Multiple sequence alignment - TraesCS5D01G011000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G011000 chr5D 100.000 3554 0 0 1 3554 6252462 6248909 0 6564
1 TraesCS5D01G011000 chr5D 97.921 3559 66 8 1 3554 503314313 503317868 0 6156
2 TraesCS5D01G011000 chr1A 98.068 3572 47 10 1 3554 554482825 554486392 0 6194
3 TraesCS5D01G011000 chr3A 97.922 3561 59 6 1 3554 105556143 105552591 0 6152
4 TraesCS5D01G011000 chr1D 97.642 3563 63 8 1 3554 254460223 254463773 0 6095
5 TraesCS5D01G011000 chr1D 97.162 3559 85 10 1 3554 51831151 51827604 0 5999
6 TraesCS5D01G011000 chr7A 96.878 3555 96 9 1 3553 537840597 537837056 0 5936
7 TraesCS5D01G011000 chr7A 95.961 619 23 1 2858 3476 338988912 338989528 0 1003
8 TraesCS5D01G011000 chr4D 96.542 3557 109 12 1 3554 19901537 19905082 0 5875
9 TraesCS5D01G011000 chr2B 98.461 3118 45 3 440 3554 683728694 683731811 0 5489
10 TraesCS5D01G011000 chr5A 98.258 3099 36 8 1 3090 559031135 559028046 0 5408


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G011000 chr5D 6248909 6252462 3553 True 6564 6564 100.000 1 3554 1 chr5D.!!$R1 3553
1 TraesCS5D01G011000 chr5D 503314313 503317868 3555 False 6156 6156 97.921 1 3554 1 chr5D.!!$F1 3553
2 TraesCS5D01G011000 chr1A 554482825 554486392 3567 False 6194 6194 98.068 1 3554 1 chr1A.!!$F1 3553
3 TraesCS5D01G011000 chr3A 105552591 105556143 3552 True 6152 6152 97.922 1 3554 1 chr3A.!!$R1 3553
4 TraesCS5D01G011000 chr1D 254460223 254463773 3550 False 6095 6095 97.642 1 3554 1 chr1D.!!$F1 3553
5 TraesCS5D01G011000 chr1D 51827604 51831151 3547 True 5999 5999 97.162 1 3554 1 chr1D.!!$R1 3553
6 TraesCS5D01G011000 chr7A 537837056 537840597 3541 True 5936 5936 96.878 1 3553 1 chr7A.!!$R1 3552
7 TraesCS5D01G011000 chr7A 338988912 338989528 616 False 1003 1003 95.961 2858 3476 1 chr7A.!!$F1 618
8 TraesCS5D01G011000 chr4D 19901537 19905082 3545 False 5875 5875 96.542 1 3554 1 chr4D.!!$F1 3553
9 TraesCS5D01G011000 chr2B 683728694 683731811 3117 False 5489 5489 98.461 440 3554 1 chr2B.!!$F1 3114
10 TraesCS5D01G011000 chr5A 559028046 559031135 3089 True 5408 5408 98.258 1 3090 1 chr5A.!!$R1 3089

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
805 844 0.236449 GTTTTCCAACAGGCCGTACG 59.764 55.000 8.69 8.69 32.54 3.67 F
1905 1945 3.402628 TCACGCCTTTTAGAAAGAGCT 57.597 42.857 2.15 0.00 0.00 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2164 2204 4.202245 AGGCTTGTAACTCTGCGAATTA 57.798 40.909 0.0 0.0 0.00 1.40 R
3155 3201 2.708051 TCCAGACACGTACTTCGAGAT 58.292 47.619 0.0 0.0 42.86 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
805 844 0.236449 GTTTTCCAACAGGCCGTACG 59.764 55.000 8.69 8.69 32.54 3.67
814 853 3.902086 GGCCGTACGAGGAGCTCC 61.902 72.222 26.22 26.22 0.00 4.70
854 893 8.626526 AGTTGTTTGAATACCGAGTTACATTTT 58.373 29.630 0.00 0.00 0.00 1.82
1090 1129 8.661345 GGAAAGTAGGGATTGAGAATATAGGTT 58.339 37.037 0.00 0.00 0.00 3.50
1405 1444 4.826183 GCTTAATTGAATCTCCTGCTCCAT 59.174 41.667 0.00 0.00 0.00 3.41
1426 1465 4.223556 TGTATAATTTCCAGGCGTTCCA 57.776 40.909 0.00 0.00 33.74 3.53
1516 1555 5.986135 CGAGAGTTAATTATTGGGGACAGAG 59.014 44.000 0.00 0.00 44.54 3.35
1905 1945 3.402628 TCACGCCTTTTAGAAAGAGCT 57.597 42.857 2.15 0.00 0.00 4.09
2164 2204 4.923281 GCAAATCAAAATTGGAACTAGCGT 59.077 37.500 0.00 0.00 0.00 5.07
2697 2737 5.648330 ACCAAAGGTTTAGAAGACCTCTT 57.352 39.130 0.00 0.00 46.60 2.85
3004 3050 1.002087 GGATACGCCCCTCTACCAATG 59.998 57.143 0.00 0.00 0.00 2.82
3155 3201 6.372103 CCGGTAACAAACACTCATAAACCATA 59.628 38.462 0.00 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
242 263 5.129634 TCATGGTCAGCAAAGTTGTTTCTA 58.870 37.500 0.00 0.00 0.00 2.10
453 492 9.010029 GTTTACAACTTTTATGATCTCTTCCCA 57.990 33.333 0.00 0.00 0.00 4.37
805 844 0.823460 CAGAGTTCCTGGAGCTCCTC 59.177 60.000 32.28 20.22 40.05 3.71
814 853 7.496529 TTCAAACAACTATTCAGAGTTCCTG 57.503 36.000 0.00 0.00 44.27 3.86
854 893 4.913345 CCAATATTAGCACGAATCGTACGA 59.087 41.667 21.93 21.93 38.32 3.43
961 1000 2.302587 TTTCGGAAGCAAGGGGAAAT 57.697 45.000 0.00 0.00 0.00 2.17
1090 1129 1.122632 TCCCCCACTTGAACTACGCA 61.123 55.000 0.00 0.00 0.00 5.24
1405 1444 4.223556 TGGAACGCCTGGAAATTATACA 57.776 40.909 0.00 0.00 34.31 2.29
1426 1465 5.671493 CCCTGTTTGAAGAGGTTCGTATAT 58.329 41.667 6.23 0.00 37.75 0.86
1516 1555 1.312815 ACTGCTGTTTTGCCAGTCTC 58.687 50.000 0.00 0.00 34.84 3.36
1905 1945 8.952278 TCGCCTAAAAGAGAATTTAATTTAGCA 58.048 29.630 0.00 0.00 34.04 3.49
2017 2057 6.998074 TCCGCAGATAAGAATATTTGTCCATT 59.002 34.615 0.00 0.00 0.00 3.16
2164 2204 4.202245 AGGCTTGTAACTCTGCGAATTA 57.798 40.909 0.00 0.00 0.00 1.40
3155 3201 2.708051 TCCAGACACGTACTTCGAGAT 58.292 47.619 0.00 0.00 42.86 2.75
3497 3548 5.678142 TCTTGATAGAGAGGGAGGATCTT 57.322 43.478 0.00 0.00 33.73 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.