Multiple sequence alignment - TraesCS5B01G573000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G573000 chr5B 100.000 2300 0 0 1 2300 713077688 713079987 0.000000e+00 4248.0
1 TraesCS5B01G573000 chr5B 98.349 2302 36 2 1 2300 713131027 713128726 0.000000e+00 4039.0
2 TraesCS5B01G573000 chr1B 99.174 2301 17 2 1 2300 683729611 683731910 0.000000e+00 4143.0
3 TraesCS5B01G573000 chr7B 98.827 2301 25 2 1 2300 698144692 698142393 0.000000e+00 4098.0
4 TraesCS5B01G573000 chr7B 95.182 2304 104 5 1 2300 47200212 47202512 0.000000e+00 3633.0
5 TraesCS5B01G573000 chr7B 96.863 255 5 2 2047 2300 424077297 424077549 7.600000e-115 424.0
6 TraesCS5B01G573000 chr7B 98.286 175 3 0 903 1077 28383359 28383185 7.980000e-80 307.0
7 TraesCS5B01G573000 chr7B 83.056 301 47 2 605 905 737111121 737111417 1.050000e-68 270.0
8 TraesCS5B01G573000 chr7B 92.513 187 11 2 1335 1521 116794594 116794411 4.870000e-67 265.0
9 TraesCS5B01G573000 chr7B 95.098 102 5 0 1035 1136 467523665 467523766 6.580000e-36 161.0
10 TraesCS5B01G573000 chr7B 96.154 52 2 0 1984 2035 716840317 716840368 4.070000e-13 86.1
11 TraesCS5B01G573000 chr7B 93.478 46 3 0 4 49 745221769 745221724 4.100000e-08 69.4
12 TraesCS5B01G573000 chr6B 98.783 2301 26 2 1 2300 128916647 128914348 0.000000e+00 4093.0
13 TraesCS5B01G573000 chr6B 97.306 2301 58 4 1 2300 388125421 388127718 0.000000e+00 3903.0
14 TraesCS5B01G573000 chr6B 95.567 2301 99 3 1 2300 625653463 625651165 0.000000e+00 3681.0
15 TraesCS5B01G573000 chr2A 98.740 2301 27 2 1 2300 563261172 563258873 0.000000e+00 4087.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G573000 chr5B 713077688 713079987 2299 False 4248 4248 100.000 1 2300 1 chr5B.!!$F1 2299
1 TraesCS5B01G573000 chr5B 713128726 713131027 2301 True 4039 4039 98.349 1 2300 1 chr5B.!!$R1 2299
2 TraesCS5B01G573000 chr1B 683729611 683731910 2299 False 4143 4143 99.174 1 2300 1 chr1B.!!$F1 2299
3 TraesCS5B01G573000 chr7B 698142393 698144692 2299 True 4098 4098 98.827 1 2300 1 chr7B.!!$R3 2299
4 TraesCS5B01G573000 chr7B 47200212 47202512 2300 False 3633 3633 95.182 1 2300 1 chr7B.!!$F1 2299
5 TraesCS5B01G573000 chr6B 128914348 128916647 2299 True 4093 4093 98.783 1 2300 1 chr6B.!!$R1 2299
6 TraesCS5B01G573000 chr6B 388125421 388127718 2297 False 3903 3903 97.306 1 2300 1 chr6B.!!$F1 2299
7 TraesCS5B01G573000 chr6B 625651165 625653463 2298 True 3681 3681 95.567 1 2300 1 chr6B.!!$R2 2299
8 TraesCS5B01G573000 chr2A 563258873 563261172 2299 True 4087 4087 98.740 1 2300 1 chr2A.!!$R1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
625 626 2.015587 CTCATCTTGCCTTTCCAGAGC 58.984 52.381 0.0 0.0 0.0 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2113 2117 1.215382 CGAGCCGATTGGTCAGACA 59.785 57.895 2.17 0.0 41.69 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 2.094762 ACGTGCCTTAAGATGTCCAC 57.905 50.000 3.36 2.66 0.00 4.02
488 489 3.066342 TCTTATCACTAGAAACTCCCGCG 59.934 47.826 0.00 0.00 0.00 6.46
507 508 4.913924 CCGCGTTAAGATATTAGCTAACGT 59.086 41.667 8.70 0.00 41.28 3.99
625 626 2.015587 CTCATCTTGCCTTTCCAGAGC 58.984 52.381 0.00 0.00 0.00 4.09
814 815 8.108999 TCTCCTGACCTCATTAATCAATTGAAA 58.891 33.333 13.09 3.45 0.00 2.69
853 854 2.178912 AATCTCCGGCGAAAAGTGAA 57.821 45.000 9.30 0.00 0.00 3.18
925 926 6.627087 AGTGGTCATCATTTCTTCCTCTTA 57.373 37.500 0.00 0.00 0.00 2.10
1733 1736 1.916777 GAGTTCGGGACCCAAGGGA 60.917 63.158 13.15 0.00 38.96 4.20
2003 2006 1.539388 CCCAGCAAGAAAACGTATGCA 59.461 47.619 11.14 0.00 41.18 3.96
2113 2117 7.717568 AGAATCTAATATGTGCAGTAGTCGTT 58.282 34.615 0.00 0.00 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 6.615264 ATCATCTTGATCGTCCTCAAATTG 57.385 37.500 0.00 0.0 34.86 2.32
49 50 8.039538 ACACGCTATGATTCATATCATCTTGAT 58.960 33.333 6.82 0.0 46.19 2.57
625 626 3.624326 TGACTTTGCAGGAACATTTCG 57.376 42.857 0.00 0.0 0.00 3.46
757 758 6.662865 ATTCGAATGATATGTGGAGAGAGT 57.337 37.500 10.50 0.0 0.00 3.24
814 815 8.314021 GGAGATTTCATGGTAGTTTTTGGAAAT 58.686 33.333 0.00 0.0 36.51 2.17
853 854 8.762645 TCATTGGATCTAGAAGTAATCACAACT 58.237 33.333 0.00 0.0 0.00 3.16
925 926 3.487372 GGAAGAAACCAGCCAACTTACT 58.513 45.455 0.00 0.0 0.00 2.24
1243 1244 2.331194 GAGGCTCGCGTAGTTTGTTAA 58.669 47.619 5.77 0.0 0.00 2.01
1733 1736 9.436957 AATAAGATACAGTTCACTCAACGATTT 57.563 29.630 0.00 0.0 40.32 2.17
2003 2006 1.946768 TGAGCGCTTTGTTGCTAAAGT 59.053 42.857 13.26 0.0 42.60 2.66
2113 2117 1.215382 CGAGCCGATTGGTCAGACA 59.785 57.895 2.17 0.0 41.69 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.