Multiple sequence alignment - TraesCS5D01G009500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009500 chr5D 100.000 2201 0 0 1 2201 6206665 6204465 0.000000e+00 4065
1 TraesCS5D01G009500 chr5D 98.442 2054 28 4 152 2201 240132461 240134514 0.000000e+00 3613
2 TraesCS5D01G009500 chr5D 98.240 1591 24 4 614 2201 449153933 449152344 0.000000e+00 2780
3 TraesCS5D01G009500 chr3B 97.686 2204 46 5 1 2201 201507736 201509937 0.000000e+00 3783
4 TraesCS5D01G009500 chr3D 97.731 2204 29 5 1 2201 21898714 21900899 0.000000e+00 3773
5 TraesCS5D01G009500 chr2D 96.150 2234 50 8 1 2201 334227074 334229304 0.000000e+00 3616
6 TraesCS5D01G009500 chr2D 98.662 299 4 0 103 401 141098400 141098102 4.160000e-147 531
7 TraesCS5D01G009500 chr2D 90.556 180 3 6 427 604 565514811 565514978 2.200000e-55 226
8 TraesCS5D01G009500 chr1D 98.608 1796 19 6 123 1914 254490942 254492735 0.000000e+00 3173
9 TraesCS5D01G009500 chr1D 98.641 1692 20 3 1 1689 483921800 483920109 0.000000e+00 2994
10 TraesCS5D01G009500 chr1D 98.160 1413 21 4 794 2201 483919206 483917794 0.000000e+00 2460
11 TraesCS5D01G009500 chr1D 98.610 1151 12 4 1054 2201 254493672 254494821 0.000000e+00 2034
12 TraesCS5D01G009500 chr1D 98.113 954 15 3 1220 2170 254493682 254492729 0.000000e+00 1659
13 TraesCS5D01G009500 chrUn 98.905 1553 17 0 1 1553 317472028 317470476 0.000000e+00 2774
14 TraesCS5D01G009500 chr7A 96.809 376 10 2 442 816 694550350 694550724 5.160000e-176 627
15 TraesCS5D01G009500 chr7A 98.208 279 5 0 196 474 167574529 167574807 2.540000e-134 488
16 TraesCS5D01G009500 chr6B 97.143 175 5 0 1 175 276897523 276897349 1.650000e-76 296
17 TraesCS5D01G009500 chr7B 98.182 165 2 1 1 165 262233605 262233442 9.940000e-74 287


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009500 chr5D 6204465 6206665 2200 True 4065.0 4065 100.0000 1 2201 1 chr5D.!!$R1 2200
1 TraesCS5D01G009500 chr5D 240132461 240134514 2053 False 3613.0 3613 98.4420 152 2201 1 chr5D.!!$F1 2049
2 TraesCS5D01G009500 chr5D 449152344 449153933 1589 True 2780.0 2780 98.2400 614 2201 1 chr5D.!!$R2 1587
3 TraesCS5D01G009500 chr3B 201507736 201509937 2201 False 3783.0 3783 97.6860 1 2201 1 chr3B.!!$F1 2200
4 TraesCS5D01G009500 chr3D 21898714 21900899 2185 False 3773.0 3773 97.7310 1 2201 1 chr3D.!!$F1 2200
5 TraesCS5D01G009500 chr2D 334227074 334229304 2230 False 3616.0 3616 96.1500 1 2201 1 chr2D.!!$F1 2200
6 TraesCS5D01G009500 chr1D 483917794 483921800 4006 True 2727.0 2994 98.4005 1 2201 2 chr1D.!!$R2 2200
7 TraesCS5D01G009500 chr1D 254490942 254494821 3879 False 2603.5 3173 98.6090 123 2201 2 chr1D.!!$F1 2078
8 TraesCS5D01G009500 chr1D 254492729 254493682 953 True 1659.0 1659 98.1130 1220 2170 1 chr1D.!!$R1 950
9 TraesCS5D01G009500 chrUn 317470476 317472028 1552 True 2774.0 2774 98.9050 1 1553 1 chrUn.!!$R1 1552

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
550 551 2.568509 CCCAAATGCTTTGTCATTCCCT 59.431 45.455 7.53 0.0 38.98 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2069 5685 2.419713 GGGAACTCCGGGAAGATACAAC 60.42 54.545 0.0 0.0 36.71 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 345 8.638629 TTTTTAGGGATAGGAAAATTTCGTCA 57.361 30.769 4.07 0.00 0.00 4.35
550 551 2.568509 CCCAAATGCTTTGTCATTCCCT 59.431 45.455 7.53 0.00 38.98 4.20
669 673 8.150296 GGAAAAAGAAAGAAAAGATGGATTGGA 58.850 33.333 0.00 0.00 0.00 3.53
1047 1053 8.755977 AGAATCAGAGTTATTTTGGAATGCATT 58.244 29.630 12.83 12.83 0.00 3.56
1185 2990 2.130395 CGCAAGCATACGACTCATCAT 58.870 47.619 0.00 0.00 0.00 2.45
2005 5621 4.629779 TCGAATTCGAAAGGGCCC 57.370 55.556 27.36 16.46 46.30 5.80
2007 5623 2.469516 CGAATTCGAAAGGGCCCGG 61.470 63.158 23.29 7.55 43.02 5.73
2066 5682 8.818057 CGTTGATTCCTACCACTTAATCTTAAG 58.182 37.037 7.91 7.91 44.37 1.85
2095 5711 0.324830 CTTCCCGGAGTTCCCTCTCT 60.325 60.000 0.73 0.00 37.86 3.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 102 5.445069 TGTGGAAAAGAAGACAGGAATTGA 58.555 37.500 0.00 0.0 0.00 2.57
755 759 5.946942 TTCTATGCTCTGATTTCTGAGGT 57.053 39.130 14.05 0.0 40.79 3.85
982 988 4.058124 GCCATGAACCTCCTTTTGTTTTC 58.942 43.478 0.00 0.0 0.00 2.29
987 993 1.631405 TGGCCATGAACCTCCTTTTG 58.369 50.000 0.00 0.0 0.00 2.44
1047 1053 2.614983 GGCACCTTTTCGAACACAACTA 59.385 45.455 0.00 0.0 0.00 2.24
1185 2990 9.226606 ACACGATGTTCCTATTTCTTTATTTCA 57.773 29.630 0.00 0.0 0.00 2.69
1502 5115 6.518369 GCTTGGATTTACTAAAGGGTTGCTTT 60.518 38.462 0.00 0.0 0.00 3.51
2066 5682 3.329929 ACTCCGGGAAGATACAACAAC 57.670 47.619 0.00 0.0 0.00 3.32
2069 5685 2.419713 GGGAACTCCGGGAAGATACAAC 60.420 54.545 0.00 0.0 36.71 3.32
2095 5711 8.727149 ACTGGAATAATAGAAGATGAATTCCCA 58.273 33.333 2.27 0.0 40.99 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.