Multiple sequence alignment - TraesCS5D01G010700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G010700 chr5D 100.000 2480 0 0 1 2480 6236044 6238523 0.000000e+00 4580.0
1 TraesCS5D01G010700 chr5D 98.036 2495 33 10 1 2480 503330767 503328274 0.000000e+00 4322.0
2 TraesCS5D01G010700 chr1D 96.019 2487 76 13 1 2480 244768337 244765867 0.000000e+00 4023.0
3 TraesCS5D01G010700 chr1D 95.776 2486 93 6 1 2480 244201148 244198669 0.000000e+00 3999.0
4 TraesCS5D01G010700 chr1D 97.972 2219 42 3 1 2218 254476854 254474638 0.000000e+00 3845.0
5 TraesCS5D01G010700 chr1D 97.066 2181 60 4 1 2180 180356538 180358715 0.000000e+00 3670.0
6 TraesCS5D01G010700 chr4A 96.809 2288 64 7 144 2428 309374680 309376961 0.000000e+00 3812.0
7 TraesCS5D01G010700 chr1A 98.311 1835 28 3 1 1834 554448089 554449921 0.000000e+00 3214.0
8 TraesCS5D01G010700 chr1A 98.662 523 6 1 1958 2480 554449919 554450440 0.000000e+00 926.0
9 TraesCS5D01G010700 chr3B 98.203 1836 30 2 1 1834 201492860 201491026 0.000000e+00 3205.0
10 TraesCS5D01G010700 chr2D 98.544 1717 22 2 120 1834 33929969 33931684 0.000000e+00 3029.0
11 TraesCS5D01G010700 chr2D 98.571 210 2 1 1 209 573706728 573706937 1.080000e-98 370.0
12 TraesCS5D01G010700 chr2D 97.917 48 1 0 1 48 648661107 648661154 1.580000e-12 84.2
13 TraesCS5D01G010700 chrUn 98.368 1164 7 3 1322 2480 406223886 406225042 0.000000e+00 2034.0
14 TraesCS5D01G010700 chrUn 98.664 524 5 2 1958 2480 429254252 429254774 0.000000e+00 928.0
15 TraesCS5D01G010700 chr1B 93.955 794 35 9 1686 2479 218012621 218011841 0.000000e+00 1188.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G010700 chr5D 6236044 6238523 2479 False 4580 4580 100.0000 1 2480 1 chr5D.!!$F1 2479
1 TraesCS5D01G010700 chr5D 503328274 503330767 2493 True 4322 4322 98.0360 1 2480 1 chr5D.!!$R1 2479
2 TraesCS5D01G010700 chr1D 244765867 244768337 2470 True 4023 4023 96.0190 1 2480 1 chr1D.!!$R2 2479
3 TraesCS5D01G010700 chr1D 244198669 244201148 2479 True 3999 3999 95.7760 1 2480 1 chr1D.!!$R1 2479
4 TraesCS5D01G010700 chr1D 254474638 254476854 2216 True 3845 3845 97.9720 1 2218 1 chr1D.!!$R3 2217
5 TraesCS5D01G010700 chr1D 180356538 180358715 2177 False 3670 3670 97.0660 1 2180 1 chr1D.!!$F1 2179
6 TraesCS5D01G010700 chr4A 309374680 309376961 2281 False 3812 3812 96.8090 144 2428 1 chr4A.!!$F1 2284
7 TraesCS5D01G010700 chr1A 554448089 554450440 2351 False 2070 3214 98.4865 1 2480 2 chr1A.!!$F1 2479
8 TraesCS5D01G010700 chr3B 201491026 201492860 1834 True 3205 3205 98.2030 1 1834 1 chr3B.!!$R1 1833
9 TraesCS5D01G010700 chr2D 33929969 33931684 1715 False 3029 3029 98.5440 120 1834 1 chr2D.!!$F1 1714
10 TraesCS5D01G010700 chrUn 406223886 406225042 1156 False 2034 2034 98.3680 1322 2480 1 chrUn.!!$F1 1158
11 TraesCS5D01G010700 chrUn 429254252 429254774 522 False 928 928 98.6640 1958 2480 1 chrUn.!!$F2 522
12 TraesCS5D01G010700 chr1B 218011841 218012621 780 True 1188 1188 93.9550 1686 2479 1 chr1B.!!$R1 793

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
71 72 2.094675 CCTTGGGCAATGAGTTTCGAT 58.905 47.619 0.0 0.0 0.0 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1859 1865 7.918076 TCTTTATGATAAAGAAGGTGGTGAGT 58.082 34.615 21.7 0.0 33.72 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 2.094675 CCTTGGGCAATGAGTTTCGAT 58.905 47.619 0.00 0.00 0.00 3.59
106 108 5.676532 TCCGTTTTTATCGAAGCTTTGAA 57.323 34.783 20.22 7.38 0.00 2.69
304 308 8.786826 ACTACACCAAATGATCTTTCGAATTA 57.213 30.769 0.00 0.00 0.00 1.40
364 368 7.271223 CGATACCAGTTGTTGTTTCATTGAATC 59.729 37.037 0.00 0.21 0.00 2.52
407 411 4.606232 CGATTCGACTTTGATCGTTATGGC 60.606 45.833 0.00 0.00 42.80 4.40
454 458 5.048013 GGCAAGCAGACCTAATTTTAACAGT 60.048 40.000 0.00 0.00 0.00 3.55
502 506 6.328641 TCCCTCTTTAGTGAGATTATACGC 57.671 41.667 0.00 0.00 36.23 4.42
568 572 5.789574 ACTATTACAGGGGGAATGTTCAA 57.210 39.130 0.00 0.00 32.02 2.69
571 575 7.518188 ACTATTACAGGGGGAATGTTCAATAG 58.482 38.462 6.90 6.90 36.33 1.73
651 655 2.349755 GCTGCCCACCTAAACCGA 59.650 61.111 0.00 0.00 0.00 4.69
1658 1664 4.344968 GGGTTTCATTTGGATTCCCCTATG 59.655 45.833 0.00 1.81 34.59 2.23
1769 1775 7.624344 GCACATTACTTAGCACAACTAGGAAAG 60.624 40.741 0.00 0.00 32.40 2.62
1823 1829 4.451629 AATATTCGTCGGAATAGCGGAT 57.548 40.909 0.00 0.00 45.62 4.18
2091 2105 3.139077 GGTGACACGAGGATTTTCAGTT 58.861 45.455 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 6.258287 CGATAAAAACGGATACACCCAATACA 59.742 38.462 0.00 0.0 34.64 2.29
106 108 6.430000 ACCAACAACTAAGATAAGCACGAAAT 59.570 34.615 0.00 0.0 0.00 2.17
364 368 4.371786 TCGTGAGCCTATTAATGAAGCAG 58.628 43.478 0.00 0.0 0.00 4.24
420 424 1.002544 GTCTGCTTGCCTAGGACTTGT 59.997 52.381 14.75 0.0 0.00 3.16
454 458 4.392445 CCATTTTCATTGTTACCGTACCGA 59.608 41.667 0.00 0.0 0.00 4.69
502 506 1.863267 TTTTGGTTCAGGCATTTGCG 58.137 45.000 0.00 0.0 43.26 4.85
571 575 4.220163 CCCGAACAGTACTATAGGAATCCC 59.780 50.000 4.43 0.0 0.00 3.85
1859 1865 7.918076 TCTTTATGATAAAGAAGGTGGTGAGT 58.082 34.615 21.70 0.0 33.72 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.