Multiple sequence alignment - TraesCS5D01G010800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G010800 chr5D 100.000 2590 0 0 1 2590 6239182 6241771 0.000000e+00 4783
1 TraesCS5D01G010800 chr5D 98.380 2593 35 6 1 2590 503327611 503325023 0.000000e+00 4549
2 TraesCS5D01G010800 chr3D 98.236 2608 28 6 1 2590 24162284 24159677 0.000000e+00 4545
3 TraesCS5D01G010800 chr1D 98.110 2592 44 4 1 2590 254473518 254470930 0.000000e+00 4510
4 TraesCS5D01G010800 chr1D 94.767 2599 106 15 1 2590 244765203 244762626 0.000000e+00 4019
5 TraesCS5D01G010800 chr1D 94.427 2602 113 17 1 2590 244198008 244195427 0.000000e+00 3973
6 TraesCS5D01G010800 chr3B 97.850 2605 34 10 1 2590 201489835 201487238 0.000000e+00 4481
7 TraesCS5D01G010800 chr3A 97.804 2596 41 7 1 2590 524025292 524022707 0.000000e+00 4464
8 TraesCS5D01G010800 chr3A 95.798 238 4 1 2353 2590 273160888 273161119 1.880000e-101 379
9 TraesCS5D01G010800 chr7B 97.238 2607 46 10 1 2590 662740910 662743507 0.000000e+00 4392
10 TraesCS5D01G010800 chr4A 94.237 2603 107 28 1 2590 205015316 205017888 0.000000e+00 3936


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G010800 chr5D 6239182 6241771 2589 False 4783 4783 100.000 1 2590 1 chr5D.!!$F1 2589
1 TraesCS5D01G010800 chr5D 503325023 503327611 2588 True 4549 4549 98.380 1 2590 1 chr5D.!!$R1 2589
2 TraesCS5D01G010800 chr3D 24159677 24162284 2607 True 4545 4545 98.236 1 2590 1 chr3D.!!$R1 2589
3 TraesCS5D01G010800 chr1D 254470930 254473518 2588 True 4510 4510 98.110 1 2590 1 chr1D.!!$R3 2589
4 TraesCS5D01G010800 chr1D 244762626 244765203 2577 True 4019 4019 94.767 1 2590 1 chr1D.!!$R2 2589
5 TraesCS5D01G010800 chr1D 244195427 244198008 2581 True 3973 3973 94.427 1 2590 1 chr1D.!!$R1 2589
6 TraesCS5D01G010800 chr3B 201487238 201489835 2597 True 4481 4481 97.850 1 2590 1 chr3B.!!$R1 2589
7 TraesCS5D01G010800 chr3A 524022707 524025292 2585 True 4464 4464 97.804 1 2590 1 chr3A.!!$R1 2589
8 TraesCS5D01G010800 chr7B 662740910 662743507 2597 False 4392 4392 97.238 1 2590 1 chr7B.!!$F1 2589
9 TraesCS5D01G010800 chr4A 205015316 205017888 2572 False 3936 3936 94.237 1 2590 1 chr4A.!!$F1 2589

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
633 635 2.159028 CCCACTTAGCTCAGAGGTTAGC 60.159 54.545 14.23 0.0 39.08 3.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2239 2281 5.150683 CGTATCTTTTGCAAACGGAATTCA 58.849 37.5 12.39 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
633 635 2.159028 CCCACTTAGCTCAGAGGTTAGC 60.159 54.545 14.23 0.00 39.08 3.09
1001 1015 3.637229 AGTCTTCATGTCCCGTTATCGAT 59.363 43.478 2.16 2.16 39.71 3.59
1183 1201 6.089150 GGTCTGACAGAACGACAATTACTTAC 59.911 42.308 6.76 0.00 0.00 2.34
1395 1414 6.597562 TGCAAACCCCGAGATATTATTACTT 58.402 36.000 0.00 0.00 0.00 2.24
1506 1525 7.788026 TGACACGTTGGAATATAAAGGACTAT 58.212 34.615 0.00 0.00 0.00 2.12
2254 2296 3.810310 ACCTTTGAATTCCGTTTGCAA 57.190 38.095 2.27 0.00 0.00 4.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
592 594 5.235831 GTGGGCTTACATAACGGAAATAGTC 59.764 44.000 0.00 0.00 0.00 2.59
1183 1201 6.537566 GCTTTTCCAGCGATATGTACATATG 58.462 40.000 28.82 21.06 39.29 1.78
1395 1414 7.447238 ACCTTTTGATCTTTGGTTATCTTTCGA 59.553 33.333 0.00 0.00 0.00 3.71
2132 2168 6.968004 TTTATTTTATAGCGAGCGCAATTG 57.032 33.333 17.68 0.00 44.88 2.32
2239 2281 5.150683 CGTATCTTTTGCAAACGGAATTCA 58.849 37.500 12.39 0.00 0.00 2.57
2254 2296 6.429078 TCGATAGTATGGTGTAGCGTATCTTT 59.571 38.462 0.00 0.00 37.40 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.