Multiple sequence alignment - TraesCS5D01G009300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009300 chr5D 100.000 2132 0 0 1 2132 6199091 6201222 0.000000e+00 3938.0
1 TraesCS5D01G009300 chr5D 98.290 2105 33 3 1 2103 560874659 560872556 0.000000e+00 3685.0
2 TraesCS5D01G009300 chr5D 97.283 2135 50 8 1 2132 329164365 329162236 0.000000e+00 3615.0
3 TraesCS5D01G009300 chr1D 97.658 2135 46 4 1 2132 254500189 254498056 0.000000e+00 3663.0
4 TraesCS5D01G009300 chr1D 92.566 2058 100 26 84 2132 244481977 244483990 0.000000e+00 2904.0
5 TraesCS5D01G009300 chr1A 96.439 2134 67 7 1 2132 168448382 168450508 0.000000e+00 3511.0
6 TraesCS5D01G009300 chr4D 96.388 2132 71 5 1 2130 19918683 19916556 0.000000e+00 3506.0
7 TraesCS5D01G009300 chr7A 94.522 2136 108 9 1 2132 352191835 352193965 0.000000e+00 3288.0
8 TraesCS5D01G009300 chr6B 96.978 1423 38 5 713 2132 22427423 22426003 0.000000e+00 2385.0
9 TraesCS5D01G009300 chr3B 97.372 1294 29 5 1 1292 201516870 201515580 0.000000e+00 2196.0
10 TraesCS5D01G009300 chr3B 94.222 675 35 4 1 675 524776894 524777564 0.000000e+00 1027.0
11 TraesCS5D01G009300 chr3D 98.401 1063 14 3 1072 2132 21905747 21904686 0.000000e+00 1866.0
12 TraesCS5D01G009300 chr3D 100.000 39 0 0 2094 2132 610999186 610999224 2.930000e-09 73.1
13 TraesCS5D01G009300 chr7B 94.667 675 35 1 1 675 102631440 102632113 0.000000e+00 1046.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009300 chr5D 6199091 6201222 2131 False 3938 3938 100.000 1 2132 1 chr5D.!!$F1 2131
1 TraesCS5D01G009300 chr5D 560872556 560874659 2103 True 3685 3685 98.290 1 2103 1 chr5D.!!$R2 2102
2 TraesCS5D01G009300 chr5D 329162236 329164365 2129 True 3615 3615 97.283 1 2132 1 chr5D.!!$R1 2131
3 TraesCS5D01G009300 chr1D 254498056 254500189 2133 True 3663 3663 97.658 1 2132 1 chr1D.!!$R1 2131
4 TraesCS5D01G009300 chr1D 244481977 244483990 2013 False 2904 2904 92.566 84 2132 1 chr1D.!!$F1 2048
5 TraesCS5D01G009300 chr1A 168448382 168450508 2126 False 3511 3511 96.439 1 2132 1 chr1A.!!$F1 2131
6 TraesCS5D01G009300 chr4D 19916556 19918683 2127 True 3506 3506 96.388 1 2130 1 chr4D.!!$R1 2129
7 TraesCS5D01G009300 chr7A 352191835 352193965 2130 False 3288 3288 94.522 1 2132 1 chr7A.!!$F1 2131
8 TraesCS5D01G009300 chr6B 22426003 22427423 1420 True 2385 2385 96.978 713 2132 1 chr6B.!!$R1 1419
9 TraesCS5D01G009300 chr3B 201515580 201516870 1290 True 2196 2196 97.372 1 1292 1 chr3B.!!$R1 1291
10 TraesCS5D01G009300 chr3B 524776894 524777564 670 False 1027 1027 94.222 1 675 1 chr3B.!!$F1 674
11 TraesCS5D01G009300 chr3D 21904686 21905747 1061 True 1866 1866 98.401 1072 2132 1 chr3D.!!$R1 1060
12 TraesCS5D01G009300 chr7B 102631440 102632113 673 False 1046 1046 94.667 1 675 1 chr7B.!!$F1 674

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
506 510 5.219739 AGAGATAACAGGCCCTTTCTATGA 58.78 41.667 0.0 0.0 0.0 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1872 1882 4.310357 ACATTTCCGGTTGTTTTGGTAC 57.69 40.909 0.0 0.0 0.0 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 7.118535 GGTCATTAGAGACTTCTTGACTTTTCC 59.881 40.741 8.14 0.0 39.51 3.13
241 243 9.173939 GAATAAGAACCGCTTGATAATCATTTG 57.826 33.333 0.00 0.0 37.42 2.32
440 444 5.980116 CACTCTATCTATTTCGTGTTCCAGG 59.020 44.000 0.00 0.0 0.00 4.45
481 485 5.289595 TCCGACGAATTAGAATCATCTTGG 58.710 41.667 0.00 0.0 37.10 3.61
506 510 5.219739 AGAGATAACAGGCCCTTTCTATGA 58.780 41.667 0.00 0.0 0.00 2.15
541 545 6.998074 AGGATCAATTCTAACAAGTCACACAA 59.002 34.615 0.00 0.0 0.00 3.33
1045 1051 6.064717 GCCATCTCCATATCTGGTTTACTTT 58.935 40.000 0.00 0.0 43.61 2.66
1106 1112 4.762251 GCAACCCTCTCAACAATTAAGAGT 59.238 41.667 0.00 0.0 35.76 3.24
1150 1156 8.682297 AGACTAATTTAAGTAAGAAGTCCCCT 57.318 34.615 0.00 0.0 34.39 4.79
1872 1882 4.133078 GCTCTAACAATTCCCTCCTCATG 58.867 47.826 0.00 0.0 0.00 3.07
1938 1949 3.737266 CGTACAAAAAGCTCACGTCCTTA 59.263 43.478 0.00 0.0 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 123 7.959689 AATTGAACTGATTCATAGGATCTCG 57.040 36.000 0.00 0.0 44.36 4.04
241 243 5.633601 TGTCGAGTCATTACACTGATTCAAC 59.366 40.000 0.00 0.0 32.95 3.18
412 416 7.504574 TGGAACACGAAATAGATAGAGTGGATA 59.495 37.037 0.00 0.0 34.28 2.59
460 464 7.139392 TCTACCAAGATGATTCTAATTCGTCG 58.861 38.462 0.00 0.0 0.00 5.12
481 485 6.267928 TCATAGAAAGGGCCTGTTATCTCTAC 59.732 42.308 6.92 0.0 0.00 2.59
541 545 7.303182 TGTTTCGGTATCTCTGGAATATGAT 57.697 36.000 0.00 0.0 0.00 2.45
1045 1051 4.855298 AGGCATACCCAGTAAAGCTTAA 57.145 40.909 0.00 0.0 36.11 1.85
1106 1112 2.297880 TCTCCGTGTTCTTCGAATGGAA 59.702 45.455 0.00 0.0 0.00 3.53
1150 1156 9.597681 CATTTAAGTAAGTAGTCCCCCTATCTA 57.402 37.037 0.00 0.0 0.00 1.98
1872 1882 4.310357 ACATTTCCGGTTGTTTTGGTAC 57.690 40.909 0.00 0.0 0.00 3.34
1938 1949 6.555360 AGGACATCCCGTCTTTAGAGATAAAT 59.445 38.462 0.00 0.0 44.70 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.