Multiple sequence alignment - TraesCS5D01G009800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009800 chr5D 100.000 2117 0 0 1 2117 6207807 6209923 0 3910
1 TraesCS5D01G009800 chr5D 97.465 1144 21 3 495 1631 329132332 329133474 0 1945
2 TraesCS5D01G009800 chr5D 98.915 461 3 1 1659 2117 483797375 483797835 0 822
3 TraesCS5D01G009800 chr1A 95.952 1655 35 8 495 2117 554465650 554467304 0 2656
4 TraesCS5D01G009800 chr1A 98.417 1137 16 2 495 1631 256026781 256027915 0 1999
5 TraesCS5D01G009800 chr1A 97.426 505 7 1 1 499 256026154 256026658 0 856
6 TraesCS5D01G009800 chr3B 95.397 1651 42 17 500 2117 201505946 201504297 0 2597
7 TraesCS5D01G009800 chr3B 97.024 504 10 1 1 499 201506591 201506088 0 843
8 TraesCS5D01G009800 chr2D 99.118 1134 10 0 498 1631 628285053 628283920 0 2039
9 TraesCS5D01G009800 chr2D 98.148 1134 20 1 498 1631 334225295 334224163 0 1977
10 TraesCS5D01G009800 chr2D 98.211 503 5 1 1 499 628285680 628285178 0 876
11 TraesCS5D01G009800 chr2D 97.012 502 11 3 1 499 334225935 334225435 0 841
12 TraesCS5D01G009800 chr2D 98.915 461 3 1 1659 2117 628283860 628283400 0 822
13 TraesCS5D01G009800 chr2D 98.915 461 3 1 1659 2117 628287114 628286654 0 822
14 TraesCS5D01G009800 chr6D 98.677 1134 15 0 498 1631 431399406 431398273 0 2012
15 TraesCS5D01G009800 chr6D 98.008 502 6 2 1 499 431400039 431399539 0 869
16 TraesCS5D01G009800 chr6D 98.265 461 2 2 1659 2117 431398213 431397757 0 802
17 TraesCS5D01G009800 chr3D 98.677 1134 15 0 498 1631 21896937 21895804 0 2012
18 TraesCS5D01G009800 chr3D 97.800 500 9 2 1 499 21897567 21897069 0 861
19 TraesCS5D01G009800 chr3D 97.831 461 8 1 1659 2117 21895747 21895287 0 795
20 TraesCS5D01G009800 chr1D 98.589 1134 16 0 498 1631 254489077 254487944 0 2006
21 TraesCS5D01G009800 chr1D 97.426 505 7 1 1 499 254489714 254489210 0 856
22 TraesCS5D01G009800 chrUn 97.431 506 6 1 1 499 317473176 317473681 0 856
23 TraesCS5D01G009800 chrUn 98.698 461 4 1 1659 2117 453774652 453774192 0 817
24 TraesCS5D01G009800 chrUn 97.210 466 6 2 1659 2117 463114100 463114565 0 782
25 TraesCS5D01G009800 chr2A 96.825 504 11 1 1 499 276441061 276441564 0 837
26 TraesCS5D01G009800 chr5A 98.704 463 4 1 1657 2117 684323794 684323332 0 821


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009800 chr5D 6207807 6209923 2116 False 3910.000000 3910 100.000000 1 2117 1 chr5D.!!$F1 2116
1 TraesCS5D01G009800 chr5D 329132332 329133474 1142 False 1945.000000 1945 97.465000 495 1631 1 chr5D.!!$F2 1136
2 TraesCS5D01G009800 chr1A 554465650 554467304 1654 False 2656.000000 2656 95.952000 495 2117 1 chr1A.!!$F1 1622
3 TraesCS5D01G009800 chr1A 256026154 256027915 1761 False 1427.500000 1999 97.921500 1 1631 2 chr1A.!!$F2 1630
4 TraesCS5D01G009800 chr3B 201504297 201506591 2294 True 1720.000000 2597 96.210500 1 2117 2 chr3B.!!$R1 2116
5 TraesCS5D01G009800 chr2D 334224163 334225935 1772 True 1409.000000 1977 97.580000 1 1631 2 chr2D.!!$R1 1630
6 TraesCS5D01G009800 chr2D 628283400 628287114 3714 True 1139.750000 2039 98.789750 1 2117 4 chr2D.!!$R2 2116
7 TraesCS5D01G009800 chr6D 431397757 431400039 2282 True 1227.666667 2012 98.316667 1 2117 3 chr6D.!!$R1 2116
8 TraesCS5D01G009800 chr3D 21895287 21897567 2280 True 1222.666667 2012 98.102667 1 2117 3 chr3D.!!$R1 2116
9 TraesCS5D01G009800 chr1D 254487944 254489714 1770 True 1431.000000 2006 98.007500 1 1631 2 chr1D.!!$R1 1630
10 TraesCS5D01G009800 chrUn 317473176 317473681 505 False 856.000000 856 97.431000 1 499 1 chrUn.!!$F1 498
11 TraesCS5D01G009800 chr2A 276441061 276441564 503 False 837.000000 837 96.825000 1 499 1 chr2A.!!$F1 498

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
931 2531 1.948145 CGGACTAGCTGTACCTACTGG 59.052 57.143 0.0 0.0 39.83 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1998 3646 9.759473 CTGGAATTCCTTATTTATATCCCATGT 57.241 33.333 24.73 0.0 36.82 3.21 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
212 1663 7.419711 TCCCTATTTCATCTCGTAAAGTTCT 57.580 36.000 0.00 0.00 0.00 3.01
231 1682 2.856032 CGCTCGCAGTTTGGTCAG 59.144 61.111 0.00 0.00 0.00 3.51
840 2439 9.307121 AGAACAACTCGATGAATTTAGTAGATG 57.693 33.333 0.00 0.00 0.00 2.90
931 2531 1.948145 CGGACTAGCTGTACCTACTGG 59.052 57.143 0.00 0.00 39.83 4.00
1313 2915 4.487948 CTGGTATTGCTGTGATTGGTTTG 58.512 43.478 0.00 0.00 0.00 2.93
1514 3123 6.108687 TCGATTCACTCTTATGAAGCAACAT 58.891 36.000 4.82 0.00 43.62 2.71
1591 3200 7.750903 CCTGAAAATCCTTGATTTAGTTTCGAC 59.249 37.037 2.73 0.00 40.77 4.20
1644 3253 9.668497 AACTATTCAACTATTCAACTAGTTCCC 57.332 33.333 4.77 0.00 39.37 3.97
1645 3254 7.980099 ACTATTCAACTATTCAACTAGTTCCCG 59.020 37.037 4.77 0.00 39.37 5.14
1646 3255 5.080969 TCAACTATTCAACTAGTTCCCGG 57.919 43.478 4.77 0.00 39.37 5.73
1647 3256 4.529377 TCAACTATTCAACTAGTTCCCGGT 59.471 41.667 4.77 0.00 39.37 5.28
1649 3258 6.211184 TCAACTATTCAACTAGTTCCCGGTAA 59.789 38.462 4.77 0.00 39.37 2.85
1650 3259 6.218108 ACTATTCAACTAGTTCCCGGTAAG 57.782 41.667 4.77 0.33 0.00 2.34
1651 3260 5.954150 ACTATTCAACTAGTTCCCGGTAAGA 59.046 40.000 4.77 0.00 0.00 2.10
1652 3261 5.750352 ATTCAACTAGTTCCCGGTAAGAA 57.250 39.130 4.77 4.28 0.00 2.52
1653 3262 5.549742 TTCAACTAGTTCCCGGTAAGAAA 57.450 39.130 4.77 0.00 0.00 2.52
1654 3263 5.750352 TCAACTAGTTCCCGGTAAGAAAT 57.250 39.130 4.77 0.00 0.00 2.17
1657 3266 8.537728 TCAACTAGTTCCCGGTAAGAAATATA 57.462 34.615 4.77 0.00 0.00 0.86
1998 3646 6.209391 CCTTTGCCTTGGATTCTCTTCTTTTA 59.791 38.462 0.00 0.00 0.00 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
105 1556 5.359860 ACTTTGGTTGGAGTTCGAAAAAGAT 59.640 36.000 17.18 4.02 0.00 2.40
106 1557 4.703093 ACTTTGGTTGGAGTTCGAAAAAGA 59.297 37.500 17.18 0.00 0.00 2.52
184 1635 7.048512 ACTTTACGAGATGAAATAGGGAAAGG 58.951 38.462 0.00 0.00 0.00 3.11
231 1682 7.229907 TGTTTGTTGGATTAGGTCTAACTTTCC 59.770 37.037 5.99 0.00 45.53 3.13
840 2439 2.027385 CATTGAGGGCCTCCTAAAAGC 58.973 52.381 30.03 4.24 45.05 3.51
1313 2915 7.279750 TGAACCATAAAAGAAAACACCTACC 57.720 36.000 0.00 0.00 0.00 3.18
1344 2946 8.744652 CGATTACTATAGAGATGAACCCAATCT 58.255 37.037 6.78 0.00 0.00 2.40
1514 3123 5.394663 GGATCCTCGAGTGATCTCTTTTTCA 60.395 44.000 28.00 0.70 38.89 2.69
1631 3240 5.549742 TTTCTTACCGGGAACTAGTTGAA 57.450 39.130 14.14 4.80 0.00 2.69
1632 3241 5.750352 ATTTCTTACCGGGAACTAGTTGA 57.250 39.130 14.14 0.00 0.00 3.18
1634 3243 8.544687 ACTATATTTCTTACCGGGAACTAGTT 57.455 34.615 8.13 8.13 0.00 2.24
1998 3646 9.759473 CTGGAATTCCTTATTTATATCCCATGT 57.241 33.333 24.73 0.00 36.82 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.