Multiple sequence alignment - TraesCS5D01G008100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G008100 chr5D 100.000 2195 0 0 1 2195 6181795 6179601 0 4054
1 TraesCS5D01G008100 chr5D 97.562 2215 29 16 1 2195 503286449 503288658 0 3768
2 TraesCS5D01G008100 chr5D 97.104 2210 39 18 1 2195 120799019 120801218 0 3703
3 TraesCS5D01G008100 chr5D 96.062 2209 62 16 1 2195 167071082 167073279 0 3574
4 TraesCS5D01G008100 chr5D 97.920 1106 11 5 1102 2195 512409297 512408192 0 1905
5 TraesCS5D01G008100 chr1D 97.284 2209 31 15 1 2195 254416213 254418406 0 3720
6 TraesCS5D01G008100 chr1D 96.924 2211 42 18 1 2195 51878923 51876723 0 3683
7 TraesCS5D01G008100 chr1D 95.227 2158 81 15 1 2144 260891256 260893405 0 3395
8 TraesCS5D01G008100 chr6D 97.279 2205 30 17 1 2190 45512415 45510226 0 3712
9 TraesCS5D01G008100 chr4A 96.062 1752 51 15 1 1747 310731445 310729707 0 2837
10 TraesCS5D01G008100 chr2A 97.690 1645 28 9 1 1641 335831479 335829841 0 2819
11 TraesCS5D01G008100 chr2A 96.380 1188 19 11 1012 2187 334595896 334594721 0 1934


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G008100 chr5D 6179601 6181795 2194 True 4054 4054 100.000 1 2195 1 chr5D.!!$R1 2194
1 TraesCS5D01G008100 chr5D 503286449 503288658 2209 False 3768 3768 97.562 1 2195 1 chr5D.!!$F3 2194
2 TraesCS5D01G008100 chr5D 120799019 120801218 2199 False 3703 3703 97.104 1 2195 1 chr5D.!!$F1 2194
3 TraesCS5D01G008100 chr5D 167071082 167073279 2197 False 3574 3574 96.062 1 2195 1 chr5D.!!$F2 2194
4 TraesCS5D01G008100 chr5D 512408192 512409297 1105 True 1905 1905 97.920 1102 2195 1 chr5D.!!$R2 1093
5 TraesCS5D01G008100 chr1D 254416213 254418406 2193 False 3720 3720 97.284 1 2195 1 chr1D.!!$F1 2194
6 TraesCS5D01G008100 chr1D 51876723 51878923 2200 True 3683 3683 96.924 1 2195 1 chr1D.!!$R1 2194
7 TraesCS5D01G008100 chr1D 260891256 260893405 2149 False 3395 3395 95.227 1 2144 1 chr1D.!!$F2 2143
8 TraesCS5D01G008100 chr6D 45510226 45512415 2189 True 3712 3712 97.279 1 2190 1 chr6D.!!$R1 2189
9 TraesCS5D01G008100 chr4A 310729707 310731445 1738 True 2837 2837 96.062 1 1747 1 chr4A.!!$R1 1746
10 TraesCS5D01G008100 chr2A 335829841 335831479 1638 True 2819 2819 97.690 1 1641 1 chr2A.!!$R2 1640
11 TraesCS5D01G008100 chr2A 334594721 334595896 1175 True 1934 1934 96.380 1012 2187 1 chr2A.!!$R1 1175

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
92 94 3.854286 AAGACGACTAACAAGTTTGCG 57.146 42.857 0.0 1.04 0.0 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1691 1709 2.019948 ATTTTTACTCCTCGCGTCCC 57.98 50.0 5.77 0.0 0.0 4.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 94 3.854286 AAGACGACTAACAAGTTTGCG 57.146 42.857 0.00 1.04 0.00 4.85
334 338 8.343168 TGAAAAGAGTGAAAGTTTTTGGTAGA 57.657 30.769 0.00 0.00 0.00 2.59
377 382 5.860611 TCAACTCGAATACCAAAAGGAAGA 58.139 37.500 0.00 0.00 0.00 2.87
1387 1401 1.915078 CTCCCCTGCACCTAGGTTGG 61.915 65.000 13.15 14.43 36.02 3.77
1892 1914 0.741221 GCCGCTTTAGTCCACTCAGG 60.741 60.000 0.00 0.00 39.47 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
334 338 9.575783 GAGTTGAAGAAGTACGAGAATTCTTAT 57.424 33.333 9.87 3.58 41.95 1.73
533 540 5.159209 AGTATTCCGTACGAGACAAAAGTG 58.841 41.667 18.76 0.00 38.38 3.16
1691 1709 2.019948 ATTTTTACTCCTCGCGTCCC 57.980 50.000 5.77 0.00 0.00 4.46
1892 1914 2.098770 GCTTTGGAACATGGAGAGATGC 59.901 50.000 0.00 0.00 39.30 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.