Multiple sequence alignment - TraesCS5D01G008500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008500 chr5D 100.000 2450 0 0 1 2450 6189581 6187132 0.000000e+00 4525
1 TraesCS5D01G008500 chr5D 98.612 2450 33 1 1 2450 503277585 503280033 0.000000e+00 4335
2 TraesCS5D01G008500 chr5D 97.674 2451 53 4 1 2450 432402856 432405303 0.000000e+00 4207
3 TraesCS5D01G008500 chr5D 98.852 2091 22 2 1 2090 503218859 503216770 0.000000e+00 3727
4 TraesCS5D01G008500 chr3D 98.694 2451 27 4 1 2450 589278903 589281349 0.000000e+00 4344
5 TraesCS5D01G008500 chr1D 98.328 2452 38 3 1 2450 254397468 254399918 0.000000e+00 4298
6 TraesCS5D01G008500 chr5A 97.513 2453 56 5 1 2450 607275041 607272591 0.000000e+00 4187
7 TraesCS5D01G008500 chr4B 96.289 2452 75 5 1 2450 308697111 308694674 0.000000e+00 4010
8 TraesCS5D01G008500 chr4A 96.138 2460 82 9 1 2450 309515771 309513315 0.000000e+00 4004
9 TraesCS5D01G008500 chr6D 98.901 2092 20 3 1 2090 168255567 168253477 0.000000e+00 3733
10 TraesCS5D01G008500 chrUn 98.805 2092 21 4 1 2090 93408990 93411079 0.000000e+00 3722
11 TraesCS5D01G008500 chrUn 98.686 609 8 0 1842 2450 239345464 239346072 0.000000e+00 1081
12 TraesCS5D01G008500 chr6B 99.042 313 3 0 2138 2450 450080812 450081124 1.640000e-156 562
13 TraesCS5D01G008500 chr7D 96.575 146 5 0 2025 2170 204018405 204018550 2.430000e-60 243


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008500 chr5D 6187132 6189581 2449 True 4525 4525 100.000 1 2450 1 chr5D.!!$R1 2449
1 TraesCS5D01G008500 chr5D 503277585 503280033 2448 False 4335 4335 98.612 1 2450 1 chr5D.!!$F2 2449
2 TraesCS5D01G008500 chr5D 432402856 432405303 2447 False 4207 4207 97.674 1 2450 1 chr5D.!!$F1 2449
3 TraesCS5D01G008500 chr5D 503216770 503218859 2089 True 3727 3727 98.852 1 2090 1 chr5D.!!$R2 2089
4 TraesCS5D01G008500 chr3D 589278903 589281349 2446 False 4344 4344 98.694 1 2450 1 chr3D.!!$F1 2449
5 TraesCS5D01G008500 chr1D 254397468 254399918 2450 False 4298 4298 98.328 1 2450 1 chr1D.!!$F1 2449
6 TraesCS5D01G008500 chr5A 607272591 607275041 2450 True 4187 4187 97.513 1 2450 1 chr5A.!!$R1 2449
7 TraesCS5D01G008500 chr4B 308694674 308697111 2437 True 4010 4010 96.289 1 2450 1 chr4B.!!$R1 2449
8 TraesCS5D01G008500 chr4A 309513315 309515771 2456 True 4004 4004 96.138 1 2450 1 chr4A.!!$R1 2449
9 TraesCS5D01G008500 chr6D 168253477 168255567 2090 True 3733 3733 98.901 1 2090 1 chr6D.!!$R1 2089
10 TraesCS5D01G008500 chrUn 93408990 93411079 2089 False 3722 3722 98.805 1 2090 1 chrUn.!!$F1 2089
11 TraesCS5D01G008500 chrUn 239345464 239346072 608 False 1081 1081 98.686 1842 2450 1 chrUn.!!$F2 608

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
642 645 1.594293 CACGCACAGAACCGGAAGT 60.594 57.895 9.46 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1903 1917 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.0 0.0 0.0 3.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 209 7.443272 AGCGCCTATACCGTAAAATAGATTTTT 59.557 33.333 2.29 0.00 40.24 1.94
642 645 1.594293 CACGCACAGAACCGGAAGT 60.594 57.895 9.46 0.00 0.00 3.01
718 721 3.119708 AGAGGCAAATTGAAAGCTAAGCG 60.120 43.478 0.00 0.00 0.00 4.68
911 914 5.753438 CGATTCGACAGATTTGGATTCCTTA 59.247 40.000 0.00 0.00 0.00 2.69
1126 1131 3.246112 CACGTGGAAGGGGTGGGA 61.246 66.667 7.95 0.00 0.00 4.37
1202 1207 4.850680 TCGGCCACTTTAAGATTACCATT 58.149 39.130 2.24 0.00 0.00 3.16
1304 1309 2.444388 TGGGTAGAGCCGGATCTAAGTA 59.556 50.000 29.95 16.05 38.44 2.24
1388 1393 1.003233 GCGGTGAAGGGAAAGCTCT 60.003 57.895 0.00 0.00 0.00 4.09
1402 1410 5.476945 GGGAAAGCTCTCATTGGTAGAAAAA 59.523 40.000 0.00 0.00 0.00 1.94
1491 1501 4.501559 CGATAGTTTTATTCTTCGTCGCCA 59.498 41.667 0.00 0.00 0.00 5.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 209 6.316140 CCAGATATGTCTTTTTGATTCCGTCA 59.684 38.462 0.00 0.0 30.42 4.35
453 456 4.164822 TCGATTTCTAGGTTTCGTCGTT 57.835 40.909 8.32 0.0 33.52 3.85
642 645 2.586425 CTCTCTTTGAAACAAGGGGCA 58.414 47.619 0.00 0.0 0.00 5.36
1202 1207 2.323999 TACTAAACGGACCTCCCCAA 57.676 50.000 0.00 0.0 0.00 4.12
1402 1410 2.923619 CCAAGGGGTTGTGGGTTTT 58.076 52.632 0.00 0.0 0.00 2.43
1903 1917 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.00 0.0 0.00 3.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.