Multiple sequence alignment - TraesCS5D01G007700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G007700 chr5D 100.000 2105 0 0 1 2105 6171982 6169878 0.000000e+00 3888
1 TraesCS5D01G007700 chr5D 97.423 2134 24 6 1 2105 503296834 503298965 0.000000e+00 3607
2 TraesCS5D01G007700 chr5D 97.187 2133 29 6 1 2105 6271047 6268918 0.000000e+00 3578
3 TraesCS5D01G007700 chr5D 99.177 486 4 0 1 486 512414202 512414687 0.000000e+00 876
4 TraesCS5D01G007700 chr1D 97.421 2133 24 6 1 2105 254439968 254442097 0.000000e+00 3605
5 TraesCS5D01G007700 chr1D 96.641 1429 25 4 1 1426 51866999 51865591 0.000000e+00 2351
6 TraesCS5D01G007700 chr1D 99.177 486 4 0 1 486 491423462 491422977 0.000000e+00 876
7 TraesCS5D01G007700 chr1D 96.575 292 2 3 1814 2105 51865269 51864986 5.250000e-131 477
8 TraesCS5D01G007700 chr2D 97.375 2133 21 5 1 2105 638429364 638431489 0.000000e+00 3596
9 TraesCS5D01G007700 chr2D 98.635 293 3 1 1814 2105 363019692 363019400 3.100000e-143 518
10 TraesCS5D01G007700 chr4D 95.912 2128 47 16 1 2105 19873443 19875553 0.000000e+00 3411
11 TraesCS5D01G007700 chr4B 95.395 2128 55 18 6 2105 308674835 308672723 0.000000e+00 3347
12 TraesCS5D01G007700 chr4A 95.794 1688 44 10 443 2105 309484656 309482971 0.000000e+00 2699
13 TraesCS5D01G007700 chr3D 93.165 1858 65 20 298 2105 235644625 235646470 0.000000e+00 2671
14 TraesCS5D01G007700 chr3D 96.359 1181 19 8 805 1963 323520783 323521961 0.000000e+00 1921
15 TraesCS5D01G007700 chr3D 99.658 292 1 0 1814 2105 24149511 24149802 3.070000e-148 534
16 TraesCS5D01G007700 chr6D 96.575 292 2 3 1814 2105 437600353 437600070 5.250000e-131 477
17 TraesCS5D01G007700 chr2B 97.403 77 2 0 456 532 799662356 799662432 4.710000e-27 132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G007700 chr5D 6169878 6171982 2104 True 3888 3888 100.000 1 2105 1 chr5D.!!$R1 2104
1 TraesCS5D01G007700 chr5D 503296834 503298965 2131 False 3607 3607 97.423 1 2105 1 chr5D.!!$F1 2104
2 TraesCS5D01G007700 chr5D 6268918 6271047 2129 True 3578 3578 97.187 1 2105 1 chr5D.!!$R2 2104
3 TraesCS5D01G007700 chr1D 254439968 254442097 2129 False 3605 3605 97.421 1 2105 1 chr1D.!!$F1 2104
4 TraesCS5D01G007700 chr1D 51864986 51866999 2013 True 1414 2351 96.608 1 2105 2 chr1D.!!$R2 2104
5 TraesCS5D01G007700 chr2D 638429364 638431489 2125 False 3596 3596 97.375 1 2105 1 chr2D.!!$F1 2104
6 TraesCS5D01G007700 chr4D 19873443 19875553 2110 False 3411 3411 95.912 1 2105 1 chr4D.!!$F1 2104
7 TraesCS5D01G007700 chr4B 308672723 308674835 2112 True 3347 3347 95.395 6 2105 1 chr4B.!!$R1 2099
8 TraesCS5D01G007700 chr4A 309482971 309484656 1685 True 2699 2699 95.794 443 2105 1 chr4A.!!$R1 1662
9 TraesCS5D01G007700 chr3D 235644625 235646470 1845 False 2671 2671 93.165 298 2105 1 chr3D.!!$F2 1807
10 TraesCS5D01G007700 chr3D 323520783 323521961 1178 False 1921 1921 96.359 805 1963 1 chr3D.!!$F3 1158

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
543 556 7.169591 TCGTATTCCCTTTTTATTTCAGACCA 58.83 34.615 0.0 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1746 1792 5.47695 TCACTAGTAGTATGGGGAAGGAA 57.523 43.478 1.57 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 8.554528 AGAGTACGAAAGACGAATCGAATATTA 58.445 33.333 10.55 0.0 45.77 0.98
543 556 7.169591 TCGTATTCCCTTTTTATTTCAGACCA 58.830 34.615 0.00 0.0 0.00 4.02
1479 1520 6.691754 AAATGTGTGATATGCCGTGAATAA 57.308 33.333 0.00 0.0 0.00 1.40
1746 1792 8.679725 TCAATTAGTAGTATCCCTAGAGTCCAT 58.320 37.037 0.00 0.0 0.00 3.41
1812 1858 0.036164 TAAAGCAGCCCAAGCGAGAA 59.964 50.000 0.00 0.0 46.67 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
247 249 3.266772 TGTGGGTATTTGATCTTGCTCCT 59.733 43.478 0.00 0.00 0.00 3.69
543 556 4.846940 AGTAGAAGTGAGATGGGGAAAAGT 59.153 41.667 0.00 0.00 0.00 2.66
907 937 0.033109 ATTCAAGGGTAGGGCTTGCC 60.033 55.000 2.49 2.49 0.00 4.52
1479 1520 7.665974 AGAAAATTAGACTTTCTTCCACGGAAT 59.334 33.333 0.00 0.00 39.55 3.01
1746 1792 5.476950 TCACTAGTAGTATGGGGAAGGAA 57.523 43.478 1.57 0.00 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.