Multiple sequence alignment - TraesCS5D01G010500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G010500 chr5D 100.000 2363 0 0 1 2363 6234855 6237217 0.000000e+00 4364
1 TraesCS5D01G010500 chr5D 98.319 1666 26 2 700 2363 503331258 503329593 0.000000e+00 2920
2 TraesCS5D01G010500 chr1A 98.377 2156 33 2 209 2363 554447109 554449263 0.000000e+00 3786
3 TraesCS5D01G010500 chr1D 98.224 2083 33 3 283 2363 254477760 254475680 0.000000e+00 3639
4 TraesCS5D01G010500 chr1D 96.107 1952 73 3 412 2363 244201924 244199976 0.000000e+00 3181
5 TraesCS5D01G010500 chr1D 96.006 1953 67 8 412 2363 244769112 244767170 0.000000e+00 3164
6 TraesCS5D01G010500 chr1D 97.040 1689 49 1 676 2363 180356024 180357712 0.000000e+00 2841
7 TraesCS5D01G010500 chr2D 98.162 2067 35 3 1 2065 648662258 648664323 0.000000e+00 3603
8 TraesCS5D01G010500 chr2D 98.788 1238 13 2 1 1237 648659918 648661154 0.000000e+00 2202
9 TraesCS5D01G010500 chr3B 98.015 1864 35 1 502 2363 201493548 201491685 0.000000e+00 3236
10 TraesCS5D01G010500 chr3B 98.335 841 12 2 1 841 201494397 201493559 0.000000e+00 1474
11 TraesCS5D01G010500 chr7A 94.094 2032 103 3 1 2031 352295415 352297430 0.000000e+00 3072
12 TraesCS5D01G010500 chr7A 95.563 293 13 0 1949 2241 647115792 647116084 9.890000e-129 470
13 TraesCS5D01G010500 chr7A 97.761 268 6 0 2069 2336 352297429 352297696 1.650000e-126 462
14 TraesCS5D01G010500 chr4A 97.307 1337 34 2 1 1337 309287794 309289128 0.000000e+00 2268


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G010500 chr5D 6234855 6237217 2362 False 4364.0 4364 100.0000 1 2363 1 chr5D.!!$F1 2362
1 TraesCS5D01G010500 chr5D 503329593 503331258 1665 True 2920.0 2920 98.3190 700 2363 1 chr5D.!!$R1 1663
2 TraesCS5D01G010500 chr1A 554447109 554449263 2154 False 3786.0 3786 98.3770 209 2363 1 chr1A.!!$F1 2154
3 TraesCS5D01G010500 chr1D 254475680 254477760 2080 True 3639.0 3639 98.2240 283 2363 1 chr1D.!!$R3 2080
4 TraesCS5D01G010500 chr1D 244199976 244201924 1948 True 3181.0 3181 96.1070 412 2363 1 chr1D.!!$R1 1951
5 TraesCS5D01G010500 chr1D 244767170 244769112 1942 True 3164.0 3164 96.0060 412 2363 1 chr1D.!!$R2 1951
6 TraesCS5D01G010500 chr1D 180356024 180357712 1688 False 2841.0 2841 97.0400 676 2363 1 chr1D.!!$F1 1687
7 TraesCS5D01G010500 chr2D 648659918 648664323 4405 False 2902.5 3603 98.4750 1 2065 2 chr2D.!!$F1 2064
8 TraesCS5D01G010500 chr3B 201491685 201494397 2712 True 2355.0 3236 98.1750 1 2363 2 chr3B.!!$R1 2362
9 TraesCS5D01G010500 chr7A 352295415 352297696 2281 False 1767.0 3072 95.9275 1 2336 2 chr7A.!!$F2 2335
10 TraesCS5D01G010500 chr4A 309287794 309289128 1334 False 2268.0 2268 97.3070 1 1337 1 chr4A.!!$F1 1336

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
832 3174 5.599656 TGGGATTCCATTGGATGAATCTTTC 59.4 40.0 6.15 2.86 38.32 2.62 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1691 4039 1.863267 TTTTGGTTCAGGCATTTGCG 58.137 45.0 0.0 0.0 43.26 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
52 53 9.716507 CGATAATAATCCGTTTGATCTGTTTTT 57.283 29.630 0.00 0.00 31.61 1.94
228 229 9.700831 AATAGAGATAAAAGCATTACCAAAGGT 57.299 29.630 0.00 0.00 40.16 3.50
832 3174 5.599656 TGGGATTCCATTGGATGAATCTTTC 59.400 40.000 6.15 2.86 38.32 2.62
1260 3605 2.094675 CCTTGGGCAATGAGTTTCGAT 58.905 47.619 0.00 0.00 0.00 3.59
1295 3641 5.676532 TCCGTTTTTATCGAAGCTTTGAA 57.323 34.783 20.22 7.38 0.00 2.69
1493 3841 8.786826 ACTACACCAAATGATCTTTCGAATTA 57.213 30.769 0.00 0.00 0.00 1.40
1553 3901 7.271223 CGATACCAGTTGTTGTTTCATTGAATC 59.729 37.037 0.00 0.21 0.00 2.52
1596 3944 4.606232 CGATTCGACTTTGATCGTTATGGC 60.606 45.833 0.00 0.00 42.80 4.40
1691 4039 6.328641 TCCCTCTTTAGTGAGATTATACGC 57.671 41.667 0.00 0.00 36.23 4.42
1757 4105 5.789574 ACTATTACAGGGGGAATGTTCAA 57.210 39.130 0.00 0.00 32.02 2.69
1760 4108 7.518188 ACTATTACAGGGGGAATGTTCAATAG 58.482 38.462 6.90 6.90 36.33 1.73
1840 4188 2.349755 GCTGCCCACCTAAACCGA 59.650 61.111 0.00 0.00 0.00 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
52 53 1.457346 GAACCGTAGACCTTCTCGGA 58.543 55.000 16.10 0.0 38.53 4.55
385 386 8.568732 TTAAAACAAAGTAGGAATTCGCAAAG 57.431 30.769 0.00 0.0 0.00 2.77
832 3174 1.738350 CCTCTGTGCTGCATCTTCTTG 59.262 52.381 5.27 0.0 0.00 3.02
1169 3513 9.689075 CAAACATATAATAGCGTATTCGGAATG 57.311 33.333 13.37 0.0 37.56 2.67
1260 3605 6.258287 CGATAAAAACGGATACACCCAATACA 59.742 38.462 0.00 0.0 34.64 2.29
1295 3641 6.430000 ACCAACAACTAAGATAAGCACGAAAT 59.570 34.615 0.00 0.0 0.00 2.17
1553 3901 4.371786 TCGTGAGCCTATTAATGAAGCAG 58.628 43.478 0.00 0.0 0.00 4.24
1609 3957 1.002544 GTCTGCTTGCCTAGGACTTGT 59.997 52.381 14.75 0.0 0.00 3.16
1691 4039 1.863267 TTTTGGTTCAGGCATTTGCG 58.137 45.000 0.00 0.0 43.26 4.85
1760 4108 4.220163 CCCGAACAGTACTATAGGAATCCC 59.780 50.000 4.43 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.