Multiple sequence alignment - TraesCS5D01G010600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G010600 chr5D 100.000 2432 0 0 1 2432 6235512 6237943 0 4492
1 TraesCS5D01G010600 chr5D 98.411 2392 36 2 43 2432 503331258 503328867 0 4205
2 TraesCS5D01G010600 chr1D 98.110 2434 43 3 1 2432 254477387 254474955 0 4237
3 TraesCS5D01G010600 chr1D 97.060 2415 69 2 19 2432 180356024 180358437 0 4065
4 TraesCS5D01G010600 chr1D 96.222 2435 77 9 1 2432 244768867 244766445 0 3973
5 TraesCS5D01G010600 chr1D 96.094 2432 91 3 1 2432 244201679 244199252 0 3962
6 TraesCS5D01G010600 chr1A 98.521 2367 32 3 1 2366 554447557 554449921 0 4174
7 TraesCS5D01G010600 chr3B 98.226 2368 39 2 1 2366 201493392 201491026 0 4137
8 TraesCS5D01G010600 chr2D 98.544 1717 22 2 652 2366 33929969 33931684 0 3029
9 TraesCS5D01G010600 chr4A 96.983 1757 49 3 676 2432 309374680 309376432 0 2948
10 TraesCS5D01G010600 chrUn 98.916 646 7 0 1 646 465171851 465171206 0 1155


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G010600 chr5D 6235512 6237943 2431 False 4492 4492 100.000 1 2432 1 chr5D.!!$F1 2431
1 TraesCS5D01G010600 chr5D 503328867 503331258 2391 True 4205 4205 98.411 43 2432 1 chr5D.!!$R1 2389
2 TraesCS5D01G010600 chr1D 254474955 254477387 2432 True 4237 4237 98.110 1 2432 1 chr1D.!!$R3 2431
3 TraesCS5D01G010600 chr1D 180356024 180358437 2413 False 4065 4065 97.060 19 2432 1 chr1D.!!$F1 2413
4 TraesCS5D01G010600 chr1D 244766445 244768867 2422 True 3973 3973 96.222 1 2432 1 chr1D.!!$R2 2431
5 TraesCS5D01G010600 chr1D 244199252 244201679 2427 True 3962 3962 96.094 1 2432 1 chr1D.!!$R1 2431
6 TraesCS5D01G010600 chr1A 554447557 554449921 2364 False 4174 4174 98.521 1 2366 1 chr1A.!!$F1 2365
7 TraesCS5D01G010600 chr3B 201491026 201493392 2366 True 4137 4137 98.226 1 2366 1 chr3B.!!$R1 2365
8 TraesCS5D01G010600 chr2D 33929969 33931684 1715 False 3029 3029 98.544 652 2366 1 chr2D.!!$F1 1714
9 TraesCS5D01G010600 chr4A 309374680 309376432 1752 False 2948 2948 96.983 676 2432 1 chr4A.!!$F1 1756
10 TraesCS5D01G010600 chrUn 465171206 465171851 645 True 1155 1155 98.916 1 646 1 chrUn.!!$R1 645

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
603 606 2.094675 CCTTGGGCAATGAGTTTCGAT 58.905 47.619 0.0 0.0 0.0 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1716 1725 1.603172 CGCTAGCTAAAGATCCACCGG 60.603 57.143 13.93 0.0 0.0 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
175 176 5.599656 TGGGATTCCATTGGATGAATCTTTC 59.400 40.000 6.15 2.86 38.32 2.62
603 606 2.094675 CCTTGGGCAATGAGTTTCGAT 58.905 47.619 0.00 0.00 0.00 3.59
638 642 5.676532 TCCGTTTTTATCGAAGCTTTGAA 57.323 34.783 20.22 7.38 0.00 2.69
836 843 8.786826 ACTACACCAAATGATCTTTCGAATTA 57.213 30.769 0.00 0.00 0.00 1.40
896 903 7.271223 CGATACCAGTTGTTGTTTCATTGAATC 59.729 37.037 0.00 0.21 0.00 2.52
939 946 4.606232 CGATTCGACTTTGATCGTTATGGC 60.606 45.833 0.00 0.00 42.80 4.40
986 993 5.048013 GGCAAGCAGACCTAATTTTAACAGT 60.048 40.000 0.00 0.00 0.00 3.55
1034 1041 6.328641 TCCCTCTTTAGTGAGATTATACGC 57.671 41.667 0.00 0.00 36.23 4.42
1100 1107 5.789574 ACTATTACAGGGGGAATGTTCAA 57.210 39.130 0.00 0.00 32.02 2.69
1103 1110 7.518188 ACTATTACAGGGGGAATGTTCAATAG 58.482 38.462 6.90 6.90 36.33 1.73
1183 1190 2.349755 GCTGCCCACCTAAACCGA 59.650 61.111 0.00 0.00 0.00 4.69
2190 2201 4.344968 GGGTTTCATTTGGATTCCCCTATG 59.655 45.833 0.00 1.81 34.59 2.23
2301 2312 7.624344 GCACATTACTTAGCACAACTAGGAAAG 60.624 40.741 0.00 0.00 32.40 2.62
2355 2366 4.451629 AATATTCGTCGGAATAGCGGAT 57.548 40.909 0.00 0.00 45.62 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
175 176 1.738350 CCTCTGTGCTGCATCTTCTTG 59.262 52.381 5.27 0.0 0.00 3.02
512 515 9.689075 CAAACATATAATAGCGTATTCGGAATG 57.311 33.333 13.37 0.0 37.56 2.67
603 606 6.258287 CGATAAAAACGGATACACCCAATACA 59.742 38.462 0.00 0.0 34.64 2.29
638 642 6.430000 ACCAACAACTAAGATAAGCACGAAAT 59.570 34.615 0.00 0.0 0.00 2.17
896 903 4.371786 TCGTGAGCCTATTAATGAAGCAG 58.628 43.478 0.00 0.0 0.00 4.24
952 959 1.002544 GTCTGCTTGCCTAGGACTTGT 59.997 52.381 14.75 0.0 0.00 3.16
986 993 4.392445 CCATTTTCATTGTTACCGTACCGA 59.608 41.667 0.00 0.0 0.00 4.69
1034 1041 1.863267 TTTTGGTTCAGGCATTTGCG 58.137 45.000 0.00 0.0 43.26 4.85
1103 1110 4.220163 CCCGAACAGTACTATAGGAATCCC 59.780 50.000 4.43 0.0 0.00 3.85
1716 1725 1.603172 CGCTAGCTAAAGATCCACCGG 60.603 57.143 13.93 0.0 0.00 5.28
2391 2402 7.918076 TCTTTATGATAAAGAAGGTGGTGAGT 58.082 34.615 21.70 0.0 33.72 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.