0 1917 97.4430 1059 2174 1 chr5D.!!$R1 1115
4 TraesCS5D01G011300 chr1D 51831973 51834151 2178 False 3692.0 3692 97.3050 1 2174 1 chr1D.!!$F1 2173
5 TraesCS5D01G011300 chr1D 254454440 254459395 4955 True 2836.0 3749 97.7305 1 2174 2 chr1D.!!$R1 2173
6 TraesCS5D01G011300 chr1D 254455569 254456639 1070 False 1818.0 1818 97.5720 1122 2174 1 chr1D.!!$F2 1052
7 TraesCS5D01G011300 chr3A 105556970 105559157 2187 False 3735.0 3735 97.5890 1 2174 1 chr3A.!!$F1 2173
8 TraesCS5D01G011300 chr1B 633714780 633716958 2178 True 3731.0 3731 97.6260 1 2174 1 chr1B.!!$R1 2173
9 TraesCS5D01G011300 chr3B 101922754 101924863 2109 True 3627.0 3627 97.7830 1 2100 1 chr3B.!!$R1 2099
10 TraesCS5D01G011300 chr4A 309446421 309448585 2164 False 3507.0 3507 95.8660 1 2174 1 chr4A.!!$F1 2173
11 TraesCS5D01G011300 chr1A 554480061 554482083 2022 True 3434.0 3434 97.3930 161 2174 1 chr1A.!!$R1 2013
12 TraesCS5D01G011300 chr4B 507428889 507429392 503 False 793.0 793 95.6350 1689 2174 1 chr4B.!!$F1 485

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
645 653 9.95672 AATCGGATTCTAAAATCATTGCTTAAG 57.043 29.63 0.0 0.0 42.66 1.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2154 8278 0.248012 TTGCAAAGGTATCTCGGCGA 59.752 50.0 10.14 10.14 0.0 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
645 653 9.956720 AATCGGATTCTAAAATCATTGCTTAAG 57.043 29.630 0.00 0.0 42.66 1.85
1085 3878 4.513692 CGCCAATATATTCCCGAAAAGTCA 59.486 41.667 8.01 0.0 0.00 3.41
2154 8278 7.389232 TGGCAATCTCGTCATATATTTGATCT 58.611 34.615 0.00 0.0 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
645 653 3.193479 CCTCTTTTATGCAGGTTTCCACC 59.807 47.826 0.00 0.00 44.67 4.61
1085 3878 6.586082 CACAAAACCATTATCGCTTAGCTTTT 59.414 34.615 1.76 0.00 0.00 2.27
1449 7041 0.392461 CACAAACCATCCCGACCGAT 60.392 55.000 0.00 0.00 0.00 4.18
1981 8105 1.328680 CAGCCAACGATGACACTATGC 59.671 52.381 0.00 0.00 0.00 3.14
2056 8180 1.207811 GTGCCATTTTGGGGATTCCTG 59.792 52.381 2.01 0.00 38.19 3.86
2154 8278 0.248012 TTGCAAAGGTATCTCGGCGA 59.752 50.000 10.14 10.14 0.00 5.54


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.