Multiple sequence alignment - TraesCS5D01G007900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G007900 chr5D 100.000 2468 0 0 1 2468 6179296 6176829 0.000000e+00 4558
1 TraesCS5D01G007900 chr5D 97.671 2490 30 3 1 2468 503288966 503291449 0.000000e+00 4252
2 TraesCS5D01G007900 chr5D 96.357 1647 52 3 1 1646 513586728 513585089 0.000000e+00 2702
3 TraesCS5D01G007900 chr6D 97.749 2488 29 7 6 2468 45509911 45507426 0.000000e+00 4259
4 TraesCS5D01G007900 chr4D 94.661 2491 104 3 1 2468 207070622 207068138 0.000000e+00 3836
5 TraesCS5D01G007900 chr2B 96.639 2291 48 5 1 2269 474901985 474904268 0.000000e+00 3777
6 TraesCS5D01G007900 chr1D 98.426 1970 29 2 501 2468 254433152 254435121 0.000000e+00 3465
7 TraesCS5D01G007900 chr1D 96.429 924 15 1 1 906 51876418 51875495 0.000000e+00 1507
8 TraesCS5D01G007900 chr1D 95.532 470 3 1 6 457 254418716 254419185 0.000000e+00 736
9 TraesCS5D01G007900 chr2D 98.274 1564 21 3 907 2468 638423033 638424592 0.000000e+00 2734
10 TraesCS5D01G007900 chr2D 97.847 1579 16 1 1 1561 9786794 9788372 0.000000e+00 2712
11 TraesCS5D01G007900 chr1A 96.786 1649 25 9 1 1627 554460118 554461760 0.000000e+00 2726
12 TraesCS5D01G007900 chr1A 98.642 1399 16 2 1073 2468 554461753 554463151 0.000000e+00 2475
13 TraesCS5D01G007900 chr4A 96.827 1418 43 2 6 1423 309505492 309504077 0.000000e+00 2368
14 TraesCS5D01G007900 chr4B 97.003 1101 33 0 1368 2468 308680781 308679681 0.000000e+00 1851
15 TraesCS5D01G007900 chr7D 95.215 418 2 1 1 400 77240484 77240901 0.000000e+00 645
16 TraesCS5D01G007900 chr1B 97.608 209 3 1 1 209 372161630 372161424 8.390000e-95 357


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G007900 chr5D 6176829 6179296 2467 True 4558.0 4558 100.000 1 2468 1 chr5D.!!$R1 2467
1 TraesCS5D01G007900 chr5D 503288966 503291449 2483 False 4252.0 4252 97.671 1 2468 1 chr5D.!!$F1 2467
2 TraesCS5D01G007900 chr5D 513585089 513586728 1639 True 2702.0 2702 96.357 1 1646 1 chr5D.!!$R2 1645
3 TraesCS5D01G007900 chr6D 45507426 45509911 2485 True 4259.0 4259 97.749 6 2468 1 chr6D.!!$R1 2462
4 TraesCS5D01G007900 chr4D 207068138 207070622 2484 True 3836.0 3836 94.661 1 2468 1 chr4D.!!$R1 2467
5 TraesCS5D01G007900 chr2B 474901985 474904268 2283 False 3777.0 3777 96.639 1 2269 1 chr2B.!!$F1 2268
6 TraesCS5D01G007900 chr1D 254433152 254435121 1969 False 3465.0 3465 98.426 501 2468 1 chr1D.!!$F2 1967
7 TraesCS5D01G007900 chr1D 51875495 51876418 923 True 1507.0 1507 96.429 1 906 1 chr1D.!!$R1 905
8 TraesCS5D01G007900 chr2D 638423033 638424592 1559 False 2734.0 2734 98.274 907 2468 1 chr2D.!!$F2 1561
9 TraesCS5D01G007900 chr2D 9786794 9788372 1578 False 2712.0 2712 97.847 1 1561 1 chr2D.!!$F1 1560
10 TraesCS5D01G007900 chr1A 554460118 554463151 3033 False 2600.5 2726 97.714 1 2468 2 chr1A.!!$F1 2467
11 TraesCS5D01G007900 chr4A 309504077 309505492 1415 True 2368.0 2368 96.827 6 1423 1 chr4A.!!$R1 1417
12 TraesCS5D01G007900 chr4B 308679681 308680781 1100 True 1851.0 1851 97.003 1368 2468 1 chr4B.!!$R1 1100

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
917 959 2.365293 GGCAATCTGGTTGGTTCTTTGT 59.635 45.455 2.39 0.0 38.29 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2146 2747 3.45761 AATATGCCAAATTCCGCCAAG 57.542 42.857 0.0 0.0 0.0 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
917 959 2.365293 GGCAATCTGGTTGGTTCTTTGT 59.635 45.455 2.39 0.0 38.29 2.83
1508 2097 0.542333 TCGTGACCAAGAAACCACCA 59.458 50.000 0.00 0.0 0.00 4.17
1514 2103 2.031870 ACCAAGAAACCACCAGCTTTC 58.968 47.619 0.00 0.0 0.00 2.62
1587 2176 0.318441 GCTCATGTAGCCTATGCCGA 59.682 55.000 6.02 0.0 46.25 5.54
2028 2625 1.716503 ACCAATTTGACCCTTAGCCCT 59.283 47.619 0.00 0.0 0.00 5.19
2146 2747 7.659186 TGTATGGTTGGGTTTTATTTGTGTAC 58.341 34.615 0.00 0.0 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 8.491958 GGGTGGAAGAACTAAAATAGAGGATTA 58.508 37.037 0.00 0.00 0.00 1.75
101 102 7.500227 TCAGCATTATTCCAAGACTCCTATTTG 59.500 37.037 0.00 0.00 0.00 2.32
415 456 6.733807 TCTTCTTTAGGAATTCTACCAAGGGA 59.266 38.462 5.23 3.66 33.01 4.20
716 758 1.737793 GACCGCCTAATTGACACCAAG 59.262 52.381 0.00 0.00 35.48 3.61
946 988 5.891198 TCCTTGGAAGAAAAGGATGAATCA 58.109 37.500 0.75 0.00 46.56 2.57
1508 2097 1.228675 CAGCCCACCAAGGAAAGCT 60.229 57.895 0.00 0.00 41.22 3.74
1514 2103 1.683365 CATTCCCAGCCCACCAAGG 60.683 63.158 0.00 0.00 37.03 3.61
1587 2176 3.071892 TCCGGCCCAGAATACGATTAATT 59.928 43.478 0.00 0.00 0.00 1.40
1662 2251 5.300792 TGTGGAAGTAAAATCAACCCTTGTC 59.699 40.000 0.00 0.00 0.00 3.18
2146 2747 3.457610 AATATGCCAAATTCCGCCAAG 57.542 42.857 0.00 0.00 0.00 3.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.