Multiple sequence alignment - TraesCS5D01G008300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008300 chr5D 100.000 2966 0 0 1 2966 6185436 6188401 0 5478
1 TraesCS5D01G008300 chr5D 98.809 2435 24 2 536 2966 503281198 503278765 0 4331
2 TraesCS5D01G008300 chr5D 98.426 1843 25 4 1125 2966 432405875 432404036 0 3240
3 TraesCS5D01G008300 chr5D 98.993 993 10 0 1 993 503282804 503281812 0 1779
4 TraesCS5D01G008300 chr1D 98.485 2971 32 4 1 2966 254401611 254398649 0 5225
5 TraesCS5D01G008300 chr1D 97.370 1331 28 4 1 1326 51882555 51883883 0 2257
6 TraesCS5D01G008300 chr6D 97.914 2972 53 5 1 2964 45516063 45519033 0 5136
7 TraesCS5D01G008300 chr2A 97.611 2972 44 7 1 2966 335835139 335838089 0 5070
8 TraesCS5D01G008300 chr4A 96.377 2981 89 13 1 2966 309511616 309514592 0 4889
9 TraesCS5D01G008300 chr4A 95.833 2976 105 13 1 2966 310735074 310738040 0 4791
10 TraesCS5D01G008300 chr4B 96.427 2967 87 5 1 2961 308692974 308695927 0 4874
11 TraesCS5D01G008300 chr3D 98.492 2122 24 5 850 2966 589282199 589280081 0 3735
12 TraesCS5D01G008300 chr5A 96.953 1969 50 7 1005 2966 607271896 607273861 0 3295
13 TraesCS5D01G008300 chr5A 96.937 1012 31 0 1 1012 607216310 607217321 0 1698


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008300 chr5D 6185436 6188401 2965 False 5478 5478 100.000 1 2966 1 chr5D.!!$F1 2965
1 TraesCS5D01G008300 chr5D 432404036 432405875 1839 True 3240 3240 98.426 1125 2966 1 chr5D.!!$R1 1841
2 TraesCS5D01G008300 chr5D 503278765 503282804 4039 True 3055 4331 98.901 1 2966 2 chr5D.!!$R2 2965
3 TraesCS5D01G008300 chr1D 254398649 254401611 2962 True 5225 5225 98.485 1 2966 1 chr1D.!!$R1 2965
4 TraesCS5D01G008300 chr1D 51882555 51883883 1328 False 2257 2257 97.370 1 1326 1 chr1D.!!$F1 1325
5 TraesCS5D01G008300 chr6D 45516063 45519033 2970 False 5136 5136 97.914 1 2964 1 chr6D.!!$F1 2963
6 TraesCS5D01G008300 chr2A 335835139 335838089 2950 False 5070 5070 97.611 1 2966 1 chr2A.!!$F1 2965
7 TraesCS5D01G008300 chr4A 309511616 309514592 2976 False 4889 4889 96.377 1 2966 1 chr4A.!!$F1 2965
8 TraesCS5D01G008300 chr4A 310735074 310738040 2966 False 4791 4791 95.833 1 2966 1 chr4A.!!$F2 2965
9 TraesCS5D01G008300 chr4B 308692974 308695927 2953 False 4874 4874 96.427 1 2961 1 chr4B.!!$F1 2960
10 TraesCS5D01G008300 chr3D 589280081 589282199 2118 True 3735 3735 98.492 850 2966 1 chr3D.!!$R1 2116
11 TraesCS5D01G008300 chr5A 607271896 607273861 1965 False 3295 3295 96.953 1005 2966 1 chr5A.!!$F2 1961
12 TraesCS5D01G008300 chr5A 607216310 607217321 1011 False 1698 1698 96.937 1 1012 1 chr5A.!!$F1 1011

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
325 328 2.163818 TCCGTGGATCAAACACTGAC 57.836 50.000 0.0 0.0 36.69 3.51 F
1066 2146 3.990092 TGTATTATCGCCTTCATCGCTT 58.010 40.909 0.0 0.0 0.00 4.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1484 2566 2.624838 CCTAACATGTGGAATGGATGCC 59.375 50.000 0.0 0.0 0.0 4.40 R
2757 3874 1.003233 GCGGTGAAGGGAAAGCTCT 60.003 57.895 0.0 0.0 0.0 4.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
325 328 2.163818 TCCGTGGATCAAACACTGAC 57.836 50.000 0.0 0.0 36.69 3.51
1066 2146 3.990092 TGTATTATCGCCTTCATCGCTT 58.010 40.909 0.0 0.0 0.00 4.68
1484 2566 2.012673 GGCAGAGCACAACATCCTTAG 58.987 52.381 0.0 0.0 0.00 2.18
1600 2682 7.607991 TCAGGGAAACTACTGAAAATGAATCTC 59.392 37.037 0.0 0.0 40.51 2.75
1673 2755 2.496871 CTGCTCATGGTTATTTTGGCCA 59.503 45.455 0.0 0.0 36.64 5.36
2242 3334 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.0 0.0 0.00 3.73
2943 4060 2.323999 TACTAAACGGACCTCCCCAA 57.676 50.000 0.0 0.0 0.00 4.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 311 0.790207 CGGTCAGTGTTTGATCCACG 59.210 55.000 0.00 0.00 38.29 4.94
317 320 5.182380 CCAAATACCAAATACGGTCAGTGTT 59.818 40.000 0.00 0.00 40.67 3.32
1066 2146 4.140447 ACCATCAATATCTACTGGAGGGGA 60.140 45.833 0.00 0.00 33.96 4.81
1484 2566 2.624838 CCTAACATGTGGAATGGATGCC 59.375 50.000 0.00 0.00 0.00 4.40
1600 2682 6.435904 TGACCAAATTTGTAACCCTCATTAGG 59.564 38.462 16.73 0.00 43.25 2.69
1673 2755 9.905713 TGAAACTAGCATATTGGAAGATTAGTT 57.094 29.630 0.00 0.00 33.04 2.24
2654 3766 4.501559 CGATAGTTTTATTCTTCGTCGCCA 59.498 41.667 0.00 0.00 0.00 5.69
2757 3874 1.003233 GCGGTGAAGGGAAAGCTCT 60.003 57.895 0.00 0.00 0.00 4.09
2841 3958 2.444388 TGGGTAGAGCCGGATCTAAGTA 59.556 50.000 29.95 16.05 38.44 2.24
2943 4060 4.850680 TCGGCCACTTTAAGATTACCATT 58.149 39.130 2.24 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.