Multiple sequence alignment - TraesCS5D01G010400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G010400 chr5D 100.000 2414 0 0 1 2414 6232466 6234879 0.000000e+00 4458
1 TraesCS5D01G010400 chr5D 98.601 2073 28 1 1 2073 483803995 483806066 0.000000e+00 3666
2 TraesCS5D01G010400 chr3B 97.887 2414 49 2 1 2414 201496784 201494373 0.000000e+00 4174
3 TraesCS5D01G010400 chr1D 97.724 2417 39 4 1 2414 254480762 254478359 0.000000e+00 4145
4 TraesCS5D01G010400 chr1D 97.261 2264 59 3 151 2414 180352115 180354375 0.000000e+00 3834
5 TraesCS5D01G010400 chr1D 95.376 2076 77 5 341 2414 244792092 244790034 0.000000e+00 3284
6 TraesCS5D01G010400 chr1D 94.788 2072 89 6 345 2414 244212129 244210075 0.000000e+00 3210
7 TraesCS5D01G010400 chr7A 93.959 2417 135 8 1 2414 352293031 352295439 0.000000e+00 3644
8 TraesCS5D01G010400 chr7A 99.153 118 1 0 1394 1511 167576195 167576312 1.880000e-51 213
9 TraesCS5D01G010400 chr7A 93.506 77 4 1 1528 1603 60206955 60206879 1.960000e-21 113
10 TraesCS5D01G010400 chr6D 96.040 1818 65 5 1 1818 210721574 210723384 0.000000e+00 2952
11 TraesCS5D01G010400 chrUn 98.807 1593 19 0 388 1980 386522344 386523936 0.000000e+00 2837
12 TraesCS5D01G010400 chrUn 98.831 1369 15 1 266 1634 407032912 407031545 0.000000e+00 2438
13 TraesCS5D01G010400 chrUn 97.744 931 9 1 1484 2414 397678312 397677394 0.000000e+00 1592
14 TraesCS5D01G010400 chr2D 98.566 1325 18 1 1 1325 643857124 643855801 0.000000e+00 2340
15 TraesCS5D01G010400 chr1A 98.118 797 13 2 1619 2414 554444322 554445117 0.000000e+00 1387
16 TraesCS5D01G010400 chr7D 95.130 616 28 2 1800 2414 88617453 88618067 0.000000e+00 970
17 TraesCS5D01G010400 chr4A 97.638 508 10 2 1908 2414 665560767 665560261 0.000000e+00 870


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G010400 chr5D 6232466 6234879 2413 False 4458 4458 100.000 1 2414 1 chr5D.!!$F1 2413
1 TraesCS5D01G010400 chr5D 483803995 483806066 2071 False 3666 3666 98.601 1 2073 1 chr5D.!!$F2 2072
2 TraesCS5D01G010400 chr3B 201494373 201496784 2411 True 4174 4174 97.887 1 2414 1 chr3B.!!$R1 2413
3 TraesCS5D01G010400 chr1D 254478359 254480762 2403 True 4145 4145 97.724 1 2414 1 chr1D.!!$R3 2413
4 TraesCS5D01G010400 chr1D 180352115 180354375 2260 False 3834 3834 97.261 151 2414 1 chr1D.!!$F1 2263
5 TraesCS5D01G010400 chr1D 244790034 244792092 2058 True 3284 3284 95.376 341 2414 1 chr1D.!!$R2 2073
6 TraesCS5D01G010400 chr1D 244210075 244212129 2054 True 3210 3210 94.788 345 2414 1 chr1D.!!$R1 2069
7 TraesCS5D01G010400 chr7A 352293031 352295439 2408 False 3644 3644 93.959 1 2414 1 chr7A.!!$F2 2413
8 TraesCS5D01G010400 chr6D 210721574 210723384 1810 False 2952 2952 96.040 1 1818 1 chr6D.!!$F1 1817
9 TraesCS5D01G010400 chrUn 386522344 386523936 1592 False 2837 2837 98.807 388 1980 1 chrUn.!!$F1 1592
10 TraesCS5D01G010400 chrUn 407031545 407032912 1367 True 2438 2438 98.831 266 1634 1 chrUn.!!$R2 1368
11 TraesCS5D01G010400 chrUn 397677394 397678312 918 True 1592 1592 97.744 1484 2414 1 chrUn.!!$R1 930
12 TraesCS5D01G010400 chr2D 643855801 643857124 1323 True 2340 2340 98.566 1 1325 1 chr2D.!!$R1 1324
13 TraesCS5D01G010400 chr1A 554444322 554445117 795 False 1387 1387 98.118 1619 2414 1 chr1A.!!$F1 795
14 TraesCS5D01G010400 chr7D 88617453 88618067 614 False 970 970 95.130 1800 2414 1 chr7D.!!$F1 614
15 TraesCS5D01G010400 chr4A 665560261 665560767 506 True 870 870 97.638 1908 2414 1 chr4A.!!$R1 506

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
585 590 2.877154 AGAGGATTAGCTTCCAGGGA 57.123 50.0 7.2 0.0 38.32 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2196 2230 0.251653 TGACTTAGGTCTGCCTCCGT 60.252 55.0 6.54 0.0 45.64 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
179 184 8.817092 AAGGAATCCGGAGTAATTAATGAAAA 57.183 30.769 11.34 0.0 0.00 2.29
560 565 5.113383 CACATTTGGATGCTACTACCGTAA 58.887 41.667 0.00 0.0 36.72 3.18
565 570 5.864418 TGGATGCTACTACCGTAATTTCT 57.136 39.130 0.00 0.0 0.00 2.52
582 587 7.596995 CGTAATTTCTAGAGGATTAGCTTCCAG 59.403 40.741 7.20 0.0 38.32 3.86
585 590 2.877154 AGAGGATTAGCTTCCAGGGA 57.123 50.000 7.20 0.0 38.32 4.20
1344 1351 4.324267 AGGGTACGAAAGATTTGGTTGAG 58.676 43.478 0.00 0.0 31.50 3.02
1389 1397 0.173708 GGAGACGAATCGAGGCTGTT 59.826 55.000 10.55 0.0 0.00 3.16
1747 1756 8.689721 AGATACAGATCGAAGGGGTATCCTCTA 61.690 44.444 18.33 0.0 40.16 2.43
1883 1893 5.835257 TCAAAGGAGCTTATTATGCAATGC 58.165 37.500 0.00 0.0 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
179 184 9.259832 AGCTACCTTTGATTCCTCAATATTTTT 57.740 29.630 0.00 0.00 40.95 1.94
327 332 6.038825 TCCTGCTTGAACAAAACGAAAGATAA 59.961 34.615 0.00 0.00 0.00 1.75
501 506 2.750888 GCAGGGTCGGTCAAATCGC 61.751 63.158 0.00 0.00 0.00 4.58
560 565 5.309282 CCCTGGAAGCTAATCCTCTAGAAAT 59.691 44.000 6.03 0.00 40.35 2.17
565 570 3.993658 TCCCTGGAAGCTAATCCTCTA 57.006 47.619 6.03 0.00 40.35 2.43
1373 1381 3.001330 CCAATTAACAGCCTCGATTCGTC 59.999 47.826 5.89 0.00 0.00 4.20
1558 1567 2.864343 GAGTATTGCTTTCATACGGCGT 59.136 45.455 19.64 19.64 0.00 5.68
1883 1893 9.667989 TGATTTTGCAATAAGATCGATTATGTG 57.332 29.630 0.00 0.00 0.00 3.21
1981 2015 1.289160 TAGGCACCTGAATTGGCTCT 58.711 50.000 1.19 0.00 46.34 4.09
2196 2230 0.251653 TGACTTAGGTCTGCCTCCGT 60.252 55.000 6.54 0.00 45.64 4.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.