Multiple sequence alignment - TraesCS5D01G011200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G011200 chr5D 100.000 2246 0 0 1 2246 6254617 6252372 0 4148
1 TraesCS5D01G011200 chr5D 97.865 2248 32 9 3 2246 503338108 503340343 0 3871
2 TraesCS5D01G011200 chr5D 97.681 2242 37 6 3 2243 503312173 503314400 0 3838
3 TraesCS5D01G011200 chr5D 98.218 2189 23 6 58 2242 299973782 299971606 0 3812
4 TraesCS5D01G011200 chr3A 98.091 2253 25 6 1 2246 105558294 105556053 0 3906
5 TraesCS5D01G011200 chr1B 97.998 2248 31 5 1 2246 633715640 633717875 0 3890
6 TraesCS5D01G011200 chr5B 97.692 2253 34 7 1 2246 57516460 57514219 0 3856
7 TraesCS5D01G011200 chr1D 97.378 2250 36 9 1 2246 254458084 254460314 0 3807
8 TraesCS5D01G011200 chr1D 97.153 2248 45 11 1 2246 51833292 51831062 0 3779
9 TraesCS5D01G011200 chr4A 95.501 2245 79 10 6 2246 309447736 309445510 0 3567


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G011200 chr5D 6252372 6254617 2245 True 4148 4148 100.000 1 2246 1 chr5D.!!$R1 2245
1 TraesCS5D01G011200 chr5D 503338108 503340343 2235 False 3871 3871 97.865 3 2246 1 chr5D.!!$F2 2243
2 TraesCS5D01G011200 chr5D 503312173 503314400 2227 False 3838 3838 97.681 3 2243 1 chr5D.!!$F1 2240
3 TraesCS5D01G011200 chr5D 299971606 299973782 2176 True 3812 3812 98.218 58 2242 1 chr5D.!!$R2 2184
4 TraesCS5D01G011200 chr3A 105556053 105558294 2241 True 3906 3906 98.091 1 2246 1 chr3A.!!$R1 2245
5 TraesCS5D01G011200 chr1B 633715640 633717875 2235 False 3890 3890 97.998 1 2246 1 chr1B.!!$F1 2245
6 TraesCS5D01G011200 chr5B 57514219 57516460 2241 True 3856 3856 97.692 1 2246 1 chr5B.!!$R1 2245
7 TraesCS5D01G011200 chr1D 254458084 254460314 2230 False 3807 3807 97.378 1 2246 1 chr1D.!!$F1 2245
8 TraesCS5D01G011200 chr1D 51831062 51833292 2230 True 3779 3779 97.153 1 2246 1 chr1D.!!$R1 2245
9 TraesCS5D01G011200 chr4A 309445510 309447736 2226 True 3567 3567 95.501 6 2246 1 chr4A.!!$R1 2240

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
683 694 3.193479 CCTCTTTTATGCAGGTTTCCACC 59.807 47.826 0.0 0.0 44.67 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1727 1753 0.107703 CGGATGGCCAGTGAGCTAAA 60.108 55.0 13.05 0.0 0.0 1.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
243 244 6.586082 CACAAAACCATTATCGCTTAGCTTTT 59.414 34.615 1.76 0.0 0.00 2.27
683 694 3.193479 CCTCTTTTATGCAGGTTTCCACC 59.807 47.826 0.00 0.0 44.67 4.61
1090 1105 3.170717 CCTGGAGTTGGTCAAGGTACTA 58.829 50.000 0.00 0.0 41.29 1.82
1770 1796 2.361789 GCAGTTTCGGGCTTAATACCA 58.638 47.619 0.00 0.0 0.00 3.25
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
243 244 4.513692 CGCCAATATATTCCCGAAAAGTCA 59.486 41.667 8.01 0.0 0.00 3.41
683 694 9.956720 AATCGGATTCTAAAATCATTGCTTAAG 57.043 29.630 0.00 0.0 42.66 1.85
1090 1105 1.342074 TCTACAGCTTGTCCTGCAGT 58.658 50.000 13.81 0.0 36.29 4.40
1526 1549 7.041721 GGTGAAAGACTTCCTTTGTTGAAATT 58.958 34.615 0.00 0.0 44.63 1.82
1727 1753 0.107703 CGGATGGCCAGTGAGCTAAA 60.108 55.000 13.05 0.0 0.00 1.85
1996 2026 4.323417 AGTTGATTTACCAATGAGTCGCA 58.677 39.130 0.00 0.0 0.00 5.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.