Multiple sequence alignment - TraesCS5D01G009400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009400 chr5D 100.000 2606 0 0 1 2606 6201612 6204217 0 4813
1 TraesCS5D01G009400 chr5D 98.698 2612 28 5 1 2606 240137373 240134762 0 4630
2 TraesCS5D01G009400 chr3B 98.201 2612 40 6 1 2606 201512795 201510185 0 4556
3 TraesCS5D01G009400 chr1D 97.970 2611 33 10 1 2606 254497664 254495069 0 4510
4 TraesCS5D01G009400 chr1D 97.954 2346 29 6 267 2606 483915214 483917546 0 4048
5 TraesCS5D01G009400 chr1D 97.793 1586 12 6 1 1565 19957700 19956117 0 2713
6 TraesCS5D01G009400 chr4D 96.595 2614 76 11 1 2606 19916164 19913556 0 4322
7 TraesCS5D01G009400 chr3D 98.414 2270 29 6 1 2266 21904292 21902026 0 3986
8 TraesCS5D01G009400 chr3D 98.315 890 13 2 1719 2606 21902036 21901147 0 1559
9 TraesCS5D01G009400 chr6B 97.816 1740 34 3 1 1737 22425611 22423873 0 3000
10 TraesCS5D01G009400 chr2D 97.704 1568 29 5 1042 2604 334231119 334229554 0 2689
11 TraesCS5D01G009400 chr1A 98.685 1293 13 3 1 1289 112776366 112777658 0 2290
12 TraesCS5D01G009400 chr2B 97.948 1316 22 5 1289 2601 474897223 474898536 0 2276
13 TraesCS5D01G009400 chrUn 98.816 1098 10 2 642 1737 440190305 440189209 0 1953
14 TraesCS5D01G009400 chr7A 97.640 805 18 1 1 804 352202444 352203248 0 1380


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009400 chr5D 6201612 6204217 2605 False 4813.0 4813 100.0000 1 2606 1 chr5D.!!$F1 2605
1 TraesCS5D01G009400 chr5D 240134762 240137373 2611 True 4630.0 4630 98.6980 1 2606 1 chr5D.!!$R1 2605
2 TraesCS5D01G009400 chr3B 201510185 201512795 2610 True 4556.0 4556 98.2010 1 2606 1 chr3B.!!$R1 2605
3 TraesCS5D01G009400 chr1D 254495069 254497664 2595 True 4510.0 4510 97.9700 1 2606 1 chr1D.!!$R2 2605
4 TraesCS5D01G009400 chr1D 483915214 483917546 2332 False 4048.0 4048 97.9540 267 2606 1 chr1D.!!$F1 2339
5 TraesCS5D01G009400 chr1D 19956117 19957700 1583 True 2713.0 2713 97.7930 1 1565 1 chr1D.!!$R1 1564
6 TraesCS5D01G009400 chr4D 19913556 19916164 2608 True 4322.0 4322 96.5950 1 2606 1 chr4D.!!$R1 2605
7 TraesCS5D01G009400 chr3D 21901147 21904292 3145 True 2772.5 3986 98.3645 1 2606 2 chr3D.!!$R1 2605
8 TraesCS5D01G009400 chr6B 22423873 22425611 1738 True 3000.0 3000 97.8160 1 1737 1 chr6B.!!$R1 1736
9 TraesCS5D01G009400 chr2D 334229554 334231119 1565 True 2689.0 2689 97.7040 1042 2604 1 chr2D.!!$R1 1562
10 TraesCS5D01G009400 chr1A 112776366 112777658 1292 False 2290.0 2290 98.6850 1 1289 1 chr1A.!!$F1 1288
11 TraesCS5D01G009400 chr2B 474897223 474898536 1313 False 2276.0 2276 97.9480 1289 2601 1 chr2B.!!$F1 1312
12 TraesCS5D01G009400 chrUn 440189209 440190305 1096 True 1953.0 1953 98.8160 642 1737 1 chrUn.!!$R1 1095
13 TraesCS5D01G009400 chr7A 352202444 352203248 804 False 1380.0 1380 97.6400 1 804 1 chr7A.!!$F1 803

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
136 137 1.153107 CCCAATGCCAGATCGCTGA 60.153 57.895 0.0 0.0 45.17 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1737 1766 0.650512 CCGTCGGCATGTTGTATGTC 59.349 55.0 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 137 1.153107 CCCAATGCCAGATCGCTGA 60.153 57.895 0.00 0.0 45.17 4.26
1059 1063 6.780706 TGTATCGAGAAAGGACACTTTTTC 57.219 37.500 0.00 0.0 46.51 2.29
1371 1398 1.903877 ATCGGGCAAGGACACCAGAG 61.904 60.000 0.00 0.0 33.55 3.35
1655 1682 5.298276 TCACAGCTAAATTCGTGTTTTCCTT 59.702 36.000 0.00 0.0 0.00 3.36
2116 2681 8.226819 AGGCTTATGCTCCTTTATCTTAAAAC 57.773 34.615 0.13 0.0 39.59 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 137 4.021544 TGTTTTCTGGCTTGTGTTTCTTGT 60.022 37.500 0.00 0.00 0.00 3.16
864 868 8.450964 CAGAAAGAAAGAATCCGCAGTTTATTA 58.549 33.333 0.00 0.00 0.00 0.98
954 958 2.665165 TGGAACACCAATGGGCATATC 58.335 47.619 3.55 0.00 37.90 1.63
1059 1063 2.185262 TCGCAACGAATCTCTTGATCG 58.815 47.619 0.00 0.00 31.06 3.69
1060 1064 3.439293 TCTCGCAACGAATCTCTTGATC 58.561 45.455 0.00 0.00 34.74 2.92
1143 1150 6.573485 CGCCTGGGGAGTTTATAAACAAAAAT 60.573 38.462 26.06 8.64 41.30 1.82
1259 1286 1.021390 AAGCAGAATGAAGGACGCCG 61.021 55.000 0.00 0.00 39.69 6.46
1737 1766 0.650512 CCGTCGGCATGTTGTATGTC 59.349 55.000 0.00 0.00 0.00 3.06
2090 2655 9.338622 GTTTTAAGATAAAGGAGCATAAGCCTA 57.661 33.333 0.00 0.00 43.56 3.93
2116 2681 1.939838 GCTGACCCTGTTAGTCCGTTG 60.940 57.143 0.00 0.00 33.09 4.10
2166 2731 9.770097 CACAATAAGAGTTATCCATACAGTGAT 57.230 33.333 0.00 0.00 0.00 3.06
2208 2773 7.956315 TCTTTGGCTCTACCTATCCATTATAGT 59.044 37.037 0.00 0.00 40.22 2.12
2491 3060 3.408634 TCTTTTAGCCACCCTTTTCTCG 58.591 45.455 0.00 0.00 0.00 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.