Multiple sequence alignment - TraesCS5B01G573100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G573100 chr5B 100.000 2558 0 0 1 2558 713088995 713091552 0 4724
1 TraesCS5B01G573100 chr5B 98.554 2558 37 0 1 2558 713119731 713117174 0 4519
2 TraesCS5B01G573100 chr5B 98.436 2558 39 1 1 2558 127825764 127823208 0 4501
3 TraesCS5B01G573100 chrUn 98.906 2560 26 1 1 2558 246703762 246701203 0 4571
4 TraesCS5B01G573100 chr6B 98.906 2559 27 1 1 2558 128896749 128894191 0 4569
5 TraesCS5B01G573100 chr7B 98.867 2559 28 1 1 2558 698133377 698130819 0 4564
6 TraesCS5B01G573100 chr7B 98.671 2559 33 1 1 2558 742930719 742933277 0 4536
7 TraesCS5B01G573100 chr1B 98.007 2559 44 4 1 2558 339026805 339029357 0 4436
8 TraesCS5B01G573100 chr2B 97.929 2559 52 1 1 2558 760900739 760898181 0 4431
9 TraesCS5B01G573100 chr2B 97.958 1420 26 1 1 1420 526494001 526492585 0 2459
10 TraesCS5B01G573100 chr2B 97.662 1155 26 1 1405 2558 391176538 391175384 0 1982


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G573100 chr5B 713088995 713091552 2557 False 4724 4724 100.000 1 2558 1 chr5B.!!$F1 2557
1 TraesCS5B01G573100 chr5B 713117174 713119731 2557 True 4519 4519 98.554 1 2558 1 chr5B.!!$R2 2557
2 TraesCS5B01G573100 chr5B 127823208 127825764 2556 True 4501 4501 98.436 1 2558 1 chr5B.!!$R1 2557
3 TraesCS5B01G573100 chrUn 246701203 246703762 2559 True 4571 4571 98.906 1 2558 1 chrUn.!!$R1 2557
4 TraesCS5B01G573100 chr6B 128894191 128896749 2558 True 4569 4569 98.906 1 2558 1 chr6B.!!$R1 2557
5 TraesCS5B01G573100 chr7B 698130819 698133377 2558 True 4564 4564 98.867 1 2558 1 chr7B.!!$R1 2557
6 TraesCS5B01G573100 chr7B 742930719 742933277 2558 False 4536 4536 98.671 1 2558 1 chr7B.!!$F1 2557
7 TraesCS5B01G573100 chr1B 339026805 339029357 2552 False 4436 4436 98.007 1 2558 1 chr1B.!!$F1 2557
8 TraesCS5B01G573100 chr2B 760898181 760900739 2558 True 4431 4431 97.929 1 2558 1 chr2B.!!$R3 2557
9 TraesCS5B01G573100 chr2B 526492585 526494001 1416 True 2459 2459 97.958 1 1420 1 chr2B.!!$R2 1419
10 TraesCS5B01G573100 chr2B 391175384 391176538 1154 True 1982 1982 97.662 1405 2558 1 chr2B.!!$R1 1153

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
375 379 1.06706 GCGAGAAAAAGTGTTTGGCCT 59.933 47.619 3.32 0.0 0.00 5.19 F
989 993 3.79942 GTGCGGAAATAGCTAGAACTGAG 59.201 47.826 0.00 0.0 35.28 3.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1424 1428 1.271325 TGGACACACGAGCAATCCAAT 60.271 47.619 0.00 0.0 36.51 3.16 R
2390 2397 1.626356 GGAGCTCCATGGGTGTAGCA 61.626 60.000 28.43 0.0 37.44 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 1.594833 TCAAGCGGCCTCAATACGT 59.405 52.632 0.00 0.00 0.00 3.57
303 305 2.073101 GGGGAGCGAAGGGAGGAAT 61.073 63.158 0.00 0.00 0.00 3.01
375 379 1.067060 GCGAGAAAAAGTGTTTGGCCT 59.933 47.619 3.32 0.00 0.00 5.19
878 882 6.127897 GGAACAATCCAATCTCATTTCGTTCT 60.128 38.462 0.00 0.00 45.79 3.01
989 993 3.799420 GTGCGGAAATAGCTAGAACTGAG 59.201 47.826 0.00 0.00 35.28 3.35
1424 1428 1.626825 AGGAAAAGGAAATCCGACGGA 59.373 47.619 20.85 20.85 40.78 4.69
1738 1744 2.036475 GCATACGACCCTGAGACATGAT 59.964 50.000 0.00 0.00 0.00 2.45
2390 2397 2.823747 TCTTACCGATACACACACTGCT 59.176 45.455 0.00 0.00 0.00 4.24
2496 2503 0.955919 GCAGCCTTGTGTACCTCACC 60.956 60.000 0.00 0.00 45.61 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.520317 AGGTATGTCATTTACAACCCCGA 59.480 43.478 0.00 0.00 42.70 5.14
127 128 6.070136 GGAGGGTCCTTTTTAGTAGATGACTT 60.070 42.308 0.00 0.00 34.94 3.01
266 268 1.762957 CCCCATCGTAGATGGTTCAGT 59.237 52.381 22.88 0.00 45.12 3.41
303 305 7.354025 CGAGAGCGTATTCTCTTATCTAAGA 57.646 40.000 10.51 0.09 43.05 2.10
375 379 3.157087 GGATCAACCTCTTTTTGGCTCA 58.843 45.455 0.00 0.00 35.41 4.26
989 993 4.231718 TGTTTTTCCATACTTTCCGCAC 57.768 40.909 0.00 0.00 0.00 5.34
1424 1428 1.271325 TGGACACACGAGCAATCCAAT 60.271 47.619 0.00 0.00 36.51 3.16
1738 1744 1.527380 GGCCGGAAAAGTGACACCA 60.527 57.895 5.05 0.00 0.00 4.17
2325 2332 4.137543 TGAGTATAGCGATGCTGAGAGAA 58.862 43.478 1.46 0.00 40.10 2.87
2390 2397 1.626356 GGAGCTCCATGGGTGTAGCA 61.626 60.000 28.43 0.00 37.44 3.49
2496 2503 3.605749 AATGTCAGGCCGGGTCACG 62.606 63.158 2.18 0.00 43.80 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.