Multiple sequence alignment - TraesCS5D01G009900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009900 chr5D 100.000 2144 0 0 1 2144 6208028 6210171 0.000000e+00 3960
1 TraesCS5D01G009900 chr5D 97.465 1144 21 3 274 1410 329132332 329133474 0.000000e+00 1945
2 TraesCS5D01G009900 chr5D 98.590 709 5 2 1438 2144 483797375 483798080 0.000000e+00 1249
3 TraesCS5D01G009900 chr5D 98.913 276 3 0 1 276 329131918 329132193 5.320000e-136 494
4 TraesCS5D01G009900 chr1A 96.111 1903 42 8 274 2144 554465650 554467552 0.000000e+00 3075
5 TraesCS5D01G009900 chr1A 98.417 1137 16 2 274 1410 256026781 256027915 0.000000e+00 1999
6 TraesCS5D01G009900 chr1A 98.921 278 3 0 1 278 256026381 256026658 4.110000e-137 497
7 TraesCS5D01G009900 chr3B 95.629 1899 48 18 279 2144 201505946 201504050 0.000000e+00 3014
8 TraesCS5D01G009900 chr3B 88.998 1218 68 29 974 2144 460159717 460160915 0.000000e+00 1447
9 TraesCS5D01G009900 chr2D 99.118 1134 10 0 277 1410 628285053 628283920 0.000000e+00 2039
10 TraesCS5D01G009900 chr2D 98.148 1134 20 1 277 1410 334225295 334224163 0.000000e+00 1977
11 TraesCS5D01G009900 chr2D 98.872 709 6 1 1438 2144 628283860 628283152 0.000000e+00 1264
12 TraesCS5D01G009900 chr2D 99.640 278 1 0 1 278 628285455 628285178 1.900000e-140 508
13 TraesCS5D01G009900 chr6D 98.677 1134 15 0 277 1410 431399406 431398273 0.000000e+00 2012
14 TraesCS5D01G009900 chr6D 99.640 278 1 0 1 278 431399816 431399539 1.900000e-140 508
15 TraesCS5D01G009900 chr3D 98.677 1134 15 0 277 1410 21896937 21895804 0.000000e+00 2012
16 TraesCS5D01G009900 chr3D 98.025 709 12 1 1438 2144 21895747 21895039 0.000000e+00 1230
17 TraesCS5D01G009900 chr1D 98.589 1134 16 0 277 1410 254489077 254487944 0.000000e+00 2006
18 TraesCS5D01G009900 chr1D 97.602 709 15 1 1438 2144 254487886 254487178 0.000000e+00 1214
19 TraesCS5D01G009900 chr1D 99.281 278 2 0 1 278 254489487 254489210 8.830000e-139 503
20 TraesCS5D01G009900 chr1D 99.283 279 1 1 1 278 394178696 394178418 8.830000e-139 503
21 TraesCS5D01G009900 chr5A 98.875 711 6 1 1436 2144 684323794 684323084 0.000000e+00 1267
22 TraesCS5D01G009900 chr5A 98.561 278 4 0 1 278 684325374 684325097 1.910000e-135 492
23 TraesCS5D01G009900 chr2A 97.737 707 13 2 1438 2142 276442896 276443601 0.000000e+00 1214
24 TraesCS5D01G009900 chrUn 99.640 278 1 0 1 278 317473404 317473681 1.900000e-140 508
25 TraesCS5D01G009900 chrUn 99.281 278 2 0 1 278 404958020 404957743 8.830000e-139 503


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009900 chr5D 6208028 6210171 2143 False 3960.000000 3960 100.000000 1 2144 1 chr5D.!!$F1 2143
1 TraesCS5D01G009900 chr5D 483797375 483798080 705 False 1249.000000 1249 98.590000 1438 2144 1 chr5D.!!$F2 706
2 TraesCS5D01G009900 chr5D 329131918 329133474 1556 False 1219.500000 1945 98.189000 1 1410 2 chr5D.!!$F3 1409
3 TraesCS5D01G009900 chr1A 554465650 554467552 1902 False 3075.000000 3075 96.111000 274 2144 1 chr1A.!!$F1 1870
4 TraesCS5D01G009900 chr1A 256026381 256027915 1534 False 1248.000000 1999 98.669000 1 1410 2 chr1A.!!$F2 1409
5 TraesCS5D01G009900 chr3B 201504050 201505946 1896 True 3014.000000 3014 95.629000 279 2144 1 chr3B.!!$R1 1865
6 TraesCS5D01G009900 chr3B 460159717 460160915 1198 False 1447.000000 1447 88.998000 974 2144 1 chr3B.!!$F1 1170
7 TraesCS5D01G009900 chr2D 334224163 334225295 1132 True 1977.000000 1977 98.148000 277 1410 1 chr2D.!!$R1 1133
8 TraesCS5D01G009900 chr2D 628283152 628285455 2303 True 1270.333333 2039 99.210000 1 2144 3 chr2D.!!$R2 2143
9 TraesCS5D01G009900 chr6D 431398273 431399816 1543 True 1260.000000 2012 99.158500 1 1410 2 chr6D.!!$R1 1409
10 TraesCS5D01G009900 chr3D 21895039 21896937 1898 True 1621.000000 2012 98.351000 277 2144 2 chr3D.!!$R1 1867
11 TraesCS5D01G009900 chr1D 254487178 254489487 2309 True 1241.000000 2006 98.490667 1 2144 3 chr1D.!!$R2 2143
12 TraesCS5D01G009900 chr5A 684323084 684325374 2290 True 879.500000 1267 98.718000 1 2144 2 chr5A.!!$R1 2143
13 TraesCS5D01G009900 chr2A 276442896 276443601 705 False 1214.000000 1214 97.737000 1438 2142 1 chr2A.!!$F1 704

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
709 867 2.355132 CACGGACTAGCTGTACCTACTG 59.645 54.545 0.0 0.0 33.84 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1935 2154 6.419413 TGAAAAGGTTCAATTGTACGAAATGC 59.581 34.615 5.13 0.0 40.87 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
619 777 9.307121 AGAACAACTCGATGAATTTAGTAGATG 57.693 33.333 0.00 0.00 0.00 2.90
709 867 2.355132 CACGGACTAGCTGTACCTACTG 59.645 54.545 0.00 0.00 33.84 2.74
1092 1254 4.487948 CTGGTATTGCTGTGATTGGTTTG 58.512 43.478 0.00 0.00 0.00 2.93
1293 1466 6.108687 TCGATTCACTCTTATGAAGCAACAT 58.891 36.000 4.82 0.00 43.62 2.71
1370 1548 7.750903 CCTGAAAATCCTTGATTTAGTTTCGAC 59.249 37.037 2.73 0.00 40.77 4.20
1423 1601 9.668497 AACTATTCAACTATTCAACTAGTTCCC 57.332 33.333 4.77 0.00 39.37 3.97
1424 1602 7.980099 ACTATTCAACTATTCAACTAGTTCCCG 59.020 37.037 4.77 0.00 39.37 5.14
1425 1603 5.080969 TCAACTATTCAACTAGTTCCCGG 57.919 43.478 4.77 0.00 39.37 5.73
1426 1604 4.529377 TCAACTATTCAACTAGTTCCCGGT 59.471 41.667 4.77 0.00 39.37 5.28
1429 1607 6.218108 ACTATTCAACTAGTTCCCGGTAAG 57.782 41.667 4.77 0.33 0.00 2.34
1430 1608 5.954150 ACTATTCAACTAGTTCCCGGTAAGA 59.046 40.000 4.77 0.00 0.00 2.10
1431 1609 5.750352 ATTCAACTAGTTCCCGGTAAGAA 57.250 39.130 4.77 4.28 0.00 2.52
1432 1610 5.549742 TTCAACTAGTTCCCGGTAAGAAA 57.450 39.130 4.77 0.00 0.00 2.52
1433 1611 5.750352 TCAACTAGTTCCCGGTAAGAAAT 57.250 39.130 4.77 0.00 0.00 2.17
1935 2154 3.136626 AGAAATCCCGGGACCTAGAAATG 59.863 47.826 29.69 0.00 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
10 11 7.229907 TGTTTGTTGGATTAGGTCTAACTTTCC 59.770 37.037 5.99 0.00 45.53 3.13
619 777 2.027385 CATTGAGGGCCTCCTAAAAGC 58.973 52.381 30.03 4.24 45.05 3.51
1092 1254 7.279750 TGAACCATAAAAGAAAACACCTACC 57.720 36.000 0.00 0.00 0.00 3.18
1123 1285 8.744652 CGATTACTATAGAGATGAACCCAATCT 58.255 37.037 6.78 0.00 0.00 2.40
1293 1466 5.394663 GGATCCTCGAGTGATCTCTTTTTCA 60.395 44.000 28.00 0.70 38.89 2.69
1410 1588 5.549742 TTTCTTACCGGGAACTAGTTGAA 57.450 39.130 14.14 4.80 0.00 2.69
1411 1589 5.750352 ATTTCTTACCGGGAACTAGTTGA 57.250 39.130 14.14 0.00 0.00 3.18
1413 1591 8.544687 ACTATATTTCTTACCGGGAACTAGTT 57.455 34.615 8.13 8.13 0.00 2.24
1935 2154 6.419413 TGAAAAGGTTCAATTGTACGAAATGC 59.581 34.615 5.13 0.00 40.87 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.