Multiple sequence alignment - TraesCS5D01G008200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008200 chr5D 100.000 3066 0 0 1 3066 6180929 6183994 0.000000e+00 5662
1 TraesCS5D01G008200 chr5D 98.017 3076 45 15 1 3066 503287316 503284247 0.000000e+00 5328
2 TraesCS5D01G008200 chr5D 97.253 2767 60 16 1 2756 120799887 120797126 0.000000e+00 4674
3 TraesCS5D01G008200 chr3B 97.951 3075 51 12 1 3066 101919028 101922099 0.000000e+00 5319
4 TraesCS5D01G008200 chr6D 97.628 3078 52 14 1 3066 45511554 45514622 0.000000e+00 5260
5 TraesCS5D01G008200 chr1D 97.202 3074 71 13 1 3066 51878056 51881122 0.000000e+00 5186
6 TraesCS5D01G008200 chr2A 97.058 3093 61 17 1 3066 335830611 335833700 0.000000e+00 5180
7 TraesCS5D01G008200 chr2A 93.023 215 14 1 2798 3012 105047676 105047463 2.300000e-81 313
8 TraesCS5D01G008200 chr4A 96.068 3077 95 21 1 3066 310730584 310733645 0.000000e+00 4988
9 TraesCS5D01G008200 chr4B 95.180 3091 116 26 1 3066 308688466 308691548 0.000000e+00 4852
10 TraesCS5D01G008200 chr7B 95.046 2624 95 14 1 2615 105256578 105259175 0.000000e+00 4093
11 TraesCS5D01G008200 chr2B 88.103 933 80 19 2142 3066 721089649 721090558 0.000000e+00 1079


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008200 chr5D 6180929 6183994 3065 False 5662 5662 100.000 1 3066 1 chr5D.!!$F1 3065
1 TraesCS5D01G008200 chr5D 503284247 503287316 3069 True 5328 5328 98.017 1 3066 1 chr5D.!!$R2 3065
2 TraesCS5D01G008200 chr5D 120797126 120799887 2761 True 4674 4674 97.253 1 2756 1 chr5D.!!$R1 2755
3 TraesCS5D01G008200 chr3B 101919028 101922099 3071 False 5319 5319 97.951 1 3066 1 chr3B.!!$F1 3065
4 TraesCS5D01G008200 chr6D 45511554 45514622 3068 False 5260 5260 97.628 1 3066 1 chr6D.!!$F1 3065
5 TraesCS5D01G008200 chr1D 51878056 51881122 3066 False 5186 5186 97.202 1 3066 1 chr1D.!!$F1 3065
6 TraesCS5D01G008200 chr2A 335830611 335833700 3089 False 5180 5180 97.058 1 3066 1 chr2A.!!$F1 3065
7 TraesCS5D01G008200 chr4A 310730584 310733645 3061 False 4988 4988 96.068 1 3066 1 chr4A.!!$F1 3065
8 TraesCS5D01G008200 chr4B 308688466 308691548 3082 False 4852 4852 95.180 1 3066 1 chr4B.!!$F1 3065
9 TraesCS5D01G008200 chr7B 105256578 105259175 2597 False 4093 4093 95.046 1 2615 1 chr7B.!!$F1 2614
10 TraesCS5D01G008200 chr2B 721089649 721090558 909 False 1079 1079 88.103 2142 3066 1 chr2B.!!$F1 924

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
333 345 5.159209 AGTATTCCGTACGAGACAAAAGTG 58.841 41.667 18.76 0.0 38.38 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2332 2368 0.315886 TTTGAGCGAAGTGTAGGCGA 59.684 50.0 0.0 0.0 0.0 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
333 345 5.159209 AGTATTCCGTACGAGACAAAAGTG 58.841 41.667 18.76 0.00 38.38 3.16
532 550 9.575783 GAGTTGAAGAAGTACGAGAATTCTTAT 57.424 33.333 9.87 3.58 41.95 1.73
1178 1202 0.671251 TCCGAACCAAATTTGCGCTT 59.329 45.000 12.92 3.45 0.00 4.68
1444 1471 6.430000 GGGTATGTTGCTACTCTTTTGAAAGA 59.570 38.462 6.07 6.07 42.41 2.52
1598 1627 6.539649 AAGTCAATTCGTTCGAAATGAGAA 57.460 33.333 20.83 4.31 35.52 2.87
2311 2347 7.689446 TGTAGATAGATGGGTCTCTTTATCG 57.311 40.000 0.00 0.00 35.87 2.92
2442 2509 9.317936 CTAAAAATAAGAAGAATTTGGCCATCC 57.682 33.333 6.09 0.00 0.00 3.51
2500 2568 3.073356 TGGAATTTAACCGGACCTGTTCT 59.927 43.478 9.46 0.00 0.00 3.01
2501 2569 4.286549 TGGAATTTAACCGGACCTGTTCTA 59.713 41.667 9.46 1.90 0.00 2.10
2580 2651 2.357323 TCAATGTTTTGACAGAAGCGCA 59.643 40.909 11.47 0.00 36.94 6.09
2982 3054 4.986708 TGCGGGGAAAGGTTGGGC 62.987 66.667 0.00 0.00 0.00 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 8.966868 TCTACACATGCGGATAATATAGAATCA 58.033 33.333 0.00 0.00 0.00 2.57
489 503 5.860611 TCAACTCGAATACCAAAAGGAAGA 58.139 37.500 0.00 0.00 0.00 2.87
532 550 8.343168 TGAAAAGAGTGAAAGTTTTTGGTAGA 57.657 30.769 0.00 0.00 0.00 2.59
774 796 3.854286 AAGACGACTAACAAGTTTGCG 57.146 42.857 0.00 1.04 0.00 4.85
1178 1202 7.760794 CCATCGTGTACTATGTTACTTAAACCA 59.239 37.037 0.00 0.00 37.27 3.67
1504 1533 6.833041 TGTGTTTACTTGTTCTGGAATCCTA 58.167 36.000 0.00 0.00 0.00 2.94
1598 1627 8.943002 TGAGTCGTCTTTAAACTCTTTTCTTTT 58.057 29.630 5.97 0.00 40.07 2.27
1710 1739 6.751514 TGACGTGCATTAATTTCCTTACAT 57.248 33.333 0.00 0.00 0.00 2.29
2332 2368 0.315886 TTTGAGCGAAGTGTAGGCGA 59.684 50.000 0.00 0.00 0.00 5.54
2427 2494 4.897670 CCTAATCAGGATGGCCAAATTCTT 59.102 41.667 10.96 0.00 45.91 2.52
2500 2568 7.172875 CCATGAAAAACACTCAAATGCCAAATA 59.827 33.333 0.00 0.00 0.00 1.40
2501 2569 6.016943 CCATGAAAAACACTCAAATGCCAAAT 60.017 34.615 0.00 0.00 0.00 2.32
2542 2613 7.458409 AACATTGAACTAGCAAGACATCAAT 57.542 32.000 0.00 0.00 35.97 2.57
2580 2651 6.015010 TCCAAAAATCAATGGAATTACACCGT 60.015 34.615 0.00 0.00 42.61 4.83
2982 3054 4.576330 AAAGGGTCCACTCATAGGAAAG 57.424 45.455 0.00 0.00 36.80 2.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.