Multiple sequence alignment - TraesCS5D01G010900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G010900 chr5D 100.000 4253 0 0 1 4253 6243418 6247670 0 7854
1 TraesCS5D01G010900 chr5D 98.173 4269 57 8 1 4253 503323367 503319104 0 7432
2 TraesCS5D01G010900 chr5D 96.461 3363 69 11 1 3343 432324195 432327527 0 5505
3 TraesCS5D01G010900 chr1D 98.104 4272 61 8 1 4253 254469281 254465011 0 7422
4 TraesCS5D01G010900 chr1D 97.347 4259 102 11 1 4253 51822100 51826353 0 7228
5 TraesCS5D01G010900 chr1D 95.984 4258 157 10 2 4253 244760981 244756732 0 6903
6 TraesCS5D01G010900 chr2B 97.235 4304 67 24 1 4253 683738305 683734003 0 7241
7 TraesCS5D01G010900 chr4D 96.745 4270 108 7 1 4253 19910548 19906293 0 7086
8 TraesCS5D01G010900 chr4A 96.397 4247 126 11 1 4229 309400758 309404995 0 6970
9 TraesCS5D01G010900 chr1A 97.843 3940 51 9 348 4253 554491570 554487631 0 6774
10 TraesCS5D01G010900 chr1B 94.008 4256 220 19 1 4253 217978239 217974016 0 6414
11 TraesCS5D01G010900 chr7B 97.973 3355 59 4 904 4253 662746113 662749463 0 5810
12 TraesCS5D01G010900 chr7B 97.870 939 16 3 1 937 662745166 662746102 0 1620
13 TraesCS5D01G010900 chrUn 97.607 1337 13 4 1 1318 357608716 357610052 0 2274
14 TraesCS5D01G010900 chr3D 98.616 939 9 3 1 937 24156993 24156057 0 1659


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G010900 chr5D 6243418 6247670 4252 False 7854 7854 100.0000 1 4253 1 chr5D.!!$F1 4252
1 TraesCS5D01G010900 chr5D 503319104 503323367 4263 True 7432 7432 98.1730 1 4253 1 chr5D.!!$R1 4252
2 TraesCS5D01G010900 chr5D 432324195 432327527 3332 False 5505 5505 96.4610 1 3343 1 chr5D.!!$F2 3342
3 TraesCS5D01G010900 chr1D 254465011 254469281 4270 True 7422 7422 98.1040 1 4253 1 chr1D.!!$R2 4252
4 TraesCS5D01G010900 chr1D 51822100 51826353 4253 False 7228 7228 97.3470 1 4253 1 chr1D.!!$F1 4252
5 TraesCS5D01G010900 chr1D 244756732 244760981 4249 True 6903 6903 95.9840 2 4253 1 chr1D.!!$R1 4251
6 TraesCS5D01G010900 chr2B 683734003 683738305 4302 True 7241 7241 97.2350 1 4253 1 chr2B.!!$R1 4252
7 TraesCS5D01G010900 chr4D 19906293 19910548 4255 True 7086 7086 96.7450 1 4253 1 chr4D.!!$R1 4252
8 TraesCS5D01G010900 chr4A 309400758 309404995 4237 False 6970 6970 96.3970 1 4229 1 chr4A.!!$F1 4228
9 TraesCS5D01G010900 chr1A 554487631 554491570 3939 True 6774 6774 97.8430 348 4253 1 chr1A.!!$R1 3905
10 TraesCS5D01G010900 chr1B 217974016 217978239 4223 True 6414 6414 94.0080 1 4253 1 chr1B.!!$R1 4252
11 TraesCS5D01G010900 chr7B 662745166 662749463 4297 False 3715 5810 97.9215 1 4253 2 chr7B.!!$F1 4252
12 TraesCS5D01G010900 chrUn 357608716 357610052 1336 False 2274 2274 97.6070 1 1318 1 chrUn.!!$F1 1317
13 TraesCS5D01G010900 chr3D 24156057 24156993 936 True 1659 1659 98.6160 1 937 1 chr3D.!!$R1 936

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
156 161 2.429610 GAGCCGTATGAGGTAGGAAACA 59.570 50.000 0.00 0.00 0.00 2.83 F
1082 1200 1.923356 TCTTTTGAGGAATGGGCCAC 58.077 50.000 9.28 0.00 0.00 5.01 F
1537 1657 2.097466 GCTGGTTGGTTCCATTATCACG 59.903 50.000 0.00 0.00 36.84 4.35 F
2967 3098 2.177531 GCACAGGCATCGCAAGTG 59.822 61.111 5.87 5.87 40.72 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1082 1200 0.322456 TCTTGAGAAATGGCCGGGTG 60.322 55.000 2.18 0.0 0.0 4.61 R
2443 2569 6.655078 AGCATGGATATTTTGTACCCATTC 57.345 37.500 0.00 0.0 35.6 2.67 R
3210 3354 2.684881 CGCTAAGAAGAATGCCCATGTT 59.315 45.455 0.00 0.0 0.0 2.71 R
4214 4365 1.768684 ATGCCCACGCCCTAATCGAT 61.769 55.000 0.00 0.0 0.0 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 73 6.976934 ATTTCTTCTGCTTAACCCAAGAAA 57.023 33.333 7.42 7.42 43.61 2.52
156 161 2.429610 GAGCCGTATGAGGTAGGAAACA 59.570 50.000 0.00 0.00 0.00 2.83
1082 1200 1.923356 TCTTTTGAGGAATGGGCCAC 58.077 50.000 9.28 0.00 0.00 5.01
1210 1328 4.185394 GGAGGAGATTTCTCGAAAAGTCC 58.815 47.826 12.24 12.24 43.76 3.85
1248 1367 5.449177 CGGGCAACTTTCCATTATCTTTCTC 60.449 44.000 0.00 0.00 0.00 2.87
1320 1439 4.798924 GCATGGCTAAGTGATCCTACTCAG 60.799 50.000 0.00 0.00 0.00 3.35
1537 1657 2.097466 GCTGGTTGGTTCCATTATCACG 59.903 50.000 0.00 0.00 36.84 4.35
2443 2569 8.131100 CCATACAATTACAACCTATCTTTGCTG 58.869 37.037 0.00 0.00 0.00 4.41
2634 2764 5.123661 TGCATTTACCATACATGTGACTGTG 59.876 40.000 9.11 0.00 0.00 3.66
2902 3033 6.800890 ACTCATATTACAGGGGGAAACTTTT 58.199 36.000 0.00 0.00 0.00 2.27
2967 3098 2.177531 GCACAGGCATCGCAAGTG 59.822 61.111 5.87 5.87 40.72 3.16
3348 3496 4.682860 CACTACTCGTCGTATTTGGTTTGT 59.317 41.667 0.00 0.00 0.00 2.83
3622 3770 2.771372 TGCTGCTGGTCCAGTGAATATA 59.229 45.455 20.24 0.00 35.28 0.86
4057 4207 4.166919 CCATTCTAACTCTTCTTGGGGGAT 59.833 45.833 0.00 0.00 0.00 3.85
4214 4365 2.122989 GCATACTCCTCCGGGGGA 60.123 66.667 25.22 25.22 36.36 4.81
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
156 161 3.771216 TCCCTTAGAACCGTACTTGAGT 58.229 45.455 0.00 0.00 0.00 3.41
261 266 7.639039 CGCTATAGCTTGTTTCCAATATTCAA 58.361 34.615 21.98 0.00 39.32 2.69
1082 1200 0.322456 TCTTGAGAAATGGCCGGGTG 60.322 55.000 2.18 0.00 0.00 4.61
1210 1328 1.737838 TGCCCGAAATGAGCACTAAG 58.262 50.000 0.00 0.00 0.00 2.18
1248 1367 2.479566 AGTACATGCCACTCAACCAG 57.520 50.000 0.00 0.00 0.00 4.00
1320 1439 0.393537 CCTGAGCACTGGGTCCAATC 60.394 60.000 0.00 0.00 40.83 2.67
1537 1657 1.512694 CCAATTTGGGAGCGGCTTC 59.487 57.895 2.97 0.21 32.67 3.86
2443 2569 6.655078 AGCATGGATATTTTGTACCCATTC 57.345 37.500 0.00 0.00 35.60 2.67
2902 3033 7.770801 CATTAATCGTAATGGAACTCTGTGA 57.229 36.000 0.00 0.00 41.98 3.58
3210 3354 2.684881 CGCTAAGAAGAATGCCCATGTT 59.315 45.455 0.00 0.00 0.00 2.71
3382 3530 9.447040 TGATAAAGACGTTCTTCAGTAATATCG 57.553 33.333 0.00 0.00 35.27 2.92
3410 3558 5.738783 GCCCAAAGTGAGAAGCAAAAATGTA 60.739 40.000 0.00 0.00 0.00 2.29
3622 3770 6.069963 ACCACTGATAAACTCCAGAATAAGCT 60.070 38.462 0.00 0.00 34.65 3.74
3890 4038 7.837202 AAGAAATTATTCCATCGAACGTACA 57.163 32.000 0.00 0.00 36.12 2.90
4057 4207 2.028130 ACTTTGCGTTTGTGGATGGAA 58.972 42.857 0.00 0.00 0.00 3.53
4214 4365 1.768684 ATGCCCACGCCCTAATCGAT 61.769 55.000 0.00 0.00 0.00 3.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.