Multiple sequence alignment - TraesCS5D01G009200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009200 chr5D 100.000 2237 0 0 1 2237 6200987 6198751 0.000000e+00 4132
1 TraesCS5D01G009200 chr5D 97.391 2261 34 8 1 2237 560872762 560875021 0.000000e+00 3825
2 TraesCS5D01G009200 chr5D 97.288 2065 48 8 1 2062 329162471 329164530 0.000000e+00 3496
3 TraesCS5D01G009200 chr5D 88.442 199 2 4 2060 2237 329192306 329192504 1.040000e-53 220
4 TraesCS5D01G009200 chr1D 97.124 2260 41 7 1 2237 254498292 254500550 0.000000e+00 3792
5 TraesCS5D01G009200 chr1D 91.936 1823 94 26 1 1814 244483755 244481977 0.000000e+00 2503
6 TraesCS5D01G009200 chr1D 95.785 688 8 4 1571 2237 206075500 206074813 0.000000e+00 1090
7 TraesCS5D01G009200 chr4D 95.398 2260 73 10 1 2237 19916789 19919040 0.000000e+00 3568
8 TraesCS5D01G009200 chr1A 95.221 2260 72 14 1 2237 168450273 168448027 0.000000e+00 3542
9 TraesCS5D01G009200 chr7A 93.808 2261 109 14 2 2237 352193729 352191475 0.000000e+00 3371
10 TraesCS5D01G009200 chr3B 96.495 1655 31 12 606 2237 201515580 201517230 0.000000e+00 2710
11 TraesCS5D01G009200 chr3B 95.337 965 15 7 1 962 201513419 201514356 0.000000e+00 1506
12 TraesCS5D01G009200 chr3B 92.166 1034 49 8 1223 2237 524777564 524776544 0.000000e+00 1432
13 TraesCS5D01G009200 chr6B 96.801 1188 33 5 1 1185 22426238 22427423 0.000000e+00 1978
14 TraesCS5D01G009200 chrUn 98.011 1056 17 4 231 1284 445812538 445811485 0.000000e+00 1831
15 TraesCS5D01G009200 chrUn 96.253 774 7 5 1485 2237 439559441 439558669 0.000000e+00 1249
16 TraesCS5D01G009200 chr7B 92.954 1036 36 10 1223 2237 102632113 102631094 0.000000e+00 1474
17 TraesCS5D01G009200 chr6A 93.487 522 11 5 1739 2237 260130741 260130220 0.000000e+00 754
18 TraesCS5D01G009200 chr6D 100.000 89 0 0 2149 2237 338517649 338517561 4.940000e-37 165
19 TraesCS5D01G009200 chr2B 97.436 78 2 0 121 198 100814761 100814838 1.390000e-27 134
20 TraesCS5D01G009200 chr2D 98.387 62 1 0 69 130 337500239 337500300 2.350000e-20 110


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009200 chr5D 6198751 6200987 2236 True 4132 4132 100.000 1 2237 1 chr5D.!!$R1 2236
1 TraesCS5D01G009200 chr5D 560872762 560875021 2259 False 3825 3825 97.391 1 2237 1 chr5D.!!$F3 2236
2 TraesCS5D01G009200 chr5D 329162471 329164530 2059 False 3496 3496 97.288 1 2062 1 chr5D.!!$F1 2061
3 TraesCS5D01G009200 chr1D 254498292 254500550 2258 False 3792 3792 97.124 1 2237 1 chr1D.!!$F1 2236
4 TraesCS5D01G009200 chr1D 244481977 244483755 1778 True 2503 2503 91.936 1 1814 1 chr1D.!!$R2 1813
5 TraesCS5D01G009200 chr1D 206074813 206075500 687 True 1090 1090 95.785 1571 2237 1 chr1D.!!$R1 666
6 TraesCS5D01G009200 chr4D 19916789 19919040 2251 False 3568 3568 95.398 1 2237 1 chr4D.!!$F1 2236
7 TraesCS5D01G009200 chr1A 168448027 168450273 2246 True 3542 3542 95.221 1 2237 1 chr1A.!!$R1 2236
8 TraesCS5D01G009200 chr7A 352191475 352193729 2254 True 3371 3371 93.808 2 2237 1 chr7A.!!$R1 2235
9 TraesCS5D01G009200 chr3B 201513419 201517230 3811 False 2108 2710 95.916 1 2237 2 chr3B.!!$F1 2236
10 TraesCS5D01G009200 chr3B 524776544 524777564 1020 True 1432 1432 92.166 1223 2237 1 chr3B.!!$R1 1014
11 TraesCS5D01G009200 chr6B 22426238 22427423 1185 False 1978 1978 96.801 1 1185 1 chr6B.!!$F1 1184
12 TraesCS5D01G009200 chrUn 445811485 445812538 1053 True 1831 1831 98.011 231 1284 1 chrUn.!!$R2 1053
13 TraesCS5D01G009200 chrUn 439558669 439559441 772 True 1249 1249 96.253 1485 2237 1 chrUn.!!$R1 752
14 TraesCS5D01G009200 chr7B 102631094 102632113 1019 True 1474 1474 92.954 1223 2237 1 chr7B.!!$R1 1014
15 TraesCS5D01G009200 chr6A 260130220 260130741 521 True 754 754 93.487 1739 2237 1 chr6A.!!$R1 498

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
790 1330 2.29788 TCTCCGTGTTCTTCGAATGGAA 59.702 45.455 0.0 0.0 0.0 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2147 3737 4.437682 TGACATGGGGAGGAACATATTC 57.562 45.455 0.0 0.0 0.0 1.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.310357 ACATTTCCGGTTGTTTTGGTAC 57.690 40.909 0.00 0.0 0.00 3.34
648 1188 9.392259 CCTTTTAGTTTCGACTTTAGGGATAAT 57.608 33.333 0.00 0.0 0.00 1.28
746 1286 9.597681 CATTTAAGTAAGTAGTCCCCCTATCTA 57.402 37.037 0.00 0.0 0.00 1.98
790 1330 2.297880 TCTCCGTGTTCTTCGAATGGAA 59.702 45.455 0.00 0.0 0.00 3.53
851 1391 4.855298 AGGCATACCCAGTAAAGCTTAA 57.145 40.909 0.00 0.0 36.11 1.85
1355 2939 7.303182 TGTTTCGGTATCTCTGGAATATGAT 57.697 36.000 0.00 0.0 0.00 2.45
1415 2999 6.267928 TCATAGAAAGGGCCTGTTATCTCTAC 59.732 42.308 6.92 0.0 0.00 2.59
1436 3020 7.139392 TCTACCAAGATGATTCTAATTCGTCG 58.861 38.462 0.00 0.0 0.00 5.12
1655 3240 5.633601 TGTCGAGTCATTACACTGATTCAAC 59.366 40.000 0.00 0.0 32.95 3.18
1774 3360 7.959689 AATTGAACTGATTCATAGGATCTCG 57.040 36.000 0.00 0.0 44.36 4.04
2145 3735 2.234908 AGGAACGTCTTGAGATTCAGGG 59.765 50.000 0.00 0.0 0.00 4.45
2146 3736 2.622436 GAACGTCTTGAGATTCAGGGG 58.378 52.381 0.00 0.0 0.00 4.79
2147 3737 0.905357 ACGTCTTGAGATTCAGGGGG 59.095 55.000 0.00 0.0 0.00 5.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.133078 GCTCTAACAATTCCCTCCTCATG 58.867 47.826 0.00 0.0 0.00 3.07
746 1286 8.682297 AGACTAATTTAAGTAAGAAGTCCCCT 57.318 34.615 0.00 0.0 34.39 4.79
790 1330 4.762251 GCAACCCTCTCAACAATTAAGAGT 59.238 41.667 0.00 0.0 35.76 3.24
851 1391 6.064717 GCCATCTCCATATCTGGTTTACTTT 58.935 40.000 0.00 0.0 43.61 2.66
1355 2939 6.998074 AGGATCAATTCTAACAAGTCACACAA 59.002 34.615 0.00 0.0 0.00 3.33
1390 2974 5.219739 AGAGATAACAGGCCCTTTCTATGA 58.780 41.667 0.00 0.0 0.00 2.15
1415 2999 5.289595 TCCGACGAATTAGAATCATCTTGG 58.710 41.667 0.00 0.0 37.10 3.61
1456 3040 5.980116 CACTCTATCTATTTCGTGTTCCAGG 59.020 44.000 0.00 0.0 0.00 4.45
1655 3240 9.173939 GAATAAGAACCGCTTGATAATCATTTG 57.826 33.333 0.00 0.0 37.42 2.32
1826 3415 7.118535 GGTCATTAGAGACTTCTTGACTTTTCC 59.881 40.741 8.14 0.0 39.51 3.13
2011 3600 8.728833 TCAAGCAGAAACACAAAAATTTTCAAT 58.271 25.926 3.41 0.0 32.62 2.57
2146 3736 9.981371 ATGTTGACATGGGGAGGAACATATTCC 62.981 44.444 0.00 0.0 43.95 3.01
2147 3737 4.437682 TGACATGGGGAGGAACATATTC 57.562 45.455 0.00 0.0 0.00 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.