Multiple sequence alignment - TraesCS5D01G008900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008900 chr5D 100.000 2211 0 0 1 2211 6193822 6191612 0 4084
1 TraesCS5D01G008900 chr5D 98.419 2214 31 3 1 2211 503223102 503220890 0 3892
2 TraesCS5D01G008900 chr3B 98.557 2218 23 5 1 2211 101916062 101913847 0 3910
3 TraesCS5D01G008900 chr3B 97.925 2217 38 4 1 2211 201531910 201529696 0 3832
4 TraesCS5D01G008900 chr3D 98.553 2212 29 3 1 2211 589272074 589274283 0 3904
5 TraesCS5D01G008900 chrUn 98.508 2212 29 3 1 2211 216513723 216515931 0 3899
6 TraesCS5D01G008900 chrUn 98.508 2212 29 3 1 2211 286269660 286267452 0 3899
7 TraesCS5D01G008900 chr1D 98.100 2211 40 2 1 2210 254393230 254395439 0 3849
8 TraesCS5D01G008900 chr3A 98.056 2212 39 4 1 2211 672905130 672907338 0 3843
9 TraesCS5D01G008900 chr3A 97.966 2212 41 4 1 2211 594894745 594896953 0 3832


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008900 chr5D 6191612 6193822 2210 True 4084 4084 100.000 1 2211 1 chr5D.!!$R1 2210
1 TraesCS5D01G008900 chr5D 503220890 503223102 2212 True 3892 3892 98.419 1 2211 1 chr5D.!!$R2 2210
2 TraesCS5D01G008900 chr3B 101913847 101916062 2215 True 3910 3910 98.557 1 2211 1 chr3B.!!$R1 2210
3 TraesCS5D01G008900 chr3B 201529696 201531910 2214 True 3832 3832 97.925 1 2211 1 chr3B.!!$R2 2210
4 TraesCS5D01G008900 chr3D 589272074 589274283 2209 False 3904 3904 98.553 1 2211 1 chr3D.!!$F1 2210
5 TraesCS5D01G008900 chrUn 216513723 216515931 2208 False 3899 3899 98.508 1 2211 1 chrUn.!!$F1 2210
6 TraesCS5D01G008900 chrUn 286267452 286269660 2208 True 3899 3899 98.508 1 2211 1 chrUn.!!$R1 2210
7 TraesCS5D01G008900 chr1D 254393230 254395439 2209 False 3849 3849 98.100 1 2210 1 chr1D.!!$F1 2209
8 TraesCS5D01G008900 chr3A 672905130 672907338 2208 False 3843 3843 98.056 1 2211 1 chr3A.!!$F2 2210
9 TraesCS5D01G008900 chr3A 594894745 594896953 2208 False 3832 3832 97.966 1 2211 1 chr3A.!!$F1 2210

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
750 752 1.794714 AGTAGATCTGTTCCGCCCAT 58.205 50.0 5.18 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1699 1702 0.533491 TCGCTACTTAATGGGCGTGT 59.467 50.0 13.05 0.0 46.37 4.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 3.033184 GCATGATTTTGGGGAATCTCCA 58.967 45.455 0.00 0.00 38.64 3.86
265 266 7.339212 TGCTTGCATTGTATTATTTGGTCTACT 59.661 33.333 0.00 0.00 0.00 2.57
316 318 5.070446 TGCAGGATTATACACGAAAGATCCT 59.930 40.000 0.00 0.00 43.00 3.24
582 584 7.093377 CCCCTTTAAGATCAAACAATTCCATCA 60.093 37.037 0.00 0.00 0.00 3.07
696 698 6.399639 AGCTGCTAGGTCTATTTCTTAGTC 57.600 41.667 0.00 0.00 0.00 2.59
750 752 1.794714 AGTAGATCTGTTCCGCCCAT 58.205 50.000 5.18 0.00 0.00 4.00
768 770 1.812571 CATAATGGGAATGGGCGCTAC 59.187 52.381 7.64 0.66 0.00 3.58
872 874 7.690454 TCTTATTATGAGAAGGGGTCATTCA 57.310 36.000 0.00 0.00 36.11 2.57
1181 1183 5.584551 AATACTCCAAGACTCCACCTTTT 57.415 39.130 0.00 0.00 0.00 2.27
1289 1291 2.288213 ACACGCGAGACTCAAAATCTCA 60.288 45.455 15.93 0.00 42.39 3.27
1373 1375 3.069586 TGAGCATTCCCCGTAGAAGTATG 59.930 47.826 0.00 0.00 0.00 2.39
1376 1378 1.868713 TTCCCCGTAGAAGTATGCCA 58.131 50.000 0.00 0.00 0.00 4.92
1501 1503 4.081309 TGAACGATCCTAAAAATCCCTCGT 60.081 41.667 0.00 0.00 39.31 4.18
1525 1527 7.985752 CGTAGGAGATAATAAAGAACCCAAAGT 59.014 37.037 0.00 0.00 0.00 2.66
1699 1702 3.073798 TCCCTGTTTGTATCCTTTGAGCA 59.926 43.478 0.00 0.00 0.00 4.26
1862 1875 8.462016 CAAGATCCCGAATAAGAAAACAGAAAT 58.538 33.333 0.00 0.00 0.00 2.17
2107 2123 3.950756 GGACGTTCCAAAAACGGGTACC 61.951 54.545 14.00 2.17 46.86 3.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 7.395190 TTCATGCTTGTTTGAGTAATAGCAT 57.605 32.000 0.00 0.0 42.65 3.79
265 266 6.198650 TCTCGAATGTTATCAGTTCCGTAA 57.801 37.500 0.00 0.0 0.00 3.18
696 698 4.962995 TCCAGTTAGTAAGAGGGATCTTGG 59.037 45.833 0.81 0.0 0.00 3.61
750 752 0.250124 CGTAGCGCCCATTCCCATTA 60.250 55.000 2.29 0.0 0.00 1.90
956 958 6.904626 AGGATAGATATGTCAAAAGCAGGTT 58.095 36.000 0.00 0.0 0.00 3.50
1376 1378 1.000396 GCACCAGGCCCAGATTTCT 60.000 57.895 0.00 0.0 36.11 2.52
1525 1527 4.160329 CCCTTGCAGTAGGATACCATCTA 58.840 47.826 5.98 0.0 44.47 1.98
1699 1702 0.533491 TCGCTACTTAATGGGCGTGT 59.467 50.000 13.05 0.0 46.37 4.49
1862 1875 1.712056 TGTGGTTTCCTCTTCCTCGA 58.288 50.000 0.00 0.0 0.00 4.04
2107 2123 3.255888 TCTCTAATTCACCCGATCCGATG 59.744 47.826 0.00 0.0 0.00 3.84


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.