Multiple sequence alignment - TraesCS5D01G010100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G010100 chr5D 100.000 2111 0 0 1 2111 6218092 6215982 0.000000e+00 3899.0
1 TraesCS5D01G010100 chr5D 98.540 1233 7 2 880 2111 6213191 6214413 0.000000e+00 2167.0
2 TraesCS5D01G010100 chr5D 97.626 716 5 4 3 706 483801665 483800950 0.000000e+00 1218.0
3 TraesCS5D01G010100 chr2D 98.581 2114 25 5 1 2111 643859450 643861561 0.000000e+00 3733.0
4 TraesCS5D01G010100 chr2D 96.970 792 12 5 19 798 628289857 628289066 0.000000e+00 1319.0
5 TraesCS5D01G010100 chr2D 97.670 515 3 1 1597 2111 628280690 628281195 0.000000e+00 876.0
6 TraesCS5D01G010100 chr2D 98.742 159 2 0 1918 2076 141097617 141097775 1.230000e-72 283.0
7 TraesCS5D01G010100 chr2D 100.000 87 0 0 1820 1906 84930167 84930081 6.030000e-36 161.0
8 TraesCS5D01G010100 chr2D 98.889 90 0 1 2022 2111 193393411 193393323 2.170000e-35 159.0
9 TraesCS5D01G010100 chr2D 98.039 51 0 1 1967 2016 513301146 513301096 1.040000e-13 87.9
10 TraesCS5D01G010100 chr1D 97.777 2114 32 8 1 2111 254483086 254485187 0.000000e+00 3629.0
11 TraesCS5D01G010100 chr1D 96.276 1101 35 5 676 1772 244396528 244397626 0.000000e+00 1801.0
12 TraesCS5D01G010100 chr1D 96.007 1102 35 6 676 1772 244402968 244404065 0.000000e+00 1783.0
13 TraesCS5D01G010100 chr1D 95.876 679 22 5 1 675 244393500 244394176 0.000000e+00 1094.0
14 TraesCS5D01G010100 chr6D 98.196 1940 21 7 183 2111 431397625 431395689 0.000000e+00 3376.0
15 TraesCS5D01G010100 chr1A 99.290 1267 8 1 846 2111 554470851 554469585 0.000000e+00 2289.0
16 TraesCS5D01G010100 chr1A 97.507 682 8 5 1 675 554472489 554471810 0.000000e+00 1157.0
17 TraesCS5D01G010100 chr3B 98.971 1263 12 1 850 2111 201500761 201502023 0.000000e+00 2259.0
18 TraesCS5D01G010100 chr3B 97.361 682 10 4 1 675 201499647 201500327 0.000000e+00 1153.0
19 TraesCS5D01G010100 chrUn 98.872 1064 11 1 856 1918 444441717 444442780 0.000000e+00 1897.0
20 TraesCS5D01G010100 chrUn 97.848 1069 13 3 237 1295 443804780 443803712 0.000000e+00 1838.0
21 TraesCS5D01G010100 chrUn 97.319 373 1 2 526 890 445362034 445362405 1.780000e-175 625.0
22 TraesCS5D01G010100 chr7A 94.570 663 31 2 1453 2111 710799160 710799821 0.000000e+00 1020.0
23 TraesCS5D01G010100 chr7A 93.662 284 17 1 1824 2107 664243664 664243382 6.960000e-115 424.0
24 TraesCS5D01G010100 chr2A 97.924 289 4 2 676 963 588082579 588082866 1.120000e-137 499.0
25 TraesCS5D01G010100 chr2B 95.484 155 7 0 1954 2108 2896609 2896763 4.500000e-62 248.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G010100 chr5D 6215982 6218092 2110 True 3899.0 3899 100.0000 1 2111 1 chr5D.!!$R1 2110
1 TraesCS5D01G010100 chr5D 6213191 6214413 1222 False 2167.0 2167 98.5400 880 2111 1 chr5D.!!$F1 1231
2 TraesCS5D01G010100 chr5D 483800950 483801665 715 True 1218.0 1218 97.6260 3 706 1 chr5D.!!$R2 703
3 TraesCS5D01G010100 chr2D 643859450 643861561 2111 False 3733.0 3733 98.5810 1 2111 1 chr2D.!!$F3 2110
4 TraesCS5D01G010100 chr2D 628289066 628289857 791 True 1319.0 1319 96.9700 19 798 1 chr2D.!!$R4 779
5 TraesCS5D01G010100 chr2D 628280690 628281195 505 False 876.0 876 97.6700 1597 2111 1 chr2D.!!$F2 514
6 TraesCS5D01G010100 chr1D 254483086 254485187 2101 False 3629.0 3629 97.7770 1 2111 1 chr1D.!!$F2 2110
7 TraesCS5D01G010100 chr1D 244402968 244404065 1097 False 1783.0 1783 96.0070 676 1772 1 chr1D.!!$F1 1096
8 TraesCS5D01G010100 chr1D 244393500 244397626 4126 False 1447.5 1801 96.0760 1 1772 2 chr1D.!!$F3 1771
9 TraesCS5D01G010100 chr6D 431395689 431397625 1936 True 3376.0 3376 98.1960 183 2111 1 chr6D.!!$R1 1928
10 TraesCS5D01G010100 chr1A 554469585 554472489 2904 True 1723.0 2289 98.3985 1 2111 2 chr1A.!!$R1 2110
11 TraesCS5D01G010100 chr3B 201499647 201502023 2376 False 1706.0 2259 98.1660 1 2111 2 chr3B.!!$F1 2110
12 TraesCS5D01G010100 chrUn 444441717 444442780 1063 False 1897.0 1897 98.8720 856 1918 1 chrUn.!!$F1 1062
13 TraesCS5D01G010100 chrUn 443803712 443804780 1068 True 1838.0 1838 97.8480 237 1295 1 chrUn.!!$R1 1058
14 TraesCS5D01G010100 chr7A 710799160 710799821 661 False 1020.0 1020 94.5700 1453 2111 1 chr7A.!!$F1 658

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
257 259 0.669318 CAAGCTCGTAACGAAGGGCA 60.669 55.0 0.0 0.0 34.74 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1801 4743 8.106462 TCTAATTGATTGGATATCCCGCATAAA 58.894 33.333 19.34 8.33 37.93 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 148 3.054948 ACCGAAATCTTTGGGGACGATTA 60.055 43.478 8.34 0.0 39.97 1.75
257 259 0.669318 CAAGCTCGTAACGAAGGGCA 60.669 55.000 0.00 0.0 34.74 5.36
798 3323 9.841295 CATGAGGATGGGAAAATCAAAATAAAT 57.159 29.630 0.00 0.0 0.00 1.40
1202 4135 2.814919 TGAAAAACGGTTATGGATGCGT 59.185 40.909 0.00 0.0 0.00 5.24
1206 4139 5.662211 AAAACGGTTATGGATGCGTATAC 57.338 39.130 0.00 0.0 0.00 1.47
1801 4743 0.809385 TCGCGTCTTCCTTCGATTCT 59.191 50.000 5.77 0.0 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 148 7.182060 AGTTCCTCCACCAAATTGTAATACAT 58.818 34.615 0.00 0.00 0.00 2.29
209 210 3.335579 GTTCCAAAGCCACTCGATTAGT 58.664 45.455 0.00 0.00 39.81 2.24
226 227 1.270147 ACGAGCTTGTACACAGGTTCC 60.270 52.381 4.25 0.00 31.29 3.62
257 259 0.176680 ACCTTCGCGAGCAAGATCAT 59.823 50.000 9.59 0.00 0.00 2.45
1801 4743 8.106462 TCTAATTGATTGGATATCCCGCATAAA 58.894 33.333 19.34 8.33 37.93 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.