Multiple sequence alignment - TraesCS5D01G007800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G007800 chr5D 100.000 2188 0 0 1 2188 6176876 6174689 0.000000e+00 4041
1 TraesCS5D01G007800 chr5D 98.096 2206 24 4 1 2188 503291911 503294116 0.000000e+00 3825
2 TraesCS5D01G007800 chr5D 99.137 1855 13 3 1 1852 512410225 512412079 0.000000e+00 3334
3 TraesCS5D01G007800 chr5D 99.084 1855 13 4 1 1852 512417162 512419015 0.000000e+00 3328
4 TraesCS5D01G007800 chr2D 98.231 2205 20 5 1 2188 638424545 638426747 0.000000e+00 3838
5 TraesCS5D01G007800 chr2D 100.000 131 0 0 2058 2188 84931567 84931697 2.170000e-60 243
6 TraesCS5D01G007800 chr2D 100.000 131 0 0 2058 2188 628294715 628294585 2.170000e-60 243
7 TraesCS5D01G007800 chr1D 98.050 2205 24 5 1 2188 254435074 254437276 0.000000e+00 3816
8 TraesCS5D01G007800 chr1D 96.283 2206 54 10 1 2188 51871897 51869702 0.000000e+00 3594
9 TraesCS5D01G007800 chr4B 96.283 2206 59 9 4 2188 308679725 308677522 0.000000e+00 3598
10 TraesCS5D01G007800 chr4D 93.976 2208 101 12 1 2188 207068185 207065990 0.000000e+00 3312
11 TraesCS5D01G007800 chr1B 97.057 1903 36 6 304 2188 633708037 633709937 0.000000e+00 3186
12 TraesCS5D01G007800 chr3D 94.494 1998 86 12 1 1993 235618924 235620902 0.000000e+00 3059
13 TraesCS5D01G007800 chr5A 97.111 1800 42 7 1 1791 657451629 657453427 0.000000e+00 3027
14 TraesCS5D01G007800 chrUn 96.329 790 14 1 1414 2188 381153706 381152917 0.000000e+00 1284
15 TraesCS5D01G007800 chr7D 93.594 281 1 2 1925 2188 231596557 231596837 9.410000e-109 403
16 TraesCS5D01G007800 chr7D 92.157 255 5 1 1949 2188 231541709 231541455 1.610000e-91 346
17 TraesCS5D01G007800 chr3A 96.190 210 4 1 1756 1961 385361705 385361914 7.480000e-90 340


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G007800 chr5D 6174689 6176876 2187 True 4041 4041 100.000 1 2188 1 chr5D.!!$R1 2187
1 TraesCS5D01G007800 chr5D 503291911 503294116 2205 False 3825 3825 98.096 1 2188 1 chr5D.!!$F1 2187
2 TraesCS5D01G007800 chr5D 512410225 512412079 1854 False 3334 3334 99.137 1 1852 1 chr5D.!!$F2 1851
3 TraesCS5D01G007800 chr5D 512417162 512419015 1853 False 3328 3328 99.084 1 1852 1 chr5D.!!$F3 1851
4 TraesCS5D01G007800 chr2D 638424545 638426747 2202 False 3838 3838 98.231 1 2188 1 chr2D.!!$F2 2187
5 TraesCS5D01G007800 chr1D 254435074 254437276 2202 False 3816 3816 98.050 1 2188 1 chr1D.!!$F1 2187
6 TraesCS5D01G007800 chr1D 51869702 51871897 2195 True 3594 3594 96.283 1 2188 1 chr1D.!!$R1 2187
7 TraesCS5D01G007800 chr4B 308677522 308679725 2203 True 3598 3598 96.283 4 2188 1 chr4B.!!$R1 2184
8 TraesCS5D01G007800 chr4D 207065990 207068185 2195 True 3312 3312 93.976 1 2188 1 chr4D.!!$R1 2187
9 TraesCS5D01G007800 chr1B 633708037 633709937 1900 False 3186 3186 97.057 304 2188 1 chr1B.!!$F1 1884
10 TraesCS5D01G007800 chr3D 235618924 235620902 1978 False 3059 3059 94.494 1 1993 1 chr3D.!!$F1 1992
11 TraesCS5D01G007800 chr5A 657451629 657453427 1798 False 3027 3027 97.111 1 1791 1 chr5A.!!$F1 1790
12 TraesCS5D01G007800 chrUn 381152917 381153706 789 True 1284 1284 96.329 1414 2188 1 chrUn.!!$R1 774

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
516 521 8.807948 TTTATGAAAGAAAGATAAGGGACAGG 57.192 34.615 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1819 1842 1.970226 GCAAGGCTTCTCCCTACCCTA 60.97 57.143 0.0 0.0 33.97 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
516 521 8.807948 TTTATGAAAGAAAGATAAGGGACAGG 57.192 34.615 0.0 0.0 0.00 4.00
688 698 9.125026 CTCCTACAAATAGAACAAAGCCATATT 57.875 33.333 0.0 0.0 0.00 1.28
1050 1065 2.974165 GCATTAATTGCGACTTCCTCG 58.026 47.619 0.0 0.0 42.54 4.63
1081 1097 6.717997 AGTAATTAGTGTACCCCTTGTTTTGG 59.282 38.462 0.0 0.0 0.00 3.28
1819 1842 9.040939 CCCTTTCGTTTCATTTTTATTTTCTGT 57.959 29.630 0.0 0.0 0.00 3.41
2017 2041 1.111116 TCGAACCCGTGACCTCAAGT 61.111 55.000 0.0 0.0 37.05 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 226 7.928167 AGACATAATTAACTGCATTGATCTCGA 59.072 33.333 0.00 0.0 0.00 4.04
1050 1065 7.093156 ACAAGGGGTACACTAATTACTAAGACC 60.093 40.741 0.00 0.0 0.00 3.85
1081 1097 2.859165 TGACCAACCATCAGGAGAAC 57.141 50.000 0.00 0.0 38.69 3.01
1819 1842 1.970226 GCAAGGCTTCTCCCTACCCTA 60.970 57.143 0.00 0.0 33.97 3.53
2017 2041 2.100916 GGTAGCTCACGAGGCTCATAAA 59.899 50.000 15.95 0.0 40.74 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.