Multiple sequence alignment - TraesCS5D01G008600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008600 chr5D 100.000 3101 0 0 1 3101 6187190 6190290 0.000000e+00 5727
1 TraesCS5D01G008600 chr5D 98.484 3101 46 1 1 3101 503279975 503276876 0.000000e+00 5465
2 TraesCS5D01G008600 chr5D 97.485 3102 74 4 1 3101 432405245 432402147 0.000000e+00 5293
3 TraesCS5D01G008600 chr5D 98.786 2800 32 2 303 3101 503216770 503219568 0.000000e+00 4981
4 TraesCS5D01G008600 chr3D 98.582 3102 38 5 1 3101 589281291 589278195 0.000000e+00 5480
5 TraesCS5D01G008600 chr1D 98.292 3103 49 4 1 3101 254399860 254396760 0.000000e+00 5433
6 TraesCS5D01G008600 chr5A 97.358 3104 76 6 1 3101 607272649 607275749 0.000000e+00 5273
7 TraesCS5D01G008600 chr2A 97.067 3103 68 6 1 3101 335836898 335839979 0.000000e+00 5204
8 TraesCS5D01G008600 chr4B 96.521 3104 91 6 1 3101 308694732 308697821 0.000000e+00 5118
9 TraesCS5D01G008600 chr4A 96.303 3111 102 9 1 3101 309513373 309516480 0.000000e+00 5096
10 TraesCS5D01G008600 chr6D 98.822 2801 30 3 303 3101 168253477 168256276 0.000000e+00 4987
11 TraesCS5D01G008600 chr3B 98.715 2801 32 4 303 3101 201525576 201528374 0.000000e+00 4970
12 TraesCS5D01G008600 chrUn 98.730 551 7 0 1 551 239346014 239345464 0.000000e+00 979
13 TraesCS5D01G008600 chr7D 96.575 146 5 0 223 368 204018550 204018405 3.090000e-60 243


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008600 chr5D 6187190 6190290 3100 False 5727 5727 100.000 1 3101 1 chr5D.!!$F1 3100
1 TraesCS5D01G008600 chr5D 503276876 503279975 3099 True 5465 5465 98.484 1 3101 1 chr5D.!!$R2 3100
2 TraesCS5D01G008600 chr5D 432402147 432405245 3098 True 5293 5293 97.485 1 3101 1 chr5D.!!$R1 3100
3 TraesCS5D01G008600 chr5D 503216770 503219568 2798 False 4981 4981 98.786 303 3101 1 chr5D.!!$F2 2798
4 TraesCS5D01G008600 chr3D 589278195 589281291 3096 True 5480 5480 98.582 1 3101 1 chr3D.!!$R1 3100
5 TraesCS5D01G008600 chr1D 254396760 254399860 3100 True 5433 5433 98.292 1 3101 1 chr1D.!!$R1 3100
6 TraesCS5D01G008600 chr5A 607272649 607275749 3100 False 5273 5273 97.358 1 3101 1 chr5A.!!$F1 3100
7 TraesCS5D01G008600 chr2A 335836898 335839979 3081 False 5204 5204 97.067 1 3101 1 chr2A.!!$F1 3100
8 TraesCS5D01G008600 chr4B 308694732 308697821 3089 False 5118 5118 96.521 1 3101 1 chr4B.!!$F1 3100
9 TraesCS5D01G008600 chr4A 309513373 309516480 3107 False 5096 5096 96.303 1 3101 1 chr4A.!!$F1 3100
10 TraesCS5D01G008600 chr6D 168253477 168256276 2799 False 4987 4987 98.822 303 3101 1 chr6D.!!$F1 2798
11 TraesCS5D01G008600 chr3B 201525576 201528374 2798 False 4970 4970 98.715 303 3101 1 chr3B.!!$F1 2798
12 TraesCS5D01G008600 chrUn 239345464 239346014 550 True 979 979 98.730 1 551 1 chrUn.!!$R1 550

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
989 1027 2.923619 CCAAGGGGTTGTGGGTTTT 58.076 52.632 0.0 0.0 0.0 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2899 2946 0.811281 GGCTGAATGGTTAAAGCGCT 59.189 50.0 2.64 2.64 36.5 5.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
488 496 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.00 0.00 0.00 3.73
989 1027 2.923619 CCAAGGGGTTGTGGGTTTT 58.076 52.632 0.00 0.00 0.00 2.43
1189 1230 2.323999 TACTAAACGGACCTCCCCAA 57.676 50.000 0.00 0.00 0.00 4.12
1749 1792 2.586425 CTCTCTTTGAAACAAGGGGCA 58.414 47.619 0.00 0.00 0.00 5.36
1938 1981 4.164822 TCGATTTCTAGGTTTCGTCGTT 57.835 40.909 8.32 0.00 33.52 3.85
2183 2228 6.316140 CCAGATATGTCTTTTTGATTCCGTCA 59.684 38.462 0.00 0.00 30.42 4.35
2899 2946 7.032580 CCGCAAATTTACCAATTATGAGTTGA 58.967 34.615 0.00 0.00 31.89 3.18
2930 2977 3.162666 CCATTCAGCCATGGATGCTTAT 58.837 45.455 25.40 14.56 46.18 1.73
3026 3073 8.408043 AAATATTCCGAGATGGCAAATATTCA 57.592 30.769 11.12 0.00 36.68 2.57
3080 3127 5.006552 CCTCGAATTGAAAGAGAGATTGAGC 59.993 44.000 0.00 0.00 34.13 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
900 936 4.501559 CGATAGTTTTATTCTTCGTCGCCA 59.498 41.667 0.00 0.00 0.00 5.69
989 1027 5.476945 GGGAAAGCTCTCATTGGTAGAAAAA 59.523 40.000 0.00 0.00 0.00 1.94
1003 1044 1.003233 GCGGTGAAGGGAAAGCTCT 60.003 57.895 0.00 0.00 0.00 4.09
1087 1128 2.444388 TGGGTAGAGCCGGATCTAAGTA 59.556 50.000 29.95 16.05 38.44 2.24
1189 1230 4.850680 TCGGCCACTTTAAGATTACCATT 58.149 39.130 2.24 0.00 0.00 3.16
1265 1306 3.246112 CACGTGGAAGGGGTGGGA 61.246 66.667 7.95 0.00 0.00 4.37
1480 1523 5.753438 CGATTCGACAGATTTGGATTCCTTA 59.247 40.000 0.00 0.00 0.00 2.69
1673 1716 3.119708 AGAGGCAAATTGAAAGCTAAGCG 60.120 43.478 0.00 0.00 0.00 4.68
1749 1792 1.594293 CACGCACAGAACCGGAAGT 60.594 57.895 9.46 0.00 0.00 3.01
2183 2228 7.443272 AGCGCCTATACCGTAAAATAGATTTTT 59.557 33.333 2.29 0.00 40.24 1.94
2505 2551 2.119495 AGCCATCGACTACCTGGAAAT 58.881 47.619 6.18 0.00 31.38 2.17
2899 2946 0.811281 GGCTGAATGGTTAAAGCGCT 59.189 50.000 2.64 2.64 36.50 5.92
2930 2977 2.583143 ACGATGTACGATGATCCCTGA 58.417 47.619 0.00 0.00 45.77 3.86
3026 3073 6.667414 AGAGAGGTGTTTTCATAGTCATCTCT 59.333 38.462 6.52 6.52 46.67 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.