Multiple sequence alignment - TraesCS5B01G573400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G573400 chr5B 100.000 2558 0 0 1 2558 713119731 713117174 0.000000e+00 4724
1 TraesCS5B01G573400 chr5B 98.554 2558 37 0 1 2558 713088995 713091552 0.000000e+00 4519
2 TraesCS5B01G573400 chr5B 98.241 2558 44 1 1 2558 127825764 127823208 0.000000e+00 4473
3 TraesCS5B01G573400 chrUn 98.711 2560 31 1 1 2558 246703762 246701203 0.000000e+00 4543
4 TraesCS5B01G573400 chr6B 98.710 2559 32 1 1 2558 128896749 128894191 0.000000e+00 4542
5 TraesCS5B01G573400 chr6B 97.518 1410 34 1 1 1410 388136737 388138145 0.000000e+00 2409
6 TraesCS5B01G573400 chr6B 98.011 704 14 0 1071 1774 681546369 681547072 0.000000e+00 1223
7 TraesCS5B01G573400 chr6B 95.878 655 27 0 1582 2236 215771860 215771206 0.000000e+00 1061
8 TraesCS5B01G573400 chr7B 98.593 2559 35 1 1 2558 698133377 698130819 0.000000e+00 4525
9 TraesCS5B01G573400 chr7B 98.476 2559 38 1 1 2558 742930719 742933277 0.000000e+00 4508
10 TraesCS5B01G573400 chr2B 97.812 2559 55 1 1 2558 760900739 760898181 0.000000e+00 4414
11 TraesCS5B01G573400 chr1B 97.773 2559 50 4 1 2558 339026805 339029357 0.000000e+00 4403
12 TraesCS5B01G573400 chr3B 85.668 307 30 4 2053 2358 42678493 42678786 6.870000e-81 311


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G573400 chr5B 713117174 713119731 2557 True 4724 4724 100.000 1 2558 1 chr5B.!!$R2 2557
1 TraesCS5B01G573400 chr5B 713088995 713091552 2557 False 4519 4519 98.554 1 2558 1 chr5B.!!$F1 2557
2 TraesCS5B01G573400 chr5B 127823208 127825764 2556 True 4473 4473 98.241 1 2558 1 chr5B.!!$R1 2557
3 TraesCS5B01G573400 chrUn 246701203 246703762 2559 True 4543 4543 98.711 1 2558 1 chrUn.!!$R1 2557
4 TraesCS5B01G573400 chr6B 128894191 128896749 2558 True 4542 4542 98.710 1 2558 1 chr6B.!!$R1 2557
5 TraesCS5B01G573400 chr6B 388136737 388138145 1408 False 2409 2409 97.518 1 1410 1 chr6B.!!$F1 1409
6 TraesCS5B01G573400 chr6B 681546369 681547072 703 False 1223 1223 98.011 1071 1774 1 chr6B.!!$F2 703
7 TraesCS5B01G573400 chr6B 215771206 215771860 654 True 1061 1061 95.878 1582 2236 1 chr6B.!!$R2 654
8 TraesCS5B01G573400 chr7B 698130819 698133377 2558 True 4525 4525 98.593 1 2558 1 chr7B.!!$R1 2557
9 TraesCS5B01G573400 chr7B 742930719 742933277 2558 False 4508 4508 98.476 1 2558 1 chr7B.!!$F1 2557
10 TraesCS5B01G573400 chr2B 760898181 760900739 2558 True 4414 4414 97.812 1 2558 1 chr2B.!!$R1 2557
11 TraesCS5B01G573400 chr1B 339026805 339029357 2552 False 4403 4403 97.773 1 2558 1 chr1B.!!$F1 2557

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
411 414 3.003394 TGATCCACTTCATTCGCCAAT 57.997 42.857 0.0 0.0 0.0 3.16 F
849 852 5.936686 TGCTCAAGACATCTCTTTTCAAG 57.063 39.130 0.0 0.0 34.2 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1275 1278 0.457337 GTTCGATTGTAGCCCGACGT 60.457 55.0 0.00 0.00 31.6 4.34 R
1751 1756 1.756408 TTGTCACTTTACCGGGCCGA 61.756 55.0 30.79 5.01 0.0 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
411 414 3.003394 TGATCCACTTCATTCGCCAAT 57.997 42.857 0.00 0.0 0.00 3.16
849 852 5.936686 TGCTCAAGACATCTCTTTTCAAG 57.063 39.130 0.00 0.0 34.20 3.02
1275 1278 2.391616 ATCGAGTCATTGAAGCAGCA 57.608 45.000 0.00 0.0 0.00 4.41
1292 1295 1.138036 CACGTCGGGCTACAATCGA 59.862 57.895 0.00 0.0 0.00 3.59
1373 1376 6.719370 AGAGTTCTCGCAGATCTTCCTATTAT 59.281 38.462 0.00 0.0 33.89 1.28
1662 1667 2.774809 GACAAAGAGGGATAGGGAGCTT 59.225 50.000 0.00 0.0 0.00 3.74
1868 1873 6.045955 AGTATGGTTGCGTTGTTTCAATTTT 58.954 32.000 0.00 0.0 0.00 1.82
2226 2231 8.345724 AGATGATCAGAAGTACATTGCTTTTT 57.654 30.769 0.09 0.0 0.00 1.94
2365 2370 3.055530 ACTCAGGATTTGATCTCACGCTT 60.056 43.478 0.00 0.0 34.68 4.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
223 224 0.406750 TGAGAACTAGGACGGGGTCA 59.593 55.000 0.00 0.00 33.68 4.02
770 773 9.901172 ATCTTTACCGACTCAATTAAGGTATTT 57.099 29.630 0.00 0.00 37.31 1.40
849 852 6.521151 AAATGAGATTGGATTGTTCCTCAC 57.479 37.500 0.00 0.00 43.07 3.51
1050 1053 3.557595 CCGTTACGAGTAGATACTTCCGT 59.442 47.826 6.24 10.41 39.23 4.69
1275 1278 0.457337 GTTCGATTGTAGCCCGACGT 60.457 55.000 0.00 0.00 31.60 4.34
1292 1295 3.313526 GCTCATAGCACGATGGAATTGTT 59.686 43.478 0.00 0.00 37.83 2.83
1751 1756 1.756408 TTGTCACTTTACCGGGCCGA 61.756 55.000 30.79 5.01 0.00 5.54
1789 1794 3.673338 CGACAACATCACGCTTCTCTTTA 59.327 43.478 0.00 0.00 0.00 1.85
1848 1853 4.452455 ACAAAAATTGAAACAACGCAACCA 59.548 33.333 0.00 0.00 0.00 3.67
1868 1873 2.159014 ACAGCAACCAGAGTACGAACAA 60.159 45.455 0.00 0.00 0.00 2.83
2365 2370 4.397103 CAGTGTGTGTATCGGTAAGACCTA 59.603 45.833 0.00 0.00 35.66 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.