Multiple sequence alignment - TraesCS5B01G573300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G573300 chr5B 100.000 3161 0 0 1 3161 713115168 713112008 0 5838
1 TraesCS5B01G573300 chr5B 98.608 3161 43 1 1 3160 713093559 713096719 0 5592
2 TraesCS5B01G573300 chr5B 98.548 2272 24 4 1 2270 127821201 127818937 0 4004
3 TraesCS5B01G573300 chr6B 98.893 3163 28 3 1 3161 128892185 128889028 0 5640
4 TraesCS5B01G573300 chr7B 98.831 3164 34 3 1 3161 716798046 716794883 0 5635
5 TraesCS5B01G573300 chr7B 98.419 3162 39 3 1 3161 742935284 742938435 0 5552
6 TraesCS5B01G573300 chr7B 96.667 3180 86 8 1 3161 47217230 47220408 0 5267
7 TraesCS5B01G573300 chr7B 96.155 3173 90 7 1 3161 139621810 139618658 0 5155
8 TraesCS5B01G573300 chr1B 98.482 3163 45 3 1 3161 583548103 583551264 0 5572
9 TraesCS5B01G573300 chr1B 96.950 3180 73 8 1 3161 49815628 49818802 0 5313
10 TraesCS5B01G573300 chr1B 97.004 3171 75 7 1 3160 49787127 49783966 0 5312
11 TraesCS5B01G573300 chr7A 98.535 2253 27 5 913 3161 60097493 60095243 0 3973


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G573300 chr5B 713112008 713115168 3160 True 5838 5838 100.000 1 3161 1 chr5B.!!$R2 3160
1 TraesCS5B01G573300 chr5B 713093559 713096719 3160 False 5592 5592 98.608 1 3160 1 chr5B.!!$F1 3159
2 TraesCS5B01G573300 chr5B 127818937 127821201 2264 True 4004 4004 98.548 1 2270 1 chr5B.!!$R1 2269
3 TraesCS5B01G573300 chr6B 128889028 128892185 3157 True 5640 5640 98.893 1 3161 1 chr6B.!!$R1 3160
4 TraesCS5B01G573300 chr7B 716794883 716798046 3163 True 5635 5635 98.831 1 3161 1 chr7B.!!$R2 3160
5 TraesCS5B01G573300 chr7B 742935284 742938435 3151 False 5552 5552 98.419 1 3161 1 chr7B.!!$F2 3160
6 TraesCS5B01G573300 chr7B 47217230 47220408 3178 False 5267 5267 96.667 1 3161 1 chr7B.!!$F1 3160
7 TraesCS5B01G573300 chr7B 139618658 139621810 3152 True 5155 5155 96.155 1 3161 1 chr7B.!!$R1 3160
8 TraesCS5B01G573300 chr1B 583548103 583551264 3161 False 5572 5572 98.482 1 3161 1 chr1B.!!$F2 3160
9 TraesCS5B01G573300 chr1B 49815628 49818802 3174 False 5313 5313 96.950 1 3161 1 chr1B.!!$F1 3160
10 TraesCS5B01G573300 chr1B 49783966 49787127 3161 True 5312 5312 97.004 1 3160 1 chr1B.!!$R1 3159
11 TraesCS5B01G573300 chr7A 60095243 60097493 2250 True 3973 3973 98.535 913 3161 1 chr7A.!!$R1 2248

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
858 865 1.155889 CAAACGCTCCAGTGTATGCA 58.844 50.0 0.0 0.0 37.87 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2214 2240 1.700739 AGTACCCGGAACCATGTTCAA 59.299 47.619 0.73 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
858 865 1.155889 CAAACGCTCCAGTGTATGCA 58.844 50.000 0.00 0.00 37.87 3.96
1064 1077 4.514545 TTGCTGCTATTACAACGAATCG 57.485 40.909 0.00 0.00 0.00 3.34
1811 1837 5.299148 TCAAAGACATGGGCTTCATTTTTG 58.701 37.500 0.00 11.27 34.18 2.44
2420 2448 1.261619 GCCATTCAGCTTCGTTATCGG 59.738 52.381 0.00 0.00 37.69 4.18
2735 2763 3.479505 AAGCGCATACGTTTTATTGCA 57.520 38.095 11.47 0.00 39.95 4.08
2788 2816 9.734620 CTGTTCATTAGTTCACTTGATTTTTCA 57.265 29.630 0.00 0.00 0.00 2.69
2934 2963 2.047844 GCGACAGCTTCTGCCTCA 60.048 61.111 0.00 0.00 40.80 3.86
2938 2967 0.319728 GACAGCTTCTGCCTCAGACA 59.680 55.000 0.00 0.00 40.46 3.41
3094 3128 2.597217 CCTTCCTTGCCGCCAACA 60.597 61.111 0.00 0.00 0.00 3.33
3098 3132 3.215568 CCTTGCCGCCAACACACA 61.216 61.111 0.00 0.00 0.00 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 236 2.797156 CGCTCCTAAAGTCGATTGGATG 59.203 50.000 0.00 0.0 0.00 3.51
858 865 6.015519 TGACAAAATGCTAGTTGCCTTGTAAT 60.016 34.615 8.13 0.0 42.00 1.89
1064 1077 4.628766 GGGAACACTTACTACGAATTGGTC 59.371 45.833 0.00 0.0 0.00 4.02
1552 1576 7.054124 TCATAAATAAGCTCGACCAAGGATTT 58.946 34.615 0.00 0.0 0.00 2.17
2214 2240 1.700739 AGTACCCGGAACCATGTTCAA 59.299 47.619 0.73 0.0 0.00 2.69
2420 2448 5.353394 TGATGTTCCCACTGATACCTAAC 57.647 43.478 0.00 0.0 0.00 2.34
2730 2758 3.149196 CAGACAAGTACCAAGGTGCAAT 58.851 45.455 9.97 0.0 33.14 3.56
2735 2763 4.974645 TTGATCAGACAAGTACCAAGGT 57.025 40.909 0.00 0.0 0.00 3.50
2788 2816 2.386661 AGCGGTTCAAGACATCGAAT 57.613 45.000 0.00 0.0 0.00 3.34
2934 2963 2.095461 TGAGCGATAGTGAAGCTGTCT 58.905 47.619 0.00 0.0 41.84 3.41
2938 2967 2.692557 AGTCATGAGCGATAGTGAAGCT 59.307 45.455 0.00 0.0 44.80 3.74
3094 3128 4.344978 TGCTTACTCTCCATCTAGTGTGT 58.655 43.478 0.00 0.0 0.00 3.72
3098 3132 4.285863 AGCTTGCTTACTCTCCATCTAGT 58.714 43.478 0.00 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.