Multiple sequence alignment - TraesCS5D01G007600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G007600 chr5D 100.000 3205 0 0 1 3205 6166977 6163773 0 5919
1 TraesCS5D01G007600 chr5D 98.254 3207 50 6 1 3205 503301807 503305009 0 5607
2 TraesCS5D01G007600 chr5D 97.723 2899 61 5 310 3205 329153606 329150710 0 4983
3 TraesCS5D01G007600 chr5D 98.674 2489 31 2 4 2490 6266003 6263515 0 4412
4 TraesCS5D01G007600 chr5D 98.718 1404 16 2 1803 3205 6263167 6261765 0 2492
5 TraesCS5D01G007600 chr1D 98.379 3208 44 7 1 3205 254444975 254448177 0 5629
6 TraesCS5D01G007600 chr1D 97.660 3205 69 6 4 3205 51862095 51858894 0 5498
7 TraesCS5D01G007600 chr3B 98.911 2846 28 3 4 2846 101910208 101907363 0 5081
8 TraesCS5D01G007600 chr4D 96.926 2700 72 6 1 2698 19878431 19881121 0 4516
9 TraesCS5D01G007600 chr4D 95.600 1091 45 3 4 1093 207036938 207035850 0 1746
10 TraesCS5D01G007600 chr4D 96.098 820 29 3 1340 2159 206989846 206989030 0 1334
11 TraesCS5D01G007600 chr6B 97.179 1950 41 2 1257 3205 18748861 18746925 0 3284
12 TraesCS5D01G007600 chr4A 96.956 1774 51 3 1094 2865 309479290 309477518 0 2974
13 TraesCS5D01G007600 chrUn 98.732 1104 11 3 251 1352 439345493 439346595 0 1958
14 TraesCS5D01G007600 chr1B 94.313 1143 64 1 600 1742 427648840 427649981 0 1749
15 TraesCS5D01G007600 chr3D 97.492 638 15 1 2569 3205 147096139 147095502 0 1088


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G007600 chr5D 6163773 6166977 3204 True 5919 5919 100.000 1 3205 1 chr5D.!!$R1 3204
1 TraesCS5D01G007600 chr5D 503301807 503305009 3202 False 5607 5607 98.254 1 3205 1 chr5D.!!$F1 3204
2 TraesCS5D01G007600 chr5D 329150710 329153606 2896 True 4983 4983 97.723 310 3205 1 chr5D.!!$R2 2895
3 TraesCS5D01G007600 chr5D 6261765 6266003 4238 True 3452 4412 98.696 4 3205 2 chr5D.!!$R3 3201
4 TraesCS5D01G007600 chr1D 254444975 254448177 3202 False 5629 5629 98.379 1 3205 1 chr1D.!!$F1 3204
5 TraesCS5D01G007600 chr1D 51858894 51862095 3201 True 5498 5498 97.660 4 3205 1 chr1D.!!$R1 3201
6 TraesCS5D01G007600 chr3B 101907363 101910208 2845 True 5081 5081 98.911 4 2846 1 chr3B.!!$R1 2842
7 TraesCS5D01G007600 chr4D 19878431 19881121 2690 False 4516 4516 96.926 1 2698 1 chr4D.!!$F1 2697
8 TraesCS5D01G007600 chr4D 207035850 207036938 1088 True 1746 1746 95.600 4 1093 1 chr4D.!!$R2 1089
9 TraesCS5D01G007600 chr4D 206989030 206989846 816 True 1334 1334 96.098 1340 2159 1 chr4D.!!$R1 819
10 TraesCS5D01G007600 chr6B 18746925 18748861 1936 True 3284 3284 97.179 1257 3205 1 chr6B.!!$R1 1948
11 TraesCS5D01G007600 chr4A 309477518 309479290 1772 True 2974 2974 96.956 1094 2865 1 chr4A.!!$R1 1771
12 TraesCS5D01G007600 chrUn 439345493 439346595 1102 False 1958 1958 98.732 251 1352 1 chrUn.!!$F1 1101
13 TraesCS5D01G007600 chr1B 427648840 427649981 1141 False 1749 1749 94.313 600 1742 1 chr1B.!!$F1 1142
14 TraesCS5D01G007600 chr3D 147095502 147096139 637 True 1088 1088 97.492 2569 3205 1 chr3D.!!$R1 636

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
944 947 0.955905 TTGGGGCGAACTTGCTTTAC 59.044 50.0 0.0 0.0 34.52 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2764 3822 1.967779 GCAAAGCCTGGGGTAGAAAAA 59.032 47.619 0.0 0.0 0.0 1.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
545 546 7.103641 TGGGAACAGATTCATGTTAGAAGTAC 58.896 38.462 0.00 0.00 43.32 2.73
944 947 0.955905 TTGGGGCGAACTTGCTTTAC 59.044 50.000 0.00 0.00 34.52 2.01
1173 1176 7.781324 ATTTGGACAGAAATGGAGTTGTTAT 57.219 32.000 0.00 0.00 0.00 1.89
1234 1237 5.054477 GGTAAATTAACGCCTCAGATAGCA 58.946 41.667 0.00 0.00 0.00 3.49
1373 1376 3.947196 CGATGTGAAATGGATCCAAAGGA 59.053 43.478 20.67 0.17 35.55 3.36
1378 1381 3.077391 TGAAATGGATCCAAAGGAACCCT 59.923 43.478 20.67 0.00 43.01 4.34
1474 1477 6.442961 ACATGGGAATAAAGGGATCATTTCA 58.557 36.000 0.00 0.00 0.00 2.69
1703 1706 7.471721 TGTGTTTTCAGAATTATATGAAGCCG 58.528 34.615 0.00 0.00 37.99 5.52
1965 1981 4.447138 TGGAAGTTTGGGCTTTAGAAGA 57.553 40.909 0.00 0.00 0.00 2.87
2373 2392 7.340999 GGCCCTCTACTTTTCATTATAAAACCA 59.659 37.037 0.00 0.00 0.00 3.67
2567 3621 2.183478 ACATCAAACTCGCATGTCCA 57.817 45.000 0.00 0.00 0.00 4.02
2764 3822 2.683211 ACCACAGCATTTCTCCCTTT 57.317 45.000 0.00 0.00 0.00 3.11
3101 4161 7.309867 GGTCTGGAGATAAAGTAGTGACTTCAA 60.310 40.741 0.00 0.00 45.50 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
385 386 9.442062 TCTATTTGGTGATAGATAAACCACCTA 57.558 33.333 11.10 1.75 46.77 3.08
1051 1054 7.929245 TCCGTCTGAATTTCATATTTTCGGATA 59.071 33.333 15.50 3.93 37.18 2.59
1057 1060 8.548721 GTCGTATCCGTCTGAATTTCATATTTT 58.451 33.333 0.00 0.00 35.01 1.82
1173 1176 2.307686 GTTTCTACCCAGGATCCCAACA 59.692 50.000 8.55 0.00 0.00 3.33
1373 1376 3.430374 CGAACCATTATGTCGAGAGGGTT 60.430 47.826 9.48 9.48 39.67 4.11
1378 1381 3.861276 ACACGAACCATTATGTCGAGA 57.139 42.857 11.27 0.00 0.00 4.04
1965 1981 9.206870 CTTGTAAAATATGAGCAACACCAAATT 57.793 29.630 0.00 0.00 0.00 1.82
2567 3621 5.227569 TCAAATACCACACATGAGTCACT 57.772 39.130 0.00 0.00 0.00 3.41
2764 3822 1.967779 GCAAAGCCTGGGGTAGAAAAA 59.032 47.619 0.00 0.00 0.00 1.94
2885 3943 4.442192 CCCCTCGTCTTCTAATTCCTTCAG 60.442 50.000 0.00 0.00 0.00 3.02
2886 3944 3.451178 CCCCTCGTCTTCTAATTCCTTCA 59.549 47.826 0.00 0.00 0.00 3.02
2957 4015 5.005012 CCAATTGCATGCGTCTAATCAAAAG 59.995 40.000 14.09 0.00 0.00 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.