Multiple sequence alignment - TraesCS5D01G009700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009700 chr5D 100.000 2114 0 0 1 2114 6208118 6206005 0.000000e+00 3904
1 TraesCS5D01G009700 chr6D 98.349 2120 28 5 1 2114 431399726 431401844 0.000000e+00 3714
2 TraesCS5D01G009700 chrUn 98.166 2127 26 4 1 2114 317473494 317471368 0.000000e+00 3699
3 TraesCS5D01G009700 chr1D 98.122 2130 24 5 1 2114 394178606 394180735 0.000000e+00 3698
4 TraesCS5D01G009700 chr1D 96.326 2123 31 7 1 2114 254489397 254491481 0.000000e+00 3445
5 TraesCS5D01G009700 chr1D 94.390 2050 92 11 77 2114 244443826 244445864 0.000000e+00 3127
6 TraesCS5D01G009700 chr1D 98.693 1454 16 3 663 2114 483922592 483921140 0.000000e+00 2577
7 TraesCS5D01G009700 chr3B 97.125 2122 52 5 1 2114 201506275 201508395 0.000000e+00 3572
8 TraesCS5D01G009700 chr2D 96.980 2119 52 8 1 2114 334225621 334227732 0.000000e+00 3548
9 TraesCS5D01G009700 chr2D 97.974 1234 11 5 1 1220 628285365 628286598 0.000000e+00 2128
10 TraesCS5D01G009700 chr3D 96.847 2125 32 9 1 2114 21897256 21899356 0.000000e+00 3520
11 TraesCS5D01G009700 chr2A 96.519 2126 41 9 1 2113 335825975 335828080 0.000000e+00 3485
12 TraesCS5D01G009700 chr2A 95.385 715 27 2 1 709 276441377 276440663 0.000000e+00 1133
13 TraesCS5D01G009700 chr1A 96.424 783 20 3 1 775 256026471 256025689 0.000000e+00 1284
14 TraesCS5D01G009700 chr5A 95.760 684 22 2 1 677 684325284 684325967 0.000000e+00 1096
15 TraesCS5D01G009700 chr7B 97.340 188 4 1 374 561 8018236 8018422 3.380000e-83 318
16 TraesCS5D01G009700 chr7B 96.825 189 4 2 374 561 8175135 8175322 4.380000e-82 315


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009700 chr5D 6206005 6208118 2113 True 3904 3904 100.000 1 2114 1 chr5D.!!$R1 2113
1 TraesCS5D01G009700 chr6D 431399726 431401844 2118 False 3714 3714 98.349 1 2114 1 chr6D.!!$F1 2113
2 TraesCS5D01G009700 chrUn 317471368 317473494 2126 True 3699 3699 98.166 1 2114 1 chrUn.!!$R1 2113
3 TraesCS5D01G009700 chr1D 394178606 394180735 2129 False 3698 3698 98.122 1 2114 1 chr1D.!!$F3 2113
4 TraesCS5D01G009700 chr1D 254489397 254491481 2084 False 3445 3445 96.326 1 2114 1 chr1D.!!$F2 2113
5 TraesCS5D01G009700 chr1D 244443826 244445864 2038 False 3127 3127 94.390 77 2114 1 chr1D.!!$F1 2037
6 TraesCS5D01G009700 chr1D 483921140 483922592 1452 True 2577 2577 98.693 663 2114 1 chr1D.!!$R1 1451
7 TraesCS5D01G009700 chr3B 201506275 201508395 2120 False 3572 3572 97.125 1 2114 1 chr3B.!!$F1 2113
8 TraesCS5D01G009700 chr2D 334225621 334227732 2111 False 3548 3548 96.980 1 2114 1 chr2D.!!$F1 2113
9 TraesCS5D01G009700 chr2D 628285365 628286598 1233 False 2128 2128 97.974 1 1220 1 chr2D.!!$F2 1219
10 TraesCS5D01G009700 chr3D 21897256 21899356 2100 False 3520 3520 96.847 1 2114 1 chr3D.!!$F1 2113
11 TraesCS5D01G009700 chr2A 335825975 335828080 2105 False 3485 3485 96.519 1 2113 1 chr2A.!!$F1 2112
12 TraesCS5D01G009700 chr2A 276440663 276441377 714 True 1133 1133 95.385 1 709 1 chr2A.!!$R1 708
13 TraesCS5D01G009700 chr1A 256025689 256026471 782 True 1284 1284 96.424 1 775 1 chr1A.!!$R1 774
14 TraesCS5D01G009700 chr5A 684325284 684325967 683 False 1096 1096 95.760 1 677 1 chr5A.!!$F1 676

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
205 206 4.703093 ACTTTGGTTGGAGTTCGAAAAAGA 59.297 37.5 17.18 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1248 1282 0.171903 AACCCGATGTCGTAGGTTCG 59.828 55.0 9.36 0.0 38.79 3.95 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 7.229907 TGTTTGTTGGATTAGGTCTAACTTTCC 59.770 37.037 5.99 0.00 45.53 3.13
205 206 4.703093 ACTTTGGTTGGAGTTCGAAAAAGA 59.297 37.500 17.18 0.00 0.00 2.52
206 207 5.359860 ACTTTGGTTGGAGTTCGAAAAAGAT 59.640 36.000 17.18 4.02 0.00 2.40
820 850 5.229921 TGAACAAGATACGCCTTATTTGC 57.770 39.130 0.00 0.00 0.00 3.68
976 1007 7.521871 TTTAGGGATAGATCGTACCTCTTTC 57.478 40.000 8.07 1.30 32.87 2.62
1150 1184 0.545309 TTGACCTCCTCCAGACCAGG 60.545 60.000 0.00 0.00 0.00 4.45
1248 1282 1.596727 GAATCACGCTCTGCAGGATTC 59.403 52.381 19.95 19.95 37.68 2.52
1304 1338 4.077108 TCTACCGAACTGAACTAAGAGCA 58.923 43.478 0.00 0.00 0.00 4.26
1797 1849 8.638629 TTTTTAGGGATAGGAAAATTTCGTCA 57.361 30.769 4.07 0.00 0.00 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 2.856032 CGCTCGCAGTTTGGTCAG 59.144 61.111 0.00 0.00 0.00 3.51
507 522 9.260002 GTTGTGGAATTTGTCAATTGAGTAAAT 57.740 29.630 18.20 18.20 32.35 1.40
1150 1184 4.772100 TCCAATTTCAATTTGACCTCCTCC 59.228 41.667 0.00 0.00 0.00 4.30
1241 1275 2.933495 TGTCGTAGGTTCGAATCCTG 57.067 50.000 22.04 11.39 41.47 3.86
1248 1282 0.171903 AACCCGATGTCGTAGGTTCG 59.828 55.000 9.36 0.00 38.79 3.95
1554 1588 5.445069 TGTGGAAAAGAAGACAGGAATTGA 58.555 37.500 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.