Multiple sequence alignment - TraesCS5D01G008700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008700 chr5D 100.000 2162 0 0 1 2162 6188429 6190590 0 3993
1 TraesCS5D01G008700 chr5D 98.659 2162 29 0 1 2162 503217707 503219868 0 3832
2 TraesCS5D01G008700 chr5D 98.427 2162 34 0 1 2162 503278737 503276576 0 3805
3 TraesCS5D01G008700 chr3B 98.705 2162 28 0 1 2162 201526513 201528674 0 3838
4 TraesCS5D01G008700 chr3B 96.082 1276 47 3 887 2162 700786918 700785646 0 2076
5 TraesCS5D01G008700 chr3B 97.739 575 13 0 333 907 810706862 810706288 0 990
6 TraesCS5D01G008700 chr3B 97.713 481 11 0 1 481 717180956 717181436 0 828
7 TraesCS5D01G008700 chr1A 98.705 2162 28 0 1 2162 554511737 554513898 0 3838
8 TraesCS5D01G008700 chr6D 98.659 2162 29 0 1 2162 168254415 168256576 0 3832
9 TraesCS5D01G008700 chr3D 98.427 2162 31 2 1 2162 589280053 589277895 0 3801
10 TraesCS5D01G008700 chr2A 97.872 2162 44 2 1 2162 194954966 194952807 0 3736
11 TraesCS5D01G008700 chr2A 97.365 2163 56 1 1 2162 335838117 335840279 0 3677


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008700 chr5D 6188429 6190590 2161 False 3993 3993 100.000 1 2162 1 chr5D.!!$F1 2161
1 TraesCS5D01G008700 chr5D 503217707 503219868 2161 False 3832 3832 98.659 1 2162 1 chr5D.!!$F2 2161
2 TraesCS5D01G008700 chr5D 503276576 503278737 2161 True 3805 3805 98.427 1 2162 1 chr5D.!!$R1 2161
3 TraesCS5D01G008700 chr3B 201526513 201528674 2161 False 3838 3838 98.705 1 2162 1 chr3B.!!$F1 2161
4 TraesCS5D01G008700 chr3B 700785646 700786918 1272 True 2076 2076 96.082 887 2162 1 chr3B.!!$R1 1275
5 TraesCS5D01G008700 chr3B 810706288 810706862 574 True 990 990 97.739 333 907 1 chr3B.!!$R2 574
6 TraesCS5D01G008700 chr1A 554511737 554513898 2161 False 3838 3838 98.705 1 2162 1 chr1A.!!$F1 2161
7 TraesCS5D01G008700 chr6D 168254415 168256576 2161 False 3832 3832 98.659 1 2162 1 chr6D.!!$F1 2161
8 TraesCS5D01G008700 chr3D 589277895 589280053 2158 True 3801 3801 98.427 1 2162 1 chr3D.!!$R1 2161
9 TraesCS5D01G008700 chr2A 194952807 194954966 2159 True 3736 3736 97.872 1 2162 1 chr2A.!!$R1 2161
10 TraesCS5D01G008700 chr2A 335838117 335840279 2162 False 3677 3677 97.365 1 2162 1 chr2A.!!$F1 2161

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
699 700 4.164822 TCGATTTCTAGGTTTCGTCGTT 57.835 40.909 8.32 0.0 33.52 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2142 2146 0.387929 CGATAGGGCTAAGCGGAACA 59.612 55.0 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
699 700 4.164822 TCGATTTCTAGGTTTCGTCGTT 57.835 40.909 8.32 0.00 33.52 3.85
944 947 6.316140 CCAGATATGTCTTTTTGATTCCGTCA 59.684 38.462 0.00 0.00 30.42 4.35
1660 1664 7.032580 CCGCAAATTTACCAATTATGAGTTGA 58.967 34.615 0.00 0.00 31.89 3.18
1691 1695 3.162666 CCATTCAGCCATGGATGCTTAT 58.837 45.455 25.40 14.56 46.18 1.73
1787 1791 8.408043 AAATATTCCGAGATGGCAAATATTCA 57.592 30.769 11.12 0.00 36.68 2.57
1841 1845 5.006552 CCTCGAATTGAAAGAGAGATTGAGC 59.993 44.000 0.00 0.00 34.13 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 3.246112 CACGTGGAAGGGGTGGGA 61.246 66.667 7.95 0.00 0.00 4.37
241 242 5.753438 CGATTCGACAGATTTGGATTCCTTA 59.247 40.000 0.00 0.00 0.00 2.69
434 435 3.119708 AGAGGCAAATTGAAAGCTAAGCG 60.120 43.478 0.00 0.00 0.00 4.68
944 947 7.443272 AGCGCCTATACCGTAAAATAGATTTTT 59.557 33.333 2.29 0.00 40.24 1.94
1266 1269 2.119495 AGCCATCGACTACCTGGAAAT 58.881 47.619 6.18 0.00 31.38 2.17
1660 1664 0.811281 GGCTGAATGGTTAAAGCGCT 59.189 50.000 2.64 2.64 36.50 5.92
1691 1695 2.583143 ACGATGTACGATGATCCCTGA 58.417 47.619 0.00 0.00 45.77 3.86
1787 1791 6.667414 AGAGAGGTGTTTTCATAGTCATCTCT 59.333 38.462 6.52 6.52 46.67 3.10
2142 2146 0.387929 CGATAGGGCTAAGCGGAACA 59.612 55.000 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.