Multiple sequence alignment - TraesCS5B01G573200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G573200 chr5B 100.000 2276 0 0 1 2276 713096031 713098306 0 4204
1 TraesCS5B01G573200 chr5B 98.027 2281 40 1 1 2276 713112697 713110417 0 3958
2 TraesCS5B01G573200 chr7A 98.422 2281 31 1 1 2276 60095932 60093652 0 4008
3 TraesCS5B01G573200 chrUn 98.334 2281 33 1 1 2276 233525002 233522722 0 3997
4 TraesCS5B01G573200 chrUn 98.163 2286 32 2 1 2276 257944378 257946663 0 3980
5 TraesCS5B01G573200 chr7B 98.334 2281 32 2 1 2276 698126667 698124388 0 3997
6 TraesCS5B01G573200 chr7B 97.940 2281 38 3 1 2276 742937748 742940024 0 3943
7 TraesCS5B01G573200 chr7B 97.896 2281 43 1 1 2276 716795572 716793292 0 3941
8 TraesCS5B01G573200 chr6B 97.983 2281 41 1 1 2276 128889717 128887437 0 3952
9 TraesCS5B01G573200 chr1D 97.944 2286 37 2 1 2276 212429135 212431420 0 3952


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G573200 chr5B 713096031 713098306 2275 False 4204 4204 100.000 1 2276 1 chr5B.!!$F1 2275
1 TraesCS5B01G573200 chr5B 713110417 713112697 2280 True 3958 3958 98.027 1 2276 1 chr5B.!!$R1 2275
2 TraesCS5B01G573200 chr7A 60093652 60095932 2280 True 4008 4008 98.422 1 2276 1 chr7A.!!$R1 2275
3 TraesCS5B01G573200 chrUn 233522722 233525002 2280 True 3997 3997 98.334 1 2276 1 chrUn.!!$R1 2275
4 TraesCS5B01G573200 chrUn 257944378 257946663 2285 False 3980 3980 98.163 1 2276 1 chrUn.!!$F1 2275
5 TraesCS5B01G573200 chr7B 698124388 698126667 2279 True 3997 3997 98.334 1 2276 1 chr7B.!!$R1 2275
6 TraesCS5B01G573200 chr7B 742937748 742940024 2276 False 3943 3943 97.940 1 2276 1 chr7B.!!$F1 2275
7 TraesCS5B01G573200 chr7B 716793292 716795572 2280 True 3941 3941 97.896 1 2276 1 chr7B.!!$R2 2275
8 TraesCS5B01G573200 chr6B 128887437 128889717 2280 True 3952 3952 97.983 1 2276 1 chr6B.!!$R1 2275
9 TraesCS5B01G573200 chr1D 212429135 212431420 2285 False 3952 3952 97.944 1 2276 1 chr1D.!!$F1 2275

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
80 81 1.269723 AGAACGAGCAGACATCGAACA 59.73 47.619 1.94 0.0 42.76 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1646 1652 1.214305 TACATGAAGGCCTTGGCCCT 61.214 55.0 26.25 14.51 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 1.269723 AGAACGAGCAGACATCGAACA 59.730 47.619 1.94 0.0 42.76 3.18
321 322 8.836413 TCATTAGTTCACTTGATTTTTCGTTCT 58.164 29.630 0.00 0.0 0.00 3.01
939 945 4.348168 GGTCAGGAGGGAAAAGATATGCTA 59.652 45.833 0.00 0.0 0.00 3.49
1007 1013 2.279784 CGAGGAAGAGATGCGGGC 60.280 66.667 0.00 0.0 0.00 6.13
1047 1053 1.844497 GTTGGGTTGGGGTATAGAGCT 59.156 52.381 0.00 0.0 0.00 4.09
1322 1328 3.076104 CGCAGCATGAGGAATGTCT 57.924 52.632 0.00 0.0 39.69 3.41
1440 1446 4.919653 GAGGCGACTGCAATGAGA 57.080 55.556 0.00 0.0 44.43 3.27
1619 1625 0.970640 TAACAGACTAAGCCGTGCCA 59.029 50.000 0.00 0.0 0.00 4.92
1646 1652 1.003839 GCATTCTCCACACGGGACA 60.004 57.895 0.00 0.0 42.15 4.02
1722 1728 2.675658 ACACCAGGGCAACTAATGTT 57.324 45.000 0.00 0.0 36.75 2.71
1914 1920 5.879223 CCTATTCTCATAATAGGCAGCAAGG 59.121 44.000 10.10 0.0 41.79 3.61
1980 1986 5.918576 CGTTAGAAATCAAAAAGGGTGGAAC 59.081 40.000 0.00 0.0 0.00 3.62
2138 2149 7.763356 TCGAGATTTAGAATCTCTTTTCGACT 58.237 34.615 21.66 0.0 41.68 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 6.880529 TGAACAACATGATCTTGAGCTATCAA 59.119 34.615 15.03 0.00 43.20 2.57
321 322 6.755141 GTGATTAGTAAGCGGTTCAAGACATA 59.245 38.462 1.59 0.00 0.00 2.29
689 695 1.719063 TTGAAGCAGGCAGGAAGGGT 61.719 55.000 0.00 0.00 0.00 4.34
939 945 3.199946 TCCGCTTGGGACTGATAGAAAAT 59.800 43.478 0.00 0.00 40.94 1.82
1646 1652 1.214305 TACATGAAGGCCTTGGCCCT 61.214 55.000 26.25 14.51 0.00 5.19
1765 1771 2.607750 AGCCCTTTCCTCTGCCGA 60.608 61.111 0.00 0.00 0.00 5.54
1914 1920 3.637229 GCCCCCTTTCCTATTTAGCTTTC 59.363 47.826 0.00 0.00 0.00 2.62
1980 1986 3.068307 ACTTGTAGCCTATTAGCTCCACG 59.932 47.826 0.00 0.00 43.67 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.