Multiple sequence alignment - TraesCS5D01G008400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008400 chr5D 100.000 2216 0 0 1 2216 6188756 6186541 0 4093
1 TraesCS5D01G008400 chr5D 98.691 2216 28 1 1 2216 503278410 503280624 0 3930
2 TraesCS5D01G008400 chr5D 97.953 2198 41 4 1 2197 432403681 432405875 0 3807
3 TraesCS5D01G008400 chr5D 98.973 1266 11 2 1 1265 503218034 503216770 0 2265
4 TraesCS5D01G008400 chr1D 98.828 2218 23 3 1 2216 254398293 254400509 0 3949
5 TraesCS5D01G008400 chr3D 98.737 2217 24 4 1 2216 589279726 589281939 0 3936
6 TraesCS5D01G008400 chr1A 98.344 2174 25 5 1 2172 554512064 554509900 0 3805
7 TraesCS5D01G008400 chr5A 97.206 2219 56 6 1 2216 607274216 607272001 0 3749
8 TraesCS5D01G008400 chr4A 96.536 2223 65 8 4 2216 309514944 309512724 0 3668
9 TraesCS5D01G008400 chr4A 95.804 2240 64 15 1 2216 310738413 310736180 0 3589
10 TraesCS5D01G008400 chr4B 96.303 2218 66 5 1 2216 308696286 308694083 0 3627
11 TraesCS5D01G008400 chr6D 97.858 1867 35 4 354 2216 45519037 45517172 0 3221


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008400 chr5D 6186541 6188756 2215 True 4093 4093 100.000 1 2216 1 chr5D.!!$R1 2215
1 TraesCS5D01G008400 chr5D 503278410 503280624 2214 False 3930 3930 98.691 1 2216 1 chr5D.!!$F2 2215
2 TraesCS5D01G008400 chr5D 432403681 432405875 2194 False 3807 3807 97.953 1 2197 1 chr5D.!!$F1 2196
3 TraesCS5D01G008400 chr5D 503216770 503218034 1264 True 2265 2265 98.973 1 1265 1 chr5D.!!$R2 1264
4 TraesCS5D01G008400 chr1D 254398293 254400509 2216 False 3949 3949 98.828 1 2216 1 chr1D.!!$F1 2215
5 TraesCS5D01G008400 chr3D 589279726 589281939 2213 False 3936 3936 98.737 1 2216 1 chr3D.!!$F1 2215
6 TraesCS5D01G008400 chr1A 554509900 554512064 2164 True 3805 3805 98.344 1 2172 1 chr1A.!!$R1 2171
7 TraesCS5D01G008400 chr5A 607272001 607274216 2215 True 3749 3749 97.206 1 2216 1 chr5A.!!$R1 2215
8 TraesCS5D01G008400 chr4A 309512724 309514944 2220 True 3668 3668 96.536 4 2216 1 chr4A.!!$R1 2212
9 TraesCS5D01G008400 chr4A 310736180 310738413 2233 True 3589 3589 95.804 1 2216 1 chr4A.!!$R2 2215
10 TraesCS5D01G008400 chr4B 308694083 308696286 2203 True 3627 3627 96.303 1 2216 1 chr4B.!!$R1 2215
11 TraesCS5D01G008400 chr6D 45517172 45519037 1865 True 3221 3221 97.858 354 2216 1 chr6D.!!$R1 1862

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
563 583 1.003233 GCGGTGAAGGGAAAGCTCT 60.003 57.895 0.0 0.0 0.0 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1836 1879 2.012673 GGCAGAGCACAACATCCTTAG 58.987 52.381 0.0 0.0 0.0 2.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 105 5.753438 CGATTCGACAGATTTGGATTCCTTA 59.247 40.000 0.00 0.00 0.00 2.69
301 321 3.246112 CACGTGGAAGGGGTGGGA 61.246 66.667 7.95 0.00 0.00 4.37
377 397 4.850680 TCGGCCACTTTAAGATTACCATT 58.149 39.130 2.24 0.00 0.00 3.16
479 499 2.444388 TGGGTAGAGCCGGATCTAAGTA 59.556 50.000 29.95 16.05 38.44 2.24
563 583 1.003233 GCGGTGAAGGGAAAGCTCT 60.003 57.895 0.00 0.00 0.00 4.09
577 600 5.476945 GGGAAAGCTCTCATTGGTAGAAAAA 59.523 40.000 0.00 0.00 0.00 1.94
666 692 4.501559 CGATAGTTTTATTCTTCGTCGCCA 59.498 41.667 0.00 0.00 0.00 5.69
1647 1690 9.905713 TGAAACTAGCATATTGGAAGATTAGTT 57.094 29.630 0.00 0.00 33.04 2.24
1720 1763 6.435904 TGACCAAATTTGTAACCCTCATTAGG 59.564 38.462 16.73 0.00 43.25 2.69
1836 1879 2.624838 CCTAACATGTGGAATGGATGCC 59.375 50.000 0.00 0.00 0.00 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
377 397 2.323999 TACTAAACGGACCTCCCCAA 57.676 50.000 0.00 0.00 0.00 4.12
577 600 2.923619 CCAAGGGGTTGTGGGTTTT 58.076 52.632 0.00 0.00 0.00 2.43
1078 1110 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.00 0.00 0.00 3.73
1645 1688 3.261580 GCTCATGGTTATTTTGGCCAAC 58.738 45.455 20.35 6.85 35.74 3.77
1647 1690 2.496871 CTGCTCATGGTTATTTTGGCCA 59.503 45.455 0.00 0.00 36.64 5.36
1720 1763 7.607991 TCAGGGAAACTACTGAAAATGAATCTC 59.392 37.037 0.00 0.00 40.51 2.75
1836 1879 2.012673 GGCAGAGCACAACATCCTTAG 58.987 52.381 0.00 0.00 0.00 2.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.