Multiple sequence alignment - TraesCS5D01G008800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008800 chr5D 100.000 2141 0 0 1 2141 6189181 6191321 0 3954
1 TraesCS5D01G008800 chr5D 98.645 2141 29 0 1 2141 503218459 503220599 0 3794
2 TraesCS5D01G008800 chr5D 98.365 2141 35 0 1 2141 503277985 503275845 0 3760
3 TraesCS5D01G008800 chr1A 98.645 2141 29 0 1 2141 554512489 554514629 0 3794
4 TraesCS5D01G008800 chr3B 98.459 2141 33 0 1 2141 201527265 201529405 0 3771
5 TraesCS5D01G008800 chr6D 98.412 2141 34 0 1 2141 168255167 168257307 0 3766
6 TraesCS5D01G008800 chr3D 98.412 2141 31 2 1 2141 589279301 589277164 0 3762
7 TraesCS5D01G008800 chr3A 98.319 2141 34 2 1 2141 672909766 672907628 0 3753
8 TraesCS5D01G008800 chr3A 98.225 2141 37 1 1 2141 594899383 594897244 0 3742
9 TraesCS5D01G008800 chr2A 97.666 2142 48 2 1 2141 335838869 335841009 0 3677


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008800 chr5D 6189181 6191321 2140 False 3954 3954 100.000 1 2141 1 chr5D.!!$F1 2140
1 TraesCS5D01G008800 chr5D 503218459 503220599 2140 False 3794 3794 98.645 1 2141 1 chr5D.!!$F2 2140
2 TraesCS5D01G008800 chr5D 503275845 503277985 2140 True 3760 3760 98.365 1 2141 1 chr5D.!!$R1 2140
3 TraesCS5D01G008800 chr1A 554512489 554514629 2140 False 3794 3794 98.645 1 2141 1 chr1A.!!$F1 2140
4 TraesCS5D01G008800 chr3B 201527265 201529405 2140 False 3771 3771 98.459 1 2141 1 chr3B.!!$F1 2140
5 TraesCS5D01G008800 chr6D 168255167 168257307 2140 False 3766 3766 98.412 1 2141 1 chr6D.!!$F1 2140
6 TraesCS5D01G008800 chr3D 589277164 589279301 2137 True 3762 3762 98.412 1 2141 1 chr3D.!!$R1 2140
7 TraesCS5D01G008800 chr3A 672907628 672909766 2138 True 3753 3753 98.319 1 2141 1 chr3A.!!$R2 2140
8 TraesCS5D01G008800 chr3A 594897244 594899383 2139 True 3742 3742 98.225 1 2141 1 chr3A.!!$R1 2140
9 TraesCS5D01G008800 chr2A 335838869 335841009 2140 False 3677 3677 97.666 1 2141 1 chr2A.!!$F1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
347 348 0.974383 CCTGTCTACGGTTCCCTTGT 59.026 55.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1976 1980 0.108186 AGACCAATGATCTTGCGCGA 60.108 50.0 12.1 0.0 0.0 5.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
192 193 6.316140 CCAGATATGTCTTTTTGATTCCGTCA 59.684 38.462 0.00 0.00 30.42 4.35
347 348 0.974383 CCTGTCTACGGTTCCCTTGT 59.026 55.000 0.00 0.00 0.00 3.16
908 910 7.032580 CCGCAAATTTACCAATTATGAGTTGA 58.967 34.615 0.00 0.00 31.89 3.18
939 941 3.162666 CCATTCAGCCATGGATGCTTAT 58.837 45.455 25.40 14.56 46.18 1.73
1035 1037 8.408043 AAATATTCCGAGATGGCAAATATTCA 57.592 30.769 11.12 0.00 36.68 2.57
1089 1091 5.006552 CCTCGAATTGAAAGAGAGATTGAGC 59.993 44.000 0.00 0.00 34.13 4.26
1752 1756 0.679960 GGGTTTGCGAGCCAAGGTAT 60.680 55.000 9.32 0.00 45.52 2.73
1976 1980 0.182775 AGTTTTTCTGGCGGACCTGT 59.817 50.000 0.00 0.00 36.34 4.00
1988 1992 1.446099 GACCTGTCGCGCAAGATCA 60.446 57.895 8.75 0.00 43.02 2.92
2007 2011 1.355720 CATTGGTCTTCCCCTGGAACT 59.644 52.381 0.00 0.00 36.71 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
192 193 7.443272 AGCGCCTATACCGTAAAATAGATTTTT 59.557 33.333 2.29 0.00 40.24 1.94
347 348 0.902984 ACACCTATCCCGAGCACACA 60.903 55.000 0.00 0.00 0.00 3.72
514 515 2.119495 AGCCATCGACTACCTGGAAAT 58.881 47.619 6.18 0.00 31.38 2.17
908 910 0.811281 GGCTGAATGGTTAAAGCGCT 59.189 50.000 2.64 2.64 36.50 5.92
939 941 2.583143 ACGATGTACGATGATCCCTGA 58.417 47.619 0.00 0.00 45.77 3.86
1035 1037 6.667414 AGAGAGGTGTTTTCATAGTCATCTCT 59.333 38.462 6.52 6.52 46.67 3.10
1390 1392 0.387929 CGATAGGGCTAAGCGGAACA 59.612 55.000 0.00 0.00 0.00 3.18
1650 1654 6.102615 TGTGGAATACTAATGGATAGGGCTTT 59.897 38.462 0.00 0.00 35.81 3.51
1869 1873 1.886542 GAAAAACCCGCTTCCTGACAT 59.113 47.619 0.00 0.00 0.00 3.06
1976 1980 0.108186 AGACCAATGATCTTGCGCGA 60.108 50.000 12.10 0.00 0.00 5.87
1988 1992 1.355720 CAGTTCCAGGGGAAGACCAAT 59.644 52.381 0.00 0.00 42.88 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.