Multiple sequence alignment - TraesCS5D01G009100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G009100 chr5D 100.000 2282 0 0 1 2282 6199939 6197658 0.000000e+00 4215
1 TraesCS5D01G009100 chr5D 97.484 2305 35 6 1 2282 560873811 560876115 0.000000e+00 3914
2 TraesCS5D01G009100 chr5D 96.442 1293 24 5 1012 2282 329192306 329193598 0.000000e+00 2113
3 TraesCS5D01G009100 chr5D 96.946 1015 26 5 1 1014 329163520 329164530 0.000000e+00 1698
4 TraesCS5D01G009100 chr1D 97.396 2304 38 5 1 2282 254499341 254501644 0.000000e+00 3903
5 TraesCS5D01G009100 chr1D 97.532 1783 21 6 523 2282 206075500 206073718 0.000000e+00 3027
6 TraesCS5D01G009100 chr3B 97.222 2304 40 11 1 2282 201516023 201518324 0.000000e+00 3879
7 TraesCS5D01G009100 chr3B 92.207 1065 51 8 175 1220 524777564 524776513 0.000000e+00 1478
8 TraesCS5D01G009100 chr4D 95.703 2304 71 8 1 2282 19917836 19920133 0.000000e+00 3681
9 TraesCS5D01G009100 chr1A 95.182 2304 72 13 1 2282 168449227 168446941 0.000000e+00 3603
10 TraesCS5D01G009100 chr7A 94.447 2305 97 11 1 2282 352192682 352190386 0.000000e+00 3518
11 TraesCS5D01G009100 chr7B 94.977 2130 68 13 175 2282 102632113 102630001 0.000000e+00 3304
12 TraesCS5D01G009100 chr6A 96.349 1616 35 6 691 2282 260130741 260129126 0.000000e+00 2636
13 TraesCS5D01G009100 chr1B 97.720 307 7 0 1 307 65450310 65450616 1.550000e-146 529


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G009100 chr5D 6197658 6199939 2281 True 4215 4215 100.000 1 2282 1 chr5D.!!$R1 2281
1 TraesCS5D01G009100 chr5D 560873811 560876115 2304 False 3914 3914 97.484 1 2282 1 chr5D.!!$F3 2281
2 TraesCS5D01G009100 chr5D 329192306 329193598 1292 False 2113 2113 96.442 1012 2282 1 chr5D.!!$F2 1270
3 TraesCS5D01G009100 chr5D 329163520 329164530 1010 False 1698 1698 96.946 1 1014 1 chr5D.!!$F1 1013
4 TraesCS5D01G009100 chr1D 254499341 254501644 2303 False 3903 3903 97.396 1 2282 1 chr1D.!!$F1 2281
5 TraesCS5D01G009100 chr1D 206073718 206075500 1782 True 3027 3027 97.532 523 2282 1 chr1D.!!$R1 1759
6 TraesCS5D01G009100 chr3B 201516023 201518324 2301 False 3879 3879 97.222 1 2282 1 chr3B.!!$F1 2281
7 TraesCS5D01G009100 chr3B 524776513 524777564 1051 True 1478 1478 92.207 175 1220 1 chr3B.!!$R1 1045
8 TraesCS5D01G009100 chr4D 19917836 19920133 2297 False 3681 3681 95.703 1 2282 1 chr4D.!!$F1 2281
9 TraesCS5D01G009100 chr1A 168446941 168449227 2286 True 3603 3603 95.182 1 2282 1 chr1A.!!$R1 2281
10 TraesCS5D01G009100 chr7A 352190386 352192682 2296 True 3518 3518 94.447 1 2282 1 chr7A.!!$R1 2281
11 TraesCS5D01G009100 chr7B 102630001 102632113 2112 True 3304 3304 94.977 175 2282 1 chr7B.!!$R1 2107
12 TraesCS5D01G009100 chr6A 260129126 260130741 1615 True 2636 2636 96.349 691 2282 1 chr6A.!!$R1 1591

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
607 611 5.633601 TGTCGAGTCATTACACTGATTCAAC 59.366 40.0 0.0 0.0 32.95 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1448 1483 3.640029 CTGCCCAATAGCCAATTTGATCT 59.36 43.478 0.0 0.0 0.0 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
307 309 7.303182 TGTTTCGGTATCTCTGGAATATGAT 57.697 36.000 0.00 0.0 0.00 2.45
367 369 6.267928 TCATAGAAAGGGCCTGTTATCTCTAC 59.732 42.308 6.92 0.0 0.00 2.59
388 390 7.139392 TCTACCAAGATGATTCTAATTCGTCG 58.861 38.462 0.00 0.0 0.00 5.12
607 611 5.633601 TGTCGAGTCATTACACTGATTCAAC 59.366 40.000 0.00 0.0 32.95 3.18
726 730 7.959689 AATTGAACTGATTCATAGGATCTCG 57.040 36.000 0.00 0.0 44.36 4.04
1097 1105 2.234908 AGGAACGTCTTGAGATTCAGGG 59.765 50.000 0.00 0.0 0.00 4.45
1098 1106 2.622436 GAACGTCTTGAGATTCAGGGG 58.378 52.381 0.00 0.0 0.00 4.79
1099 1107 0.905357 ACGTCTTGAGATTCAGGGGG 59.095 55.000 0.00 0.0 0.00 5.40
1259 1292 2.902705 TACATAATGACCGAGGCCAC 57.097 50.000 5.01 0.0 0.00 5.01
1275 1308 2.289382 GGCCACCTTTGGTTGGTTAATG 60.289 50.000 0.00 0.0 45.98 1.90
1319 1353 9.625747 TCAGCAAGTATGATGGTTTTAATGATA 57.374 29.630 0.00 0.0 43.15 2.15
1448 1483 6.016610 GTGTAACTGGTTATTCTTTGCCTTGA 60.017 38.462 0.00 0.0 0.00 3.02
1585 1620 7.857569 TCCACTTTGACTCGTTTTTATAGTTG 58.142 34.615 0.00 0.0 0.00 3.16
1618 1653 2.230994 CTGCCTCTGCTTACTGCCGA 62.231 60.000 0.00 0.0 42.00 5.54
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
307 309 6.998074 AGGATCAATTCTAACAAGTCACACAA 59.002 34.615 0.00 0.00 0.00 3.33
342 344 5.219739 AGAGATAACAGGCCCTTTCTATGA 58.780 41.667 0.00 0.00 0.00 2.15
367 369 5.289595 TCCGACGAATTAGAATCATCTTGG 58.710 41.667 0.00 0.00 37.10 3.61
408 410 5.980116 CACTCTATCTATTTCGTGTTCCAGG 59.020 44.000 0.00 0.00 0.00 4.45
607 611 9.173939 GAATAAGAACCGCTTGATAATCATTTG 57.826 33.333 0.00 0.00 37.42 2.32
778 785 7.118535 GGTCATTAGAGACTTCTTGACTTTTCC 59.881 40.741 8.14 0.00 39.51 3.13
963 970 8.728833 TCAAGCAGAAACACAAAAATTTTCAAT 58.271 25.926 3.41 0.00 32.62 2.57
1098 1106 9.981371 ATGTTGACATGGGGAGGAACATATTCC 62.981 44.444 0.00 0.00 43.95 3.01
1099 1107 4.437682 TGACATGGGGAGGAACATATTC 57.562 45.455 0.00 0.00 0.00 1.75
1259 1292 8.364142 TGAACTAATTCATTAACCAACCAAAGG 58.636 33.333 0.00 0.00 40.01 3.11
1275 1308 4.811024 TGCTGACCATCGATGAACTAATTC 59.189 41.667 26.86 10.65 35.18 2.17
1319 1353 4.009675 ACACACGAAATACATGCAGGATT 58.990 39.130 4.84 0.00 0.00 3.01
1448 1483 3.640029 CTGCCCAATAGCCAATTTGATCT 59.360 43.478 0.00 0.00 0.00 2.75
1585 1620 4.184629 CAGAGGCAGTACAAAGGTATGTC 58.815 47.826 0.00 0.00 34.75 3.06
1618 1653 9.941325 TCATTGGAAAGTGCATTAACATAAATT 57.059 25.926 0.00 0.00 0.00 1.82
2030 2065 3.880040 ATGGATGACATGGTTGCGA 57.120 47.368 0.00 0.00 38.70 5.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.