Multiple sequence alignment - TraesCS5B01G572600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G572600 chr5B 100.000 4872 0 0 1 4872 712964220 712969091 0.000000e+00 8997.0
1 TraesCS5B01G572600 chr5B 100.000 4332 0 0 5186 9517 712969405 712973736 0.000000e+00 8000.0
2 TraesCS5B01G572600 chr5B 84.116 1788 190 60 5250 6990 621844711 621842971 0.000000e+00 1642.0
3 TraesCS5B01G572600 chr5B 87.044 1397 143 21 3483 4852 621846158 621844773 0.000000e+00 1543.0
4 TraesCS5B01G572600 chr5B 83.203 637 86 11 7896 8518 621841881 621841252 1.790000e-156 564.0
5 TraesCS5B01G572600 chr5B 82.830 530 64 18 2815 3341 621846732 621846227 5.240000e-122 449.0
6 TraesCS5B01G572600 chr5B 84.305 446 55 9 1103 1533 621849659 621849214 1.140000e-113 422.0
7 TraesCS5B01G572600 chr5B 86.089 381 41 5 7206 7582 621842607 621842235 5.350000e-107 399.0
8 TraesCS5B01G572600 chr5B 86.243 378 41 6 9108 9478 701836051 701836424 5.350000e-107 399.0
9 TraesCS5B01G572600 chr5B 92.386 197 15 0 7621 7817 621842230 621842034 2.020000e-71 281.0
10 TraesCS5B01G572600 chr5B 96.914 162 5 0 7005 7166 621842859 621842698 1.220000e-68 272.0
11 TraesCS5B01G572600 chr5B 90.426 94 9 0 2568 2661 621846906 621846813 3.610000e-24 124.0
12 TraesCS5B01G572600 chr5B 87.755 49 6 0 1736 1784 462751224 462751272 3.710000e-04 58.4
13 TraesCS5B01G572600 chr7B 91.432 1459 70 35 7216 8657 44896 43476 0.000000e+00 1951.0
14 TraesCS5B01G572600 chr7B 84.684 2011 161 88 5286 7198 46931 44970 0.000000e+00 1871.0
15 TraesCS5B01G572600 chr7B 96.817 911 29 0 3483 4393 48481 47571 0.000000e+00 1522.0
16 TraesCS5B01G572600 chr7B 84.095 1006 117 25 5744 6726 103893916 103892931 0.000000e+00 931.0
17 TraesCS5B01G572600 chr7B 85.940 761 50 23 807 1533 51093 50356 0.000000e+00 760.0
18 TraesCS5B01G572600 chr7B 89.047 493 40 9 2815 3306 49063 48584 4.920000e-167 599.0
19 TraesCS5B01G572600 chr7B 87.302 378 35 5 9108 9478 680529626 680529255 4.110000e-113 420.0
20 TraesCS5B01G572600 chr7B 86.224 392 22 20 4464 4850 47359 46995 6.930000e-106 396.0
21 TraesCS5B01G572600 chr7B 81.238 501 44 26 2196 2690 49595 49139 9.090000e-95 359.0
22 TraesCS5B01G572600 chr7B 89.286 196 19 2 7629 7823 103891753 103891559 2.650000e-60 244.0
23 TraesCS5B01G572600 chr7B 77.471 435 62 20 1102 1533 103903550 103903149 2.670000e-55 228.0
24 TraesCS5B01G572600 chr5D 88.476 1640 122 46 5955 7565 562724160 562725761 0.000000e+00 1919.0
25 TraesCS5B01G572600 chr5D 91.185 1418 76 26 3464 4863 562722041 562723427 0.000000e+00 1881.0
26 TraesCS5B01G572600 chr5D 85.006 1794 179 58 5250 6990 500444148 500442392 0.000000e+00 1740.0
27 TraesCS5B01G572600 chr5D 87.554 1398 132 17 3483 4852 500445585 500444202 0.000000e+00 1580.0
28 TraesCS5B01G572600 chr5D 93.446 1068 42 11 7604 8657 562725764 562726817 0.000000e+00 1559.0
29 TraesCS5B01G572600 chr5D 88.202 1246 109 18 3534 4767 18172692 18173911 0.000000e+00 1452.0
30 TraesCS5B01G572600 chr5D 85.055 823 55 27 731 1533 562719718 562720492 0.000000e+00 776.0
31 TraesCS5B01G572600 chr5D 85.069 797 55 26 6400 7166 18175116 18175878 0.000000e+00 754.0
32 TraesCS5B01G572600 chr5D 90.172 580 34 17 5746 6321 18174463 18175023 0.000000e+00 734.0
33 TraesCS5B01G572600 chr5D 84.219 640 82 11 7891 8518 500441316 500440684 1.060000e-168 604.0
34 TraesCS5B01G572600 chr5D 83.010 671 32 35 5287 5886 562723489 562724148 5.060000e-147 532.0
35 TraesCS5B01G572600 chr5D 81.761 636 97 13 7891 8518 18176663 18177287 1.830000e-141 514.0
36 TraesCS5B01G572600 chr5D 82.959 534 63 14 2815 3345 500446165 500445657 3.130000e-124 457.0
37 TraesCS5B01G572600 chr5D 84.889 450 53 8 1103 1538 500448992 500448544 3.150000e-119 440.0
38 TraesCS5B01G572600 chr5D 86.500 400 37 11 7196 7588 18175960 18176349 3.180000e-114 424.0
39 TraesCS5B01G572600 chr5D 87.332 371 43 3 9108 9478 554636926 554637292 1.140000e-113 422.0
40 TraesCS5B01G572600 chr5D 92.230 296 23 0 2815 3110 562721486 562721781 4.110000e-113 420.0
41 TraesCS5B01G572600 chr5D 91.554 296 25 0 2815 3110 18161867 18162162 8.900000e-110 409.0
42 TraesCS5B01G572600 chr5D 87.151 358 37 4 7225 7582 500442013 500441665 1.930000e-106 398.0
43 TraesCS5B01G572600 chr5D 83.797 395 55 7 5250 5642 18174002 18174389 5.430000e-97 366.0
44 TraesCS5B01G572600 chr5D 95.349 172 8 0 6995 7166 500442289 500442118 3.390000e-69 274.0
45 TraesCS5B01G572600 chr5D 91.371 197 17 0 7621 7817 500441661 500441465 4.380000e-68 270.0
46 TraesCS5B01G572600 chr5D 81.356 354 35 17 2347 2674 562721026 562721374 9.480000e-65 259.0
47 TraesCS5B01G572600 chr5D 99.020 102 1 0 3205 3306 562721845 562721946 5.870000e-42 183.0
48 TraesCS5B01G572600 chr5D 87.179 156 7 7 94 242 562717522 562717671 2.130000e-36 165.0
49 TraesCS5B01G572600 chr5D 88.889 108 12 0 3207 3314 18162237 18162344 6.000000e-27 134.0
50 TraesCS5B01G572600 chr5D 89.706 68 2 4 605 672 562719662 562719724 2.200000e-11 82.4
51 TraesCS5B01G572600 chr5D 79.528 127 5 11 332 458 562717879 562717984 4.770000e-08 71.3
52 TraesCS5B01G572600 chr5D 92.857 42 3 0 9476 9517 449134564 449134605 2.870000e-05 62.1
53 TraesCS5B01G572600 chr5A 88.881 1385 116 18 3480 4852 11938216 11939574 0.000000e+00 1670.0
54 TraesCS5B01G572600 chr5A 83.940 1787 185 65 5250 6990 626969637 626967907 0.000000e+00 1616.0
55 TraesCS5B01G572600 chr5A 87.786 1400 127 19 3483 4852 626971085 626969700 0.000000e+00 1598.0
56 TraesCS5B01G572600 chr5A 88.845 1004 61 32 5746 6729 11940099 11941071 0.000000e+00 1186.0
57 TraesCS5B01G572600 chr5A 84.399 641 82 9 7891 8518 626966829 626966194 1.760000e-171 614.0
58 TraesCS5B01G572600 chr5A 82.409 631 92 12 7896 8518 11942290 11942909 5.060000e-147 532.0
59 TraesCS5B01G572600 chr5A 84.294 503 51 13 2815 3314 11937655 11938132 5.200000e-127 466.0
60 TraesCS5B01G572600 chr5A 82.642 530 64 14 2815 3341 626971665 626971161 2.440000e-120 444.0
61 TraesCS5B01G572600 chr5A 89.873 316 28 4 7196 7507 11941579 11941894 4.140000e-108 403.0
62 TraesCS5B01G572600 chr5A 83.669 447 51 12 1103 1534 626976258 626975819 1.490000e-107 401.0
63 TraesCS5B01G572600 chr5A 85.230 413 27 20 6784 7166 11941090 11941498 2.490000e-105 394.0
64 TraesCS5B01G572600 chr5A 84.304 395 53 7 5250 5642 11939638 11940025 2.510000e-100 377.0
65 TraesCS5B01G572600 chr5A 82.529 435 60 12 1111 1534 11935594 11936023 1.510000e-97 368.0
66 TraesCS5B01G572600 chr5A 92.893 197 14 0 7621 7817 626967167 626966971 4.350000e-73 287.0
67 TraesCS5B01G572600 chr5A 95.349 172 8 0 6995 7166 626967805 626967634 3.390000e-69 274.0
68 TraesCS5B01G572600 chr5A 87.931 116 10 3 2568 2680 626971839 626971725 6.000000e-27 134.0
69 TraesCS5B01G572600 chr4A 88.278 1382 126 15 3483 4852 615698820 615697463 0.000000e+00 1622.0
70 TraesCS5B01G572600 chr4A 87.381 1054 90 28 5958 6990 615696775 615695744 0.000000e+00 1170.0
71 TraesCS5B01G572600 chr4A 84.100 522 59 10 2815 3331 615699389 615698887 5.170000e-132 483.0
72 TraesCS5B01G572600 chr4A 87.986 283 29 4 7225 7507 615695387 615695110 7.120000e-86 329.0
73 TraesCS5B01G572600 chr4A 88.603 272 24 4 1271 1537 615702073 615701804 3.310000e-84 324.0
74 TraesCS5B01G572600 chr4A 81.704 399 60 9 5250 5647 615697399 615697013 4.290000e-83 320.0
75 TraesCS5B01G572600 chr4A 92.823 209 13 2 7610 7817 615695052 615694845 1.550000e-77 302.0
76 TraesCS5B01G572600 chr4A 92.547 161 12 0 7005 7165 615695664 615695504 2.070000e-56 231.0
77 TraesCS5B01G572600 chr4A 85.207 169 17 6 5746 5912 615696944 615696782 5.910000e-37 167.0
78 TraesCS5B01G572600 chr4A 91.743 109 9 0 1148 1256 615702223 615702115 1.660000e-32 152.0
79 TraesCS5B01G572600 chr4A 91.111 90 8 0 2351 2440 615699836 615699747 1.300000e-23 122.0
80 TraesCS5B01G572600 chr7A 84.274 1418 165 30 3482 4850 138509411 138508003 0.000000e+00 1330.0
81 TraesCS5B01G572600 chr7A 79.724 651 111 13 7891 8525 138502399 138501754 1.460000e-122 451.0
82 TraesCS5B01G572600 chr7A 85.789 380 41 7 9108 9478 436691879 436691504 3.220000e-104 390.0
83 TraesCS5B01G572600 chr7A 85.981 321 39 4 7196 7512 138503373 138503055 1.180000e-88 339.0
84 TraesCS5B01G572600 chr7A 90.000 190 17 2 7629 7817 138502977 138502789 2.650000e-60 244.0
85 TraesCS5B01G572600 chr7A 89.091 110 4 7 3328 3435 223532881 223532984 7.760000e-26 130.0
86 TraesCS5B01G572600 chr7D 85.308 1232 147 18 3432 4630 138426652 138425422 0.000000e+00 1242.0
87 TraesCS5B01G572600 chr7D 84.279 1005 117 24 5748 6730 138424528 138423543 0.000000e+00 942.0
88 TraesCS5B01G572600 chr7D 79.815 649 114 11 7891 8525 138421713 138421068 3.130000e-124 457.0
89 TraesCS5B01G572600 chr7D 85.714 378 47 5 9108 9478 556541694 556541317 8.960000e-105 392.0
90 TraesCS5B01G572600 chr7D 86.218 312 38 3 7205 7512 138422763 138422453 5.510000e-87 333.0
91 TraesCS5B01G572600 chr7D 89.286 196 19 2 7629 7823 138422375 138422181 2.650000e-60 244.0
92 TraesCS5B01G572600 chr7D 77.471 435 62 18 1102 1533 138439597 138439196 2.670000e-55 228.0
93 TraesCS5B01G572600 chr2B 82.977 1216 145 37 5782 6963 787754977 787756164 0.000000e+00 1042.0
94 TraesCS5B01G572600 chr2B 87.302 378 41 5 9108 9478 148033581 148033204 8.830000e-115 425.0
95 TraesCS5B01G572600 chr2B 87.421 159 18 2 7006 7163 787756295 787756452 2.110000e-41 182.0
96 TraesCS5B01G572600 chr2B 91.667 48 4 0 1737 1784 699040896 699040849 6.170000e-07 67.6
97 TraesCS5B01G572600 chr3D 87.368 380 41 4 9108 9480 123012533 123012154 6.830000e-116 429.0
98 TraesCS5B01G572600 chr3D 86.772 378 43 4 9108 9478 30108619 30108242 1.910000e-111 414.0
99 TraesCS5B01G572600 chr1D 86.772 378 43 3 9108 9478 484991244 484990867 1.910000e-111 414.0
100 TraesCS5B01G572600 chr2D 93.000 100 6 1 3345 3444 524048588 524048686 2.770000e-30 145.0
101 TraesCS5B01G572600 chr6D 94.624 93 2 1 3342 3434 28123526 28123615 3.580000e-29 141.0
102 TraesCS5B01G572600 chr6D 93.684 95 5 1 3345 3438 431311760 431311854 3.580000e-29 141.0
103 TraesCS5B01G572600 chr6B 93.750 96 3 2 3344 3436 46738099 46738004 3.580000e-29 141.0
104 TraesCS5B01G572600 chr6B 85.965 57 7 1 1728 1784 131695032 131695087 1.030000e-04 60.2
105 TraesCS5B01G572600 chr3B 93.684 95 4 1 3345 3437 187150400 187150494 3.580000e-29 141.0
106 TraesCS5B01G572600 chr3B 86.777 121 7 5 3320 3438 11978707 11978594 1.000000e-24 126.0
107 TraesCS5B01G572600 chr4B 89.720 107 5 3 3337 3442 585960722 585960621 2.160000e-26 132.0
108 TraesCS5B01G572600 chr2A 88.889 108 8 3 3328 3435 323015660 323015557 7.760000e-26 130.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G572600 chr5B 712964220 712973736 9516 False 8498.500000 8997 100.000000 1 9517 2 chr5B.!!$F3 9516
1 TraesCS5B01G572600 chr5B 621841252 621849659 8407 True 632.888889 1642 87.479222 1103 8518 9 chr5B.!!$R1 7415
2 TraesCS5B01G572600 chr7B 43476 51093 7617 True 1065.428571 1951 87.911714 807 8657 7 chr7B.!!$R3 7850
3 TraesCS5B01G572600 chr7B 103891559 103893916 2357 True 587.500000 931 86.690500 5744 7823 2 chr7B.!!$R4 2079
4 TraesCS5B01G572600 chr5D 500440684 500448992 8308 True 720.375000 1740 87.312250 1103 8518 8 chr5D.!!$R1 7415
5 TraesCS5B01G572600 chr5D 562717522 562726817 9295 False 713.427273 1919 88.199182 94 8657 11 chr5D.!!$F5 8563
6 TraesCS5B01G572600 chr5D 18172692 18177287 4595 False 707.333333 1452 85.916833 3534 8518 6 chr5D.!!$F4 4984
7 TraesCS5B01G572600 chr5A 11935594 11942909 7315 False 674.500000 1670 85.795625 1111 8518 8 chr5A.!!$F1 7407
8 TraesCS5B01G572600 chr5A 626966194 626976258 10064 True 671.000000 1616 87.326125 1103 8518 8 chr5A.!!$R1 7415
9 TraesCS5B01G572600 chr4A 615694845 615702223 7378 True 474.727273 1622 88.316636 1148 7817 11 chr4A.!!$R1 6669
10 TraesCS5B01G572600 chr7A 138508003 138509411 1408 True 1330.000000 1330 84.274000 3482 4850 1 chr7A.!!$R1 1368
11 TraesCS5B01G572600 chr7A 138501754 138503373 1619 True 344.666667 451 85.235000 7196 8525 3 chr7A.!!$R3 1329
12 TraesCS5B01G572600 chr7D 138421068 138426652 5584 True 643.600000 1242 84.981200 3432 8525 5 chr7D.!!$R3 5093
13 TraesCS5B01G572600 chr2B 787754977 787756452 1475 False 612.000000 1042 85.199000 5782 7163 2 chr2B.!!$F1 1381


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
693 2346 0.035343 CGTTCCCTTCCCTTCCCTTC 60.035 60.000 0.00 0.0 0.00 3.46 F
905 2564 0.037232 CGGAGGAGACCAACACCTTC 60.037 60.000 0.00 0.0 39.58 3.46 F
1961 7825 0.110056 GGTCAGTTCATGCAGCAACG 60.110 55.000 0.00 0.0 0.00 4.10 F
2224 8824 0.106519 ACTGTGCCCACTGCTTCTTT 60.107 50.000 5.37 0.0 42.00 2.52 F
2225 8825 1.142870 ACTGTGCCCACTGCTTCTTTA 59.857 47.619 5.37 0.0 42.00 1.85 F
3439 10384 1.206610 GGAACGGAGGGAGTAGAAACC 59.793 57.143 0.00 0.0 0.00 3.27 F
3727 10703 0.163788 CACGCGACAACATCTTGGAC 59.836 55.000 15.93 0.0 0.00 4.02 F
3958 10934 0.529378 CCAAAACTCATCCTGCTGCC 59.471 55.000 0.00 0.0 0.00 4.85 F
5395 12626 2.654385 ACTGGAGATTGGGGATTTTGGA 59.346 45.455 0.00 0.0 0.00 3.53 F
5676 13010 1.338674 ACACTATTGCAGCCGCTAACA 60.339 47.619 0.00 0.0 39.64 2.41 F
6418 13884 0.102481 TAATCTTCACCCTCGCTCGC 59.898 55.000 0.00 0.0 0.00 5.03 F
6963 14698 0.527113 CATGTTTCGATTGGGCAGCA 59.473 50.000 0.00 0.0 0.00 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2085 8345 0.034059 GTCTCTGGTCTGGTGTGGTG 59.966 60.000 0.0 0.0 0.00 4.17 R
2089 8349 0.105453 AGTGGTCTCTGGTCTGGTGT 60.105 55.000 0.0 0.0 0.00 4.16 R
2813 9756 0.179037 TGATGCTGCCAGATACCTGC 60.179 55.000 0.0 0.0 39.07 4.85 R
3202 10146 0.610232 GCCCAAGCACCTGAGATGTT 60.610 55.000 0.0 0.0 39.53 2.71 R
3476 10421 0.689623 ATCTCCCCTGCCATCGAATC 59.310 55.000 0.0 0.0 0.00 2.52 R
4727 11951 0.391263 GGTCGGATGTCACCTGTTCC 60.391 60.000 0.0 0.0 0.00 3.62 R
5326 12557 0.613260 TCGCCTACTGTGGATGCTTT 59.387 50.000 0.0 0.0 0.00 3.51 R
5554 12813 1.003355 CGCTGGGAGCTGGAAAAGA 60.003 57.895 0.0 0.0 39.60 2.52 R
6272 13700 0.320374 ACATCCGAGGAAAGACGCAA 59.680 50.000 0.0 0.0 0.00 4.85 R
7670 15624 1.227764 AGCAGCATATGTGGCTCCG 60.228 57.895 14.9 0.0 40.23 4.63 R
7928 16294 0.937304 CGTGTATTCAATCCCCTGCG 59.063 55.000 0.0 0.0 0.00 5.18 R
8949 17357 0.238289 GACCACGCCATGTTGACTTG 59.762 55.000 0.0 0.0 0.00 3.16 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 5.890424 TTTTTATGAGGAAAAGGTAGGCG 57.110 39.130 0.00 0.00 30.30 5.52
35 36 4.829872 TTTATGAGGAAAAGGTAGGCGA 57.170 40.909 0.00 0.00 0.00 5.54
36 37 5.367945 TTTATGAGGAAAAGGTAGGCGAT 57.632 39.130 0.00 0.00 0.00 4.58
37 38 2.981859 TGAGGAAAAGGTAGGCGATC 57.018 50.000 0.00 0.00 0.00 3.69
38 39 1.485066 TGAGGAAAAGGTAGGCGATCC 59.515 52.381 0.00 0.00 0.00 3.36
39 40 0.464452 AGGAAAAGGTAGGCGATCCG 59.536 55.000 0.00 0.00 37.47 4.18
40 41 0.177373 GGAAAAGGTAGGCGATCCGT 59.823 55.000 0.00 0.00 37.47 4.69
41 42 1.568606 GAAAAGGTAGGCGATCCGTC 58.431 55.000 0.00 0.00 37.47 4.79
51 52 3.117589 CGATCCGTCGTTTTCAGGT 57.882 52.632 0.00 0.00 42.78 4.00
52 53 0.713883 CGATCCGTCGTTTTCAGGTG 59.286 55.000 0.00 0.00 42.78 4.00
53 54 0.442699 GATCCGTCGTTTTCAGGTGC 59.557 55.000 0.00 0.00 0.00 5.01
54 55 1.289109 ATCCGTCGTTTTCAGGTGCG 61.289 55.000 0.00 0.00 0.00 5.34
55 56 2.241880 CCGTCGTTTTCAGGTGCGT 61.242 57.895 0.00 0.00 0.00 5.24
56 57 1.083657 CGTCGTTTTCAGGTGCGTG 60.084 57.895 0.00 0.00 0.00 5.34
57 58 1.278637 GTCGTTTTCAGGTGCGTGG 59.721 57.895 0.00 0.00 0.00 4.94
58 59 1.890041 TCGTTTTCAGGTGCGTGGG 60.890 57.895 0.00 0.00 0.00 4.61
59 60 2.184167 CGTTTTCAGGTGCGTGGGT 61.184 57.895 0.00 0.00 0.00 4.51
60 61 1.358759 GTTTTCAGGTGCGTGGGTG 59.641 57.895 0.00 0.00 0.00 4.61
61 62 1.098712 GTTTTCAGGTGCGTGGGTGA 61.099 55.000 0.00 0.00 0.00 4.02
62 63 0.817634 TTTTCAGGTGCGTGGGTGAG 60.818 55.000 0.00 0.00 0.00 3.51
63 64 1.978455 TTTCAGGTGCGTGGGTGAGT 61.978 55.000 0.00 0.00 0.00 3.41
64 65 1.978455 TTCAGGTGCGTGGGTGAGTT 61.978 55.000 0.00 0.00 0.00 3.01
65 66 2.111043 AGGTGCGTGGGTGAGTTG 59.889 61.111 0.00 0.00 0.00 3.16
66 67 3.660111 GGTGCGTGGGTGAGTTGC 61.660 66.667 0.00 0.00 0.00 4.17
67 68 2.899838 GTGCGTGGGTGAGTTGCA 60.900 61.111 0.00 0.00 0.00 4.08
68 69 2.112928 TGCGTGGGTGAGTTGCAT 59.887 55.556 0.00 0.00 0.00 3.96
69 70 0.953471 GTGCGTGGGTGAGTTGCATA 60.953 55.000 0.00 0.00 37.93 3.14
70 71 0.953471 TGCGTGGGTGAGTTGCATAC 60.953 55.000 0.00 0.00 0.00 2.39
71 72 1.966493 GCGTGGGTGAGTTGCATACG 61.966 60.000 0.00 0.00 35.62 3.06
72 73 0.669318 CGTGGGTGAGTTGCATACGT 60.669 55.000 0.00 0.00 31.24 3.57
73 74 1.403116 CGTGGGTGAGTTGCATACGTA 60.403 52.381 0.00 0.00 31.24 3.57
74 75 2.268298 GTGGGTGAGTTGCATACGTAG 58.732 52.381 0.08 0.00 0.00 3.51
75 76 1.206132 TGGGTGAGTTGCATACGTAGG 59.794 52.381 2.16 2.16 0.00 3.18
76 77 1.479323 GGGTGAGTTGCATACGTAGGA 59.521 52.381 12.12 0.00 0.00 2.94
77 78 2.093869 GGGTGAGTTGCATACGTAGGAA 60.094 50.000 12.12 0.00 0.00 3.36
78 79 3.592059 GGTGAGTTGCATACGTAGGAAA 58.408 45.455 12.12 3.49 0.00 3.13
79 80 3.617263 GGTGAGTTGCATACGTAGGAAAG 59.383 47.826 12.12 0.00 0.00 2.62
80 81 4.491676 GTGAGTTGCATACGTAGGAAAGA 58.508 43.478 12.12 0.00 0.00 2.52
81 82 4.326548 GTGAGTTGCATACGTAGGAAAGAC 59.673 45.833 12.12 4.56 0.00 3.01
82 83 4.021807 TGAGTTGCATACGTAGGAAAGACA 60.022 41.667 12.12 7.11 0.00 3.41
83 84 4.243270 AGTTGCATACGTAGGAAAGACAC 58.757 43.478 12.12 0.00 0.00 3.67
84 85 3.945981 TGCATACGTAGGAAAGACACA 57.054 42.857 12.12 0.00 0.00 3.72
85 86 4.260139 TGCATACGTAGGAAAGACACAA 57.740 40.909 12.12 0.00 0.00 3.33
86 87 4.633175 TGCATACGTAGGAAAGACACAAA 58.367 39.130 12.12 0.00 0.00 2.83
87 88 4.688879 TGCATACGTAGGAAAGACACAAAG 59.311 41.667 12.12 0.00 0.00 2.77
88 89 4.927425 GCATACGTAGGAAAGACACAAAGA 59.073 41.667 12.12 0.00 0.00 2.52
89 90 5.062308 GCATACGTAGGAAAGACACAAAGAG 59.938 44.000 12.12 0.00 0.00 2.85
90 91 4.931661 ACGTAGGAAAGACACAAAGAGA 57.068 40.909 0.00 0.00 0.00 3.10
91 92 4.618965 ACGTAGGAAAGACACAAAGAGAC 58.381 43.478 0.00 0.00 0.00 3.36
92 93 4.098960 ACGTAGGAAAGACACAAAGAGACA 59.901 41.667 0.00 0.00 0.00 3.41
125 126 7.067251 GGTTGGGTTGTTAATTAACGATGGATA 59.933 37.037 19.00 0.57 39.00 2.59
126 127 8.626526 GTTGGGTTGTTAATTAACGATGGATAT 58.373 33.333 19.00 0.00 39.00 1.63
149 150 2.031944 CGAGTGAGTGACGTCTCTGAAA 60.032 50.000 23.76 7.40 35.68 2.69
162 163 7.041167 TGACGTCTCTGAAATGAAATGAAATGT 60.041 33.333 17.92 0.00 0.00 2.71
164 165 8.446273 ACGTCTCTGAAATGAAATGAAATGTAG 58.554 33.333 0.00 0.00 0.00 2.74
165 166 8.659491 CGTCTCTGAAATGAAATGAAATGTAGA 58.341 33.333 0.00 0.00 0.00 2.59
173 174 9.865321 AAATGAAATGAAATGTAGATGAGTTGG 57.135 29.630 0.00 0.00 0.00 3.77
174 175 8.812513 ATGAAATGAAATGTAGATGAGTTGGA 57.187 30.769 0.00 0.00 0.00 3.53
177 178 6.690194 ATGAAATGTAGATGAGTTGGAAGC 57.310 37.500 0.00 0.00 0.00 3.86
178 179 4.943705 TGAAATGTAGATGAGTTGGAAGCC 59.056 41.667 0.00 0.00 0.00 4.35
180 181 1.899814 TGTAGATGAGTTGGAAGCCGT 59.100 47.619 0.00 0.00 0.00 5.68
206 211 0.465460 TGCTCTGGTTTCCGCAAGTT 60.465 50.000 0.00 0.00 0.00 2.66
209 214 2.870435 GCTCTGGTTTCCGCAAGTTAGA 60.870 50.000 0.00 0.00 0.00 2.10
227 232 3.133141 AGACCAGCTTTTGTCTCTTCC 57.867 47.619 4.81 0.00 37.24 3.46
237 242 5.762711 GCTTTTGTCTCTTCCTCTTCTTCTT 59.237 40.000 0.00 0.00 0.00 2.52
239 244 5.476091 TTGTCTCTTCCTCTTCTTCTTCC 57.524 43.478 0.00 0.00 0.00 3.46
244 336 6.661805 GTCTCTTCCTCTTCTTCTTCCTCTAA 59.338 42.308 0.00 0.00 0.00 2.10
274 387 6.737254 CGGAGCCGGAATGTATTATTAATT 57.263 37.500 5.05 0.00 35.56 1.40
292 405 6.839124 TTAATTGTGCACCATCTTCATCTT 57.161 33.333 15.69 0.00 0.00 2.40
294 407 3.421919 TGTGCACCATCTTCATCTTCA 57.578 42.857 15.69 0.00 0.00 3.02
295 408 3.959293 TGTGCACCATCTTCATCTTCAT 58.041 40.909 15.69 0.00 0.00 2.57
296 409 3.943381 TGTGCACCATCTTCATCTTCATC 59.057 43.478 15.69 0.00 0.00 2.92
298 411 4.272991 GTGCACCATCTTCATCTTCATCTC 59.727 45.833 5.22 0.00 0.00 2.75
299 412 3.814283 GCACCATCTTCATCTTCATCTCC 59.186 47.826 0.00 0.00 0.00 3.71
300 413 4.685302 GCACCATCTTCATCTTCATCTCCA 60.685 45.833 0.00 0.00 0.00 3.86
301 414 5.622180 CACCATCTTCATCTTCATCTCCAT 58.378 41.667 0.00 0.00 0.00 3.41
302 415 5.701750 CACCATCTTCATCTTCATCTCCATC 59.298 44.000 0.00 0.00 0.00 3.51
303 416 5.607592 ACCATCTTCATCTTCATCTCCATCT 59.392 40.000 0.00 0.00 0.00 2.90
304 417 6.167685 CCATCTTCATCTTCATCTCCATCTC 58.832 44.000 0.00 0.00 0.00 2.75
305 418 5.804944 TCTTCATCTTCATCTCCATCTCC 57.195 43.478 0.00 0.00 0.00 3.71
307 420 5.845065 TCTTCATCTTCATCTCCATCTCCAT 59.155 40.000 0.00 0.00 0.00 3.41
308 421 5.741962 TCATCTTCATCTCCATCTCCATC 57.258 43.478 0.00 0.00 0.00 3.51
309 422 5.404395 TCATCTTCATCTCCATCTCCATCT 58.596 41.667 0.00 0.00 0.00 2.90
311 424 4.158786 TCTTCATCTCCATCTCCATCTCC 58.841 47.826 0.00 0.00 0.00 3.71
314 427 4.500452 TCATCTCCATCTCCATCTCCATT 58.500 43.478 0.00 0.00 0.00 3.16
315 428 4.912133 TCATCTCCATCTCCATCTCCATTT 59.088 41.667 0.00 0.00 0.00 2.32
316 429 5.371769 TCATCTCCATCTCCATCTCCATTTT 59.628 40.000 0.00 0.00 0.00 1.82
317 430 5.301835 TCTCCATCTCCATCTCCATTTTC 57.698 43.478 0.00 0.00 0.00 2.29
319 432 5.371769 TCTCCATCTCCATCTCCATTTTCAT 59.628 40.000 0.00 0.00 0.00 2.57
321 434 5.371769 TCCATCTCCATCTCCATTTTCATCT 59.628 40.000 0.00 0.00 0.00 2.90
322 435 5.706369 CCATCTCCATCTCCATTTTCATCTC 59.294 44.000 0.00 0.00 0.00 2.75
323 436 5.301835 TCTCCATCTCCATTTTCATCTCC 57.698 43.478 0.00 0.00 0.00 3.71
324 437 4.723285 TCTCCATCTCCATTTTCATCTCCA 59.277 41.667 0.00 0.00 0.00 3.86
325 438 5.371769 TCTCCATCTCCATTTTCATCTCCAT 59.628 40.000 0.00 0.00 0.00 3.41
326 439 5.628130 TCCATCTCCATTTTCATCTCCATC 58.372 41.667 0.00 0.00 0.00 3.51
327 440 5.371769 TCCATCTCCATTTTCATCTCCATCT 59.628 40.000 0.00 0.00 0.00 2.90
329 442 5.301835 TCTCCATTTTCATCTCCATCTCC 57.698 43.478 0.00 0.00 0.00 3.71
330 443 4.723285 TCTCCATTTTCATCTCCATCTCCA 59.277 41.667 0.00 0.00 0.00 3.86
351 473 1.225368 CGTGCGTGCGTGTGATTAC 60.225 57.895 0.00 0.00 0.00 1.89
354 476 1.320555 GTGCGTGCGTGTGATTACTAG 59.679 52.381 0.00 0.00 0.00 2.57
357 479 2.529090 GCGTGCGTGTGATTACTAGTAC 59.471 50.000 0.91 0.00 0.00 2.73
360 482 5.196102 CGTGCGTGTGATTACTAGTACTAG 58.804 45.833 25.30 25.30 39.04 2.57
361 483 5.508872 GTGCGTGTGATTACTAGTACTAGG 58.491 45.833 29.05 14.29 37.49 3.02
363 485 5.295292 TGCGTGTGATTACTAGTACTAGGAC 59.705 44.000 29.05 18.11 37.49 3.85
365 487 6.703607 GCGTGTGATTACTAGTACTAGGACTA 59.296 42.308 29.05 14.32 37.49 2.59
419 541 6.843069 AAATTGTAAAATGTGGTCAGCAAC 57.157 33.333 0.00 0.00 0.00 4.17
420 542 4.991153 TTGTAAAATGTGGTCAGCAACA 57.009 36.364 0.00 0.00 32.28 3.33
421 543 4.566545 TGTAAAATGTGGTCAGCAACAG 57.433 40.909 0.00 0.00 31.05 3.16
422 544 2.514205 AAAATGTGGTCAGCAACAGC 57.486 45.000 0.00 0.00 31.05 4.40
423 545 1.401761 AAATGTGGTCAGCAACAGCA 58.598 45.000 0.00 0.00 31.05 4.41
424 546 1.624336 AATGTGGTCAGCAACAGCAT 58.376 45.000 0.00 0.00 31.05 3.79
425 547 0.885879 ATGTGGTCAGCAACAGCATG 59.114 50.000 0.00 0.00 46.00 4.06
426 548 1.080974 GTGGTCAGCAACAGCATGC 60.081 57.895 10.51 10.51 46.78 4.06
461 583 2.896443 GCGCCAAGCTACCTCTCT 59.104 61.111 0.00 0.00 44.04 3.10
462 584 1.520342 GCGCCAAGCTACCTCTCTG 60.520 63.158 0.00 0.00 44.04 3.35
463 585 1.520342 CGCCAAGCTACCTCTCTGC 60.520 63.158 0.00 0.00 0.00 4.26
466 588 1.484038 CCAAGCTACCTCTCTGCTCT 58.516 55.000 0.00 0.00 35.85 4.09
467 589 1.136695 CCAAGCTACCTCTCTGCTCTG 59.863 57.143 0.00 0.00 35.85 3.35
519 713 6.151985 TCCTTAGCAAACAAACTTTGACTTGA 59.848 34.615 17.78 3.59 32.55 3.02
525 719 6.589454 CAAACAAACTTTGACTTGACAAACC 58.411 36.000 8.55 0.00 36.11 3.27
527 721 3.775661 AACTTTGACTTGACAAACCCG 57.224 42.857 0.00 0.00 36.11 5.28
529 723 0.741915 TTTGACTTGACAAACCCGCC 59.258 50.000 0.00 0.00 35.29 6.13
530 724 0.394488 TTGACTTGACAAACCCGCCA 60.394 50.000 0.00 0.00 0.00 5.69
531 725 0.394488 TGACTTGACAAACCCGCCAA 60.394 50.000 0.00 0.00 0.00 4.52
533 727 0.395173 ACTTGACAAACCCGCCAACT 60.395 50.000 0.00 0.00 0.00 3.16
534 728 0.744281 CTTGACAAACCCGCCAACTT 59.256 50.000 0.00 0.00 0.00 2.66
535 729 1.950909 CTTGACAAACCCGCCAACTTA 59.049 47.619 0.00 0.00 0.00 2.24
536 730 1.310904 TGACAAACCCGCCAACTTAC 58.689 50.000 0.00 0.00 0.00 2.34
538 732 0.824595 ACAAACCCGCCAACTTACCC 60.825 55.000 0.00 0.00 0.00 3.69
539 733 0.538746 CAAACCCGCCAACTTACCCT 60.539 55.000 0.00 0.00 0.00 4.34
541 735 0.538746 AACCCGCCAACTTACCCTTG 60.539 55.000 0.00 0.00 0.00 3.61
542 736 1.677633 CCCGCCAACTTACCCTTGG 60.678 63.158 0.00 0.00 41.17 3.61
545 739 0.879090 CGCCAACTTACCCTTGGTTC 59.121 55.000 0.00 0.00 40.46 3.62
546 740 1.254026 GCCAACTTACCCTTGGTTCC 58.746 55.000 0.00 0.00 40.46 3.62
547 741 1.203013 GCCAACTTACCCTTGGTTCCT 60.203 52.381 0.00 0.00 40.46 3.36
548 742 2.755208 GCCAACTTACCCTTGGTTCCTT 60.755 50.000 0.00 0.00 40.46 3.36
549 743 3.154710 CCAACTTACCCTTGGTTCCTTC 58.845 50.000 0.00 0.00 37.09 3.46
550 744 3.154710 CAACTTACCCTTGGTTCCTTCC 58.845 50.000 0.00 0.00 37.09 3.46
554 2207 0.178961 ACCCTTGGTTCCTTCCTTGC 60.179 55.000 0.00 0.00 27.29 4.01
557 2210 1.889170 CCTTGGTTCCTTCCTTGCTTC 59.111 52.381 0.00 0.00 0.00 3.86
568 2221 3.887621 TCCTTGCTTCGTTATGCTAGT 57.112 42.857 0.00 0.00 31.91 2.57
569 2222 3.521560 TCCTTGCTTCGTTATGCTAGTG 58.478 45.455 0.00 0.00 31.91 2.74
570 2223 2.030946 CCTTGCTTCGTTATGCTAGTGC 59.969 50.000 0.00 0.00 40.20 4.40
571 2224 2.672961 TGCTTCGTTATGCTAGTGCT 57.327 45.000 0.00 0.00 40.48 4.40
573 2226 3.706698 TGCTTCGTTATGCTAGTGCTAG 58.293 45.455 2.04 2.04 40.48 3.42
574 2227 3.380320 TGCTTCGTTATGCTAGTGCTAGA 59.620 43.478 10.17 0.00 40.48 2.43
575 2228 3.731717 GCTTCGTTATGCTAGTGCTAGAC 59.268 47.826 10.17 2.87 40.48 2.59
633 2286 1.945394 GCTGAGCATGAATGGAATCGT 59.055 47.619 0.00 0.00 0.00 3.73
636 2289 4.595116 CTGAGCATGAATGGAATCGTTTC 58.405 43.478 0.00 0.00 0.00 2.78
645 2298 0.455815 GGAATCGTTTCCCACATGCC 59.544 55.000 13.40 0.00 44.96 4.40
646 2299 1.463674 GAATCGTTTCCCACATGCCT 58.536 50.000 0.00 0.00 0.00 4.75
647 2300 2.639065 GAATCGTTTCCCACATGCCTA 58.361 47.619 0.00 0.00 0.00 3.93
648 2301 3.214328 GAATCGTTTCCCACATGCCTAT 58.786 45.455 0.00 0.00 0.00 2.57
649 2302 2.036958 TCGTTTCCCACATGCCTATG 57.963 50.000 0.00 0.00 40.24 2.23
650 2303 0.381801 CGTTTCCCACATGCCTATGC 59.618 55.000 0.00 0.00 37.85 3.14
672 2325 0.618458 ATGCACCGGCCTTCTTCTTA 59.382 50.000 0.00 0.00 40.13 2.10
673 2326 0.618458 TGCACCGGCCTTCTTCTTAT 59.382 50.000 0.00 0.00 40.13 1.73
674 2327 1.300481 GCACCGGCCTTCTTCTTATC 58.700 55.000 0.00 0.00 0.00 1.75
675 2328 1.571919 CACCGGCCTTCTTCTTATCG 58.428 55.000 0.00 0.00 0.00 2.92
676 2329 1.134788 CACCGGCCTTCTTCTTATCGT 60.135 52.381 0.00 0.00 0.00 3.73
677 2330 1.553704 ACCGGCCTTCTTCTTATCGTT 59.446 47.619 0.00 0.00 0.00 3.85
678 2331 2.202566 CCGGCCTTCTTCTTATCGTTC 58.797 52.381 0.00 0.00 0.00 3.95
679 2332 2.202566 CGGCCTTCTTCTTATCGTTCC 58.797 52.381 0.00 0.00 0.00 3.62
680 2333 2.562635 GGCCTTCTTCTTATCGTTCCC 58.437 52.381 0.00 0.00 0.00 3.97
681 2334 2.170817 GGCCTTCTTCTTATCGTTCCCT 59.829 50.000 0.00 0.00 0.00 4.20
682 2335 3.370633 GGCCTTCTTCTTATCGTTCCCTT 60.371 47.826 0.00 0.00 0.00 3.95
683 2336 3.872182 GCCTTCTTCTTATCGTTCCCTTC 59.128 47.826 0.00 0.00 0.00 3.46
684 2337 4.443621 CCTTCTTCTTATCGTTCCCTTCC 58.556 47.826 0.00 0.00 0.00 3.46
685 2338 4.443621 CTTCTTCTTATCGTTCCCTTCCC 58.556 47.826 0.00 0.00 0.00 3.97
686 2339 3.721021 TCTTCTTATCGTTCCCTTCCCT 58.279 45.455 0.00 0.00 0.00 4.20
687 2340 4.101856 TCTTCTTATCGTTCCCTTCCCTT 58.898 43.478 0.00 0.00 0.00 3.95
688 2341 4.161754 TCTTCTTATCGTTCCCTTCCCTTC 59.838 45.833 0.00 0.00 0.00 3.46
689 2342 2.770232 TCTTATCGTTCCCTTCCCTTCC 59.230 50.000 0.00 0.00 0.00 3.46
690 2343 1.503800 TATCGTTCCCTTCCCTTCCC 58.496 55.000 0.00 0.00 0.00 3.97
691 2344 0.253207 ATCGTTCCCTTCCCTTCCCT 60.253 55.000 0.00 0.00 0.00 4.20
692 2345 0.475048 TCGTTCCCTTCCCTTCCCTT 60.475 55.000 0.00 0.00 0.00 3.95
693 2346 0.035343 CGTTCCCTTCCCTTCCCTTC 60.035 60.000 0.00 0.00 0.00 3.46
694 2347 0.331954 GTTCCCTTCCCTTCCCTTCC 59.668 60.000 0.00 0.00 0.00 3.46
695 2348 0.849540 TTCCCTTCCCTTCCCTTCCC 60.850 60.000 0.00 0.00 0.00 3.97
696 2349 1.230314 CCCTTCCCTTCCCTTCCCT 60.230 63.158 0.00 0.00 0.00 4.20
697 2350 0.851332 CCCTTCCCTTCCCTTCCCTT 60.851 60.000 0.00 0.00 0.00 3.95
698 2351 0.626382 CCTTCCCTTCCCTTCCCTTC 59.374 60.000 0.00 0.00 0.00 3.46
699 2352 0.626382 CTTCCCTTCCCTTCCCTTCC 59.374 60.000 0.00 0.00 0.00 3.46
700 2353 0.849540 TTCCCTTCCCTTCCCTTCCC 60.850 60.000 0.00 0.00 0.00 3.97
701 2354 1.230314 CCCTTCCCTTCCCTTCCCT 60.230 63.158 0.00 0.00 0.00 4.20
702 2355 1.575447 CCCTTCCCTTCCCTTCCCTG 61.575 65.000 0.00 0.00 0.00 4.45
703 2356 1.304617 CTTCCCTTCCCTTCCCTGC 59.695 63.158 0.00 0.00 0.00 4.85
704 2357 2.216782 CTTCCCTTCCCTTCCCTGCC 62.217 65.000 0.00 0.00 0.00 4.85
705 2358 2.615288 CCCTTCCCTTCCCTGCCT 60.615 66.667 0.00 0.00 0.00 4.75
706 2359 2.241659 CCCTTCCCTTCCCTGCCTT 61.242 63.158 0.00 0.00 0.00 4.35
707 2360 1.000396 CCTTCCCTTCCCTGCCTTG 60.000 63.158 0.00 0.00 0.00 3.61
708 2361 1.680314 CTTCCCTTCCCTGCCTTGC 60.680 63.158 0.00 0.00 0.00 4.01
709 2362 3.224007 TTCCCTTCCCTGCCTTGCC 62.224 63.158 0.00 0.00 0.00 4.52
712 2365 4.729918 CTTCCCTGCCTTGCCGCT 62.730 66.667 0.00 0.00 0.00 5.52
713 2366 4.284550 TTCCCTGCCTTGCCGCTT 62.285 61.111 0.00 0.00 0.00 4.68
727 2380 2.480224 CCGCTTGGCTTGTATGATTG 57.520 50.000 0.00 0.00 0.00 2.67
728 2381 1.745087 CCGCTTGGCTTGTATGATTGT 59.255 47.619 0.00 0.00 0.00 2.71
729 2382 2.942376 CCGCTTGGCTTGTATGATTGTA 59.058 45.455 0.00 0.00 0.00 2.41
730 2383 3.565482 CCGCTTGGCTTGTATGATTGTAT 59.435 43.478 0.00 0.00 0.00 2.29
731 2384 4.319766 CCGCTTGGCTTGTATGATTGTATC 60.320 45.833 0.00 0.00 0.00 2.24
732 2385 4.512944 CGCTTGGCTTGTATGATTGTATCT 59.487 41.667 0.00 0.00 0.00 1.98
733 2386 5.333645 CGCTTGGCTTGTATGATTGTATCTC 60.334 44.000 0.00 0.00 0.00 2.75
734 2387 5.762218 GCTTGGCTTGTATGATTGTATCTCT 59.238 40.000 0.00 0.00 0.00 3.10
735 2388 6.073331 GCTTGGCTTGTATGATTGTATCTCTC 60.073 42.308 0.00 0.00 0.00 3.20
736 2389 6.737720 TGGCTTGTATGATTGTATCTCTCT 57.262 37.500 0.00 0.00 0.00 3.10
737 2390 6.753180 TGGCTTGTATGATTGTATCTCTCTC 58.247 40.000 0.00 0.00 0.00 3.20
740 2393 7.090173 GCTTGTATGATTGTATCTCTCTCCTC 58.910 42.308 0.00 0.00 0.00 3.71
792 2445 1.950216 TCTCATCTGCTACCTACGCTG 59.050 52.381 0.00 0.00 0.00 5.18
794 2447 0.598680 CATCTGCTACCTACGCTGCC 60.599 60.000 0.00 0.00 0.00 4.85
795 2448 1.043116 ATCTGCTACCTACGCTGCCA 61.043 55.000 0.00 0.00 0.00 4.92
796 2449 1.519455 CTGCTACCTACGCTGCCAC 60.519 63.158 0.00 0.00 0.00 5.01
798 2451 1.079405 GCTACCTACGCTGCCACAA 60.079 57.895 0.00 0.00 0.00 3.33
799 2452 1.084370 GCTACCTACGCTGCCACAAG 61.084 60.000 0.00 0.00 0.00 3.16
800 2453 1.079405 TACCTACGCTGCCACAAGC 60.079 57.895 0.00 0.00 44.14 4.01
803 2456 1.965930 CTACGCTGCCACAAGCCAA 60.966 57.895 0.00 0.00 42.71 4.52
804 2457 1.514678 CTACGCTGCCACAAGCCAAA 61.515 55.000 0.00 0.00 42.71 3.28
805 2458 0.893270 TACGCTGCCACAAGCCAAAT 60.893 50.000 0.00 0.00 42.71 2.32
878 2537 0.970427 ATTCCCATTCCCAACGCCAC 60.970 55.000 0.00 0.00 0.00 5.01
879 2538 2.035626 CCCATTCCCAACGCCACT 59.964 61.111 0.00 0.00 0.00 4.00
880 2539 2.046285 CCCATTCCCAACGCCACTC 61.046 63.158 0.00 0.00 0.00 3.51
881 2540 1.303236 CCATTCCCAACGCCACTCA 60.303 57.895 0.00 0.00 0.00 3.41
882 2541 0.680921 CCATTCCCAACGCCACTCAT 60.681 55.000 0.00 0.00 0.00 2.90
883 2542 0.734889 CATTCCCAACGCCACTCATC 59.265 55.000 0.00 0.00 0.00 2.92
884 2543 0.327924 ATTCCCAACGCCACTCATCA 59.672 50.000 0.00 0.00 0.00 3.07
885 2544 0.109532 TTCCCAACGCCACTCATCAA 59.890 50.000 0.00 0.00 0.00 2.57
887 2546 1.497278 CCAACGCCACTCATCAACG 59.503 57.895 0.00 0.00 0.00 4.10
888 2547 1.497278 CAACGCCACTCATCAACGG 59.503 57.895 0.00 0.00 0.00 4.44
889 2548 0.948623 CAACGCCACTCATCAACGGA 60.949 55.000 0.00 0.00 0.00 4.69
890 2549 0.670546 AACGCCACTCATCAACGGAG 60.671 55.000 0.00 0.00 38.36 4.63
891 2550 1.811266 CGCCACTCATCAACGGAGG 60.811 63.158 0.00 0.00 36.70 4.30
892 2551 1.596934 GCCACTCATCAACGGAGGA 59.403 57.895 0.00 0.00 36.70 3.71
897 2556 3.374318 TCATCAACGGAGGAGACCA 57.626 52.632 0.00 0.00 29.12 4.02
898 2557 1.639722 TCATCAACGGAGGAGACCAA 58.360 50.000 0.00 0.00 29.12 3.67
899 2558 1.275291 TCATCAACGGAGGAGACCAAC 59.725 52.381 0.00 0.00 29.12 3.77
900 2559 1.001974 CATCAACGGAGGAGACCAACA 59.998 52.381 0.00 0.00 0.00 3.33
901 2560 0.391597 TCAACGGAGGAGACCAACAC 59.608 55.000 0.00 0.00 0.00 3.32
902 2561 0.602905 CAACGGAGGAGACCAACACC 60.603 60.000 0.00 0.00 0.00 4.16
903 2562 0.763223 AACGGAGGAGACCAACACCT 60.763 55.000 0.00 0.00 42.06 4.00
904 2563 0.763223 ACGGAGGAGACCAACACCTT 60.763 55.000 0.00 0.00 39.58 3.50
905 2564 0.037232 CGGAGGAGACCAACACCTTC 60.037 60.000 0.00 0.00 39.58 3.46
906 2565 0.325272 GGAGGAGACCAACACCTTCC 59.675 60.000 0.00 0.00 39.58 3.46
907 2566 1.353091 GAGGAGACCAACACCTTCCT 58.647 55.000 0.00 0.00 39.58 3.36
908 2567 1.700186 GAGGAGACCAACACCTTCCTT 59.300 52.381 0.00 0.00 39.58 3.36
909 2568 1.700186 AGGAGACCAACACCTTCCTTC 59.300 52.381 0.00 0.00 36.18 3.46
910 2569 1.271434 GGAGACCAACACCTTCCTTCC 60.271 57.143 0.00 0.00 0.00 3.46
911 2570 1.700186 GAGACCAACACCTTCCTTCCT 59.300 52.381 0.00 0.00 0.00 3.36
936 2595 0.487325 TTCCTCCACCACTCTCTCCA 59.513 55.000 0.00 0.00 0.00 3.86
939 2598 1.638529 CTCCACCACTCTCTCCACTT 58.361 55.000 0.00 0.00 0.00 3.16
940 2599 1.548269 CTCCACCACTCTCTCCACTTC 59.452 57.143 0.00 0.00 0.00 3.01
972 2637 0.896226 GACAGAGACCACCACTACCC 59.104 60.000 0.00 0.00 0.00 3.69
974 2639 1.203313 ACAGAGACCACCACTACCCAT 60.203 52.381 0.00 0.00 0.00 4.00
994 2659 1.451028 GATCGAGCTTGGCTTGGCT 60.451 57.895 0.00 0.00 39.88 4.75
995 2660 1.001641 ATCGAGCTTGGCTTGGCTT 60.002 52.632 0.00 0.00 39.88 4.35
996 2661 1.310933 ATCGAGCTTGGCTTGGCTTG 61.311 55.000 0.00 7.49 39.88 4.01
1128 2809 4.785453 CACTCCTTCCGCCAGCCC 62.785 72.222 0.00 0.00 0.00 5.19
1206 2887 2.107141 GAGAACCTCCGATGGGCG 59.893 66.667 0.00 0.00 40.47 6.13
1269 2977 0.251653 TCCTCCTAAGTCACGCTGGT 60.252 55.000 0.00 0.00 0.00 4.00
1380 3091 2.733593 GACGACAGCGAGCGGTTT 60.734 61.111 1.99 0.00 41.64 3.27
1385 3096 1.618640 GACAGCGAGCGGTTTCTGAC 61.619 60.000 19.29 11.93 0.00 3.51
1515 3226 3.303135 ACGCTCTGGAACTCGGCA 61.303 61.111 0.00 0.00 0.00 5.69
1543 3285 4.080299 ACTTCCTACAGGTTCCATTCCATC 60.080 45.833 0.00 0.00 36.34 3.51
1549 3291 1.213926 AGGTTCCATTCCATCCTGCTC 59.786 52.381 0.00 0.00 0.00 4.26
1550 3292 1.213926 GGTTCCATTCCATCCTGCTCT 59.786 52.381 0.00 0.00 0.00 4.09
1552 3294 1.135094 TCCATTCCATCCTGCTCTCC 58.865 55.000 0.00 0.00 0.00 3.71
1553 3295 1.138568 CCATTCCATCCTGCTCTCCT 58.861 55.000 0.00 0.00 0.00 3.69
1562 3304 4.837860 CCATCCTGCTCTCCTCTACTATTT 59.162 45.833 0.00 0.00 0.00 1.40
1565 3307 6.472686 TCCTGCTCTCCTCTACTATTTTTC 57.527 41.667 0.00 0.00 0.00 2.29
1575 3317 9.594478 CTCCTCTACTATTTTTCTCTTCTTTCC 57.406 37.037 0.00 0.00 0.00 3.13
1576 3318 9.327731 TCCTCTACTATTTTTCTCTTCTTTCCT 57.672 33.333 0.00 0.00 0.00 3.36
1577 3319 9.952030 CCTCTACTATTTTTCTCTTCTTTCCTT 57.048 33.333 0.00 0.00 0.00 3.36
1588 3330 9.799106 TTTCTCTTCTTTCCTTCATAAATCAGT 57.201 29.630 0.00 0.00 0.00 3.41
1589 3331 9.442047 TTCTCTTCTTTCCTTCATAAATCAGTC 57.558 33.333 0.00 0.00 0.00 3.51
1591 3333 8.783833 TCTTCTTTCCTTCATAAATCAGTCTG 57.216 34.615 0.00 0.00 0.00 3.51
1594 3336 6.596888 TCTTTCCTTCATAAATCAGTCTGCTG 59.403 38.462 0.00 0.00 43.87 4.41
1610 3352 3.254166 TCTGCTGCTTGGTCTTTTCATTC 59.746 43.478 0.00 0.00 0.00 2.67
1612 3354 2.669391 GCTGCTTGGTCTTTTCATTCCG 60.669 50.000 0.00 0.00 0.00 4.30
1613 3355 2.813754 CTGCTTGGTCTTTTCATTCCGA 59.186 45.455 0.00 0.00 0.00 4.55
1614 3356 3.420893 TGCTTGGTCTTTTCATTCCGAT 58.579 40.909 0.00 0.00 0.00 4.18
1615 3357 3.440173 TGCTTGGTCTTTTCATTCCGATC 59.560 43.478 0.00 0.00 0.00 3.69
1617 3359 4.265073 CTTGGTCTTTTCATTCCGATCCT 58.735 43.478 0.00 0.00 0.00 3.24
1619 3361 4.662278 TGGTCTTTTCATTCCGATCCTTT 58.338 39.130 0.00 0.00 0.00 3.11
1621 3363 5.183140 TGGTCTTTTCATTCCGATCCTTTTC 59.817 40.000 0.00 0.00 0.00 2.29
1622 3364 5.393135 GGTCTTTTCATTCCGATCCTTTTCC 60.393 44.000 0.00 0.00 0.00 3.13
1646 3864 1.732528 CGCTCAATCGTACGTCTCTC 58.267 55.000 16.05 1.06 0.00 3.20
1660 4209 8.905850 TCGTACGTCTCTCATAGATAGATAGAT 58.094 37.037 16.05 0.00 36.36 1.98
1748 4924 9.472361 GATAGATAGATAGATACTCTGTCCGTC 57.528 40.741 0.00 0.00 35.52 4.79
1762 4947 2.420722 TGTCCGTCCAAAAACACTTGTC 59.579 45.455 0.00 0.00 0.00 3.18
1763 4948 2.420722 GTCCGTCCAAAAACACTTGTCA 59.579 45.455 0.00 0.00 0.00 3.58
1766 4951 4.882427 TCCGTCCAAAAACACTTGTCATTA 59.118 37.500 0.00 0.00 0.00 1.90
1771 4956 8.055402 CGTCCAAAAACACTTGTCATTAAAATG 58.945 33.333 0.00 0.00 37.75 2.32
1773 4958 8.260818 TCCAAAAACACTTGTCATTAAAATGGA 58.739 29.630 3.00 0.00 37.03 3.41
1774 4959 9.054922 CCAAAAACACTTGTCATTAAAATGGAT 57.945 29.630 3.00 0.00 37.03 3.41
1795 5021 9.942526 ATGGATAAAAGAGAAGGGATATTTGTT 57.057 29.630 0.00 0.00 0.00 2.83
1803 5266 8.934023 AGAGAAGGGATATTTGTTTTTACACA 57.066 30.769 0.00 0.00 0.00 3.72
1804 5267 8.793592 AGAGAAGGGATATTTGTTTTTACACAC 58.206 33.333 0.00 0.00 0.00 3.82
1805 5268 7.892609 AGAAGGGATATTTGTTTTTACACACC 58.107 34.615 0.00 0.00 0.00 4.16
1807 5270 7.227049 AGGGATATTTGTTTTTACACACCTG 57.773 36.000 0.00 0.00 0.00 4.00
1808 5271 6.210584 AGGGATATTTGTTTTTACACACCTGG 59.789 38.462 0.00 0.00 0.00 4.45
1829 5321 1.303317 GGCCACGTCACCCAGATTT 60.303 57.895 0.00 0.00 0.00 2.17
1886 7723 2.352805 CTCCCACTCCACCCAAGC 59.647 66.667 0.00 0.00 0.00 4.01
1892 7729 2.677875 CTCCACCCAAGCCCAAGC 60.678 66.667 0.00 0.00 40.32 4.01
1928 7768 1.717032 GGCCAAAGGAAAGGAAAGGT 58.283 50.000 0.00 0.00 0.00 3.50
1929 7769 2.047061 GGCCAAAGGAAAGGAAAGGTT 58.953 47.619 0.00 0.00 0.00 3.50
1931 7771 2.434336 GCCAAAGGAAAGGAAAGGTTGT 59.566 45.455 0.00 0.00 0.00 3.32
1934 7774 4.441495 CCAAAGGAAAGGAAAGGTTGTGAC 60.441 45.833 0.00 0.00 0.00 3.67
1940 7804 5.507985 GGAAAGGAAAGGTTGTGACTGAATG 60.508 44.000 0.00 0.00 0.00 2.67
1955 7819 1.075212 TGAATGGGGTCAGTTCATGCA 59.925 47.619 0.00 0.00 0.00 3.96
1958 7822 1.303561 GGGGTCAGTTCATGCAGCA 60.304 57.895 0.00 0.00 0.00 4.41
1959 7823 0.895100 GGGGTCAGTTCATGCAGCAA 60.895 55.000 0.00 0.00 0.00 3.91
1960 7824 0.242017 GGGTCAGTTCATGCAGCAAC 59.758 55.000 0.00 0.00 0.00 4.17
1961 7825 0.110056 GGTCAGTTCATGCAGCAACG 60.110 55.000 0.00 0.00 0.00 4.10
1962 7826 0.867746 GTCAGTTCATGCAGCAACGA 59.132 50.000 0.00 0.00 0.00 3.85
1963 7827 0.867746 TCAGTTCATGCAGCAACGAC 59.132 50.000 0.00 0.00 0.00 4.34
1964 7828 0.451628 CAGTTCATGCAGCAACGACG 60.452 55.000 0.00 0.00 0.00 5.12
1965 7829 0.599991 AGTTCATGCAGCAACGACGA 60.600 50.000 0.00 0.00 0.00 4.20
1966 7830 0.451135 GTTCATGCAGCAACGACGAC 60.451 55.000 0.00 0.00 0.00 4.34
1967 7831 1.885814 TTCATGCAGCAACGACGACG 61.886 55.000 5.58 5.58 45.75 5.12
1968 7832 2.049526 ATGCAGCAACGACGACGA 60.050 55.556 15.32 0.00 42.66 4.20
1969 7833 2.372690 ATGCAGCAACGACGACGAC 61.373 57.895 15.32 3.02 42.66 4.34
1970 7834 4.104633 GCAGCAACGACGACGACG 62.105 66.667 17.60 17.60 42.66 5.12
1971 7835 2.426261 CAGCAACGACGACGACGA 60.426 61.111 25.15 0.00 42.66 4.20
1972 7836 2.426425 AGCAACGACGACGACGAC 60.426 61.111 25.15 13.78 42.66 4.34
1973 7837 3.456039 GCAACGACGACGACGACC 61.456 66.667 25.15 9.44 42.66 4.79
1974 7838 2.051971 CAACGACGACGACGACCA 60.052 61.111 25.15 0.00 42.66 4.02
1975 7839 2.051882 AACGACGACGACGACCAC 60.052 61.111 25.15 1.87 42.66 4.16
1976 7840 3.527360 AACGACGACGACGACCACC 62.527 63.158 25.15 0.00 42.66 4.61
1977 7841 4.016629 CGACGACGACGACCACCA 62.017 66.667 15.32 0.00 42.66 4.17
1978 7842 2.126965 GACGACGACGACCACCAG 60.127 66.667 15.32 0.00 42.66 4.00
1990 7854 3.073228 CCACCAGGTCCAGAGAGAA 57.927 57.895 0.00 0.00 0.00 2.87
1998 7862 3.696051 CAGGTCCAGAGAGAAAGAGAGAG 59.304 52.174 0.00 0.00 0.00 3.20
1999 7863 3.591527 AGGTCCAGAGAGAAAGAGAGAGA 59.408 47.826 0.00 0.00 0.00 3.10
2000 7864 3.947834 GGTCCAGAGAGAAAGAGAGAGAG 59.052 52.174 0.00 0.00 0.00 3.20
2001 7865 4.324254 GGTCCAGAGAGAAAGAGAGAGAGA 60.324 50.000 0.00 0.00 0.00 3.10
2004 7868 4.202441 CAGAGAGAAAGAGAGAGAGAGGG 58.798 52.174 0.00 0.00 0.00 4.30
2043 8303 2.293399 GGTGTTGGACCAAATGTCTGTC 59.707 50.000 8.94 0.00 45.34 3.51
2044 8304 3.214328 GTGTTGGACCAAATGTCTGTCT 58.786 45.455 8.94 0.00 43.89 3.41
2045 8305 3.251004 GTGTTGGACCAAATGTCTGTCTC 59.749 47.826 8.94 0.00 43.89 3.36
2046 8306 3.136443 TGTTGGACCAAATGTCTGTCTCT 59.864 43.478 8.94 0.00 43.89 3.10
2047 8307 4.346709 TGTTGGACCAAATGTCTGTCTCTA 59.653 41.667 8.94 0.00 43.89 2.43
2048 8308 5.163248 TGTTGGACCAAATGTCTGTCTCTAA 60.163 40.000 8.94 0.00 43.89 2.10
2050 8310 4.346709 TGGACCAAATGTCTGTCTCTAACA 59.653 41.667 0.00 0.00 43.89 2.41
2051 8311 4.691216 GGACCAAATGTCTGTCTCTAACAC 59.309 45.833 0.00 0.00 43.89 3.32
2055 8315 2.391926 TGTCTGTCTCTAACACCCCA 57.608 50.000 0.00 0.00 33.24 4.96
2056 8316 2.684943 TGTCTGTCTCTAACACCCCAA 58.315 47.619 0.00 0.00 33.24 4.12
2058 8318 1.975680 TCTGTCTCTAACACCCCAACC 59.024 52.381 0.00 0.00 33.24 3.77
2064 8324 2.791501 CTAACACCCCAACCCGTCCG 62.792 65.000 0.00 0.00 0.00 4.79
2068 8328 4.462280 CCCCAACCCGTCCGCTAC 62.462 72.222 0.00 0.00 0.00 3.58
2082 8342 3.248171 CTACGCTCGCGGCTCAAC 61.248 66.667 16.18 0.00 44.69 3.18
2088 8348 4.980805 TCGCGGCTCAACCACACC 62.981 66.667 6.13 0.00 39.03 4.16
2092 8352 2.542907 CGGCTCAACCACACCACAC 61.543 63.158 0.00 0.00 39.03 3.82
2093 8353 2.193536 GGCTCAACCACACCACACC 61.194 63.158 0.00 0.00 38.86 4.16
2094 8354 1.453015 GCTCAACCACACCACACCA 60.453 57.895 0.00 0.00 0.00 4.17
2095 8355 1.447317 GCTCAACCACACCACACCAG 61.447 60.000 0.00 0.00 0.00 4.00
2096 8356 0.180171 CTCAACCACACCACACCAGA 59.820 55.000 0.00 0.00 0.00 3.86
2097 8357 0.107410 TCAACCACACCACACCAGAC 60.107 55.000 0.00 0.00 0.00 3.51
2098 8358 1.101049 CAACCACACCACACCAGACC 61.101 60.000 0.00 0.00 0.00 3.85
2099 8359 1.567208 AACCACACCACACCAGACCA 61.567 55.000 0.00 0.00 0.00 4.02
2100 8360 1.227943 CCACACCACACCAGACCAG 60.228 63.158 0.00 0.00 0.00 4.00
2101 8361 1.695114 CCACACCACACCAGACCAGA 61.695 60.000 0.00 0.00 0.00 3.86
2102 8362 0.250038 CACACCACACCAGACCAGAG 60.250 60.000 0.00 0.00 0.00 3.35
2103 8363 0.398522 ACACCACACCAGACCAGAGA 60.399 55.000 0.00 0.00 0.00 3.10
2105 8365 1.122019 ACCACACCAGACCAGAGACC 61.122 60.000 0.00 0.00 0.00 3.85
2110 8370 1.001406 CACCAGACCAGAGACCACTTC 59.999 57.143 0.00 0.00 0.00 3.01
2111 8371 0.610687 CCAGACCAGAGACCACTTCC 59.389 60.000 0.00 0.00 0.00 3.46
2114 8374 3.370104 CAGACCAGAGACCACTTCCTAT 58.630 50.000 0.00 0.00 0.00 2.57
2115 8375 3.383185 CAGACCAGAGACCACTTCCTATC 59.617 52.174 0.00 0.00 0.00 2.08
2116 8376 2.359531 GACCAGAGACCACTTCCTATCG 59.640 54.545 0.00 0.00 0.00 2.92
2117 8377 2.291670 ACCAGAGACCACTTCCTATCGT 60.292 50.000 0.00 0.00 0.00 3.73
2118 8378 3.053842 ACCAGAGACCACTTCCTATCGTA 60.054 47.826 0.00 0.00 0.00 3.43
2119 8379 4.145807 CCAGAGACCACTTCCTATCGTAT 58.854 47.826 0.00 0.00 0.00 3.06
2120 8380 4.216687 CCAGAGACCACTTCCTATCGTATC 59.783 50.000 0.00 0.00 0.00 2.24
2124 8384 6.012333 AGAGACCACTTCCTATCGTATCCTAT 60.012 42.308 0.00 0.00 0.00 2.57
2150 8410 9.322769 TCCTATCCTATCCTTAATTGAGTTACC 57.677 37.037 0.00 0.00 0.00 2.85
2151 8411 9.101325 CCTATCCTATCCTTAATTGAGTTACCA 57.899 37.037 0.00 0.00 0.00 3.25
2161 8637 2.584835 TGAGTTACCATTGCCTTGCT 57.415 45.000 0.00 0.00 0.00 3.91
2188 8668 9.342308 GTATCAATCAAATTTCCACATCCTCTA 57.658 33.333 0.00 0.00 0.00 2.43
2223 8823 0.764890 TACTGTGCCCACTGCTTCTT 59.235 50.000 5.37 0.00 42.00 2.52
2224 8824 0.106519 ACTGTGCCCACTGCTTCTTT 60.107 50.000 5.37 0.00 42.00 2.52
2225 8825 1.142870 ACTGTGCCCACTGCTTCTTTA 59.857 47.619 5.37 0.00 42.00 1.85
2226 8826 2.224867 ACTGTGCCCACTGCTTCTTTAT 60.225 45.455 5.37 0.00 42.00 1.40
2227 8827 2.161855 TGTGCCCACTGCTTCTTTATG 58.838 47.619 0.00 0.00 42.00 1.90
2228 8828 2.224744 TGTGCCCACTGCTTCTTTATGA 60.225 45.455 0.00 0.00 42.00 2.15
2229 8829 2.162408 GTGCCCACTGCTTCTTTATGAC 59.838 50.000 0.00 0.00 42.00 3.06
2230 8830 2.040278 TGCCCACTGCTTCTTTATGACT 59.960 45.455 0.00 0.00 42.00 3.41
2231 8831 2.680339 GCCCACTGCTTCTTTATGACTC 59.320 50.000 0.00 0.00 36.87 3.36
2232 8832 3.620966 GCCCACTGCTTCTTTATGACTCT 60.621 47.826 0.00 0.00 36.87 3.24
2233 8833 4.187694 CCCACTGCTTCTTTATGACTCTC 58.812 47.826 0.00 0.00 0.00 3.20
2234 8834 4.081198 CCCACTGCTTCTTTATGACTCTCT 60.081 45.833 0.00 0.00 0.00 3.10
2260 8860 3.315470 TGTCTGTCTGTCTGTCTGTGTAC 59.685 47.826 0.00 0.00 0.00 2.90
2269 8932 2.094659 GTCTGTGTACGCAGCGCAT 61.095 57.895 27.91 0.00 36.49 4.73
2452 9162 4.411013 CCATCCAGGTTTCTTCTTCCTTT 58.589 43.478 0.00 0.00 0.00 3.11
2453 9163 4.460731 CCATCCAGGTTTCTTCTTCCTTTC 59.539 45.833 0.00 0.00 0.00 2.62
2454 9164 4.100279 TCCAGGTTTCTTCTTCCTTTCC 57.900 45.455 0.00 0.00 0.00 3.13
2455 9165 3.722101 TCCAGGTTTCTTCTTCCTTTCCT 59.278 43.478 0.00 0.00 0.00 3.36
2457 9167 4.895889 CCAGGTTTCTTCTTCCTTTCCTTT 59.104 41.667 0.00 0.00 0.00 3.11
2458 9168 5.363868 CCAGGTTTCTTCTTCCTTTCCTTTT 59.636 40.000 0.00 0.00 0.00 2.27
2459 9169 6.461648 CCAGGTTTCTTCTTCCTTTCCTTTTC 60.462 42.308 0.00 0.00 0.00 2.29
2460 9170 6.322456 CAGGTTTCTTCTTCCTTTCCTTTTCT 59.678 38.462 0.00 0.00 0.00 2.52
2462 9172 7.400339 AGGTTTCTTCTTCCTTTCCTTTTCTTT 59.600 33.333 0.00 0.00 0.00 2.52
2521 9265 6.012113 TCTTTACCACACAAGCCTACTACTA 58.988 40.000 0.00 0.00 0.00 1.82
2674 9596 5.440610 TCAAGGTCTGCTTTCTTTCTTTCT 58.559 37.500 0.00 0.00 0.00 2.52
2675 9597 5.888161 TCAAGGTCTGCTTTCTTTCTTTCTT 59.112 36.000 0.00 0.00 0.00 2.52
2676 9598 6.378280 TCAAGGTCTGCTTTCTTTCTTTCTTT 59.622 34.615 0.00 0.00 0.00 2.52
2677 9599 6.384258 AGGTCTGCTTTCTTTCTTTCTTTC 57.616 37.500 0.00 0.00 0.00 2.62
2679 9601 6.605194 AGGTCTGCTTTCTTTCTTTCTTTCTT 59.395 34.615 0.00 0.00 0.00 2.52
2680 9602 7.123397 AGGTCTGCTTTCTTTCTTTCTTTCTTT 59.877 33.333 0.00 0.00 0.00 2.52
2681 9603 7.433719 GGTCTGCTTTCTTTCTTTCTTTCTTTC 59.566 37.037 0.00 0.00 0.00 2.62
2682 9604 8.187480 GTCTGCTTTCTTTCTTTCTTTCTTTCT 58.813 33.333 0.00 0.00 0.00 2.52
2683 9605 8.743714 TCTGCTTTCTTTCTTTCTTTCTTTCTT 58.256 29.630 0.00 0.00 0.00 2.52
2684 9606 9.363763 CTGCTTTCTTTCTTTCTTTCTTTCTTT 57.636 29.630 0.00 0.00 0.00 2.52
2686 9608 9.579768 GCTTTCTTTCTTTCTTTCTTTCTTTCT 57.420 29.630 0.00 0.00 0.00 2.52
2711 9633 9.500864 CTTTCTTTCTTTCTTTCTTTCTGTCAG 57.499 33.333 0.00 0.00 0.00 3.51
2713 9635 6.599244 TCTTTCTTTCTTTCTTTCTGTCAGCA 59.401 34.615 0.00 0.00 0.00 4.41
2714 9636 5.998454 TCTTTCTTTCTTTCTGTCAGCAG 57.002 39.130 0.00 0.00 43.87 4.24
2715 9637 4.274459 TCTTTCTTTCTTTCTGTCAGCAGC 59.726 41.667 0.00 0.00 42.29 5.25
2721 9643 2.158914 TCTTTCTGTCAGCAGCACTTGA 60.159 45.455 0.00 0.00 42.29 3.02
2724 9646 3.683365 TCTGTCAGCAGCACTTGATTA 57.317 42.857 0.00 0.00 42.29 1.75
2759 9702 6.257423 TGCTTATGCATTATGAGTTTGAACG 58.743 36.000 3.54 0.00 45.31 3.95
2761 9704 6.412072 GCTTATGCATTATGAGTTTGAACGAC 59.588 38.462 3.54 0.00 39.41 4.34
2762 9705 4.678509 TGCATTATGAGTTTGAACGACC 57.321 40.909 0.00 0.00 0.00 4.79
2763 9706 3.124466 TGCATTATGAGTTTGAACGACCG 59.876 43.478 0.00 0.00 0.00 4.79
2764 9707 3.670203 CATTATGAGTTTGAACGACCGC 58.330 45.455 0.00 0.00 0.00 5.68
2766 9709 1.897398 ATGAGTTTGAACGACCGCGC 61.897 55.000 0.00 0.00 42.48 6.86
2767 9710 3.609422 GAGTTTGAACGACCGCGCG 62.609 63.158 25.67 25.67 42.48 6.86
2782 9725 1.995991 CGCGCGGGCATATACATAC 59.004 57.895 24.84 0.00 39.92 2.39
2784 9727 1.434555 GCGCGGGCATATACATACAA 58.565 50.000 20.76 0.00 39.62 2.41
2788 9731 4.093703 GCGCGGGCATATACATACAAATAA 59.906 41.667 20.76 0.00 39.62 1.40
2790 9733 5.579119 CGCGGGCATATACATACAAATAAGA 59.421 40.000 0.00 0.00 0.00 2.10
2793 9736 7.962918 GCGGGCATATACATACAAATAAGAAAG 59.037 37.037 0.00 0.00 0.00 2.62
2794 9737 9.214957 CGGGCATATACATACAAATAAGAAAGA 57.785 33.333 0.00 0.00 0.00 2.52
2867 9810 1.271656 ACGTTTGAGGAGTTCTACCCG 59.728 52.381 0.00 0.00 0.00 5.28
2963 9906 2.046892 AGGCGCTGCTTAGGTGTG 60.047 61.111 7.64 0.00 0.00 3.82
3110 10053 5.125097 TGTTACCGATCTTACTCTCAAGGTC 59.875 44.000 0.00 0.00 33.14 3.85
3112 10055 4.087182 ACCGATCTTACTCTCAAGGTCAA 58.913 43.478 0.00 0.00 35.72 3.18
3113 10056 4.082136 ACCGATCTTACTCTCAAGGTCAAC 60.082 45.833 0.00 0.00 35.72 3.18
3116 10059 5.518128 CGATCTTACTCTCAAGGTCAACATG 59.482 44.000 0.00 0.00 35.72 3.21
3118 10061 2.936919 ACTCTCAAGGTCAACATGCA 57.063 45.000 0.00 0.00 0.00 3.96
3120 10063 3.079578 ACTCTCAAGGTCAACATGCATG 58.920 45.455 25.09 25.09 0.00 4.06
3121 10064 1.814394 TCTCAAGGTCAACATGCATGC 59.186 47.619 26.53 11.82 0.00 4.06
3128 10071 4.212716 AGGTCAACATGCATGCATCTAAT 58.787 39.130 30.07 13.22 33.90 1.73
3135 10078 9.602568 TCAACATGCATGCATCTAATTTAATTT 57.397 25.926 30.07 2.66 33.90 1.82
3139 10082 9.692749 CATGCATGCATCTAATTTAATTTCTCT 57.307 29.630 30.07 0.61 33.90 3.10
3142 10085 9.609950 GCATGCATCTAATTTAATTTCTCTCTC 57.390 33.333 14.21 0.00 0.00 3.20
3157 10101 5.638530 TCTCTCTCTCTCTAGGCACATTA 57.361 43.478 0.00 0.00 0.00 1.90
3160 10104 7.066142 TCTCTCTCTCTCTAGGCACATTATTT 58.934 38.462 0.00 0.00 0.00 1.40
3161 10105 7.014134 TCTCTCTCTCTCTAGGCACATTATTTG 59.986 40.741 0.00 0.00 0.00 2.32
3162 10106 6.836007 TCTCTCTCTCTAGGCACATTATTTGA 59.164 38.462 0.00 0.00 0.00 2.69
3163 10107 6.810911 TCTCTCTCTAGGCACATTATTTGAC 58.189 40.000 0.00 0.00 0.00 3.18
3165 10109 6.810911 TCTCTCTAGGCACATTATTTGACTC 58.189 40.000 0.00 0.00 0.00 3.36
3168 10112 7.624549 TCTCTAGGCACATTATTTGACTCTTT 58.375 34.615 0.00 0.00 0.00 2.52
3169 10113 8.103305 TCTCTAGGCACATTATTTGACTCTTTT 58.897 33.333 0.00 0.00 0.00 2.27
3191 10135 9.639601 CTTTTTAACAAGAAGAAAAACCTCACT 57.360 29.630 0.00 0.00 30.89 3.41
3192 10136 9.634163 TTTTTAACAAGAAGAAAAACCTCACTC 57.366 29.630 0.00 0.00 29.46 3.51
3193 10137 8.575649 TTTAACAAGAAGAAAAACCTCACTCT 57.424 30.769 0.00 0.00 0.00 3.24
3200 10144 7.127917 GAAGAAAAACCTCACTCTTCTCATC 57.872 40.000 3.92 0.00 40.33 2.92
3201 10145 6.432403 AGAAAAACCTCACTCTTCTCATCT 57.568 37.500 0.00 0.00 0.00 2.90
3202 10146 7.546250 AGAAAAACCTCACTCTTCTCATCTA 57.454 36.000 0.00 0.00 0.00 1.98
3203 10147 7.967908 AGAAAAACCTCACTCTTCTCATCTAA 58.032 34.615 0.00 0.00 0.00 2.10
3306 10250 1.456923 GAAGCGTGTAACAACCGGTAC 59.543 52.381 8.00 2.01 35.74 3.34
3324 10268 4.667262 GGTACGCATGCACATCAATAAAA 58.333 39.130 19.57 0.00 0.00 1.52
3326 10270 6.434596 GGTACGCATGCACATCAATAAAATA 58.565 36.000 19.57 0.00 0.00 1.40
3349 10294 6.819397 AAAATAAGCTCAACCACTTACTCC 57.181 37.500 0.00 0.00 31.51 3.85
3350 10295 2.861147 AAGCTCAACCACTTACTCCC 57.139 50.000 0.00 0.00 0.00 4.30
3353 10298 1.903183 GCTCAACCACTTACTCCCTCT 59.097 52.381 0.00 0.00 0.00 3.69
3354 10299 2.354203 GCTCAACCACTTACTCCCTCTG 60.354 54.545 0.00 0.00 0.00 3.35
3356 10301 3.314693 TCAACCACTTACTCCCTCTGTT 58.685 45.455 0.00 0.00 0.00 3.16
3357 10302 3.714798 TCAACCACTTACTCCCTCTGTTT 59.285 43.478 0.00 0.00 0.00 2.83
3358 10303 4.065789 CAACCACTTACTCCCTCTGTTTC 58.934 47.826 0.00 0.00 0.00 2.78
3359 10304 3.314693 ACCACTTACTCCCTCTGTTTCA 58.685 45.455 0.00 0.00 0.00 2.69
3360 10305 3.714798 ACCACTTACTCCCTCTGTTTCAA 59.285 43.478 0.00 0.00 0.00 2.69
3362 10307 5.130350 CCACTTACTCCCTCTGTTTCAAAA 58.870 41.667 0.00 0.00 0.00 2.44
3364 10309 6.940298 CCACTTACTCCCTCTGTTTCAAAATA 59.060 38.462 0.00 0.00 0.00 1.40
3365 10310 7.119846 CCACTTACTCCCTCTGTTTCAAAATAG 59.880 40.741 0.00 0.00 0.00 1.73
3366 10311 7.878127 CACTTACTCCCTCTGTTTCAAAATAGA 59.122 37.037 2.56 2.56 35.32 1.98
3369 10314 7.020827 ACTCCCTCTGTTTCAAAATAGATGA 57.979 36.000 2.91 3.20 35.92 2.92
3370 10315 6.881602 ACTCCCTCTGTTTCAAAATAGATGAC 59.118 38.462 2.91 0.00 35.92 3.06
3371 10316 7.020827 TCCCTCTGTTTCAAAATAGATGACT 57.979 36.000 2.91 0.00 35.92 3.41
3372 10317 7.106239 TCCCTCTGTTTCAAAATAGATGACTC 58.894 38.462 2.91 0.00 35.92 3.36
3375 10320 8.233190 CCTCTGTTTCAAAATAGATGACTCAAC 58.767 37.037 2.91 0.00 35.92 3.18
3376 10321 8.908786 TCTGTTTCAAAATAGATGACTCAACT 57.091 30.769 0.00 0.00 32.24 3.16
3377 10322 9.342308 TCTGTTTCAAAATAGATGACTCAACTT 57.658 29.630 0.00 0.00 32.24 2.66
3378 10323 9.956720 CTGTTTCAAAATAGATGACTCAACTTT 57.043 29.630 0.00 0.00 29.67 2.66
3379 10324 9.734620 TGTTTCAAAATAGATGACTCAACTTTG 57.265 29.630 0.00 0.00 0.00 2.77
3380 10325 9.736023 GTTTCAAAATAGATGACTCAACTTTGT 57.264 29.630 0.00 0.00 0.00 2.83
3383 10328 9.778741 TCAAAATAGATGACTCAACTTTGTACT 57.221 29.630 0.00 0.00 0.00 2.73
3393 10338 9.880157 TGACTCAACTTTGTACTAAAGTTAGTT 57.120 29.630 23.56 15.61 45.57 2.24
3410 10355 9.880157 AAAGTTAGTTAGTACAAAGTTGAGTCA 57.120 29.630 0.00 0.00 0.00 3.41
3412 10357 9.694137 AGTTAGTTAGTACAAAGTTGAGTCATC 57.306 33.333 0.00 0.00 0.00 2.92
3413 10358 9.694137 GTTAGTTAGTACAAAGTTGAGTCATCT 57.306 33.333 0.00 0.00 0.00 2.90
3420 10365 9.003658 AGTACAAAGTTGAGTCATCTATTTTGG 57.996 33.333 14.35 0.00 40.00 3.28
3421 10366 8.999431 GTACAAAGTTGAGTCATCTATTTTGGA 58.001 33.333 14.35 6.88 40.00 3.53
3422 10367 8.463930 ACAAAGTTGAGTCATCTATTTTGGAA 57.536 30.769 14.35 0.00 40.00 3.53
3423 10368 8.352942 ACAAAGTTGAGTCATCTATTTTGGAAC 58.647 33.333 14.35 0.00 40.00 3.62
3424 10369 6.727824 AGTTGAGTCATCTATTTTGGAACG 57.272 37.500 1.70 0.00 0.00 3.95
3425 10370 5.643777 AGTTGAGTCATCTATTTTGGAACGG 59.356 40.000 1.70 0.00 0.00 4.44
3426 10371 5.414789 TGAGTCATCTATTTTGGAACGGA 57.585 39.130 0.00 0.00 0.00 4.69
3427 10372 5.419542 TGAGTCATCTATTTTGGAACGGAG 58.580 41.667 0.00 0.00 0.00 4.63
3428 10373 4.770795 AGTCATCTATTTTGGAACGGAGG 58.229 43.478 0.00 0.00 0.00 4.30
3429 10374 3.877508 GTCATCTATTTTGGAACGGAGGG 59.122 47.826 0.00 0.00 0.00 4.30
3430 10375 3.778075 TCATCTATTTTGGAACGGAGGGA 59.222 43.478 0.00 0.00 0.00 4.20
3438 10383 1.897802 TGGAACGGAGGGAGTAGAAAC 59.102 52.381 0.00 0.00 0.00 2.78
3439 10384 1.206610 GGAACGGAGGGAGTAGAAACC 59.793 57.143 0.00 0.00 0.00 3.27
3442 10387 1.622312 ACGGAGGGAGTAGAAACCAAC 59.378 52.381 0.00 0.00 0.00 3.77
3472 10417 6.814343 ACTTAATTAATGTTGTGTCGTCGTC 58.186 36.000 0.00 0.00 0.00 4.20
3473 10418 3.965209 ATTAATGTTGTGTCGTCGTCG 57.035 42.857 0.00 0.00 38.55 5.12
3475 10420 1.126079 AATGTTGTGTCGTCGTCGTC 58.874 50.000 1.33 0.00 38.33 4.20
3476 10421 0.995234 ATGTTGTGTCGTCGTCGTCG 60.995 55.000 5.50 5.50 38.33 5.12
3532 10508 2.731572 AGGGCTTTGTTCATGGATGAG 58.268 47.619 0.00 0.00 38.19 2.90
3700 10676 7.010771 TGCTATCAGAAGGGTACATAGTGTAT 58.989 38.462 0.00 0.00 35.05 2.29
3727 10703 0.163788 CACGCGACAACATCTTGGAC 59.836 55.000 15.93 0.00 0.00 4.02
3742 10718 1.609208 TGGACTTCTTTGAAGCTGCC 58.391 50.000 7.17 7.19 0.00 4.85
3958 10934 0.529378 CCAAAACTCATCCTGCTGCC 59.471 55.000 0.00 0.00 0.00 4.85
4222 11198 2.872245 GTTTGCTGAGCTACAACTGACA 59.128 45.455 5.83 0.00 0.00 3.58
4462 11615 8.579850 TGGTAACTTCATCTATTTGCTCATTT 57.420 30.769 0.00 0.00 37.61 2.32
4586 11739 3.321682 ACACCTTTGGGATGTTTGTGATG 59.678 43.478 0.00 0.00 36.25 3.07
4701 11919 7.562454 TCGATGAAAGTGAAAGTAAACCTTT 57.438 32.000 0.00 0.00 46.11 3.11
4702 11920 7.992008 TCGATGAAAGTGAAAGTAAACCTTTT 58.008 30.769 0.00 0.00 43.47 2.27
4703 11921 8.126700 TCGATGAAAGTGAAAGTAAACCTTTTC 58.873 33.333 0.00 0.00 43.47 2.29
4727 11951 6.881065 TCTGTCTCTGTCCTGATTTTTAATGG 59.119 38.462 0.00 0.00 0.00 3.16
4822 12046 8.411683 GCAATATCAGTCAATGAATTCCTTTCT 58.588 33.333 2.27 0.00 42.53 2.52
5209 12440 4.828939 TGGTTTCTTCTAAGTCGGACAGTA 59.171 41.667 11.27 1.38 0.00 2.74
5210 12441 5.159925 GGTTTCTTCTAAGTCGGACAGTAC 58.840 45.833 11.27 2.42 0.00 2.73
5211 12442 5.048154 GGTTTCTTCTAAGTCGGACAGTACT 60.048 44.000 11.27 0.00 0.00 2.73
5226 12457 5.513267 GGACAGTACTGAAGGGATCACTTTT 60.513 44.000 29.30 2.22 33.47 2.27
5227 12458 5.308825 ACAGTACTGAAGGGATCACTTTTG 58.691 41.667 29.30 10.20 33.47 2.44
5228 12459 5.163195 ACAGTACTGAAGGGATCACTTTTGT 60.163 40.000 29.30 15.28 33.47 2.83
5229 12460 6.042781 ACAGTACTGAAGGGATCACTTTTGTA 59.957 38.462 29.30 14.32 33.47 2.41
5231 12462 7.278868 CAGTACTGAAGGGATCACTTTTGTATC 59.721 40.741 18.45 11.61 33.47 2.24
5232 12463 5.501156 ACTGAAGGGATCACTTTTGTATCC 58.499 41.667 12.49 0.00 38.79 2.59
5234 12465 6.443849 ACTGAAGGGATCACTTTTGTATCCTA 59.556 38.462 12.49 0.00 39.36 2.94
5235 12466 6.889198 TGAAGGGATCACTTTTGTATCCTAG 58.111 40.000 12.49 0.00 39.36 3.02
5236 12467 5.297569 AGGGATCACTTTTGTATCCTAGC 57.702 43.478 0.00 0.00 39.36 3.42
5238 12469 6.143915 AGGGATCACTTTTGTATCCTAGCTA 58.856 40.000 0.00 0.00 39.36 3.32
5239 12470 6.268847 AGGGATCACTTTTGTATCCTAGCTAG 59.731 42.308 14.20 14.20 39.36 3.42
5240 12471 6.042208 GGGATCACTTTTGTATCCTAGCTAGT 59.958 42.308 19.31 4.58 39.36 2.57
5241 12472 6.926272 GGATCACTTTTGTATCCTAGCTAGTG 59.074 42.308 19.31 9.52 36.93 2.74
5242 12473 5.661458 TCACTTTTGTATCCTAGCTAGTGC 58.339 41.667 19.31 6.28 40.05 4.40
5269 12500 4.307432 ACTGTAAAGGTGACAACATCTCG 58.693 43.478 0.00 0.00 36.34 4.04
5280 12511 6.404403 GGTGACAACATCTCGACTAATACTGA 60.404 42.308 0.00 0.00 0.00 3.41
5281 12512 7.027760 GTGACAACATCTCGACTAATACTGAA 58.972 38.462 0.00 0.00 0.00 3.02
5282 12513 7.219154 GTGACAACATCTCGACTAATACTGAAG 59.781 40.741 0.00 0.00 0.00 3.02
5326 12557 5.640783 CAGACAAACACTGAAGCATCTATCA 59.359 40.000 0.00 0.00 37.54 2.15
5334 12565 4.820716 ACTGAAGCATCTATCAAAGCATCC 59.179 41.667 0.00 0.00 0.00 3.51
5395 12626 2.654385 ACTGGAGATTGGGGATTTTGGA 59.346 45.455 0.00 0.00 0.00 3.53
5609 12893 5.752036 TCAGACAAGGAGAATGAGAATGT 57.248 39.130 0.00 0.00 0.00 2.71
5670 13004 4.314961 TCCATATTACACTATTGCAGCCG 58.685 43.478 0.00 0.00 0.00 5.52
5671 13005 3.120199 CCATATTACACTATTGCAGCCGC 60.120 47.826 0.00 0.00 39.24 6.53
5676 13010 1.338674 ACACTATTGCAGCCGCTAACA 60.339 47.619 0.00 0.00 39.64 2.41
5677 13011 1.737236 CACTATTGCAGCCGCTAACAA 59.263 47.619 9.71 9.71 39.64 2.83
5685 13019 4.888917 TGCAGCCGCTAACAATATATACA 58.111 39.130 0.00 0.00 39.64 2.29
5686 13020 5.487433 TGCAGCCGCTAACAATATATACAT 58.513 37.500 0.00 0.00 39.64 2.29
5687 13021 6.635755 TGCAGCCGCTAACAATATATACATA 58.364 36.000 0.00 0.00 39.64 2.29
5737 13110 6.406692 TCACTTGCAATATCTCTAGGTACC 57.593 41.667 2.73 2.73 0.00 3.34
5741 13114 8.367911 CACTTGCAATATCTCTAGGTACCAATA 58.632 37.037 15.94 4.27 0.00 1.90
5742 13115 9.105844 ACTTGCAATATCTCTAGGTACCAATAT 57.894 33.333 15.94 6.35 0.00 1.28
5773 13146 1.485066 ACAAACCGACCAACTCAGACT 59.515 47.619 0.00 0.00 0.00 3.24
5926 13324 2.170397 ACATTATCTGCCGATGTGGACA 59.830 45.455 0.20 0.00 42.00 4.02
5934 13332 3.006940 TGCCGATGTGGACAGAAAATAC 58.993 45.455 0.00 0.00 42.00 1.89
5941 13339 6.594159 CGATGTGGACAGAAAATACTTTAGGT 59.406 38.462 0.00 0.00 0.00 3.08
5943 13341 6.235664 TGTGGACAGAAAATACTTTAGGTCC 58.764 40.000 10.63 10.63 42.62 4.46
5944 13342 5.350640 GTGGACAGAAAATACTTTAGGTCCG 59.649 44.000 12.04 0.00 43.88 4.79
5962 13390 7.387119 AGGTCCGTCTAACATAAAAATTTCC 57.613 36.000 0.00 0.00 0.00 3.13
6110 13538 5.501156 GGAAAACCACTCTAATGGATGTCT 58.499 41.667 0.00 0.00 43.02 3.41
6272 13700 2.114616 CCATTCTCTACTCTGCCTGGT 58.885 52.381 0.00 0.00 0.00 4.00
6286 13714 1.291877 CCTGGTTGCGTCTTTCCTCG 61.292 60.000 0.00 0.00 0.00 4.63
6324 13752 8.625786 AAAACAAGAAAGGTACCATATACGTT 57.374 30.769 15.94 7.72 0.00 3.99
6325 13753 7.605410 AACAAGAAAGGTACCATATACGTTG 57.395 36.000 15.94 10.16 0.00 4.10
6327 13755 7.039882 ACAAGAAAGGTACCATATACGTTGAG 58.960 38.462 15.94 0.00 0.00 3.02
6329 13757 7.040473 AGAAAGGTACCATATACGTTGAGAG 57.960 40.000 15.94 0.00 0.00 3.20
6331 13759 6.636562 AAGGTACCATATACGTTGAGAGAG 57.363 41.667 15.94 0.00 0.00 3.20
6333 13761 5.764192 AGGTACCATATACGTTGAGAGAGAC 59.236 44.000 15.94 0.00 0.00 3.36
6334 13762 5.764192 GGTACCATATACGTTGAGAGAGACT 59.236 44.000 7.15 0.00 0.00 3.24
6358 13808 7.040686 ACTCAAGTAATTAAAGATGCGGTGTTT 60.041 33.333 0.00 0.00 0.00 2.83
6359 13809 7.081349 TCAAGTAATTAAAGATGCGGTGTTTG 58.919 34.615 0.00 0.00 0.00 2.93
6361 13811 7.209471 AGTAATTAAAGATGCGGTGTTTGAA 57.791 32.000 0.00 0.00 0.00 2.69
6363 13813 6.763303 AATTAAAGATGCGGTGTTTGAAAC 57.237 33.333 0.14 0.14 0.00 2.78
6364 13814 5.508200 TTAAAGATGCGGTGTTTGAAACT 57.492 34.783 9.69 0.00 0.00 2.66
6368 13818 5.508200 AGATGCGGTGTTTGAAACTTTAA 57.492 34.783 9.69 0.00 0.00 1.52
6369 13819 5.278604 AGATGCGGTGTTTGAAACTTTAAC 58.721 37.500 9.69 0.00 0.00 2.01
6370 13820 4.705337 TGCGGTGTTTGAAACTTTAACT 57.295 36.364 9.69 0.00 0.00 2.24
6371 13821 4.664188 TGCGGTGTTTGAAACTTTAACTC 58.336 39.130 9.69 0.00 0.00 3.01
6372 13822 4.396790 TGCGGTGTTTGAAACTTTAACTCT 59.603 37.500 9.69 0.00 0.00 3.24
6373 13823 5.585445 TGCGGTGTTTGAAACTTTAACTCTA 59.415 36.000 9.69 0.00 0.00 2.43
6374 13824 6.134061 GCGGTGTTTGAAACTTTAACTCTAG 58.866 40.000 9.69 0.00 0.00 2.43
6415 13881 5.104259 AGAAATTAATCTTCACCCTCGCT 57.896 39.130 10.80 0.00 0.00 4.93
6416 13882 5.119694 AGAAATTAATCTTCACCCTCGCTC 58.880 41.667 10.80 0.00 0.00 5.03
6417 13883 2.579207 TTAATCTTCACCCTCGCTCG 57.421 50.000 0.00 0.00 0.00 5.03
6418 13884 0.102481 TAATCTTCACCCTCGCTCGC 59.898 55.000 0.00 0.00 0.00 5.03
6462 13928 5.065704 TGACTCTTGTAGAGCTTGATGTC 57.934 43.478 3.68 0.00 46.12 3.06
6540 14006 2.086054 AGAGACTGACAATTGCCGTC 57.914 50.000 5.05 9.50 0.00 4.79
6624 14090 2.655044 GCGGCCATTGTAATGCGC 60.655 61.111 2.24 0.00 39.42 6.09
6910 14611 4.546829 TGGTCGCCACTCTTATAAACTT 57.453 40.909 0.00 0.00 0.00 2.66
6959 14694 2.423538 AGCTTACATGTTTCGATTGGGC 59.576 45.455 2.30 0.00 0.00 5.36
6962 14697 0.527565 ACATGTTTCGATTGGGCAGC 59.472 50.000 0.00 0.00 0.00 5.25
6963 14698 0.527113 CATGTTTCGATTGGGCAGCA 59.473 50.000 0.00 0.00 0.00 4.41
7009 14852 9.571816 AATTGAATTAAAACCCATGATGTTGTT 57.428 25.926 0.00 0.00 0.00 2.83
7093 14936 1.224870 GCTGGAAGTTAGCTCCCCC 59.775 63.158 0.00 0.00 38.14 5.40
7150 14993 9.395707 GCTGAAATTTATGCTAATTCTGATCTG 57.604 33.333 7.41 0.00 0.00 2.90
7185 15051 7.770897 AGTAGCCAACCTTTCACTATTCTTATG 59.229 37.037 0.00 0.00 0.00 1.90
7213 15136 3.781079 TGTTGAAACAGAGTGCCAAAG 57.219 42.857 0.00 0.00 34.30 2.77
7219 15142 1.473258 ACAGAGTGCCAAAGTTGCAA 58.527 45.000 0.00 0.00 41.06 4.08
7261 15188 7.965107 GCACACTGAGTTCCTATTTCTTAAATG 59.035 37.037 0.00 0.00 32.38 2.32
7264 15191 9.003658 CACTGAGTTCCTATTTCTTAAATGTGT 57.996 33.333 0.00 0.00 32.38 3.72
7523 15453 5.229423 TGATCCTGTTTTGCTATTGTTTGC 58.771 37.500 0.00 0.00 0.00 3.68
7566 15508 4.136051 GGAGTACGTAGCTTCTATGGAGT 58.864 47.826 0.00 0.00 0.00 3.85
7567 15509 4.579753 GGAGTACGTAGCTTCTATGGAGTT 59.420 45.833 0.00 0.00 0.00 3.01
7568 15510 5.502153 AGTACGTAGCTTCTATGGAGTTG 57.498 43.478 0.00 0.00 0.00 3.16
7582 15524 4.519540 TGGAGTTGCTAATGCCTTTTTC 57.480 40.909 0.00 0.00 38.71 2.29
7584 15526 4.588528 TGGAGTTGCTAATGCCTTTTTCTT 59.411 37.500 0.00 0.00 38.71 2.52
7585 15527 5.164233 GGAGTTGCTAATGCCTTTTTCTTC 58.836 41.667 0.00 0.00 38.71 2.87
7586 15528 5.047731 GGAGTTGCTAATGCCTTTTTCTTCT 60.048 40.000 0.00 0.00 38.71 2.85
7587 15529 6.410942 AGTTGCTAATGCCTTTTTCTTCTT 57.589 33.333 0.00 0.00 38.71 2.52
7588 15530 6.450545 AGTTGCTAATGCCTTTTTCTTCTTC 58.549 36.000 0.00 0.00 38.71 2.87
7589 15531 6.266330 AGTTGCTAATGCCTTTTTCTTCTTCT 59.734 34.615 0.00 0.00 38.71 2.85
7590 15532 6.655078 TGCTAATGCCTTTTTCTTCTTCTT 57.345 33.333 0.00 0.00 38.71 2.52
7591 15533 6.681777 TGCTAATGCCTTTTTCTTCTTCTTC 58.318 36.000 0.00 0.00 38.71 2.87
7592 15534 6.491403 TGCTAATGCCTTTTTCTTCTTCTTCT 59.509 34.615 0.00 0.00 38.71 2.85
7593 15535 7.014615 TGCTAATGCCTTTTTCTTCTTCTTCTT 59.985 33.333 0.00 0.00 38.71 2.52
7594 15536 7.540400 GCTAATGCCTTTTTCTTCTTCTTCTTC 59.460 37.037 0.00 0.00 0.00 2.87
7595 15537 7.594351 AATGCCTTTTTCTTCTTCTTCTTCT 57.406 32.000 0.00 0.00 0.00 2.85
7596 15538 7.594351 ATGCCTTTTTCTTCTTCTTCTTCTT 57.406 32.000 0.00 0.00 0.00 2.52
7597 15539 7.032377 TGCCTTTTTCTTCTTCTTCTTCTTC 57.968 36.000 0.00 0.00 0.00 2.87
7598 15540 6.830838 TGCCTTTTTCTTCTTCTTCTTCTTCT 59.169 34.615 0.00 0.00 0.00 2.85
7599 15541 7.340487 TGCCTTTTTCTTCTTCTTCTTCTTCTT 59.660 33.333 0.00 0.00 0.00 2.52
7600 15542 7.860373 GCCTTTTTCTTCTTCTTCTTCTTCTTC 59.140 37.037 0.00 0.00 0.00 2.87
7601 15543 9.119418 CCTTTTTCTTCTTCTTCTTCTTCTTCT 57.881 33.333 0.00 0.00 0.00 2.85
7606 15548 9.541143 TTCTTCTTCTTCTTCTTCTTCTTCTTC 57.459 33.333 0.00 0.00 0.00 2.87
7609 15551 9.541143 TTCTTCTTCTTCTTCTTCTTCTTCTTC 57.459 33.333 0.00 0.00 0.00 2.87
7612 15554 9.541143 TTCTTCTTCTTCTTCTTCTTCTTCTTC 57.459 33.333 0.00 0.00 0.00 2.87
7613 15555 8.923270 TCTTCTTCTTCTTCTTCTTCTTCTTCT 58.077 33.333 0.00 0.00 0.00 2.85
7615 15557 9.541143 TTCTTCTTCTTCTTCTTCTTCTTCTTC 57.459 33.333 0.00 0.00 0.00 2.87
7670 15624 6.454848 CGCAACAAGATCTGTTCAATCTACTC 60.455 42.308 0.00 0.00 45.50 2.59
7679 15633 1.847328 TCAATCTACTCGGAGCCACA 58.153 50.000 4.58 0.00 0.00 4.17
7751 15705 0.781787 TTGTGTCAATCGAGCGAACG 59.218 50.000 0.00 0.00 0.00 3.95
7928 16294 2.159099 TGGAGGTGATCTACAACATCGC 60.159 50.000 0.00 0.00 38.92 4.58
7998 16364 1.754226 TGGAAAGCGGCAAAGTTCTTT 59.246 42.857 1.45 0.00 0.00 2.52
8103 16469 3.735746 TGCTCGCAAACATACTGATATCG 59.264 43.478 0.00 0.00 0.00 2.92
8165 16532 1.336517 CGTCAGACCGGTAAGCAAAGA 60.337 52.381 7.34 0.00 0.00 2.52
8183 16563 5.561125 GCAAAGAAAAATTAAGCAACGCATG 59.439 36.000 0.00 0.00 0.00 4.06
8230 16624 4.520492 GTCAAGACTGATGATTGGTTGGTT 59.480 41.667 0.00 0.00 33.05 3.67
8231 16625 4.520111 TCAAGACTGATGATTGGTTGGTTG 59.480 41.667 0.00 0.00 0.00 3.77
8232 16626 3.424703 AGACTGATGATTGGTTGGTTGG 58.575 45.455 0.00 0.00 0.00 3.77
8233 16627 3.157087 GACTGATGATTGGTTGGTTGGT 58.843 45.455 0.00 0.00 0.00 3.67
8234 16628 2.892852 ACTGATGATTGGTTGGTTGGTG 59.107 45.455 0.00 0.00 0.00 4.17
8235 16629 1.617850 TGATGATTGGTTGGTTGGTGC 59.382 47.619 0.00 0.00 0.00 5.01
8518 16915 3.735591 TGAACTTCCAGAAACGTTAGGG 58.264 45.455 0.00 3.68 0.00 3.53
8520 16917 1.418637 ACTTCCAGAAACGTTAGGGCA 59.581 47.619 0.00 0.00 0.00 5.36
8521 16918 2.158726 ACTTCCAGAAACGTTAGGGCAA 60.159 45.455 0.00 0.43 0.00 4.52
8522 16919 2.871096 TCCAGAAACGTTAGGGCAAT 57.129 45.000 0.00 0.00 0.00 3.56
8523 16920 2.432444 TCCAGAAACGTTAGGGCAATG 58.568 47.619 0.00 0.00 0.00 2.82
8567 16968 6.033407 GCGTTTGTTTGTGTGTATATGAATGG 59.967 38.462 0.00 0.00 0.00 3.16
8657 17065 7.878644 GGTGGTATAAATTAGAGGAATGAGACC 59.121 40.741 0.00 0.00 30.94 3.85
8658 17066 8.652290 GTGGTATAAATTAGAGGAATGAGACCT 58.348 37.037 0.00 0.00 40.80 3.85
8659 17067 9.892444 TGGTATAAATTAGAGGAATGAGACCTA 57.108 33.333 0.00 0.00 37.93 3.08
8687 17095 6.503589 TTTTCTTCTTTCGGTTCTGTTTCA 57.496 33.333 0.00 0.00 0.00 2.69
8688 17096 5.479716 TTCTTCTTTCGGTTCTGTTTCAC 57.520 39.130 0.00 0.00 0.00 3.18
8689 17097 3.875134 TCTTCTTTCGGTTCTGTTTCACC 59.125 43.478 0.00 0.00 0.00 4.02
8690 17098 3.269538 TCTTTCGGTTCTGTTTCACCA 57.730 42.857 0.00 0.00 31.84 4.17
8691 17099 3.815809 TCTTTCGGTTCTGTTTCACCAT 58.184 40.909 0.00 0.00 31.84 3.55
8692 17100 4.204012 TCTTTCGGTTCTGTTTCACCATT 58.796 39.130 0.00 0.00 31.84 3.16
8693 17101 3.980646 TTCGGTTCTGTTTCACCATTG 57.019 42.857 0.00 0.00 31.84 2.82
8694 17102 3.201353 TCGGTTCTGTTTCACCATTGA 57.799 42.857 0.00 0.00 31.84 2.57
8695 17103 3.750371 TCGGTTCTGTTTCACCATTGAT 58.250 40.909 0.00 0.00 31.84 2.57
8696 17104 4.900684 TCGGTTCTGTTTCACCATTGATA 58.099 39.130 0.00 0.00 31.84 2.15
8697 17105 5.496556 TCGGTTCTGTTTCACCATTGATAT 58.503 37.500 0.00 0.00 31.84 1.63
8698 17106 5.943416 TCGGTTCTGTTTCACCATTGATATT 59.057 36.000 0.00 0.00 31.84 1.28
8699 17107 7.106890 TCGGTTCTGTTTCACCATTGATATTA 58.893 34.615 0.00 0.00 31.84 0.98
8700 17108 7.608376 TCGGTTCTGTTTCACCATTGATATTAA 59.392 33.333 0.00 0.00 31.84 1.40
8701 17109 8.240682 CGGTTCTGTTTCACCATTGATATTAAA 58.759 33.333 0.00 0.00 31.84 1.52
8706 17114 9.663904 CTGTTTCACCATTGATATTAAATACGG 57.336 33.333 0.00 0.00 0.00 4.02
8707 17115 9.397280 TGTTTCACCATTGATATTAAATACGGA 57.603 29.630 0.00 0.00 0.00 4.69
8723 17131 9.819267 TTAAATACGGAAAAGTTCATTTTTGGT 57.181 25.926 0.00 0.00 41.24 3.67
8724 17132 7.707774 AATACGGAAAAGTTCATTTTTGGTG 57.292 32.000 0.00 0.00 41.24 4.17
8725 17133 5.079689 ACGGAAAAGTTCATTTTTGGTGT 57.920 34.783 0.00 0.00 41.24 4.16
8726 17134 4.867608 ACGGAAAAGTTCATTTTTGGTGTG 59.132 37.500 0.00 0.00 41.24 3.82
8727 17135 5.105752 CGGAAAAGTTCATTTTTGGTGTGA 58.894 37.500 0.00 0.00 41.24 3.58
8728 17136 5.578727 CGGAAAAGTTCATTTTTGGTGTGAA 59.421 36.000 0.00 0.00 41.24 3.18
8729 17137 6.091441 CGGAAAAGTTCATTTTTGGTGTGAAA 59.909 34.615 0.00 0.00 41.24 2.69
8730 17138 7.240674 GGAAAAGTTCATTTTTGGTGTGAAAC 58.759 34.615 0.00 0.00 41.24 2.78
8731 17139 7.119116 GGAAAAGTTCATTTTTGGTGTGAAACT 59.881 33.333 0.00 0.00 41.24 2.66
8732 17140 9.145865 GAAAAGTTCATTTTTGGTGTGAAACTA 57.854 29.630 0.00 0.00 41.24 2.24
8733 17141 8.702163 AAAGTTCATTTTTGGTGTGAAACTAG 57.298 30.769 0.00 0.00 38.04 2.57
8734 17142 7.404671 AGTTCATTTTTGGTGTGAAACTAGT 57.595 32.000 0.00 0.00 38.04 2.57
8735 17143 7.480810 AGTTCATTTTTGGTGTGAAACTAGTC 58.519 34.615 0.00 0.00 38.04 2.59
8736 17144 7.339466 AGTTCATTTTTGGTGTGAAACTAGTCT 59.661 33.333 0.00 0.00 38.04 3.24
8737 17145 8.617809 GTTCATTTTTGGTGTGAAACTAGTCTA 58.382 33.333 0.00 0.00 38.04 2.59
8738 17146 8.740123 TCATTTTTGGTGTGAAACTAGTCTAA 57.260 30.769 0.00 0.00 38.04 2.10
8739 17147 9.179909 TCATTTTTGGTGTGAAACTAGTCTAAA 57.820 29.630 0.00 0.00 38.04 1.85
8740 17148 9.450807 CATTTTTGGTGTGAAACTAGTCTAAAG 57.549 33.333 0.00 0.00 38.04 1.85
8741 17149 6.613755 TTTGGTGTGAAACTAGTCTAAAGC 57.386 37.500 0.00 0.00 38.04 3.51
8742 17150 5.284861 TGGTGTGAAACTAGTCTAAAGCA 57.715 39.130 0.00 0.00 38.04 3.91
8743 17151 5.297547 TGGTGTGAAACTAGTCTAAAGCAG 58.702 41.667 0.00 0.00 38.04 4.24
8744 17152 5.163343 TGGTGTGAAACTAGTCTAAAGCAGT 60.163 40.000 0.00 0.00 38.04 4.40
8745 17153 5.758784 GGTGTGAAACTAGTCTAAAGCAGTT 59.241 40.000 0.00 0.00 38.04 3.16
8746 17154 6.260271 GGTGTGAAACTAGTCTAAAGCAGTTT 59.740 38.462 0.00 0.00 42.36 2.66
8747 17155 7.126398 GTGTGAAACTAGTCTAAAGCAGTTTG 58.874 38.462 0.00 0.00 40.38 2.93
8748 17156 6.260050 TGTGAAACTAGTCTAAAGCAGTTTGG 59.740 38.462 0.00 0.00 40.38 3.28
8749 17157 6.260271 GTGAAACTAGTCTAAAGCAGTTTGGT 59.740 38.462 0.00 0.00 40.38 3.67
8750 17158 6.482308 TGAAACTAGTCTAAAGCAGTTTGGTC 59.518 38.462 0.00 0.00 40.38 4.02
8751 17159 4.895961 ACTAGTCTAAAGCAGTTTGGTCC 58.104 43.478 0.00 0.00 0.00 4.46
8752 17160 4.593634 ACTAGTCTAAAGCAGTTTGGTCCT 59.406 41.667 0.00 0.00 0.00 3.85
8753 17161 4.009370 AGTCTAAAGCAGTTTGGTCCTC 57.991 45.455 0.00 0.00 0.00 3.71
8754 17162 3.391296 AGTCTAAAGCAGTTTGGTCCTCA 59.609 43.478 0.00 0.00 0.00 3.86
8755 17163 4.134563 GTCTAAAGCAGTTTGGTCCTCAA 58.865 43.478 0.00 0.00 0.00 3.02
8756 17164 4.762251 GTCTAAAGCAGTTTGGTCCTCAAT 59.238 41.667 0.00 0.00 34.98 2.57
8757 17165 5.241728 GTCTAAAGCAGTTTGGTCCTCAATT 59.758 40.000 0.00 0.00 34.98 2.32
8758 17166 4.590850 AAAGCAGTTTGGTCCTCAATTC 57.409 40.909 0.00 0.00 34.98 2.17
8759 17167 3.515602 AGCAGTTTGGTCCTCAATTCT 57.484 42.857 0.00 0.00 34.98 2.40
8760 17168 4.640771 AGCAGTTTGGTCCTCAATTCTA 57.359 40.909 0.00 0.00 34.98 2.10
8761 17169 5.184892 AGCAGTTTGGTCCTCAATTCTAT 57.815 39.130 0.00 0.00 34.98 1.98
8762 17170 5.189180 AGCAGTTTGGTCCTCAATTCTATC 58.811 41.667 0.00 0.00 34.98 2.08
8763 17171 5.045286 AGCAGTTTGGTCCTCAATTCTATCT 60.045 40.000 0.00 0.00 34.98 1.98
8764 17172 5.295540 GCAGTTTGGTCCTCAATTCTATCTC 59.704 44.000 0.00 0.00 34.98 2.75
8765 17173 6.648192 CAGTTTGGTCCTCAATTCTATCTCT 58.352 40.000 0.00 0.00 34.98 3.10
8766 17174 7.633772 GCAGTTTGGTCCTCAATTCTATCTCTA 60.634 40.741 0.00 0.00 34.98 2.43
8767 17175 7.708752 CAGTTTGGTCCTCAATTCTATCTCTAC 59.291 40.741 0.00 0.00 34.98 2.59
8768 17176 7.621683 AGTTTGGTCCTCAATTCTATCTCTACT 59.378 37.037 0.00 0.00 34.98 2.57
8769 17177 8.915036 GTTTGGTCCTCAATTCTATCTCTACTA 58.085 37.037 0.00 0.00 34.98 1.82
8770 17178 8.466617 TTGGTCCTCAATTCTATCTCTACTAC 57.533 38.462 0.00 0.00 0.00 2.73
8771 17179 6.711194 TGGTCCTCAATTCTATCTCTACTACG 59.289 42.308 0.00 0.00 0.00 3.51
8772 17180 6.348704 GGTCCTCAATTCTATCTCTACTACGC 60.349 46.154 0.00 0.00 0.00 4.42
8773 17181 6.205076 GTCCTCAATTCTATCTCTACTACGCA 59.795 42.308 0.00 0.00 0.00 5.24
8774 17182 6.205076 TCCTCAATTCTATCTCTACTACGCAC 59.795 42.308 0.00 0.00 0.00 5.34
8775 17183 5.986936 TCAATTCTATCTCTACTACGCACG 58.013 41.667 0.00 0.00 0.00 5.34
8776 17184 5.526479 TCAATTCTATCTCTACTACGCACGT 59.474 40.000 0.00 0.00 0.00 4.49
8777 17185 6.703165 TCAATTCTATCTCTACTACGCACGTA 59.297 38.462 2.56 2.56 0.00 3.57
8778 17186 5.896922 TTCTATCTCTACTACGCACGTAC 57.103 43.478 0.00 0.00 0.00 3.67
8779 17187 5.193663 TCTATCTCTACTACGCACGTACT 57.806 43.478 0.00 0.00 0.00 2.73
8780 17188 6.319141 TCTATCTCTACTACGCACGTACTA 57.681 41.667 0.00 0.00 0.00 1.82
8781 17189 6.377780 TCTATCTCTACTACGCACGTACTAG 58.622 44.000 0.00 4.93 0.00 2.57
8782 17190 4.377839 TCTCTACTACGCACGTACTAGT 57.622 45.455 0.00 0.00 0.00 2.57
8783 17191 4.748892 TCTCTACTACGCACGTACTAGTT 58.251 43.478 0.00 0.00 0.00 2.24
8784 17192 4.564372 TCTCTACTACGCACGTACTAGTTG 59.436 45.833 0.00 0.00 0.00 3.16
8785 17193 2.907910 ACTACGCACGTACTAGTTGG 57.092 50.000 0.00 0.00 0.00 3.77
8786 17194 2.426522 ACTACGCACGTACTAGTTGGA 58.573 47.619 0.00 0.00 0.00 3.53
8787 17195 2.813754 ACTACGCACGTACTAGTTGGAA 59.186 45.455 0.00 0.00 0.00 3.53
8788 17196 2.342910 ACGCACGTACTAGTTGGAAG 57.657 50.000 0.00 0.00 0.00 3.46
8789 17197 1.610522 ACGCACGTACTAGTTGGAAGT 59.389 47.619 0.00 0.00 0.00 3.01
8790 17198 2.813754 ACGCACGTACTAGTTGGAAGTA 59.186 45.455 0.00 0.00 0.00 2.24
8791 17199 3.441572 ACGCACGTACTAGTTGGAAGTAT 59.558 43.478 0.00 0.00 32.34 2.12
8792 17200 4.082571 ACGCACGTACTAGTTGGAAGTATT 60.083 41.667 0.00 0.00 32.34 1.89
8793 17201 4.860907 CGCACGTACTAGTTGGAAGTATTT 59.139 41.667 0.00 0.00 32.34 1.40
8794 17202 6.029607 CGCACGTACTAGTTGGAAGTATTTA 58.970 40.000 0.00 0.00 32.34 1.40
8795 17203 6.694411 CGCACGTACTAGTTGGAAGTATTTAT 59.306 38.462 0.00 0.00 32.34 1.40
8796 17204 7.096722 CGCACGTACTAGTTGGAAGTATTTATC 60.097 40.741 0.00 0.00 32.34 1.75
8797 17205 7.703621 GCACGTACTAGTTGGAAGTATTTATCA 59.296 37.037 0.00 0.00 32.34 2.15
8798 17206 9.017669 CACGTACTAGTTGGAAGTATTTATCAC 57.982 37.037 0.00 0.00 32.34 3.06
8799 17207 8.964772 ACGTACTAGTTGGAAGTATTTATCACT 58.035 33.333 0.00 0.00 32.34 3.41
8800 17208 9.448294 CGTACTAGTTGGAAGTATTTATCACTC 57.552 37.037 0.00 0.00 32.34 3.51
8801 17209 9.448294 GTACTAGTTGGAAGTATTTATCACTCG 57.552 37.037 0.00 0.00 32.34 4.18
8802 17210 8.289939 ACTAGTTGGAAGTATTTATCACTCGA 57.710 34.615 0.00 0.00 0.00 4.04
8803 17211 8.189460 ACTAGTTGGAAGTATTTATCACTCGAC 58.811 37.037 0.00 0.00 0.00 4.20
8804 17212 7.171630 AGTTGGAAGTATTTATCACTCGACT 57.828 36.000 0.00 0.00 0.00 4.18
8805 17213 7.259161 AGTTGGAAGTATTTATCACTCGACTC 58.741 38.462 0.00 0.00 0.00 3.36
8806 17214 5.817988 TGGAAGTATTTATCACTCGACTCG 58.182 41.667 0.00 0.00 0.00 4.18
8807 17215 4.676018 GGAAGTATTTATCACTCGACTCGC 59.324 45.833 0.00 0.00 0.00 5.03
8808 17216 4.226113 AGTATTTATCACTCGACTCGCC 57.774 45.455 0.00 0.00 0.00 5.54
8809 17217 3.884091 AGTATTTATCACTCGACTCGCCT 59.116 43.478 0.00 0.00 0.00 5.52
8810 17218 2.846039 TTTATCACTCGACTCGCCTC 57.154 50.000 0.00 0.00 0.00 4.70
8811 17219 2.039818 TTATCACTCGACTCGCCTCT 57.960 50.000 0.00 0.00 0.00 3.69
8812 17220 1.584175 TATCACTCGACTCGCCTCTC 58.416 55.000 0.00 0.00 0.00 3.20
8813 17221 1.098712 ATCACTCGACTCGCCTCTCC 61.099 60.000 0.00 0.00 0.00 3.71
8814 17222 2.438795 ACTCGACTCGCCTCTCCC 60.439 66.667 0.00 0.00 0.00 4.30
8815 17223 2.124487 CTCGACTCGCCTCTCCCT 60.124 66.667 0.00 0.00 0.00 4.20
8816 17224 2.124653 TCGACTCGCCTCTCCCTC 60.125 66.667 0.00 0.00 0.00 4.30
8817 17225 3.213402 CGACTCGCCTCTCCCTCC 61.213 72.222 0.00 0.00 0.00 4.30
8818 17226 2.835895 GACTCGCCTCTCCCTCCC 60.836 72.222 0.00 0.00 0.00 4.30
8819 17227 3.351885 ACTCGCCTCTCCCTCCCT 61.352 66.667 0.00 0.00 0.00 4.20
8820 17228 2.520741 CTCGCCTCTCCCTCCCTC 60.521 72.222 0.00 0.00 0.00 4.30
8821 17229 4.144727 TCGCCTCTCCCTCCCTCC 62.145 72.222 0.00 0.00 0.00 4.30
8823 17231 3.773154 GCCTCTCCCTCCCTCCCT 61.773 72.222 0.00 0.00 0.00 4.20
8824 17232 2.612251 CCTCTCCCTCCCTCCCTC 59.388 72.222 0.00 0.00 0.00 4.30
8825 17233 2.612251 CTCTCCCTCCCTCCCTCC 59.388 72.222 0.00 0.00 0.00 4.30
8826 17234 3.036959 TCTCCCTCCCTCCCTCCC 61.037 72.222 0.00 0.00 0.00 4.30
8827 17235 3.039526 CTCCCTCCCTCCCTCCCT 61.040 72.222 0.00 0.00 0.00 4.20
8828 17236 3.036959 TCCCTCCCTCCCTCCCTC 61.037 72.222 0.00 0.00 0.00 4.30
8829 17237 4.179599 CCCTCCCTCCCTCCCTCC 62.180 77.778 0.00 0.00 0.00 4.30
8830 17238 4.179599 CCTCCCTCCCTCCCTCCC 62.180 77.778 0.00 0.00 0.00 4.30
8831 17239 3.039526 CTCCCTCCCTCCCTCCCT 61.040 72.222 0.00 0.00 0.00 4.20
8832 17240 3.036959 TCCCTCCCTCCCTCCCTC 61.037 72.222 0.00 0.00 0.00 4.30
8833 17241 4.179599 CCCTCCCTCCCTCCCTCC 62.180 77.778 0.00 0.00 0.00 4.30
8834 17242 3.039526 CCTCCCTCCCTCCCTCCT 61.040 72.222 0.00 0.00 0.00 3.69
8835 17243 2.612251 CTCCCTCCCTCCCTCCTC 59.388 72.222 0.00 0.00 0.00 3.71
8836 17244 2.018086 CTCCCTCCCTCCCTCCTCT 61.018 68.421 0.00 0.00 0.00 3.69
8837 17245 2.285180 CCCTCCCTCCCTCCTCTG 59.715 72.222 0.00 0.00 0.00 3.35
8838 17246 2.328589 CCCTCCCTCCCTCCTCTGA 61.329 68.421 0.00 0.00 0.00 3.27
8839 17247 1.673928 CCCTCCCTCCCTCCTCTGAT 61.674 65.000 0.00 0.00 0.00 2.90
8840 17248 1.162505 CCTCCCTCCCTCCTCTGATA 58.837 60.000 0.00 0.00 0.00 2.15
8841 17249 1.721691 CCTCCCTCCCTCCTCTGATAT 59.278 57.143 0.00 0.00 0.00 1.63
8842 17250 2.113414 CCTCCCTCCCTCCTCTGATATT 59.887 54.545 0.00 0.00 0.00 1.28
8843 17251 3.440127 CTCCCTCCCTCCTCTGATATTC 58.560 54.545 0.00 0.00 0.00 1.75
8844 17252 3.075181 TCCCTCCCTCCTCTGATATTCT 58.925 50.000 0.00 0.00 0.00 2.40
8845 17253 4.260477 TCCCTCCCTCCTCTGATATTCTA 58.740 47.826 0.00 0.00 0.00 2.10
8846 17254 4.044825 TCCCTCCCTCCTCTGATATTCTAC 59.955 50.000 0.00 0.00 0.00 2.59
8847 17255 4.202727 CCCTCCCTCCTCTGATATTCTACA 60.203 50.000 0.00 0.00 0.00 2.74
8848 17256 5.016173 CCTCCCTCCTCTGATATTCTACAG 58.984 50.000 0.00 0.00 35.72 2.74
8849 17257 5.458948 CCTCCCTCCTCTGATATTCTACAGT 60.459 48.000 0.00 0.00 35.84 3.55
8850 17258 6.240321 CCTCCCTCCTCTGATATTCTACAGTA 60.240 46.154 0.00 0.00 35.84 2.74
8851 17259 6.785076 TCCCTCCTCTGATATTCTACAGTAG 58.215 44.000 0.47 0.47 35.84 2.57
8852 17260 5.949354 CCCTCCTCTGATATTCTACAGTAGG 59.051 48.000 7.79 0.00 35.20 3.18
8853 17261 6.468066 CCCTCCTCTGATATTCTACAGTAGGT 60.468 46.154 7.79 0.25 35.30 3.08
8854 17262 7.257089 CCCTCCTCTGATATTCTACAGTAGGTA 60.257 44.444 7.79 2.45 35.30 3.08
8855 17263 8.333235 CCTCCTCTGATATTCTACAGTAGGTAT 58.667 40.741 7.79 6.88 35.30 2.73
8856 17264 9.391006 CTCCTCTGATATTCTACAGTAGGTATC 57.609 40.741 18.10 18.10 35.30 2.24
8857 17265 8.891501 TCCTCTGATATTCTACAGTAGGTATCA 58.108 37.037 22.27 22.27 35.30 2.15
8858 17266 9.693739 CCTCTGATATTCTACAGTAGGTATCAT 57.306 37.037 23.09 8.10 35.41 2.45
8860 17268 8.961634 TCTGATATTCTACAGTAGGTATCATGC 58.038 37.037 23.09 8.70 35.41 4.06
8861 17269 8.650143 TGATATTCTACAGTAGGTATCATGCA 57.350 34.615 21.04 0.00 33.27 3.96
8862 17270 9.259832 TGATATTCTACAGTAGGTATCATGCAT 57.740 33.333 21.04 0.00 33.27 3.96
8863 17271 9.526713 GATATTCTACAGTAGGTATCATGCATG 57.473 37.037 21.07 21.07 30.80 4.06
8864 17272 5.139435 TCTACAGTAGGTATCATGCATGC 57.861 43.478 22.25 11.82 0.00 4.06
8865 17273 3.843893 ACAGTAGGTATCATGCATGCA 57.156 42.857 25.04 25.04 0.00 3.96
8866 17274 4.362470 ACAGTAGGTATCATGCATGCAT 57.638 40.909 27.46 27.46 37.08 3.96
8881 17289 1.034356 TGCATGCATGGGATTAGTGC 58.966 50.000 27.34 12.28 39.26 4.40
8882 17290 1.325355 GCATGCATGGGATTAGTGCT 58.675 50.000 27.34 0.00 39.52 4.40
8883 17291 1.684983 GCATGCATGGGATTAGTGCTT 59.315 47.619 27.34 0.00 39.52 3.91
8884 17292 2.101917 GCATGCATGGGATTAGTGCTTT 59.898 45.455 27.34 0.00 39.52 3.51
8885 17293 3.713288 CATGCATGGGATTAGTGCTTTG 58.287 45.455 19.40 0.00 39.52 2.77
8886 17294 3.084536 TGCATGGGATTAGTGCTTTGA 57.915 42.857 0.00 0.00 39.52 2.69
8887 17295 3.429492 TGCATGGGATTAGTGCTTTGAA 58.571 40.909 0.00 0.00 39.52 2.69
8888 17296 4.025360 TGCATGGGATTAGTGCTTTGAAT 58.975 39.130 0.00 0.00 39.52 2.57
8889 17297 4.467082 TGCATGGGATTAGTGCTTTGAATT 59.533 37.500 0.00 0.00 39.52 2.17
8890 17298 4.807304 GCATGGGATTAGTGCTTTGAATTG 59.193 41.667 0.00 0.00 36.02 2.32
8891 17299 5.394443 GCATGGGATTAGTGCTTTGAATTGA 60.394 40.000 0.00 0.00 36.02 2.57
8892 17300 6.684613 GCATGGGATTAGTGCTTTGAATTGAT 60.685 38.462 0.00 0.00 36.02 2.57
8893 17301 6.855763 TGGGATTAGTGCTTTGAATTGATT 57.144 33.333 0.00 0.00 0.00 2.57
8894 17302 7.243604 TGGGATTAGTGCTTTGAATTGATTT 57.756 32.000 0.00 0.00 0.00 2.17
8895 17303 7.098477 TGGGATTAGTGCTTTGAATTGATTTG 58.902 34.615 0.00 0.00 0.00 2.32
8896 17304 7.039152 TGGGATTAGTGCTTTGAATTGATTTGA 60.039 33.333 0.00 0.00 0.00 2.69
8897 17305 7.983484 GGGATTAGTGCTTTGAATTGATTTGAT 59.017 33.333 0.00 0.00 0.00 2.57
8898 17306 9.374838 GGATTAGTGCTTTGAATTGATTTGATT 57.625 29.630 0.00 0.00 0.00 2.57
8901 17309 9.761504 TTAGTGCTTTGAATTGATTTGATTTGA 57.238 25.926 0.00 0.00 0.00 2.69
8902 17310 8.665643 AGTGCTTTGAATTGATTTGATTTGAA 57.334 26.923 0.00 0.00 0.00 2.69
8903 17311 9.280174 AGTGCTTTGAATTGATTTGATTTGAAT 57.720 25.926 0.00 0.00 0.00 2.57
8904 17312 9.887406 GTGCTTTGAATTGATTTGATTTGAATT 57.113 25.926 0.00 0.00 0.00 2.17
8905 17313 9.885934 TGCTTTGAATTGATTTGATTTGAATTG 57.114 25.926 0.00 0.00 0.00 2.32
8906 17314 9.337091 GCTTTGAATTGATTTGATTTGAATTGG 57.663 29.630 0.00 0.00 0.00 3.16
8909 17317 8.325421 TGAATTGATTTGATTTGAATTGGTGG 57.675 30.769 0.00 0.00 0.00 4.61
8910 17318 6.746745 ATTGATTTGATTTGAATTGGTGGC 57.253 33.333 0.00 0.00 0.00 5.01
8911 17319 5.224821 TGATTTGATTTGAATTGGTGGCA 57.775 34.783 0.00 0.00 0.00 4.92
8912 17320 5.806818 TGATTTGATTTGAATTGGTGGCAT 58.193 33.333 0.00 0.00 0.00 4.40
8913 17321 6.944096 TGATTTGATTTGAATTGGTGGCATA 58.056 32.000 0.00 0.00 0.00 3.14
8914 17322 7.566569 TGATTTGATTTGAATTGGTGGCATAT 58.433 30.769 0.00 0.00 0.00 1.78
8915 17323 7.711772 TGATTTGATTTGAATTGGTGGCATATC 59.288 33.333 0.00 0.00 0.00 1.63
8916 17324 6.541934 TTGATTTGAATTGGTGGCATATCA 57.458 33.333 0.00 0.00 31.36 2.15
8917 17325 6.541934 TGATTTGAATTGGTGGCATATCAA 57.458 33.333 0.00 0.00 33.04 2.57
8918 17326 6.944096 TGATTTGAATTGGTGGCATATCAAA 58.056 32.000 14.09 14.09 40.01 2.69
8919 17327 7.566569 TGATTTGAATTGGTGGCATATCAAAT 58.433 30.769 19.36 19.36 45.21 2.32
8920 17328 8.047911 TGATTTGAATTGGTGGCATATCAAATT 58.952 29.630 19.84 8.66 43.60 1.82
8921 17329 8.810990 ATTTGAATTGGTGGCATATCAAATTT 57.189 26.923 16.23 0.00 41.94 1.82
8922 17330 8.632906 TTTGAATTGGTGGCATATCAAATTTT 57.367 26.923 0.00 0.00 32.07 1.82
8923 17331 8.632906 TTGAATTGGTGGCATATCAAATTTTT 57.367 26.923 0.00 0.00 32.07 1.94
8924 17332 8.041829 TGAATTGGTGGCATATCAAATTTTTG 57.958 30.769 0.00 0.00 39.48 2.44
8925 17333 5.876612 TTGGTGGCATATCAAATTTTTGC 57.123 34.783 0.00 0.00 38.05 3.68
8929 17337 2.287644 GGCATATCAAATTTTTGCCGGC 59.712 45.455 22.73 22.73 42.97 6.13
8930 17338 2.935201 GCATATCAAATTTTTGCCGGCA 59.065 40.909 29.03 29.03 38.05 5.69
8931 17339 3.373439 GCATATCAAATTTTTGCCGGCAA 59.627 39.130 37.30 37.30 38.05 4.52
8932 17340 4.727448 GCATATCAAATTTTTGCCGGCAAC 60.727 41.667 40.36 20.40 38.05 4.17
8946 17354 2.902065 GGCAACGAGAAAACAGATCC 57.098 50.000 0.00 0.00 0.00 3.36
8947 17355 2.151202 GGCAACGAGAAAACAGATCCA 58.849 47.619 0.00 0.00 0.00 3.41
8948 17356 2.160417 GGCAACGAGAAAACAGATCCAG 59.840 50.000 0.00 0.00 0.00 3.86
8949 17357 2.413371 GCAACGAGAAAACAGATCCAGC 60.413 50.000 0.00 0.00 0.00 4.85
8950 17358 2.807967 CAACGAGAAAACAGATCCAGCA 59.192 45.455 0.00 0.00 0.00 4.41
8951 17359 3.126001 ACGAGAAAACAGATCCAGCAA 57.874 42.857 0.00 0.00 0.00 3.91
8952 17360 3.070018 ACGAGAAAACAGATCCAGCAAG 58.930 45.455 0.00 0.00 0.00 4.01
8953 17361 3.070018 CGAGAAAACAGATCCAGCAAGT 58.930 45.455 0.00 0.00 0.00 3.16
8954 17362 3.124297 CGAGAAAACAGATCCAGCAAGTC 59.876 47.826 0.00 0.00 0.00 3.01
8955 17363 4.067896 GAGAAAACAGATCCAGCAAGTCA 58.932 43.478 0.00 0.00 0.00 3.41
8956 17364 4.464008 AGAAAACAGATCCAGCAAGTCAA 58.536 39.130 0.00 0.00 0.00 3.18
8957 17365 4.276926 AGAAAACAGATCCAGCAAGTCAAC 59.723 41.667 0.00 0.00 0.00 3.18
8958 17366 2.936919 ACAGATCCAGCAAGTCAACA 57.063 45.000 0.00 0.00 0.00 3.33
8959 17367 3.430042 ACAGATCCAGCAAGTCAACAT 57.570 42.857 0.00 0.00 0.00 2.71
8960 17368 3.079578 ACAGATCCAGCAAGTCAACATG 58.920 45.455 0.00 0.00 0.00 3.21
8961 17369 2.422479 CAGATCCAGCAAGTCAACATGG 59.578 50.000 0.00 0.00 0.00 3.66
8962 17370 1.133790 GATCCAGCAAGTCAACATGGC 59.866 52.381 0.00 0.00 0.00 4.40
8963 17371 1.210931 CCAGCAAGTCAACATGGCG 59.789 57.895 0.00 0.00 0.00 5.69
8964 17372 1.518056 CCAGCAAGTCAACATGGCGT 61.518 55.000 0.00 0.00 0.00 5.68
8965 17373 0.386352 CAGCAAGTCAACATGGCGTG 60.386 55.000 4.87 4.87 34.63 5.34
8966 17374 1.081242 GCAAGTCAACATGGCGTGG 60.081 57.895 12.05 0.00 32.18 4.94
8967 17375 1.795170 GCAAGTCAACATGGCGTGGT 61.795 55.000 12.05 0.09 32.18 4.16
8968 17376 0.238289 CAAGTCAACATGGCGTGGTC 59.762 55.000 12.05 0.00 27.93 4.02
8969 17377 0.889186 AAGTCAACATGGCGTGGTCC 60.889 55.000 12.05 0.00 0.00 4.46
8970 17378 2.358125 TCAACATGGCGTGGTCCG 60.358 61.111 12.05 0.00 40.40 4.79
8986 17394 2.507102 CGCAGCGGATTCGACACT 60.507 61.111 7.00 0.00 39.00 3.55
8987 17395 1.226575 CGCAGCGGATTCGACACTA 60.227 57.895 7.00 0.00 39.00 2.74
8988 17396 0.595053 CGCAGCGGATTCGACACTAT 60.595 55.000 7.00 0.00 39.00 2.12
8989 17397 1.571919 GCAGCGGATTCGACACTATT 58.428 50.000 0.00 0.00 39.00 1.73
8990 17398 1.523095 GCAGCGGATTCGACACTATTC 59.477 52.381 0.00 0.00 39.00 1.75
8991 17399 2.799917 GCAGCGGATTCGACACTATTCT 60.800 50.000 0.00 0.00 39.00 2.40
8992 17400 3.448686 CAGCGGATTCGACACTATTCTT 58.551 45.455 0.00 0.00 39.00 2.52
8993 17401 3.865745 CAGCGGATTCGACACTATTCTTT 59.134 43.478 0.00 0.00 39.00 2.52
8994 17402 4.330074 CAGCGGATTCGACACTATTCTTTT 59.670 41.667 0.00 0.00 39.00 2.27
8995 17403 4.935808 AGCGGATTCGACACTATTCTTTTT 59.064 37.500 0.00 0.00 39.00 1.94
9013 17421 4.574599 TTTTTCTGCTTTCCTCTGCTTC 57.425 40.909 0.00 0.00 0.00 3.86
9014 17422 3.498774 TTTCTGCTTTCCTCTGCTTCT 57.501 42.857 0.00 0.00 0.00 2.85
9015 17423 4.623932 TTTCTGCTTTCCTCTGCTTCTA 57.376 40.909 0.00 0.00 0.00 2.10
9016 17424 4.833478 TTCTGCTTTCCTCTGCTTCTAT 57.167 40.909 0.00 0.00 0.00 1.98
9017 17425 4.833478 TCTGCTTTCCTCTGCTTCTATT 57.167 40.909 0.00 0.00 0.00 1.73
9018 17426 4.764172 TCTGCTTTCCTCTGCTTCTATTC 58.236 43.478 0.00 0.00 0.00 1.75
9019 17427 4.469227 TCTGCTTTCCTCTGCTTCTATTCT 59.531 41.667 0.00 0.00 0.00 2.40
9020 17428 4.764172 TGCTTTCCTCTGCTTCTATTCTC 58.236 43.478 0.00 0.00 0.00 2.87
9021 17429 4.469227 TGCTTTCCTCTGCTTCTATTCTCT 59.531 41.667 0.00 0.00 0.00 3.10
9022 17430 5.046014 TGCTTTCCTCTGCTTCTATTCTCTT 60.046 40.000 0.00 0.00 0.00 2.85
9023 17431 5.879777 GCTTTCCTCTGCTTCTATTCTCTTT 59.120 40.000 0.00 0.00 0.00 2.52
9024 17432 6.374053 GCTTTCCTCTGCTTCTATTCTCTTTT 59.626 38.462 0.00 0.00 0.00 2.27
9025 17433 7.094420 GCTTTCCTCTGCTTCTATTCTCTTTTT 60.094 37.037 0.00 0.00 0.00 1.94
9073 17481 0.033228 TTTTTGCAGGGTTGGCATCG 59.967 50.000 0.00 0.00 41.58 3.84
9074 17482 2.433231 TTTTGCAGGGTTGGCATCGC 62.433 55.000 4.58 4.58 41.58 4.58
9085 17493 3.588277 GGCATCGCCTCTATTCGAA 57.412 52.632 0.00 0.00 46.69 3.71
9086 17494 1.865865 GGCATCGCCTCTATTCGAAA 58.134 50.000 0.00 0.00 46.69 3.46
9087 17495 2.210116 GGCATCGCCTCTATTCGAAAA 58.790 47.619 0.00 0.00 46.69 2.29
9088 17496 2.221981 GGCATCGCCTCTATTCGAAAAG 59.778 50.000 0.00 0.00 46.69 2.27
9089 17497 2.348966 GCATCGCCTCTATTCGAAAAGC 60.349 50.000 0.00 0.00 38.28 3.51
9090 17498 1.935933 TCGCCTCTATTCGAAAAGCC 58.064 50.000 0.00 0.00 0.00 4.35
9091 17499 0.577269 CGCCTCTATTCGAAAAGCCG 59.423 55.000 0.00 0.00 0.00 5.52
9092 17500 0.938008 GCCTCTATTCGAAAAGCCGG 59.062 55.000 0.00 0.00 0.00 6.13
9093 17501 1.472728 GCCTCTATTCGAAAAGCCGGA 60.473 52.381 5.05 0.00 0.00 5.14
9094 17502 2.474816 CCTCTATTCGAAAAGCCGGAG 58.525 52.381 5.05 4.02 0.00 4.63
9095 17503 2.100916 CCTCTATTCGAAAAGCCGGAGA 59.899 50.000 5.05 0.00 0.00 3.71
9096 17504 3.430374 CCTCTATTCGAAAAGCCGGAGAA 60.430 47.826 5.05 0.12 0.00 2.87
9097 17505 4.372656 CTCTATTCGAAAAGCCGGAGAAT 58.627 43.478 5.05 8.16 35.88 2.40
9098 17506 5.509163 CCTCTATTCGAAAAGCCGGAGAATA 60.509 44.000 5.05 8.86 34.02 1.75
9099 17507 5.529791 TCTATTCGAAAAGCCGGAGAATAG 58.470 41.667 21.01 21.01 45.76 1.73
9100 17508 3.880047 TTCGAAAAGCCGGAGAATAGA 57.120 42.857 5.05 0.00 0.00 1.98
9101 17509 3.880047 TCGAAAAGCCGGAGAATAGAA 57.120 42.857 5.05 0.00 0.00 2.10
9102 17510 4.402056 TCGAAAAGCCGGAGAATAGAAT 57.598 40.909 5.05 0.00 0.00 2.40
9103 17511 4.119862 TCGAAAAGCCGGAGAATAGAATG 58.880 43.478 5.05 0.00 0.00 2.67
9104 17512 3.248602 CGAAAAGCCGGAGAATAGAATGG 59.751 47.826 5.05 0.00 0.00 3.16
9105 17513 2.938956 AAGCCGGAGAATAGAATGGG 57.061 50.000 5.05 0.00 0.00 4.00
9106 17514 1.059913 AGCCGGAGAATAGAATGGGG 58.940 55.000 5.05 0.00 0.00 4.96
9107 17515 0.036875 GCCGGAGAATAGAATGGGGG 59.963 60.000 5.05 0.00 0.00 5.40
9108 17516 1.729586 CCGGAGAATAGAATGGGGGA 58.270 55.000 0.00 0.00 0.00 4.81
9109 17517 2.269940 CCGGAGAATAGAATGGGGGAT 58.730 52.381 0.00 0.00 0.00 3.85
9110 17518 2.026822 CCGGAGAATAGAATGGGGGATG 60.027 54.545 0.00 0.00 0.00 3.51
9111 17519 2.639839 CGGAGAATAGAATGGGGGATGT 59.360 50.000 0.00 0.00 0.00 3.06
9112 17520 3.073062 CGGAGAATAGAATGGGGGATGTT 59.927 47.826 0.00 0.00 0.00 2.71
9113 17521 4.657013 GGAGAATAGAATGGGGGATGTTC 58.343 47.826 0.00 0.00 0.00 3.18
9114 17522 4.352298 GGAGAATAGAATGGGGGATGTTCT 59.648 45.833 0.00 0.00 36.30 3.01
9115 17523 5.312079 GAGAATAGAATGGGGGATGTTCTG 58.688 45.833 0.00 0.00 34.33 3.02
9116 17524 4.728860 AGAATAGAATGGGGGATGTTCTGT 59.271 41.667 0.00 0.00 34.33 3.41
9117 17525 5.911178 AGAATAGAATGGGGGATGTTCTGTA 59.089 40.000 0.00 0.00 34.33 2.74
9118 17526 6.389869 AGAATAGAATGGGGGATGTTCTGTAA 59.610 38.462 0.00 0.00 34.33 2.41
9119 17527 6.786843 ATAGAATGGGGGATGTTCTGTAAT 57.213 37.500 0.00 0.00 34.33 1.89
9120 17528 4.796606 AGAATGGGGGATGTTCTGTAATG 58.203 43.478 0.00 0.00 31.41 1.90
9121 17529 3.600448 ATGGGGGATGTTCTGTAATGG 57.400 47.619 0.00 0.00 0.00 3.16
9122 17530 2.283834 TGGGGGATGTTCTGTAATGGT 58.716 47.619 0.00 0.00 0.00 3.55
9123 17531 2.652348 TGGGGGATGTTCTGTAATGGTT 59.348 45.455 0.00 0.00 0.00 3.67
9124 17532 3.076785 TGGGGGATGTTCTGTAATGGTTT 59.923 43.478 0.00 0.00 0.00 3.27
9125 17533 4.093743 GGGGGATGTTCTGTAATGGTTTT 58.906 43.478 0.00 0.00 0.00 2.43
9126 17534 4.530553 GGGGGATGTTCTGTAATGGTTTTT 59.469 41.667 0.00 0.00 0.00 1.94
9127 17535 5.478407 GGGGATGTTCTGTAATGGTTTTTG 58.522 41.667 0.00 0.00 0.00 2.44
9128 17536 5.245075 GGGGATGTTCTGTAATGGTTTTTGA 59.755 40.000 0.00 0.00 0.00 2.69
9129 17537 6.070824 GGGGATGTTCTGTAATGGTTTTTGAT 60.071 38.462 0.00 0.00 0.00 2.57
9130 17538 7.123547 GGGGATGTTCTGTAATGGTTTTTGATA 59.876 37.037 0.00 0.00 0.00 2.15
9131 17539 8.695456 GGGATGTTCTGTAATGGTTTTTGATAT 58.305 33.333 0.00 0.00 0.00 1.63
9158 17566 9.948964 ACTTAAGTATATAATGCATGCAGATGA 57.051 29.630 26.69 11.81 0.00 2.92
9161 17569 7.621428 AGTATATAATGCATGCAGATGAACC 57.379 36.000 26.69 11.48 0.00 3.62
9162 17570 3.909776 ATAATGCATGCAGATGAACCG 57.090 42.857 26.69 0.00 0.00 4.44
9163 17571 0.742505 AATGCATGCAGATGAACCGG 59.257 50.000 26.69 0.00 0.00 5.28
9164 17572 1.731433 ATGCATGCAGATGAACCGGC 61.731 55.000 26.69 0.00 0.00 6.13
9165 17573 2.409055 GCATGCAGATGAACCGGCA 61.409 57.895 14.21 0.00 41.00 5.69
9166 17574 1.936436 GCATGCAGATGAACCGGCAA 61.936 55.000 14.21 0.00 40.02 4.52
9167 17575 0.179156 CATGCAGATGAACCGGCAAC 60.179 55.000 0.00 0.00 40.02 4.17
9182 17590 2.358247 AACGGATGCACGGTGACC 60.358 61.111 13.29 10.39 38.39 4.02
9199 17607 5.230942 GGTGACCGAACATCTATATTGAGG 58.769 45.833 0.00 0.00 0.00 3.86
9200 17608 5.230942 GTGACCGAACATCTATATTGAGGG 58.769 45.833 3.98 0.00 0.00 4.30
9201 17609 4.246458 GACCGAACATCTATATTGAGGGC 58.754 47.826 3.98 0.00 0.00 5.19
9202 17610 3.008049 ACCGAACATCTATATTGAGGGCC 59.992 47.826 0.00 0.00 0.00 5.80
9203 17611 3.261897 CCGAACATCTATATTGAGGGCCT 59.738 47.826 5.25 5.25 0.00 5.19
9204 17612 4.248859 CGAACATCTATATTGAGGGCCTG 58.751 47.826 12.95 0.00 0.00 4.85
9205 17613 3.710209 ACATCTATATTGAGGGCCTGC 57.290 47.619 12.95 2.95 0.00 4.85
9206 17614 2.981784 ACATCTATATTGAGGGCCTGCA 59.018 45.455 12.95 6.13 0.00 4.41
9207 17615 3.590630 ACATCTATATTGAGGGCCTGCAT 59.409 43.478 12.95 4.81 0.00 3.96
9208 17616 4.784838 ACATCTATATTGAGGGCCTGCATA 59.215 41.667 12.95 7.31 0.00 3.14
9209 17617 5.251468 ACATCTATATTGAGGGCCTGCATAA 59.749 40.000 12.95 0.51 0.00 1.90
9210 17618 6.069206 ACATCTATATTGAGGGCCTGCATAAT 60.069 38.462 12.95 8.89 0.00 1.28
9211 17619 6.392911 TCTATATTGAGGGCCTGCATAATT 57.607 37.500 12.95 0.00 0.00 1.40
9212 17620 6.793478 TCTATATTGAGGGCCTGCATAATTT 58.207 36.000 12.95 4.38 0.00 1.82
9213 17621 7.240897 TCTATATTGAGGGCCTGCATAATTTT 58.759 34.615 12.95 1.10 0.00 1.82
9214 17622 6.752285 ATATTGAGGGCCTGCATAATTTTT 57.248 33.333 12.95 0.00 0.00 1.94
9230 17638 0.951558 TTTTTCGAAGTGGCTGAGGC 59.048 50.000 0.00 0.00 37.82 4.70
9231 17639 0.179032 TTTTCGAAGTGGCTGAGGCA 60.179 50.000 3.93 3.93 40.87 4.75
9232 17640 0.179032 TTTCGAAGTGGCTGAGGCAA 60.179 50.000 11.29 0.00 40.46 4.52
9233 17641 0.179032 TTCGAAGTGGCTGAGGCAAA 60.179 50.000 11.29 0.00 40.46 3.68
9234 17642 0.884704 TCGAAGTGGCTGAGGCAAAC 60.885 55.000 11.29 0.00 40.46 2.93
9235 17643 1.165907 CGAAGTGGCTGAGGCAAACA 61.166 55.000 11.29 0.00 40.46 2.83
9236 17644 1.032014 GAAGTGGCTGAGGCAAACAA 58.968 50.000 11.29 0.00 40.46 2.83
9237 17645 1.000938 GAAGTGGCTGAGGCAAACAAG 60.001 52.381 11.29 0.00 40.46 3.16
9238 17646 1.006922 GTGGCTGAGGCAAACAAGC 60.007 57.895 11.29 0.00 40.46 4.01
9239 17647 1.455402 TGGCTGAGGCAAACAAGCA 60.455 52.632 6.12 0.00 40.87 3.91
9240 17648 1.288127 GGCTGAGGCAAACAAGCAG 59.712 57.895 0.00 0.00 40.87 4.24
9241 17649 1.174712 GGCTGAGGCAAACAAGCAGA 61.175 55.000 0.00 0.00 40.87 4.26
9242 17650 0.670162 GCTGAGGCAAACAAGCAGAA 59.330 50.000 0.00 0.00 38.54 3.02
9243 17651 1.271656 GCTGAGGCAAACAAGCAGAAT 59.728 47.619 0.00 0.00 38.54 2.40
9244 17652 2.925306 GCTGAGGCAAACAAGCAGAATG 60.925 50.000 0.00 0.00 38.54 2.67
9245 17653 1.614903 TGAGGCAAACAAGCAGAATGG 59.385 47.619 0.00 0.00 35.86 3.16
9261 17669 6.862209 GCAGAATGGTTTTATGTATTGTCCA 58.138 36.000 0.00 0.00 35.86 4.02
9262 17670 7.491682 GCAGAATGGTTTTATGTATTGTCCAT 58.508 34.615 0.00 0.00 35.86 3.41
9263 17671 7.436080 GCAGAATGGTTTTATGTATTGTCCATG 59.564 37.037 0.00 0.00 34.93 3.66
9264 17672 8.469200 CAGAATGGTTTTATGTATTGTCCATGT 58.531 33.333 0.00 0.00 34.93 3.21
9265 17673 9.693739 AGAATGGTTTTATGTATTGTCCATGTA 57.306 29.630 0.00 0.00 34.93 2.29
9266 17674 9.730420 GAATGGTTTTATGTATTGTCCATGTAC 57.270 33.333 0.00 0.00 34.93 2.90
9267 17675 9.474313 AATGGTTTTATGTATTGTCCATGTACT 57.526 29.630 0.00 0.00 34.93 2.73
9268 17676 8.275015 TGGTTTTATGTATTGTCCATGTACTG 57.725 34.615 0.00 0.00 0.00 2.74
9269 17677 7.885922 TGGTTTTATGTATTGTCCATGTACTGT 59.114 33.333 0.00 0.00 0.00 3.55
9270 17678 8.395633 GGTTTTATGTATTGTCCATGTACTGTC 58.604 37.037 0.00 0.00 0.00 3.51
9271 17679 9.162764 GTTTTATGTATTGTCCATGTACTGTCT 57.837 33.333 0.00 0.00 0.00 3.41
9272 17680 8.716646 TTTATGTATTGTCCATGTACTGTCTG 57.283 34.615 0.00 0.00 0.00 3.51
9273 17681 5.738619 TGTATTGTCCATGTACTGTCTGT 57.261 39.130 0.00 0.00 0.00 3.41
9274 17682 5.478407 TGTATTGTCCATGTACTGTCTGTG 58.522 41.667 0.00 0.00 0.00 3.66
9275 17683 3.401033 TTGTCCATGTACTGTCTGTGG 57.599 47.619 0.00 0.00 0.00 4.17
9276 17684 1.623311 TGTCCATGTACTGTCTGTGGG 59.377 52.381 0.00 0.00 0.00 4.61
9277 17685 1.899814 GTCCATGTACTGTCTGTGGGA 59.100 52.381 0.00 0.00 0.00 4.37
9278 17686 2.301870 GTCCATGTACTGTCTGTGGGAA 59.698 50.000 0.00 0.00 0.00 3.97
9279 17687 3.055094 GTCCATGTACTGTCTGTGGGAAT 60.055 47.826 0.00 0.00 0.00 3.01
9280 17688 4.161565 GTCCATGTACTGTCTGTGGGAATA 59.838 45.833 0.00 0.00 0.00 1.75
9281 17689 4.161565 TCCATGTACTGTCTGTGGGAATAC 59.838 45.833 0.00 0.00 0.00 1.89
9282 17690 3.861276 TGTACTGTCTGTGGGAATACG 57.139 47.619 0.00 0.00 0.00 3.06
9283 17691 3.423749 TGTACTGTCTGTGGGAATACGA 58.576 45.455 0.00 0.00 0.00 3.43
9284 17692 3.827876 TGTACTGTCTGTGGGAATACGAA 59.172 43.478 0.00 0.00 0.00 3.85
9285 17693 3.594603 ACTGTCTGTGGGAATACGAAG 57.405 47.619 0.00 0.00 0.00 3.79
9286 17694 2.233922 ACTGTCTGTGGGAATACGAAGG 59.766 50.000 0.00 0.00 0.00 3.46
9287 17695 2.496070 CTGTCTGTGGGAATACGAAGGA 59.504 50.000 0.00 0.00 0.00 3.36
9288 17696 3.104512 TGTCTGTGGGAATACGAAGGAT 58.895 45.455 0.00 0.00 0.00 3.24
9289 17697 3.132289 TGTCTGTGGGAATACGAAGGATC 59.868 47.826 0.00 0.00 0.00 3.36
9290 17698 3.132289 GTCTGTGGGAATACGAAGGATCA 59.868 47.826 0.00 0.00 0.00 2.92
9291 17699 3.132289 TCTGTGGGAATACGAAGGATCAC 59.868 47.826 0.00 0.00 0.00 3.06
9292 17700 3.104512 TGTGGGAATACGAAGGATCACT 58.895 45.455 0.00 0.00 0.00 3.41
9293 17701 3.132289 TGTGGGAATACGAAGGATCACTC 59.868 47.826 0.00 0.00 0.00 3.51
9294 17702 3.385111 GTGGGAATACGAAGGATCACTCT 59.615 47.826 0.00 0.00 0.00 3.24
9295 17703 3.384789 TGGGAATACGAAGGATCACTCTG 59.615 47.826 0.00 0.00 0.00 3.35
9296 17704 3.637229 GGGAATACGAAGGATCACTCTGA 59.363 47.826 0.00 0.00 0.00 3.27
9297 17705 4.500035 GGGAATACGAAGGATCACTCTGAC 60.500 50.000 0.00 0.00 0.00 3.51
9298 17706 4.339814 GGAATACGAAGGATCACTCTGACT 59.660 45.833 0.00 0.00 0.00 3.41
9299 17707 5.506649 GGAATACGAAGGATCACTCTGACTC 60.507 48.000 0.00 0.00 0.00 3.36
9300 17708 1.740585 ACGAAGGATCACTCTGACTCG 59.259 52.381 0.00 0.00 0.00 4.18
9301 17709 2.010497 CGAAGGATCACTCTGACTCGA 58.990 52.381 0.00 0.00 0.00 4.04
9302 17710 2.420372 CGAAGGATCACTCTGACTCGAA 59.580 50.000 0.00 0.00 0.00 3.71
9303 17711 3.119814 CGAAGGATCACTCTGACTCGAAA 60.120 47.826 0.00 0.00 0.00 3.46
9304 17712 4.616143 CGAAGGATCACTCTGACTCGAAAA 60.616 45.833 0.00 0.00 0.00 2.29
9305 17713 4.181309 AGGATCACTCTGACTCGAAAAC 57.819 45.455 0.00 0.00 0.00 2.43
9306 17714 3.056465 AGGATCACTCTGACTCGAAAACC 60.056 47.826 0.00 0.00 0.00 3.27
9307 17715 2.814280 TCACTCTGACTCGAAAACCC 57.186 50.000 0.00 0.00 0.00 4.11
9308 17716 2.317040 TCACTCTGACTCGAAAACCCT 58.683 47.619 0.00 0.00 0.00 4.34
9309 17717 2.698797 TCACTCTGACTCGAAAACCCTT 59.301 45.455 0.00 0.00 0.00 3.95
9310 17718 3.060602 CACTCTGACTCGAAAACCCTTC 58.939 50.000 0.00 0.00 0.00 3.46
9311 17719 2.698797 ACTCTGACTCGAAAACCCTTCA 59.301 45.455 0.00 0.00 0.00 3.02
9312 17720 3.325135 ACTCTGACTCGAAAACCCTTCAT 59.675 43.478 0.00 0.00 0.00 2.57
9313 17721 3.664107 TCTGACTCGAAAACCCTTCATG 58.336 45.455 0.00 0.00 0.00 3.07
9314 17722 3.071023 TCTGACTCGAAAACCCTTCATGT 59.929 43.478 0.00 0.00 0.00 3.21
9315 17723 3.399330 TGACTCGAAAACCCTTCATGTC 58.601 45.455 0.00 0.00 0.00 3.06
9316 17724 2.742589 GACTCGAAAACCCTTCATGTCC 59.257 50.000 0.00 0.00 0.00 4.02
9317 17725 2.105821 ACTCGAAAACCCTTCATGTCCA 59.894 45.455 0.00 0.00 0.00 4.02
9318 17726 2.484264 CTCGAAAACCCTTCATGTCCAC 59.516 50.000 0.00 0.00 0.00 4.02
9319 17727 2.158740 TCGAAAACCCTTCATGTCCACA 60.159 45.455 0.00 0.00 0.00 4.17
9320 17728 2.819608 CGAAAACCCTTCATGTCCACAT 59.180 45.455 0.00 0.00 36.96 3.21
9332 17740 3.354948 TGTCCACATGATTGAGAAGGG 57.645 47.619 0.00 0.00 0.00 3.95
9333 17741 2.644299 TGTCCACATGATTGAGAAGGGT 59.356 45.455 0.00 0.00 0.00 4.34
9334 17742 3.074390 TGTCCACATGATTGAGAAGGGTT 59.926 43.478 0.00 0.00 0.00 4.11
9335 17743 4.082125 GTCCACATGATTGAGAAGGGTTT 58.918 43.478 0.00 0.00 0.00 3.27
9336 17744 4.156739 GTCCACATGATTGAGAAGGGTTTC 59.843 45.833 0.00 0.00 0.00 2.78
9337 17745 4.081406 CCACATGATTGAGAAGGGTTTCA 58.919 43.478 0.00 0.00 35.70 2.69
9338 17746 4.708421 CCACATGATTGAGAAGGGTTTCAT 59.292 41.667 0.00 0.00 35.70 2.57
9339 17747 5.393787 CCACATGATTGAGAAGGGTTTCATG 60.394 44.000 0.00 8.68 43.69 3.07
9340 17748 4.159135 ACATGATTGAGAAGGGTTTCATGC 59.841 41.667 0.00 0.00 42.51 4.06
9341 17749 3.091545 TGATTGAGAAGGGTTTCATGCC 58.908 45.455 0.00 0.00 35.70 4.40
9342 17750 2.673775 TTGAGAAGGGTTTCATGCCA 57.326 45.000 0.00 0.00 35.70 4.92
9343 17751 1.909700 TGAGAAGGGTTTCATGCCAC 58.090 50.000 0.00 0.00 35.70 5.01
9344 17752 1.144708 TGAGAAGGGTTTCATGCCACA 59.855 47.619 0.00 0.00 35.70 4.17
9345 17753 1.541588 GAGAAGGGTTTCATGCCACAC 59.458 52.381 0.00 0.00 35.70 3.82
9346 17754 1.145738 AGAAGGGTTTCATGCCACACT 59.854 47.619 0.00 0.00 35.70 3.55
9347 17755 2.375174 AGAAGGGTTTCATGCCACACTA 59.625 45.455 0.00 0.00 35.70 2.74
9348 17756 3.010584 AGAAGGGTTTCATGCCACACTAT 59.989 43.478 0.00 0.00 35.70 2.12
9349 17757 4.227300 AGAAGGGTTTCATGCCACACTATA 59.773 41.667 0.00 0.00 35.70 1.31
9350 17758 4.584638 AGGGTTTCATGCCACACTATAA 57.415 40.909 0.00 0.00 0.00 0.98
9351 17759 5.129368 AGGGTTTCATGCCACACTATAAT 57.871 39.130 0.00 0.00 0.00 1.28
9352 17760 5.518865 AGGGTTTCATGCCACACTATAATT 58.481 37.500 0.00 0.00 0.00 1.40
9353 17761 5.957774 AGGGTTTCATGCCACACTATAATTT 59.042 36.000 0.00 0.00 0.00 1.82
9354 17762 6.440328 AGGGTTTCATGCCACACTATAATTTT 59.560 34.615 0.00 0.00 0.00 1.82
9355 17763 7.038373 AGGGTTTCATGCCACACTATAATTTTT 60.038 33.333 0.00 0.00 0.00 1.94
9356 17764 8.254508 GGGTTTCATGCCACACTATAATTTTTA 58.745 33.333 0.00 0.00 0.00 1.52
9357 17765 9.301153 GGTTTCATGCCACACTATAATTTTTAG 57.699 33.333 0.00 0.00 0.00 1.85
9360 17768 8.800370 TCATGCCACACTATAATTTTTAGACA 57.200 30.769 1.51 0.00 0.00 3.41
9361 17769 9.237187 TCATGCCACACTATAATTTTTAGACAA 57.763 29.630 1.51 0.00 0.00 3.18
9362 17770 9.853555 CATGCCACACTATAATTTTTAGACAAA 57.146 29.630 1.51 0.00 0.00 2.83
9364 17772 8.026607 TGCCACACTATAATTTTTAGACAAAGC 58.973 33.333 1.51 0.00 0.00 3.51
9365 17773 8.026607 GCCACACTATAATTTTTAGACAAAGCA 58.973 33.333 1.51 0.00 0.00 3.91
9366 17774 9.341899 CCACACTATAATTTTTAGACAAAGCAC 57.658 33.333 1.51 0.00 0.00 4.40
9367 17775 9.051027 CACACTATAATTTTTAGACAAAGCACG 57.949 33.333 1.51 0.00 0.00 5.34
9368 17776 8.234546 ACACTATAATTTTTAGACAAAGCACGG 58.765 33.333 1.51 0.00 0.00 4.94
9369 17777 8.447833 CACTATAATTTTTAGACAAAGCACGGA 58.552 33.333 1.51 0.00 0.00 4.69
9370 17778 8.665685 ACTATAATTTTTAGACAAAGCACGGAG 58.334 33.333 1.51 0.00 0.00 4.63
9371 17779 7.681939 ATAATTTTTAGACAAAGCACGGAGA 57.318 32.000 0.00 0.00 0.00 3.71
9372 17780 6.385649 AATTTTTAGACAAAGCACGGAGAA 57.614 33.333 0.00 0.00 0.00 2.87
9373 17781 5.821516 TTTTTAGACAAAGCACGGAGAAA 57.178 34.783 0.00 0.00 0.00 2.52
9374 17782 5.418310 TTTTAGACAAAGCACGGAGAAAG 57.582 39.130 0.00 0.00 0.00 2.62
9375 17783 2.910688 AGACAAAGCACGGAGAAAGA 57.089 45.000 0.00 0.00 0.00 2.52
9376 17784 2.760374 AGACAAAGCACGGAGAAAGAG 58.240 47.619 0.00 0.00 0.00 2.85
9377 17785 1.801178 GACAAAGCACGGAGAAAGAGG 59.199 52.381 0.00 0.00 0.00 3.69
9378 17786 1.160137 CAAAGCACGGAGAAAGAGGG 58.840 55.000 0.00 0.00 0.00 4.30
9379 17787 0.606673 AAAGCACGGAGAAAGAGGGC 60.607 55.000 0.00 0.00 0.00 5.19
9380 17788 1.484444 AAGCACGGAGAAAGAGGGCT 61.484 55.000 0.00 0.00 0.00 5.19
9381 17789 1.003233 GCACGGAGAAAGAGGGCTT 60.003 57.895 0.00 0.00 35.37 4.35
9382 17790 0.249398 GCACGGAGAAAGAGGGCTTA 59.751 55.000 0.00 0.00 32.98 3.09
9383 17791 1.134371 GCACGGAGAAAGAGGGCTTAT 60.134 52.381 0.00 0.00 32.98 1.73
9384 17792 2.555199 CACGGAGAAAGAGGGCTTATG 58.445 52.381 0.00 0.00 32.98 1.90
9385 17793 2.168521 CACGGAGAAAGAGGGCTTATGA 59.831 50.000 0.00 0.00 32.98 2.15
9386 17794 3.041946 ACGGAGAAAGAGGGCTTATGAT 58.958 45.455 0.00 0.00 32.98 2.45
9387 17795 3.181461 ACGGAGAAAGAGGGCTTATGATG 60.181 47.826 0.00 0.00 32.98 3.07
9388 17796 3.749226 GGAGAAAGAGGGCTTATGATGG 58.251 50.000 0.00 0.00 32.98 3.51
9389 17797 3.392616 GGAGAAAGAGGGCTTATGATGGA 59.607 47.826 0.00 0.00 32.98 3.41
9390 17798 4.141390 GGAGAAAGAGGGCTTATGATGGAA 60.141 45.833 0.00 0.00 32.98 3.53
9391 17799 5.046288 AGAAAGAGGGCTTATGATGGAAG 57.954 43.478 0.00 0.00 32.98 3.46
9392 17800 4.723789 AGAAAGAGGGCTTATGATGGAAGA 59.276 41.667 0.00 0.00 32.98 2.87
9393 17801 4.429854 AAGAGGGCTTATGATGGAAGAC 57.570 45.455 0.00 0.00 31.07 3.01
9394 17802 3.387962 AGAGGGCTTATGATGGAAGACA 58.612 45.455 0.00 0.00 33.19 3.41
9395 17803 3.782523 AGAGGGCTTATGATGGAAGACAA 59.217 43.478 0.00 0.00 33.19 3.18
9396 17804 4.414846 AGAGGGCTTATGATGGAAGACAAT 59.585 41.667 0.00 0.00 33.19 2.71
9397 17805 4.467769 AGGGCTTATGATGGAAGACAATG 58.532 43.478 0.00 0.00 33.19 2.82
9398 17806 4.166725 AGGGCTTATGATGGAAGACAATGA 59.833 41.667 0.00 0.00 33.19 2.57
9399 17807 4.889409 GGGCTTATGATGGAAGACAATGAA 59.111 41.667 0.00 0.00 33.19 2.57
9400 17808 5.009410 GGGCTTATGATGGAAGACAATGAAG 59.991 44.000 0.00 0.00 33.19 3.02
9401 17809 5.824624 GGCTTATGATGGAAGACAATGAAGA 59.175 40.000 0.00 0.00 31.72 2.87
9402 17810 6.319658 GGCTTATGATGGAAGACAATGAAGAA 59.680 38.462 0.00 0.00 31.72 2.52
9403 17811 7.148018 GGCTTATGATGGAAGACAATGAAGAAA 60.148 37.037 0.00 0.00 31.72 2.52
9404 17812 8.246180 GCTTATGATGGAAGACAATGAAGAAAA 58.754 33.333 0.00 0.00 0.00 2.29
9407 17815 7.822161 TGATGGAAGACAATGAAGAAAAAGA 57.178 32.000 0.00 0.00 0.00 2.52
9408 17816 7.879070 TGATGGAAGACAATGAAGAAAAAGAG 58.121 34.615 0.00 0.00 0.00 2.85
9409 17817 6.639632 TGGAAGACAATGAAGAAAAAGAGG 57.360 37.500 0.00 0.00 0.00 3.69
9410 17818 6.364701 TGGAAGACAATGAAGAAAAAGAGGA 58.635 36.000 0.00 0.00 0.00 3.71
9411 17819 7.006509 TGGAAGACAATGAAGAAAAAGAGGAT 58.993 34.615 0.00 0.00 0.00 3.24
9412 17820 7.040201 TGGAAGACAATGAAGAAAAAGAGGATG 60.040 37.037 0.00 0.00 0.00 3.51
9413 17821 7.175641 GGAAGACAATGAAGAAAAAGAGGATGA 59.824 37.037 0.00 0.00 0.00 2.92
9414 17822 8.647256 AAGACAATGAAGAAAAAGAGGATGAT 57.353 30.769 0.00 0.00 0.00 2.45
9415 17823 8.053026 AGACAATGAAGAAAAAGAGGATGATG 57.947 34.615 0.00 0.00 0.00 3.07
9416 17824 7.122353 AGACAATGAAGAAAAAGAGGATGATGG 59.878 37.037 0.00 0.00 0.00 3.51
9417 17825 5.848833 ATGAAGAAAAAGAGGATGATGGC 57.151 39.130 0.00 0.00 0.00 4.40
9418 17826 4.665451 TGAAGAAAAAGAGGATGATGGCA 58.335 39.130 0.00 0.00 0.00 4.92
9419 17827 5.078949 TGAAGAAAAAGAGGATGATGGCAA 58.921 37.500 0.00 0.00 0.00 4.52
9420 17828 5.047802 TGAAGAAAAAGAGGATGATGGCAAC 60.048 40.000 0.00 0.00 0.00 4.17
9421 17829 3.766051 AGAAAAAGAGGATGATGGCAACC 59.234 43.478 0.00 0.00 37.23 3.77
9422 17830 2.905415 AAAGAGGATGATGGCAACCA 57.095 45.000 0.00 0.00 39.29 3.67
9433 17841 2.435372 TGGCAACCATCCTATGTTCC 57.565 50.000 0.00 0.00 0.00 3.62
9434 17842 1.064017 TGGCAACCATCCTATGTTCCC 60.064 52.381 0.00 0.00 0.00 3.97
9435 17843 1.215423 GGCAACCATCCTATGTTCCCT 59.785 52.381 0.00 0.00 0.00 4.20
9436 17844 2.301346 GCAACCATCCTATGTTCCCTG 58.699 52.381 0.00 0.00 0.00 4.45
9437 17845 2.092429 GCAACCATCCTATGTTCCCTGA 60.092 50.000 0.00 0.00 0.00 3.86
9438 17846 3.624707 GCAACCATCCTATGTTCCCTGAA 60.625 47.826 0.00 0.00 0.00 3.02
9439 17847 4.796606 CAACCATCCTATGTTCCCTGAAT 58.203 43.478 0.00 0.00 0.00 2.57
9440 17848 5.690097 GCAACCATCCTATGTTCCCTGAATA 60.690 44.000 0.00 0.00 0.00 1.75
9441 17849 5.568620 ACCATCCTATGTTCCCTGAATAC 57.431 43.478 0.00 0.00 0.00 1.89
9442 17850 5.227593 ACCATCCTATGTTCCCTGAATACT 58.772 41.667 0.00 0.00 0.00 2.12
9443 17851 5.072329 ACCATCCTATGTTCCCTGAATACTG 59.928 44.000 0.00 0.00 0.00 2.74
9444 17852 5.072329 CCATCCTATGTTCCCTGAATACTGT 59.928 44.000 0.00 0.00 0.00 3.55
9445 17853 5.614324 TCCTATGTTCCCTGAATACTGTG 57.386 43.478 0.00 0.00 0.00 3.66
9446 17854 5.277250 TCCTATGTTCCCTGAATACTGTGA 58.723 41.667 0.00 0.00 0.00 3.58
9447 17855 5.905331 TCCTATGTTCCCTGAATACTGTGAT 59.095 40.000 0.00 0.00 0.00 3.06
9448 17856 7.073208 TCCTATGTTCCCTGAATACTGTGATA 58.927 38.462 0.00 0.00 0.00 2.15
9449 17857 7.015292 TCCTATGTTCCCTGAATACTGTGATAC 59.985 40.741 0.00 0.00 0.00 2.24
9450 17858 6.814954 ATGTTCCCTGAATACTGTGATACT 57.185 37.500 0.00 0.00 0.00 2.12
9451 17859 5.977635 TGTTCCCTGAATACTGTGATACTG 58.022 41.667 0.00 0.00 0.00 2.74
9452 17860 4.672587 TCCCTGAATACTGTGATACTGC 57.327 45.455 0.00 0.00 0.00 4.40
9453 17861 4.030216 TCCCTGAATACTGTGATACTGCA 58.970 43.478 0.00 0.00 0.00 4.41
9454 17862 4.469586 TCCCTGAATACTGTGATACTGCAA 59.530 41.667 0.00 0.00 0.00 4.08
9455 17863 4.572389 CCCTGAATACTGTGATACTGCAAC 59.428 45.833 0.00 0.00 0.00 4.17
9456 17864 5.178061 CCTGAATACTGTGATACTGCAACA 58.822 41.667 0.00 0.00 0.00 3.33
9457 17865 5.063944 CCTGAATACTGTGATACTGCAACAC 59.936 44.000 0.00 0.00 35.45 3.32
9458 17866 4.625311 TGAATACTGTGATACTGCAACACG 59.375 41.667 0.00 0.00 37.35 4.49
9459 17867 1.795768 ACTGTGATACTGCAACACGG 58.204 50.000 15.39 15.39 43.74 4.94
9460 17868 1.078709 CTGTGATACTGCAACACGGG 58.921 55.000 11.47 0.00 37.29 5.28
9461 17869 0.682292 TGTGATACTGCAACACGGGA 59.318 50.000 0.00 0.00 37.35 5.14
9462 17870 1.070914 TGTGATACTGCAACACGGGAA 59.929 47.619 0.00 0.00 37.35 3.97
9463 17871 1.732259 GTGATACTGCAACACGGGAAG 59.268 52.381 0.00 0.00 0.00 3.46
9464 17872 0.727398 GATACTGCAACACGGGAAGC 59.273 55.000 0.00 0.00 0.00 3.86
9465 17873 0.324943 ATACTGCAACACGGGAAGCT 59.675 50.000 0.00 0.00 0.00 3.74
9466 17874 0.602638 TACTGCAACACGGGAAGCTG 60.603 55.000 0.00 0.93 0.00 4.24
9467 17875 1.597854 CTGCAACACGGGAAGCTGA 60.598 57.895 0.00 0.00 0.00 4.26
9468 17876 1.153066 TGCAACACGGGAAGCTGAA 60.153 52.632 0.00 0.00 0.00 3.02
9469 17877 1.165907 TGCAACACGGGAAGCTGAAG 61.166 55.000 0.00 0.00 0.00 3.02
9470 17878 0.884704 GCAACACGGGAAGCTGAAGA 60.885 55.000 0.00 0.00 0.00 2.87
9471 17879 1.813513 CAACACGGGAAGCTGAAGAT 58.186 50.000 0.00 0.00 0.00 2.40
9472 17880 1.734465 CAACACGGGAAGCTGAAGATC 59.266 52.381 0.00 0.00 0.00 2.75
9473 17881 0.976641 ACACGGGAAGCTGAAGATCA 59.023 50.000 0.00 0.00 0.00 2.92
9474 17882 1.347707 ACACGGGAAGCTGAAGATCAA 59.652 47.619 0.00 0.00 0.00 2.57
9475 17883 2.005451 CACGGGAAGCTGAAGATCAAG 58.995 52.381 0.00 0.00 0.00 3.02
9476 17884 1.902508 ACGGGAAGCTGAAGATCAAGA 59.097 47.619 0.00 0.00 0.00 3.02
9477 17885 2.093764 ACGGGAAGCTGAAGATCAAGAG 60.094 50.000 0.00 0.00 0.00 2.85
9478 17886 2.287769 GGGAAGCTGAAGATCAAGAGC 58.712 52.381 0.00 0.00 0.00 4.09
9479 17887 2.355513 GGGAAGCTGAAGATCAAGAGCA 60.356 50.000 11.18 0.00 0.00 4.26
9480 17888 3.543665 GGAAGCTGAAGATCAAGAGCAT 58.456 45.455 11.18 1.08 0.00 3.79
9481 17889 3.312973 GGAAGCTGAAGATCAAGAGCATG 59.687 47.826 11.18 0.00 0.00 4.06
9482 17890 2.920524 AGCTGAAGATCAAGAGCATGG 58.079 47.619 11.18 0.00 0.00 3.66
9483 17891 2.239150 AGCTGAAGATCAAGAGCATGGT 59.761 45.455 0.00 0.00 0.00 3.55
9484 17892 3.015327 GCTGAAGATCAAGAGCATGGTT 58.985 45.455 0.00 0.00 0.00 3.67
9485 17893 3.442977 GCTGAAGATCAAGAGCATGGTTT 59.557 43.478 0.00 0.00 0.00 3.27
9486 17894 4.082354 GCTGAAGATCAAGAGCATGGTTTT 60.082 41.667 0.00 0.00 0.00 2.43
9487 17895 5.381174 TGAAGATCAAGAGCATGGTTTTG 57.619 39.130 19.17 19.17 0.00 2.44
9488 17896 4.219070 TGAAGATCAAGAGCATGGTTTTGG 59.781 41.667 23.23 9.04 0.00 3.28
9489 17897 3.094572 AGATCAAGAGCATGGTTTTGGG 58.905 45.455 23.23 4.17 0.00 4.12
9490 17898 2.380064 TCAAGAGCATGGTTTTGGGT 57.620 45.000 23.23 0.00 0.00 4.51
9491 17899 3.517296 TCAAGAGCATGGTTTTGGGTA 57.483 42.857 23.23 6.22 0.00 3.69
9492 17900 3.153919 TCAAGAGCATGGTTTTGGGTAC 58.846 45.455 23.23 0.00 0.00 3.34
9507 17915 1.150827 GGTACCACCCGAGAAAAACG 58.849 55.000 7.15 0.00 30.04 3.60
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 7.996644 TCGCCTACCTTTTCCTCATAAAAATAT 59.003 33.333 0.00 0.00 0.00 1.28
11 12 6.184789 TCGCCTACCTTTTCCTCATAAAAAT 58.815 36.000 0.00 0.00 0.00 1.82
12 13 5.562635 TCGCCTACCTTTTCCTCATAAAAA 58.437 37.500 0.00 0.00 0.00 1.94
13 14 5.168647 TCGCCTACCTTTTCCTCATAAAA 57.831 39.130 0.00 0.00 0.00 1.52
15 16 4.202326 GGATCGCCTACCTTTTCCTCATAA 60.202 45.833 0.00 0.00 0.00 1.90
16 17 3.323979 GGATCGCCTACCTTTTCCTCATA 59.676 47.826 0.00 0.00 0.00 2.15
18 19 1.485066 GGATCGCCTACCTTTTCCTCA 59.515 52.381 0.00 0.00 0.00 3.86
19 20 1.538419 CGGATCGCCTACCTTTTCCTC 60.538 57.143 0.00 0.00 0.00 3.71
20 21 0.464452 CGGATCGCCTACCTTTTCCT 59.536 55.000 0.00 0.00 0.00 3.36
21 22 0.177373 ACGGATCGCCTACCTTTTCC 59.823 55.000 0.00 0.00 0.00 3.13
22 23 1.568606 GACGGATCGCCTACCTTTTC 58.431 55.000 0.00 0.00 0.00 2.29
23 24 0.179119 CGACGGATCGCCTACCTTTT 60.179 55.000 0.00 0.00 42.43 2.27
24 25 1.436336 CGACGGATCGCCTACCTTT 59.564 57.895 0.00 0.00 42.43 3.11
25 26 3.117372 CGACGGATCGCCTACCTT 58.883 61.111 0.00 0.00 42.43 3.50
34 35 0.442699 GCACCTGAAAACGACGGATC 59.557 55.000 0.00 0.00 0.00 3.36
35 36 1.289109 CGCACCTGAAAACGACGGAT 61.289 55.000 0.00 0.00 0.00 4.18
36 37 1.952133 CGCACCTGAAAACGACGGA 60.952 57.895 0.00 0.00 0.00 4.69
37 38 2.241880 ACGCACCTGAAAACGACGG 61.242 57.895 0.00 0.00 0.00 4.79
38 39 1.083657 CACGCACCTGAAAACGACG 60.084 57.895 0.00 0.00 0.00 5.12
39 40 1.278637 CCACGCACCTGAAAACGAC 59.721 57.895 0.00 0.00 0.00 4.34
40 41 1.890041 CCCACGCACCTGAAAACGA 60.890 57.895 0.00 0.00 0.00 3.85
41 42 2.184167 ACCCACGCACCTGAAAACG 61.184 57.895 0.00 0.00 0.00 3.60
42 43 1.098712 TCACCCACGCACCTGAAAAC 61.099 55.000 0.00 0.00 0.00 2.43
43 44 0.817634 CTCACCCACGCACCTGAAAA 60.818 55.000 0.00 0.00 0.00 2.29
44 45 1.227823 CTCACCCACGCACCTGAAA 60.228 57.895 0.00 0.00 0.00 2.69
45 46 1.978455 AACTCACCCACGCACCTGAA 61.978 55.000 0.00 0.00 0.00 3.02
46 47 2.439960 AACTCACCCACGCACCTGA 61.440 57.895 0.00 0.00 0.00 3.86
47 48 2.111043 AACTCACCCACGCACCTG 59.889 61.111 0.00 0.00 0.00 4.00
48 49 2.111043 CAACTCACCCACGCACCT 59.889 61.111 0.00 0.00 0.00 4.00
49 50 3.660111 GCAACTCACCCACGCACC 61.660 66.667 0.00 0.00 0.00 5.01
50 51 0.953471 TATGCAACTCACCCACGCAC 60.953 55.000 0.00 0.00 35.02 5.34
51 52 0.953471 GTATGCAACTCACCCACGCA 60.953 55.000 0.00 0.00 36.95 5.24
52 53 1.794222 GTATGCAACTCACCCACGC 59.206 57.895 0.00 0.00 0.00 5.34
53 54 0.669318 ACGTATGCAACTCACCCACG 60.669 55.000 0.00 0.00 35.27 4.94
54 55 2.268298 CTACGTATGCAACTCACCCAC 58.732 52.381 0.00 0.00 0.00 4.61
55 56 1.206132 CCTACGTATGCAACTCACCCA 59.794 52.381 0.00 0.00 0.00 4.51
56 57 1.479323 TCCTACGTATGCAACTCACCC 59.521 52.381 0.00 0.00 0.00 4.61
57 58 2.953466 TCCTACGTATGCAACTCACC 57.047 50.000 0.00 0.00 0.00 4.02
58 59 4.326548 GTCTTTCCTACGTATGCAACTCAC 59.673 45.833 0.00 0.00 0.00 3.51
59 60 4.021807 TGTCTTTCCTACGTATGCAACTCA 60.022 41.667 0.00 0.00 0.00 3.41
60 61 4.326548 GTGTCTTTCCTACGTATGCAACTC 59.673 45.833 0.00 0.00 0.00 3.01
61 62 4.243270 GTGTCTTTCCTACGTATGCAACT 58.757 43.478 0.00 0.00 0.00 3.16
62 63 3.991773 TGTGTCTTTCCTACGTATGCAAC 59.008 43.478 0.00 0.00 0.00 4.17
63 64 4.260139 TGTGTCTTTCCTACGTATGCAA 57.740 40.909 0.00 0.00 0.00 4.08
64 65 3.945981 TGTGTCTTTCCTACGTATGCA 57.054 42.857 0.00 0.00 0.00 3.96
65 66 4.927425 TCTTTGTGTCTTTCCTACGTATGC 59.073 41.667 0.00 0.00 0.00 3.14
66 67 6.308282 GTCTCTTTGTGTCTTTCCTACGTATG 59.692 42.308 0.00 0.00 0.00 2.39
67 68 6.015688 TGTCTCTTTGTGTCTTTCCTACGTAT 60.016 38.462 0.00 0.00 0.00 3.06
68 69 5.300034 TGTCTCTTTGTGTCTTTCCTACGTA 59.700 40.000 0.00 0.00 0.00 3.57
69 70 4.098960 TGTCTCTTTGTGTCTTTCCTACGT 59.901 41.667 0.00 0.00 0.00 3.57
70 71 4.617959 TGTCTCTTTGTGTCTTTCCTACG 58.382 43.478 0.00 0.00 0.00 3.51
71 72 4.991687 CCTGTCTCTTTGTGTCTTTCCTAC 59.008 45.833 0.00 0.00 0.00 3.18
72 73 4.899457 TCCTGTCTCTTTGTGTCTTTCCTA 59.101 41.667 0.00 0.00 0.00 2.94
73 74 3.711704 TCCTGTCTCTTTGTGTCTTTCCT 59.288 43.478 0.00 0.00 0.00 3.36
74 75 4.073293 TCCTGTCTCTTTGTGTCTTTCC 57.927 45.455 0.00 0.00 0.00 3.13
75 76 5.049129 CCAATCCTGTCTCTTTGTGTCTTTC 60.049 44.000 0.00 0.00 0.00 2.62
76 77 4.823989 CCAATCCTGTCTCTTTGTGTCTTT 59.176 41.667 0.00 0.00 0.00 2.52
77 78 4.392940 CCAATCCTGTCTCTTTGTGTCTT 58.607 43.478 0.00 0.00 0.00 3.01
78 79 3.244700 CCCAATCCTGTCTCTTTGTGTCT 60.245 47.826 0.00 0.00 0.00 3.41
79 80 3.077359 CCCAATCCTGTCTCTTTGTGTC 58.923 50.000 0.00 0.00 0.00 3.67
80 81 2.443255 ACCCAATCCTGTCTCTTTGTGT 59.557 45.455 0.00 0.00 0.00 3.72
81 82 3.146104 ACCCAATCCTGTCTCTTTGTG 57.854 47.619 0.00 0.00 0.00 3.33
82 83 3.490348 CAACCCAATCCTGTCTCTTTGT 58.510 45.455 0.00 0.00 0.00 2.83
83 84 2.821969 CCAACCCAATCCTGTCTCTTTG 59.178 50.000 0.00 0.00 0.00 2.77
84 85 2.225117 CCCAACCCAATCCTGTCTCTTT 60.225 50.000 0.00 0.00 0.00 2.52
85 86 1.355720 CCCAACCCAATCCTGTCTCTT 59.644 52.381 0.00 0.00 0.00 2.85
86 87 0.995024 CCCAACCCAATCCTGTCTCT 59.005 55.000 0.00 0.00 0.00 3.10
87 88 0.698818 ACCCAACCCAATCCTGTCTC 59.301 55.000 0.00 0.00 0.00 3.36
88 89 1.158007 AACCCAACCCAATCCTGTCT 58.842 50.000 0.00 0.00 0.00 3.41
89 90 1.256812 CAACCCAACCCAATCCTGTC 58.743 55.000 0.00 0.00 0.00 3.51
90 91 0.560688 ACAACCCAACCCAATCCTGT 59.439 50.000 0.00 0.00 0.00 4.00
91 92 1.715785 AACAACCCAACCCAATCCTG 58.284 50.000 0.00 0.00 0.00 3.86
92 93 3.621682 TTAACAACCCAACCCAATCCT 57.378 42.857 0.00 0.00 0.00 3.24
125 126 0.169230 GAGACGTCACTCACTCGCAT 59.831 55.000 19.50 0.00 36.95 4.73
126 127 0.885150 AGAGACGTCACTCACTCGCA 60.885 55.000 19.50 0.00 39.14 5.10
149 150 8.812513 TCCAACTCATCTACATTTCATTTCAT 57.187 30.769 0.00 0.00 0.00 2.57
162 163 2.100916 GCTACGGCTTCCAACTCATCTA 59.899 50.000 0.00 0.00 35.22 1.98
164 165 1.291132 GCTACGGCTTCCAACTCATC 58.709 55.000 0.00 0.00 35.22 2.92
165 166 0.613260 TGCTACGGCTTCCAACTCAT 59.387 50.000 0.00 0.00 39.59 2.90
166 167 0.613260 ATGCTACGGCTTCCAACTCA 59.387 50.000 0.00 0.00 39.59 3.41
167 168 2.596904 TATGCTACGGCTTCCAACTC 57.403 50.000 0.00 0.00 39.59 3.01
169 170 1.264288 GCATATGCTACGGCTTCCAAC 59.736 52.381 20.64 0.00 39.59 3.77
171 172 3.305709 GCATATGCTACGGCTTCCA 57.694 52.632 20.64 0.00 39.59 3.53
194 199 1.197036 GCTGGTCTAACTTGCGGAAAC 59.803 52.381 0.00 0.00 0.00 2.78
206 211 3.904339 AGGAAGAGACAAAAGCTGGTCTA 59.096 43.478 13.94 0.00 44.03 2.59
209 214 2.708325 AGAGGAAGAGACAAAAGCTGGT 59.292 45.455 0.00 0.00 0.00 4.00
239 244 1.443828 GGCTCCGGCTCCTTTAGAG 59.556 63.158 0.00 0.00 46.29 2.43
262 354 9.183368 TGAAGATGGTGCACAATTAATAATACA 57.817 29.630 20.43 2.66 0.00 2.29
265 357 9.139734 AGATGAAGATGGTGCACAATTAATAAT 57.860 29.630 20.43 4.75 0.00 1.28
274 387 3.421919 TGAAGATGAAGATGGTGCACA 57.578 42.857 20.43 5.24 0.00 4.57
286 399 5.404395 AGATGGAGATGGAGATGAAGATGA 58.596 41.667 0.00 0.00 0.00 2.92
292 405 3.625252 TGGAGATGGAGATGGAGATGA 57.375 47.619 0.00 0.00 0.00 2.92
294 407 5.371769 TGAAAATGGAGATGGAGATGGAGAT 59.628 40.000 0.00 0.00 0.00 2.75
295 408 4.723285 TGAAAATGGAGATGGAGATGGAGA 59.277 41.667 0.00 0.00 0.00 3.71
296 409 5.045012 TGAAAATGGAGATGGAGATGGAG 57.955 43.478 0.00 0.00 0.00 3.86
298 411 5.632118 AGATGAAAATGGAGATGGAGATGG 58.368 41.667 0.00 0.00 0.00 3.51
299 412 5.706369 GGAGATGAAAATGGAGATGGAGATG 59.294 44.000 0.00 0.00 0.00 2.90
300 413 5.371769 TGGAGATGAAAATGGAGATGGAGAT 59.628 40.000 0.00 0.00 0.00 2.75
301 414 4.723285 TGGAGATGAAAATGGAGATGGAGA 59.277 41.667 0.00 0.00 0.00 3.71
302 415 5.045012 TGGAGATGAAAATGGAGATGGAG 57.955 43.478 0.00 0.00 0.00 3.86
303 416 5.371769 AGATGGAGATGAAAATGGAGATGGA 59.628 40.000 0.00 0.00 0.00 3.41
304 417 5.632118 AGATGGAGATGAAAATGGAGATGG 58.368 41.667 0.00 0.00 0.00 3.51
305 418 5.706369 GGAGATGGAGATGAAAATGGAGATG 59.294 44.000 0.00 0.00 0.00 2.90
307 420 4.723285 TGGAGATGGAGATGAAAATGGAGA 59.277 41.667 0.00 0.00 0.00 3.71
308 421 5.045012 TGGAGATGGAGATGAAAATGGAG 57.955 43.478 0.00 0.00 0.00 3.86
309 422 5.457197 GGATGGAGATGGAGATGAAAATGGA 60.457 44.000 0.00 0.00 0.00 3.41
311 424 4.454847 CGGATGGAGATGGAGATGAAAATG 59.545 45.833 0.00 0.00 0.00 2.32
314 427 3.041211 ACGGATGGAGATGGAGATGAAA 58.959 45.455 0.00 0.00 0.00 2.69
315 428 2.366590 CACGGATGGAGATGGAGATGAA 59.633 50.000 0.00 0.00 0.00 2.57
316 429 1.966354 CACGGATGGAGATGGAGATGA 59.034 52.381 0.00 0.00 0.00 2.92
317 430 1.607509 GCACGGATGGAGATGGAGATG 60.608 57.143 0.00 0.00 0.00 2.90
319 432 1.738346 CGCACGGATGGAGATGGAGA 61.738 60.000 0.00 0.00 0.00 3.71
321 434 2.058001 ACGCACGGATGGAGATGGA 61.058 57.895 0.00 0.00 0.00 3.41
322 435 1.884464 CACGCACGGATGGAGATGG 60.884 63.158 0.00 0.00 0.00 3.51
323 436 2.528743 GCACGCACGGATGGAGATG 61.529 63.158 0.00 0.00 0.00 2.90
324 437 2.202932 GCACGCACGGATGGAGAT 60.203 61.111 0.00 0.00 0.00 2.75
325 438 4.794439 CGCACGCACGGATGGAGA 62.794 66.667 0.00 0.00 0.00 3.71
329 442 4.428922 CACACGCACGCACGGATG 62.429 66.667 2.61 0.00 37.37 3.51
330 443 3.932580 ATCACACGCACGCACGGAT 62.933 57.895 2.61 0.00 37.37 4.18
393 515 8.987890 GTTGCTGACCACATTTTACAATTTATT 58.012 29.630 0.00 0.00 0.00 1.40
394 516 8.147058 TGTTGCTGACCACATTTTACAATTTAT 58.853 29.630 0.00 0.00 0.00 1.40
395 517 7.492524 TGTTGCTGACCACATTTTACAATTTA 58.507 30.769 0.00 0.00 0.00 1.40
396 518 6.344500 TGTTGCTGACCACATTTTACAATTT 58.656 32.000 0.00 0.00 0.00 1.82
458 580 0.392595 TCCATGCAAGCAGAGCAGAG 60.393 55.000 0.00 0.10 46.36 3.35
462 584 3.642901 CATTCCATGCAAGCAGAGC 57.357 52.632 0.00 0.00 0.00 4.09
490 680 8.040727 AGTCAAAGTTTGTTTGCTAAGGATTTT 58.959 29.630 15.08 0.00 0.00 1.82
491 681 7.555965 AGTCAAAGTTTGTTTGCTAAGGATTT 58.444 30.769 15.08 0.00 0.00 2.17
492 682 7.112452 AGTCAAAGTTTGTTTGCTAAGGATT 57.888 32.000 15.08 0.00 0.00 3.01
493 683 6.715347 AGTCAAAGTTTGTTTGCTAAGGAT 57.285 33.333 15.08 0.00 0.00 3.24
494 684 6.151985 TCAAGTCAAAGTTTGTTTGCTAAGGA 59.848 34.615 20.74 8.39 0.00 3.36
495 685 6.253512 GTCAAGTCAAAGTTTGTTTGCTAAGG 59.746 38.462 20.74 9.34 0.00 2.69
496 686 6.806249 TGTCAAGTCAAAGTTTGTTTGCTAAG 59.194 34.615 20.74 11.08 0.00 2.18
497 687 6.682746 TGTCAAGTCAAAGTTTGTTTGCTAA 58.317 32.000 20.74 11.75 0.00 3.09
498 688 6.260870 TGTCAAGTCAAAGTTTGTTTGCTA 57.739 33.333 20.74 13.67 0.00 3.49
504 698 4.617298 CGGGTTTGTCAAGTCAAAGTTTGT 60.617 41.667 15.08 0.00 37.87 2.83
509 703 1.269051 GGCGGGTTTGTCAAGTCAAAG 60.269 52.381 0.00 0.00 37.87 2.77
519 713 0.824595 GGGTAAGTTGGCGGGTTTGT 60.825 55.000 0.00 0.00 0.00 2.83
525 719 3.996614 CCAAGGGTAAGTTGGCGG 58.003 61.111 0.00 0.00 38.23 6.13
529 723 3.154710 GGAAGGAACCAAGGGTAAGTTG 58.845 50.000 0.00 0.00 33.12 3.16
530 724 3.061369 AGGAAGGAACCAAGGGTAAGTT 58.939 45.455 0.00 0.00 33.12 2.66
531 725 2.714808 AGGAAGGAACCAAGGGTAAGT 58.285 47.619 0.00 0.00 33.12 2.24
533 727 2.490168 GCAAGGAAGGAACCAAGGGTAA 60.490 50.000 0.00 0.00 33.12 2.85
534 728 1.074889 GCAAGGAAGGAACCAAGGGTA 59.925 52.381 0.00 0.00 33.12 3.69
535 729 0.178961 GCAAGGAAGGAACCAAGGGT 60.179 55.000 0.00 0.00 37.65 4.34
536 730 0.113190 AGCAAGGAAGGAACCAAGGG 59.887 55.000 0.00 0.00 0.00 3.95
538 732 1.537202 CGAAGCAAGGAAGGAACCAAG 59.463 52.381 0.00 0.00 0.00 3.61
539 733 1.133915 ACGAAGCAAGGAAGGAACCAA 60.134 47.619 0.00 0.00 0.00 3.67
541 735 1.605753 AACGAAGCAAGGAAGGAACC 58.394 50.000 0.00 0.00 0.00 3.62
542 736 3.426292 GCATAACGAAGCAAGGAAGGAAC 60.426 47.826 0.00 0.00 0.00 3.62
545 739 2.359900 AGCATAACGAAGCAAGGAAGG 58.640 47.619 0.00 0.00 0.00 3.46
546 740 4.033358 CACTAGCATAACGAAGCAAGGAAG 59.967 45.833 0.00 0.00 0.00 3.46
547 741 3.932710 CACTAGCATAACGAAGCAAGGAA 59.067 43.478 0.00 0.00 0.00 3.36
548 742 3.521560 CACTAGCATAACGAAGCAAGGA 58.478 45.455 0.00 0.00 0.00 3.36
549 743 2.030946 GCACTAGCATAACGAAGCAAGG 59.969 50.000 0.00 0.00 41.58 3.61
550 744 2.932614 AGCACTAGCATAACGAAGCAAG 59.067 45.455 0.00 0.00 45.49 4.01
554 2207 5.176407 AGTCTAGCACTAGCATAACGAAG 57.824 43.478 0.00 0.00 45.49 3.79
588 2241 7.121168 GCAGCCTGCCTCATTACATTATTAATA 59.879 37.037 5.06 0.00 37.42 0.98
589 2242 6.071728 GCAGCCTGCCTCATTACATTATTAAT 60.072 38.462 5.06 0.00 37.42 1.40
590 2243 5.241506 GCAGCCTGCCTCATTACATTATTAA 59.758 40.000 5.06 0.00 37.42 1.40
595 2248 1.064166 AGCAGCCTGCCTCATTACATT 60.064 47.619 14.25 0.00 46.52 2.71
597 2250 0.393402 CAGCAGCCTGCCTCATTACA 60.393 55.000 14.25 0.00 46.52 2.41
599 2252 0.179702 CTCAGCAGCCTGCCTCATTA 59.820 55.000 14.25 0.00 46.52 1.90
601 2254 2.590645 CTCAGCAGCCTGCCTCAT 59.409 61.111 14.25 0.00 46.52 2.90
602 2255 4.405671 GCTCAGCAGCCTGCCTCA 62.406 66.667 14.25 0.00 46.52 3.86
603 2256 3.700831 ATGCTCAGCAGCCTGCCTC 62.701 63.158 14.25 0.51 46.52 4.70
649 2302 1.103398 AAGAAGGCCGGTGCATATGC 61.103 55.000 21.09 21.09 40.13 3.14
650 2303 0.947244 GAAGAAGGCCGGTGCATATG 59.053 55.000 1.90 0.00 40.13 1.78
651 2304 0.839946 AGAAGAAGGCCGGTGCATAT 59.160 50.000 1.90 0.00 40.13 1.78
652 2305 0.618458 AAGAAGAAGGCCGGTGCATA 59.382 50.000 1.90 0.00 40.13 3.14
672 2325 0.253207 AGGGAAGGGAAGGGAACGAT 60.253 55.000 0.00 0.00 0.00 3.73
673 2326 0.475048 AAGGGAAGGGAAGGGAACGA 60.475 55.000 0.00 0.00 0.00 3.85
674 2327 0.035343 GAAGGGAAGGGAAGGGAACG 60.035 60.000 0.00 0.00 0.00 3.95
675 2328 0.331954 GGAAGGGAAGGGAAGGGAAC 59.668 60.000 0.00 0.00 0.00 3.62
676 2329 0.849540 GGGAAGGGAAGGGAAGGGAA 60.850 60.000 0.00 0.00 0.00 3.97
677 2330 1.230182 GGGAAGGGAAGGGAAGGGA 60.230 63.158 0.00 0.00 0.00 4.20
678 2331 0.851332 AAGGGAAGGGAAGGGAAGGG 60.851 60.000 0.00 0.00 0.00 3.95
679 2332 0.626382 GAAGGGAAGGGAAGGGAAGG 59.374 60.000 0.00 0.00 0.00 3.46
680 2333 0.626382 GGAAGGGAAGGGAAGGGAAG 59.374 60.000 0.00 0.00 0.00 3.46
681 2334 0.849540 GGGAAGGGAAGGGAAGGGAA 60.850 60.000 0.00 0.00 0.00 3.97
682 2335 1.230182 GGGAAGGGAAGGGAAGGGA 60.230 63.158 0.00 0.00 0.00 4.20
683 2336 1.230314 AGGGAAGGGAAGGGAAGGG 60.230 63.158 0.00 0.00 0.00 3.95
684 2337 2.002625 CAGGGAAGGGAAGGGAAGG 58.997 63.158 0.00 0.00 0.00 3.46
685 2338 1.304617 GCAGGGAAGGGAAGGGAAG 59.695 63.158 0.00 0.00 0.00 3.46
686 2339 2.238701 GGCAGGGAAGGGAAGGGAA 61.239 63.158 0.00 0.00 0.00 3.97
687 2340 2.614013 GGCAGGGAAGGGAAGGGA 60.614 66.667 0.00 0.00 0.00 4.20
688 2341 2.241659 AAGGCAGGGAAGGGAAGGG 61.242 63.158 0.00 0.00 0.00 3.95
689 2342 1.000396 CAAGGCAGGGAAGGGAAGG 60.000 63.158 0.00 0.00 0.00 3.46
690 2343 1.680314 GCAAGGCAGGGAAGGGAAG 60.680 63.158 0.00 0.00 0.00 3.46
691 2344 2.440599 GCAAGGCAGGGAAGGGAA 59.559 61.111 0.00 0.00 0.00 3.97
692 2345 3.661648 GGCAAGGCAGGGAAGGGA 61.662 66.667 0.00 0.00 0.00 4.20
695 2348 4.729918 AGCGGCAAGGCAGGGAAG 62.730 66.667 1.45 0.00 34.64 3.46
696 2349 4.284550 AAGCGGCAAGGCAGGGAA 62.285 61.111 1.45 0.00 34.64 3.97
708 2361 1.745087 ACAATCATACAAGCCAAGCGG 59.255 47.619 0.00 0.00 0.00 5.52
709 2362 4.512944 AGATACAATCATACAAGCCAAGCG 59.487 41.667 0.00 0.00 0.00 4.68
710 2363 5.762218 AGAGATACAATCATACAAGCCAAGC 59.238 40.000 0.00 0.00 0.00 4.01
711 2364 7.215789 AGAGAGATACAATCATACAAGCCAAG 58.784 38.462 0.00 0.00 0.00 3.61
712 2365 7.129457 AGAGAGATACAATCATACAAGCCAA 57.871 36.000 0.00 0.00 0.00 4.52
713 2366 6.239430 GGAGAGAGATACAATCATACAAGCCA 60.239 42.308 0.00 0.00 0.00 4.75
714 2367 6.014669 AGGAGAGAGATACAATCATACAAGCC 60.015 42.308 0.00 0.00 0.00 4.35
715 2368 6.991938 AGGAGAGAGATACAATCATACAAGC 58.008 40.000 0.00 0.00 0.00 4.01
716 2369 8.408043 AGAGGAGAGAGATACAATCATACAAG 57.592 38.462 0.00 0.00 0.00 3.16
755 2408 7.201626 GCAGATGAGATGCAAATATCATACTCC 60.202 40.741 0.00 0.00 43.31 3.85
756 2409 7.549842 AGCAGATGAGATGCAAATATCATACTC 59.450 37.037 0.00 0.00 46.31 2.59
757 2410 7.395617 AGCAGATGAGATGCAAATATCATACT 58.604 34.615 0.00 0.00 46.31 2.12
763 2416 6.124316 AGGTAGCAGATGAGATGCAAATAT 57.876 37.500 0.00 0.00 46.31 1.28
792 2445 0.671472 GCCTTGATTTGGCTTGTGGC 60.671 55.000 0.00 0.00 46.38 5.01
800 2453 3.749665 TTGTTCCTTGCCTTGATTTGG 57.250 42.857 0.00 0.00 0.00 3.28
803 2456 4.559153 CGATTTTGTTCCTTGCCTTGATT 58.441 39.130 0.00 0.00 0.00 2.57
804 2457 3.056607 CCGATTTTGTTCCTTGCCTTGAT 60.057 43.478 0.00 0.00 0.00 2.57
805 2458 2.295909 CCGATTTTGTTCCTTGCCTTGA 59.704 45.455 0.00 0.00 0.00 3.02
844 2497 0.111253 GGAATGGGAATGGGCGATCT 59.889 55.000 0.00 0.00 0.00 2.75
878 2537 1.186200 TGGTCTCCTCCGTTGATGAG 58.814 55.000 0.00 0.00 35.32 2.90
879 2538 1.275291 GTTGGTCTCCTCCGTTGATGA 59.725 52.381 0.00 0.00 0.00 2.92
880 2539 1.001974 TGTTGGTCTCCTCCGTTGATG 59.998 52.381 0.00 0.00 0.00 3.07
881 2540 1.002087 GTGTTGGTCTCCTCCGTTGAT 59.998 52.381 0.00 0.00 0.00 2.57
882 2541 0.391597 GTGTTGGTCTCCTCCGTTGA 59.608 55.000 0.00 0.00 0.00 3.18
883 2542 0.602905 GGTGTTGGTCTCCTCCGTTG 60.603 60.000 0.00 0.00 0.00 4.10
884 2543 0.763223 AGGTGTTGGTCTCCTCCGTT 60.763 55.000 0.00 0.00 35.39 4.44
885 2544 0.763223 AAGGTGTTGGTCTCCTCCGT 60.763 55.000 0.00 0.00 38.87 4.69
887 2546 0.325272 GGAAGGTGTTGGTCTCCTCC 59.675 60.000 0.00 0.00 38.87 4.30
888 2547 1.353091 AGGAAGGTGTTGGTCTCCTC 58.647 55.000 0.00 0.00 38.87 3.71
889 2548 1.700186 GAAGGAAGGTGTTGGTCTCCT 59.300 52.381 0.00 0.00 41.20 3.69
890 2549 1.271434 GGAAGGAAGGTGTTGGTCTCC 60.271 57.143 0.00 0.00 0.00 3.71
891 2550 1.700186 AGGAAGGAAGGTGTTGGTCTC 59.300 52.381 0.00 0.00 0.00 3.36
892 2551 1.821088 AGGAAGGAAGGTGTTGGTCT 58.179 50.000 0.00 0.00 0.00 3.85
893 2552 2.658807 AAGGAAGGAAGGTGTTGGTC 57.341 50.000 0.00 0.00 0.00 4.02
894 2553 2.424379 GGAAAGGAAGGAAGGTGTTGGT 60.424 50.000 0.00 0.00 0.00 3.67
895 2554 2.158460 AGGAAAGGAAGGAAGGTGTTGG 60.158 50.000 0.00 0.00 0.00 3.77
896 2555 3.229697 AGGAAAGGAAGGAAGGTGTTG 57.770 47.619 0.00 0.00 0.00 3.33
897 2556 3.973472 AAGGAAAGGAAGGAAGGTGTT 57.027 42.857 0.00 0.00 0.00 3.32
898 2557 3.436615 GGAAAGGAAAGGAAGGAAGGTGT 60.437 47.826 0.00 0.00 0.00 4.16
899 2558 3.157881 GGAAAGGAAAGGAAGGAAGGTG 58.842 50.000 0.00 0.00 0.00 4.00
900 2559 3.064412 AGGAAAGGAAAGGAAGGAAGGT 58.936 45.455 0.00 0.00 0.00 3.50
901 2560 3.562393 GGAGGAAAGGAAAGGAAGGAAGG 60.562 52.174 0.00 0.00 0.00 3.46
902 2561 3.074538 TGGAGGAAAGGAAAGGAAGGAAG 59.925 47.826 0.00 0.00 0.00 3.46
903 2562 3.060611 TGGAGGAAAGGAAAGGAAGGAA 58.939 45.455 0.00 0.00 0.00 3.36
904 2563 2.375509 GTGGAGGAAAGGAAAGGAAGGA 59.624 50.000 0.00 0.00 0.00 3.36
905 2564 2.555448 GGTGGAGGAAAGGAAAGGAAGG 60.555 54.545 0.00 0.00 0.00 3.46
906 2565 2.108250 TGGTGGAGGAAAGGAAAGGAAG 59.892 50.000 0.00 0.00 0.00 3.46
907 2566 2.140224 TGGTGGAGGAAAGGAAAGGAA 58.860 47.619 0.00 0.00 0.00 3.36
908 2567 1.423921 GTGGTGGAGGAAAGGAAAGGA 59.576 52.381 0.00 0.00 0.00 3.36
909 2568 1.425448 AGTGGTGGAGGAAAGGAAAGG 59.575 52.381 0.00 0.00 0.00 3.11
910 2569 2.373502 AGAGTGGTGGAGGAAAGGAAAG 59.626 50.000 0.00 0.00 0.00 2.62
911 2570 2.372172 GAGAGTGGTGGAGGAAAGGAAA 59.628 50.000 0.00 0.00 0.00 3.13
936 2595 4.219115 TCTGTCTTTGTCTCTGGAGAAGT 58.781 43.478 1.56 0.00 39.48 3.01
939 2598 3.823873 GTCTCTGTCTTTGTCTCTGGAGA 59.176 47.826 0.00 0.00 34.56 3.71
940 2599 3.056891 GGTCTCTGTCTTTGTCTCTGGAG 60.057 52.174 0.00 0.00 0.00 3.86
972 2637 0.580578 CAAGCCAAGCTCGATCGATG 59.419 55.000 19.78 14.05 38.25 3.84
974 2639 1.153568 CCAAGCCAAGCTCGATCGA 60.154 57.895 18.32 18.32 38.25 3.59
1094 2775 1.690633 TGGGAGATGGAGCCACCTC 60.691 63.158 2.01 2.01 35.87 3.85
1096 2777 1.977293 GAGTGGGAGATGGAGCCACC 61.977 65.000 0.00 0.00 39.54 4.61
1097 2778 1.524482 GAGTGGGAGATGGAGCCAC 59.476 63.158 0.00 0.00 0.00 5.01
1098 2779 1.690633 GGAGTGGGAGATGGAGCCA 60.691 63.158 0.00 0.00 0.00 4.75
1206 2887 4.811364 GGCAGCTTCTCCAGGGCC 62.811 72.222 0.00 0.00 0.00 5.80
1245 2926 1.516423 GTGACTTAGGAGGACGGCC 59.484 63.158 0.00 0.00 0.00 6.13
1377 3088 3.753797 GGTCCCTCAATCTTGTCAGAAAC 59.246 47.826 0.00 0.00 30.76 2.78
1380 3091 1.550524 CGGTCCCTCAATCTTGTCAGA 59.449 52.381 0.00 0.00 0.00 3.27
1385 3096 1.442769 CACACGGTCCCTCAATCTTG 58.557 55.000 0.00 0.00 0.00 3.02
1515 3226 6.449830 AATGGAACCTGTAGGAAGTTAGTT 57.550 37.500 4.64 0.00 38.94 2.24
1543 3285 6.323739 AGAGAAAAATAGTAGAGGAGAGCAGG 59.676 42.308 0.00 0.00 0.00 4.85
1549 3291 9.594478 GGAAAGAAGAGAAAAATAGTAGAGGAG 57.406 37.037 0.00 0.00 0.00 3.69
1550 3292 9.327731 AGGAAAGAAGAGAAAAATAGTAGAGGA 57.672 33.333 0.00 0.00 0.00 3.71
1562 3304 9.799106 ACTGATTTATGAAGGAAAGAAGAGAAA 57.201 29.630 0.00 0.00 0.00 2.52
1565 3307 8.881743 CAGACTGATTTATGAAGGAAAGAAGAG 58.118 37.037 0.00 0.00 0.00 2.85
1583 3325 0.982704 AGACCAAGCAGCAGACTGAT 59.017 50.000 6.65 0.00 46.79 2.90
1586 3328 2.225467 GAAAAGACCAAGCAGCAGACT 58.775 47.619 0.00 0.00 0.00 3.24
1587 3329 1.949525 TGAAAAGACCAAGCAGCAGAC 59.050 47.619 0.00 0.00 0.00 3.51
1588 3330 2.346766 TGAAAAGACCAAGCAGCAGA 57.653 45.000 0.00 0.00 0.00 4.26
1589 3331 3.572584 GAATGAAAAGACCAAGCAGCAG 58.427 45.455 0.00 0.00 0.00 4.24
1591 3333 2.669391 CGGAATGAAAAGACCAAGCAGC 60.669 50.000 0.00 0.00 0.00 5.25
1594 3336 3.181496 GGATCGGAATGAAAAGACCAAGC 60.181 47.826 0.00 0.00 0.00 4.01
1610 3352 3.573491 GCGCGGGAAAAGGATCGG 61.573 66.667 8.83 0.00 0.00 4.18
1612 3354 4.237809 GCGCGCGGGAAAAGGATC 62.238 66.667 33.06 6.44 0.00 3.36
1613 3355 4.778143 AGCGCGCGGGAAAAGGAT 62.778 61.111 33.06 0.00 0.00 3.24
1617 3359 3.034370 GATTGAGCGCGCGGGAAAA 62.034 57.895 33.06 16.57 0.00 2.29
1622 3364 3.972803 GTACGATTGAGCGCGCGG 61.973 66.667 33.06 15.38 33.86 6.46
1734 4910 4.151867 GTGTTTTTGGACGGACAGAGTATC 59.848 45.833 0.00 0.00 0.00 2.24
1740 4916 2.422127 ACAAGTGTTTTTGGACGGACAG 59.578 45.455 0.00 0.00 32.32 3.51
1742 4918 2.420722 TGACAAGTGTTTTTGGACGGAC 59.579 45.455 0.00 0.00 32.32 4.79
1748 4924 8.430801 TCCATTTTAATGACAAGTGTTTTTGG 57.569 30.769 4.07 0.00 38.70 3.28
1777 4962 9.362151 TGTGTAAAAACAAATATCCCTTCTCTT 57.638 29.630 0.00 0.00 0.00 2.85
1778 4963 8.793592 GTGTGTAAAAACAAATATCCCTTCTCT 58.206 33.333 0.00 0.00 0.00 3.10
1779 4964 8.027189 GGTGTGTAAAAACAAATATCCCTTCTC 58.973 37.037 0.00 0.00 0.00 2.87
1780 4965 7.728532 AGGTGTGTAAAAACAAATATCCCTTCT 59.271 33.333 0.00 0.00 0.00 2.85
1781 4966 7.812669 CAGGTGTGTAAAAACAAATATCCCTTC 59.187 37.037 0.00 0.00 0.00 3.46
1783 4968 6.210584 CCAGGTGTGTAAAAACAAATATCCCT 59.789 38.462 0.00 0.00 0.00 4.20
1793 5019 1.067974 GCCCACCAGGTGTGTAAAAAC 59.932 52.381 18.82 0.00 43.85 2.43
1795 5021 0.468400 GGCCCACCAGGTGTGTAAAA 60.468 55.000 18.82 0.00 43.85 1.52
1810 5273 2.764637 AAATCTGGGTGACGTGGCCC 62.765 60.000 15.19 15.19 45.04 5.80
1811 5274 0.035820 TAAATCTGGGTGACGTGGCC 60.036 55.000 0.00 0.00 0.00 5.36
1829 5321 5.305644 AGAGGAAGAGCAAGTGAAGAAAGTA 59.694 40.000 0.00 0.00 0.00 2.24
1874 5438 2.846532 CTTGGGCTTGGGTGGAGT 59.153 61.111 0.00 0.00 0.00 3.85
1928 7768 2.566833 CTGACCCCATTCAGTCACAA 57.433 50.000 0.00 0.00 38.07 3.33
1940 7804 0.895100 TTGCTGCATGAACTGACCCC 60.895 55.000 1.84 0.00 0.00 4.95
1949 7813 2.371923 CGTCGTCGTTGCTGCATGA 61.372 57.895 1.84 1.62 0.00 3.07
1950 7814 2.094539 CGTCGTCGTTGCTGCATG 59.905 61.111 1.84 0.00 0.00 4.06
1951 7815 2.049526 TCGTCGTCGTTGCTGCAT 60.050 55.556 1.84 0.00 38.33 3.96
1953 7817 4.104633 CGTCGTCGTCGTTGCTGC 62.105 66.667 3.67 0.00 38.33 5.25
1955 7819 2.426425 GTCGTCGTCGTCGTTGCT 60.426 61.111 11.41 0.00 38.33 3.91
1958 7822 2.051882 GTGGTCGTCGTCGTCGTT 60.052 61.111 11.41 0.00 38.33 3.85
1959 7823 4.017877 GGTGGTCGTCGTCGTCGT 62.018 66.667 11.41 0.00 38.33 4.34
1960 7824 3.923356 CTGGTGGTCGTCGTCGTCG 62.923 68.421 5.50 5.50 38.33 5.12
1961 7825 2.126965 CTGGTGGTCGTCGTCGTC 60.127 66.667 1.33 0.00 38.33 4.20
1962 7826 3.667282 CCTGGTGGTCGTCGTCGT 61.667 66.667 1.33 0.00 38.33 4.34
1963 7827 3.667282 ACCTGGTGGTCGTCGTCG 61.667 66.667 0.00 0.00 44.78 5.12
1972 7836 1.277557 CTTTCTCTCTGGACCTGGTGG 59.722 57.143 2.82 0.00 39.83 4.61
1973 7837 2.233431 CTCTTTCTCTCTGGACCTGGTG 59.767 54.545 2.82 0.00 0.00 4.17
1974 7838 2.110899 TCTCTTTCTCTCTGGACCTGGT 59.889 50.000 0.00 0.00 0.00 4.00
1975 7839 2.760092 CTCTCTTTCTCTCTGGACCTGG 59.240 54.545 0.00 0.00 0.00 4.45
1976 7840 3.696045 TCTCTCTTTCTCTCTGGACCTG 58.304 50.000 0.00 0.00 0.00 4.00
1977 7841 3.591527 TCTCTCTCTTTCTCTCTGGACCT 59.408 47.826 0.00 0.00 0.00 3.85
1978 7842 3.947834 CTCTCTCTCTTTCTCTCTGGACC 59.052 52.174 0.00 0.00 0.00 4.46
2004 7868 1.153005 CTGAGCTGCATCTTCCCCC 60.153 63.158 1.02 0.00 0.00 5.40
2043 8303 0.036671 GACGGGTTGGGGTGTTAGAG 60.037 60.000 0.00 0.00 0.00 2.43
2044 8304 1.482748 GGACGGGTTGGGGTGTTAGA 61.483 60.000 0.00 0.00 0.00 2.10
2045 8305 1.002990 GGACGGGTTGGGGTGTTAG 60.003 63.158 0.00 0.00 0.00 2.34
2046 8306 2.881528 CGGACGGGTTGGGGTGTTA 61.882 63.158 0.00 0.00 0.00 2.41
2047 8307 4.259131 CGGACGGGTTGGGGTGTT 62.259 66.667 0.00 0.00 0.00 3.32
2051 8311 4.462280 GTAGCGGACGGGTTGGGG 62.462 72.222 0.00 0.00 0.00 4.96
2075 8335 2.193536 GGTGTGGTGTGGTTGAGCC 61.194 63.158 0.00 0.00 37.90 4.70
2076 8336 1.447317 CTGGTGTGGTGTGGTTGAGC 61.447 60.000 0.00 0.00 0.00 4.26
2079 8339 1.101049 GGTCTGGTGTGGTGTGGTTG 61.101 60.000 0.00 0.00 0.00 3.77
2080 8340 1.226262 GGTCTGGTGTGGTGTGGTT 59.774 57.895 0.00 0.00 0.00 3.67
2082 8342 1.227943 CTGGTCTGGTGTGGTGTGG 60.228 63.158 0.00 0.00 0.00 4.17
2084 8344 0.398522 TCTCTGGTCTGGTGTGGTGT 60.399 55.000 0.00 0.00 0.00 4.16
2085 8345 0.034059 GTCTCTGGTCTGGTGTGGTG 59.966 60.000 0.00 0.00 0.00 4.17
2086 8346 1.122019 GGTCTCTGGTCTGGTGTGGT 61.122 60.000 0.00 0.00 0.00 4.16
2088 8348 0.034059 GTGGTCTCTGGTCTGGTGTG 59.966 60.000 0.00 0.00 0.00 3.82
2089 8349 0.105453 AGTGGTCTCTGGTCTGGTGT 60.105 55.000 0.00 0.00 0.00 4.16
2092 8352 0.610687 GGAAGTGGTCTCTGGTCTGG 59.389 60.000 0.00 0.00 0.00 3.86
2093 8353 1.638529 AGGAAGTGGTCTCTGGTCTG 58.361 55.000 0.00 0.00 0.00 3.51
2094 8354 3.637769 GATAGGAAGTGGTCTCTGGTCT 58.362 50.000 0.00 0.00 0.00 3.85
2095 8355 2.359531 CGATAGGAAGTGGTCTCTGGTC 59.640 54.545 0.00 0.00 0.00 4.02
2096 8356 2.291670 ACGATAGGAAGTGGTCTCTGGT 60.292 50.000 0.00 0.00 43.77 4.00
2097 8357 2.379972 ACGATAGGAAGTGGTCTCTGG 58.620 52.381 0.00 0.00 43.77 3.86
2098 8358 4.216687 GGATACGATAGGAAGTGGTCTCTG 59.783 50.000 0.00 0.00 43.77 3.35
2099 8359 4.105057 AGGATACGATAGGAAGTGGTCTCT 59.895 45.833 0.00 0.00 46.39 3.10
2100 8360 4.400120 AGGATACGATAGGAAGTGGTCTC 58.600 47.826 0.00 0.00 46.39 3.36
2101 8361 4.456662 AGGATACGATAGGAAGTGGTCT 57.543 45.455 0.00 0.00 46.39 3.85
2102 8362 5.357596 GGATAGGATACGATAGGAAGTGGTC 59.642 48.000 0.00 0.00 46.39 4.02
2103 8363 5.015391 AGGATAGGATACGATAGGAAGTGGT 59.985 44.000 0.00 0.00 46.39 4.16
2105 8365 7.446013 GGATAGGATAGGATACGATAGGAAGTG 59.554 44.444 0.00 0.00 46.39 3.16
2110 8370 8.269317 GGATAGGATAGGATAGGATACGATAGG 58.731 44.444 0.00 0.00 46.39 2.57
2111 8371 9.053472 AGGATAGGATAGGATAGGATACGATAG 57.947 40.741 0.00 0.00 46.39 2.08
2114 8374 7.709024 AAGGATAGGATAGGATAGGATACGA 57.291 40.000 0.00 0.00 46.39 3.43
2119 8379 9.944079 CTCAATTAAGGATAGGATAGGATAGGA 57.056 37.037 0.00 0.00 0.00 2.94
2120 8380 9.722317 ACTCAATTAAGGATAGGATAGGATAGG 57.278 37.037 0.00 0.00 0.00 2.57
2124 8384 9.322769 GGTAACTCAATTAAGGATAGGATAGGA 57.677 37.037 0.00 0.00 0.00 2.94
2147 8407 3.643199 TGATACAGCAAGGCAATGGTA 57.357 42.857 0.00 0.00 0.00 3.25
2149 8409 3.382227 TGATTGATACAGCAAGGCAATGG 59.618 43.478 0.00 0.00 30.06 3.16
2150 8410 4.642445 TGATTGATACAGCAAGGCAATG 57.358 40.909 0.00 0.00 30.06 2.82
2151 8411 5.664294 TTTGATTGATACAGCAAGGCAAT 57.336 34.783 0.00 0.00 31.00 3.56
2161 8637 7.835682 AGAGGATGTGGAAATTTGATTGATACA 59.164 33.333 0.00 0.00 0.00 2.29
2188 8668 6.489361 GGGCACAGTACATACTACTAGTACAT 59.511 42.308 0.00 0.00 40.32 2.29
2192 8672 4.643784 GTGGGCACAGTACATACTACTAGT 59.356 45.833 0.00 0.00 34.13 2.57
2193 8673 4.888239 AGTGGGCACAGTACATACTACTAG 59.112 45.833 0.00 0.00 34.13 2.57
2228 8828 3.146066 GACAGACAGACAGACAGAGAGT 58.854 50.000 0.00 0.00 0.00 3.24
2229 8829 3.189080 CAGACAGACAGACAGACAGAGAG 59.811 52.174 0.00 0.00 0.00 3.20
2230 8830 3.145286 CAGACAGACAGACAGACAGAGA 58.855 50.000 0.00 0.00 0.00 3.10
2231 8831 2.884012 ACAGACAGACAGACAGACAGAG 59.116 50.000 0.00 0.00 0.00 3.35
2232 8832 2.881513 GACAGACAGACAGACAGACAGA 59.118 50.000 0.00 0.00 0.00 3.41
2233 8833 2.884012 AGACAGACAGACAGACAGACAG 59.116 50.000 0.00 0.00 0.00 3.51
2234 8834 2.620585 CAGACAGACAGACAGACAGACA 59.379 50.000 0.00 0.00 0.00 3.41
2277 8940 9.923143 CAAATTAATCATGTTCCTATGATGCAT 57.077 29.630 0.00 0.00 44.74 3.96
2278 8941 7.868922 GCAAATTAATCATGTTCCTATGATGCA 59.131 33.333 2.35 0.00 44.74 3.96
2279 8942 8.086522 AGCAAATTAATCATGTTCCTATGATGC 58.913 33.333 2.35 2.74 44.74 3.91
2280 8943 9.976511 AAGCAAATTAATCATGTTCCTATGATG 57.023 29.630 2.35 0.00 44.74 3.07
2312 9010 6.368791 GCATTTCATTTCATGGATGGATCATG 59.631 38.462 9.23 0.00 42.28 3.07
2440 9150 9.035890 AGAAAAAGAAAAGGAAAGGAAGAAGAA 57.964 29.630 0.00 0.00 0.00 2.52
2442 9152 9.658799 AAAGAAAAAGAAAAGGAAAGGAAGAAG 57.341 29.630 0.00 0.00 0.00 2.85
2448 9158 8.792830 AGGAAAAAGAAAAAGAAAAGGAAAGG 57.207 30.769 0.00 0.00 0.00 3.11
2489 9218 6.071051 AGGCTTGTGTGGTAAAGAAAAAGAAA 60.071 34.615 0.00 0.00 0.00 2.52
2491 9220 4.953579 AGGCTTGTGTGGTAAAGAAAAAGA 59.046 37.500 0.00 0.00 0.00 2.52
2503 9232 4.948621 ACTAGTAGTAGTAGGCTTGTGTGG 59.051 45.833 15.09 0.00 37.76 4.17
2684 9606 9.231297 TGACAGAAAGAAAGAAAGAAAGAAAGA 57.769 29.630 0.00 0.00 0.00 2.52
2686 9608 7.970614 GCTGACAGAAAGAAAGAAAGAAAGAAA 59.029 33.333 6.65 0.00 0.00 2.52
2687 9609 7.121168 TGCTGACAGAAAGAAAGAAAGAAAGAA 59.879 33.333 6.65 0.00 0.00 2.52
2690 9612 6.757897 TGCTGACAGAAAGAAAGAAAGAAA 57.242 33.333 6.65 0.00 0.00 2.52
2706 9628 7.395190 AAATAATAATCAAGTGCTGCTGACA 57.605 32.000 0.00 0.00 0.00 3.58
2707 9629 9.956720 AATAAATAATAATCAAGTGCTGCTGAC 57.043 29.630 0.00 0.00 0.00 3.51
2711 9633 9.853921 GCAAAATAAATAATAATCAAGTGCTGC 57.146 29.630 0.00 0.00 0.00 5.25
2750 9688 3.698463 CGCGCGGTCGTTCAAACT 61.698 61.111 24.84 0.00 38.14 2.66
2763 9706 1.807981 TATGTATATGCCCGCGCGC 60.808 57.895 27.36 23.91 38.08 6.86
2764 9707 0.734597 TGTATGTATATGCCCGCGCG 60.735 55.000 25.67 25.67 38.08 6.86
2766 9709 5.579119 TCTTATTTGTATGTATATGCCCGCG 59.421 40.000 0.00 0.00 0.00 6.46
2767 9710 6.978343 TCTTATTTGTATGTATATGCCCGC 57.022 37.500 0.00 0.00 0.00 6.13
2768 9711 9.214957 TCTTTCTTATTTGTATGTATATGCCCG 57.785 33.333 0.00 0.00 0.00 6.13
2799 9742 7.233553 GCCAGATACCTGCCATATATACTCATA 59.766 40.741 0.00 0.00 39.07 2.15
2800 9743 6.042552 GCCAGATACCTGCCATATATACTCAT 59.957 42.308 0.00 0.00 39.07 2.90
2801 9744 5.363868 GCCAGATACCTGCCATATATACTCA 59.636 44.000 0.00 0.00 39.07 3.41
2802 9745 5.363868 TGCCAGATACCTGCCATATATACTC 59.636 44.000 0.00 0.00 39.07 2.59
2803 9746 5.280499 TGCCAGATACCTGCCATATATACT 58.720 41.667 0.00 0.00 39.07 2.12
2804 9747 5.605534 CTGCCAGATACCTGCCATATATAC 58.394 45.833 0.00 0.00 39.07 1.47
2805 9748 4.101585 GCTGCCAGATACCTGCCATATATA 59.898 45.833 0.00 0.00 39.07 0.86
2806 9749 3.118112 GCTGCCAGATACCTGCCATATAT 60.118 47.826 0.00 0.00 39.07 0.86
2807 9750 2.237143 GCTGCCAGATACCTGCCATATA 59.763 50.000 0.00 0.00 39.07 0.86
2808 9751 1.004044 GCTGCCAGATACCTGCCATAT 59.996 52.381 0.00 0.00 39.07 1.78
2809 9752 0.397941 GCTGCCAGATACCTGCCATA 59.602 55.000 0.00 0.00 39.07 2.74
2810 9753 1.150081 GCTGCCAGATACCTGCCAT 59.850 57.895 0.00 0.00 39.07 4.40
2811 9754 1.638679 ATGCTGCCAGATACCTGCCA 61.639 55.000 0.00 0.00 39.07 4.92
2812 9755 0.888285 GATGCTGCCAGATACCTGCC 60.888 60.000 0.00 0.00 39.07 4.85
2813 9756 0.179037 TGATGCTGCCAGATACCTGC 60.179 55.000 0.00 0.00 39.07 4.85
2867 9810 3.138798 TACGCGCTGGTCCTCTCC 61.139 66.667 5.73 0.00 0.00 3.71
2903 9846 1.069204 ACAGTCATCTCTGCGTTGTGT 59.931 47.619 0.00 0.00 38.84 3.72
2963 9906 1.202855 AGCATGTCATATCTGGCACCC 60.203 52.381 0.00 0.00 40.44 4.61
3110 10053 9.858247 GAAATTAAATTAGATGCATGCATGTTG 57.142 29.630 36.73 4.87 36.70 3.33
3112 10055 9.472361 GAGAAATTAAATTAGATGCATGCATGT 57.528 29.630 36.73 33.28 36.70 3.21
3113 10056 9.692749 AGAGAAATTAAATTAGATGCATGCATG 57.307 29.630 36.73 22.70 36.70 4.06
3116 10059 9.609950 GAGAGAGAAATTAAATTAGATGCATGC 57.390 33.333 11.82 11.82 0.00 4.06
3128 10071 7.397476 TGTGCCTAGAGAGAGAGAGAAATTAAA 59.603 37.037 0.00 0.00 0.00 1.52
3135 10078 4.518278 AATGTGCCTAGAGAGAGAGAGA 57.482 45.455 0.00 0.00 0.00 3.10
3139 10082 6.609212 AGTCAAATAATGTGCCTAGAGAGAGA 59.391 38.462 0.00 0.00 0.00 3.10
3142 10085 6.815089 AGAGTCAAATAATGTGCCTAGAGAG 58.185 40.000 0.00 0.00 0.00 3.20
3160 10104 9.634163 GGTTTTTCTTCTTGTTAAAAAGAGTCA 57.366 29.630 8.11 0.00 37.48 3.41
3161 10105 9.856488 AGGTTTTTCTTCTTGTTAAAAAGAGTC 57.144 29.630 8.11 0.00 37.48 3.36
3162 10106 9.856488 GAGGTTTTTCTTCTTGTTAAAAAGAGT 57.144 29.630 8.11 0.00 37.48 3.24
3163 10107 9.855021 TGAGGTTTTTCTTCTTGTTAAAAAGAG 57.145 29.630 8.11 3.93 37.48 2.85
3165 10109 9.639601 AGTGAGGTTTTTCTTCTTGTTAAAAAG 57.360 29.630 0.00 0.00 33.93 2.27
3168 10112 8.575649 AGAGTGAGGTTTTTCTTCTTGTTAAA 57.424 30.769 0.00 0.00 0.00 1.52
3169 10113 8.575649 AAGAGTGAGGTTTTTCTTCTTGTTAA 57.424 30.769 0.00 0.00 0.00 2.01
3191 10135 5.163468 GCACCTGAGATGTTAGATGAGAAGA 60.163 44.000 0.00 0.00 0.00 2.87
3192 10136 5.049167 GCACCTGAGATGTTAGATGAGAAG 58.951 45.833 0.00 0.00 0.00 2.85
3193 10137 4.713814 AGCACCTGAGATGTTAGATGAGAA 59.286 41.667 0.00 0.00 0.00 2.87
3197 10141 3.875727 CCAAGCACCTGAGATGTTAGATG 59.124 47.826 0.00 0.00 0.00 2.90
3198 10142 3.118112 CCCAAGCACCTGAGATGTTAGAT 60.118 47.826 0.00 0.00 0.00 1.98
3199 10143 2.237143 CCCAAGCACCTGAGATGTTAGA 59.763 50.000 0.00 0.00 0.00 2.10
3200 10144 2.636830 CCCAAGCACCTGAGATGTTAG 58.363 52.381 0.00 0.00 0.00 2.34
3201 10145 1.340017 GCCCAAGCACCTGAGATGTTA 60.340 52.381 0.00 0.00 39.53 2.41
3202 10146 0.610232 GCCCAAGCACCTGAGATGTT 60.610 55.000 0.00 0.00 39.53 2.71
3203 10147 1.001641 GCCCAAGCACCTGAGATGT 60.002 57.895 0.00 0.00 39.53 3.06
3324 10268 7.556635 GGGAGTAAGTGGTTGAGCTTATTTTAT 59.443 37.037 0.00 0.00 31.02 1.40
3326 10270 5.710567 GGGAGTAAGTGGTTGAGCTTATTTT 59.289 40.000 0.00 0.00 31.02 1.82
3341 10286 7.974504 TCTATTTTGAAACAGAGGGAGTAAGT 58.025 34.615 0.00 0.00 0.00 2.24
3343 10288 8.602424 TCATCTATTTTGAAACAGAGGGAGTAA 58.398 33.333 0.00 0.00 0.00 2.24
3344 10289 8.041323 GTCATCTATTTTGAAACAGAGGGAGTA 58.959 37.037 0.00 0.00 0.00 2.59
3346 10291 7.108847 AGTCATCTATTTTGAAACAGAGGGAG 58.891 38.462 0.00 0.00 0.00 4.30
3349 10294 7.912056 TGAGTCATCTATTTTGAAACAGAGG 57.088 36.000 0.00 0.00 0.00 3.69
3350 10295 8.997323 AGTTGAGTCATCTATTTTGAAACAGAG 58.003 33.333 1.70 0.00 0.00 3.35
3353 10298 9.734620 CAAAGTTGAGTCATCTATTTTGAAACA 57.265 29.630 4.14 0.00 38.91 2.83
3354 10299 9.736023 ACAAAGTTGAGTCATCTATTTTGAAAC 57.264 29.630 15.99 0.00 38.91 2.78
3357 10302 9.778741 AGTACAAAGTTGAGTCATCTATTTTGA 57.221 29.630 15.99 3.46 38.91 2.69
3384 10329 9.880157 TGACTCAACTTTGTACTAACTAACTTT 57.120 29.630 0.00 0.00 0.00 2.66
3386 10331 9.694137 GATGACTCAACTTTGTACTAACTAACT 57.306 33.333 0.00 0.00 0.00 2.24
3387 10332 9.694137 AGATGACTCAACTTTGTACTAACTAAC 57.306 33.333 0.00 0.00 0.00 2.34
3394 10339 9.003658 CCAAAATAGATGACTCAACTTTGTACT 57.996 33.333 0.00 0.00 0.00 2.73
3395 10340 8.999431 TCCAAAATAGATGACTCAACTTTGTAC 58.001 33.333 0.00 0.00 0.00 2.90
3396 10341 9.567776 TTCCAAAATAGATGACTCAACTTTGTA 57.432 29.630 0.00 0.00 0.00 2.41
3397 10342 8.352942 GTTCCAAAATAGATGACTCAACTTTGT 58.647 33.333 0.00 0.00 0.00 2.83
3398 10343 7.535258 CGTTCCAAAATAGATGACTCAACTTTG 59.465 37.037 0.00 0.00 0.00 2.77
3399 10344 7.308589 CCGTTCCAAAATAGATGACTCAACTTT 60.309 37.037 0.00 0.00 0.00 2.66
3400 10345 6.149474 CCGTTCCAAAATAGATGACTCAACTT 59.851 38.462 0.00 0.00 0.00 2.66
3401 10346 5.643777 CCGTTCCAAAATAGATGACTCAACT 59.356 40.000 0.00 0.00 0.00 3.16
3402 10347 5.642063 TCCGTTCCAAAATAGATGACTCAAC 59.358 40.000 0.00 0.00 0.00 3.18
3403 10348 5.800296 TCCGTTCCAAAATAGATGACTCAA 58.200 37.500 0.00 0.00 0.00 3.02
3404 10349 5.414789 TCCGTTCCAAAATAGATGACTCA 57.585 39.130 0.00 0.00 0.00 3.41
3405 10350 4.811557 CCTCCGTTCCAAAATAGATGACTC 59.188 45.833 0.00 0.00 0.00 3.36
3406 10351 4.384208 CCCTCCGTTCCAAAATAGATGACT 60.384 45.833 0.00 0.00 0.00 3.41
3407 10352 3.877508 CCCTCCGTTCCAAAATAGATGAC 59.122 47.826 0.00 0.00 0.00 3.06
3408 10353 3.778075 TCCCTCCGTTCCAAAATAGATGA 59.222 43.478 0.00 0.00 0.00 2.92
3409 10354 4.130118 CTCCCTCCGTTCCAAAATAGATG 58.870 47.826 0.00 0.00 0.00 2.90
3410 10355 3.780850 ACTCCCTCCGTTCCAAAATAGAT 59.219 43.478 0.00 0.00 0.00 1.98
3411 10356 3.178865 ACTCCCTCCGTTCCAAAATAGA 58.821 45.455 0.00 0.00 0.00 1.98
3412 10357 3.629142 ACTCCCTCCGTTCCAAAATAG 57.371 47.619 0.00 0.00 0.00 1.73
3413 10358 4.355549 TCTACTCCCTCCGTTCCAAAATA 58.644 43.478 0.00 0.00 0.00 1.40
3414 10359 3.178865 TCTACTCCCTCCGTTCCAAAAT 58.821 45.455 0.00 0.00 0.00 1.82
3415 10360 2.612000 TCTACTCCCTCCGTTCCAAAA 58.388 47.619 0.00 0.00 0.00 2.44
3416 10361 2.314071 TCTACTCCCTCCGTTCCAAA 57.686 50.000 0.00 0.00 0.00 3.28
3417 10362 2.301009 GTTTCTACTCCCTCCGTTCCAA 59.699 50.000 0.00 0.00 0.00 3.53
3418 10363 1.897802 GTTTCTACTCCCTCCGTTCCA 59.102 52.381 0.00 0.00 0.00 3.53
3419 10364 1.206610 GGTTTCTACTCCCTCCGTTCC 59.793 57.143 0.00 0.00 0.00 3.62
3420 10365 1.897802 TGGTTTCTACTCCCTCCGTTC 59.102 52.381 0.00 0.00 0.00 3.95
3421 10366 2.019807 TGGTTTCTACTCCCTCCGTT 57.980 50.000 0.00 0.00 0.00 4.44
3422 10367 1.622312 GTTGGTTTCTACTCCCTCCGT 59.378 52.381 0.00 0.00 0.00 4.69
3423 10368 1.900486 AGTTGGTTTCTACTCCCTCCG 59.100 52.381 0.00 0.00 0.00 4.63
3424 10369 3.583526 AGAAGTTGGTTTCTACTCCCTCC 59.416 47.826 0.00 0.00 35.70 4.30
3425 10370 4.893829 AGAAGTTGGTTTCTACTCCCTC 57.106 45.455 0.00 0.00 35.70 4.30
3426 10371 5.845065 AGTAAGAAGTTGGTTTCTACTCCCT 59.155 40.000 0.00 0.00 36.42 4.20
3427 10372 6.111669 AGTAAGAAGTTGGTTTCTACTCCC 57.888 41.667 0.00 0.00 36.42 4.30
3428 10373 9.722184 ATTAAGTAAGAAGTTGGTTTCTACTCC 57.278 33.333 0.00 0.00 36.42 3.85
3469 10414 1.532343 CTGCCATCGAATCGACGACG 61.532 60.000 7.77 0.00 44.84 5.12
3472 10417 1.951130 CCCTGCCATCGAATCGACG 60.951 63.158 7.77 0.00 39.18 5.12
3473 10418 1.595382 CCCCTGCCATCGAATCGAC 60.595 63.158 7.77 0.00 39.18 4.20
3475 10420 1.301244 CTCCCCTGCCATCGAATCG 60.301 63.158 0.00 0.00 0.00 3.34
3476 10421 0.689623 ATCTCCCCTGCCATCGAATC 59.310 55.000 0.00 0.00 0.00 2.52
3700 10676 4.321966 TTGTCGCGTGGCCCATGA 62.322 61.111 7.26 0.00 0.00 3.07
3727 10703 0.954452 AACCGGCAGCTTCAAAGAAG 59.046 50.000 0.00 2.48 0.00 2.85
3958 10934 2.819608 CCCATACTTGTTGGTGGTCAAG 59.180 50.000 0.00 0.00 44.29 3.02
4222 11198 9.528489 TTGTAGAAGGTAGGAAGCATTTTAATT 57.472 29.630 0.00 0.00 0.00 1.40
4462 11615 2.910688 AAGCTGACGAAAGAACCTGA 57.089 45.000 0.00 0.00 0.00 3.86
4661 11814 9.224267 ACTTTCATCGATGCAAATAGCTTATAT 57.776 29.630 20.81 0.00 45.94 0.86
4663 11816 7.227314 TCACTTTCATCGATGCAAATAGCTTAT 59.773 33.333 20.81 0.00 45.94 1.73
4664 11817 6.538381 TCACTTTCATCGATGCAAATAGCTTA 59.462 34.615 20.81 0.00 45.94 3.09
4665 11818 5.355071 TCACTTTCATCGATGCAAATAGCTT 59.645 36.000 20.81 2.92 45.94 3.74
4667 11820 5.160699 TCACTTTCATCGATGCAAATAGC 57.839 39.130 20.81 0.00 45.96 2.97
4668 11821 7.246311 ACTTTCACTTTCATCGATGCAAATAG 58.754 34.615 20.81 13.68 0.00 1.73
4701 11919 7.391554 CCATTAAAAATCAGGACAGAGACAGAA 59.608 37.037 0.00 0.00 0.00 3.02
4702 11920 6.881065 CCATTAAAAATCAGGACAGAGACAGA 59.119 38.462 0.00 0.00 0.00 3.41
4703 11921 6.094603 CCCATTAAAAATCAGGACAGAGACAG 59.905 42.308 0.00 0.00 0.00 3.51
4727 11951 0.391263 GGTCGGATGTCACCTGTTCC 60.391 60.000 0.00 0.00 0.00 3.62
4822 12046 1.826720 CTTACGTTGGCCCACCTACTA 59.173 52.381 0.00 0.00 39.29 1.82
5209 12440 5.251700 AGGATACAAAAGTGATCCCTTCAGT 59.748 40.000 0.00 0.00 40.13 3.41
5210 12441 5.749462 AGGATACAAAAGTGATCCCTTCAG 58.251 41.667 0.00 0.00 40.13 3.02
5211 12442 5.779241 AGGATACAAAAGTGATCCCTTCA 57.221 39.130 0.00 0.00 40.13 3.02
5235 12466 4.389077 CACCTTTACAGTAACAGCACTAGC 59.611 45.833 0.00 0.00 42.56 3.42
5236 12467 5.634020 GTCACCTTTACAGTAACAGCACTAG 59.366 44.000 0.00 0.00 0.00 2.57
5238 12469 4.141801 TGTCACCTTTACAGTAACAGCACT 60.142 41.667 0.00 0.00 0.00 4.40
5239 12470 4.124238 TGTCACCTTTACAGTAACAGCAC 58.876 43.478 0.00 0.00 0.00 4.40
5240 12471 4.409718 TGTCACCTTTACAGTAACAGCA 57.590 40.909 0.00 0.00 0.00 4.41
5241 12472 4.573201 TGTTGTCACCTTTACAGTAACAGC 59.427 41.667 0.00 0.00 0.00 4.40
5242 12473 6.706270 AGATGTTGTCACCTTTACAGTAACAG 59.294 38.462 0.00 0.00 0.00 3.16
5243 12474 6.588204 AGATGTTGTCACCTTTACAGTAACA 58.412 36.000 0.00 0.00 0.00 2.41
5244 12475 6.128902 CGAGATGTTGTCACCTTTACAGTAAC 60.129 42.308 0.00 0.00 0.00 2.50
5245 12476 5.924254 CGAGATGTTGTCACCTTTACAGTAA 59.076 40.000 0.00 0.00 0.00 2.24
5246 12477 5.242171 TCGAGATGTTGTCACCTTTACAGTA 59.758 40.000 0.00 0.00 0.00 2.74
5247 12478 4.038763 TCGAGATGTTGTCACCTTTACAGT 59.961 41.667 0.00 0.00 0.00 3.55
5248 12479 4.386049 GTCGAGATGTTGTCACCTTTACAG 59.614 45.833 0.00 0.00 0.00 2.74
5269 12500 7.617041 ATGAAAAGGTGCTTCAGTATTAGTC 57.383 36.000 0.00 0.00 36.30 2.59
5280 12511 8.135529 GTCTGTAGTAAAAATGAAAAGGTGCTT 58.864 33.333 0.00 0.00 0.00 3.91
5281 12512 7.284489 TGTCTGTAGTAAAAATGAAAAGGTGCT 59.716 33.333 0.00 0.00 0.00 4.40
5282 12513 7.422399 TGTCTGTAGTAAAAATGAAAAGGTGC 58.578 34.615 0.00 0.00 0.00 5.01
5326 12557 0.613260 TCGCCTACTGTGGATGCTTT 59.387 50.000 0.00 0.00 0.00 3.51
5334 12565 1.683917 AGAATAGCCTCGCCTACTGTG 59.316 52.381 0.00 0.00 0.00 3.66
5395 12626 1.238615 AGGATGGCTCCCATGGAAAT 58.761 50.000 15.22 0.00 45.26 2.17
5547 12806 3.008049 TGGGAGCTGGAAAAGAACTACTC 59.992 47.826 0.00 0.00 0.00 2.59
5554 12813 1.003355 CGCTGGGAGCTGGAAAAGA 60.003 57.895 0.00 0.00 39.60 2.52
5555 12814 2.042831 CCGCTGGGAGCTGGAAAAG 61.043 63.158 0.00 0.00 39.60 2.27
5609 12893 2.701107 TCGGTGTTGAAGTGTTTGTCA 58.299 42.857 0.00 0.00 0.00 3.58
5709 13069 8.484214 ACCTAGAGATATTGCAAGTGAAGATA 57.516 34.615 4.94 0.00 0.00 1.98
5710 13070 7.372260 ACCTAGAGATATTGCAAGTGAAGAT 57.628 36.000 4.94 0.00 0.00 2.40
5737 13110 6.472163 GTCGGTTTGTGGCTTCATTAATATTG 59.528 38.462 0.00 0.00 0.00 1.90
5741 13114 3.192633 GGTCGGTTTGTGGCTTCATTAAT 59.807 43.478 0.00 0.00 0.00 1.40
5742 13115 2.554893 GGTCGGTTTGTGGCTTCATTAA 59.445 45.455 0.00 0.00 0.00 1.40
5773 13146 2.892852 CTGGAAAGGCAAGGTGATTTGA 59.107 45.455 0.00 0.00 0.00 2.69
5916 13314 6.594159 ACCTAAAGTATTTTCTGTCCACATCG 59.406 38.462 0.00 0.00 40.09 3.84
5926 13324 7.899973 TGTTAGACGGACCTAAAGTATTTTCT 58.100 34.615 0.00 0.00 40.09 2.52
5941 13339 7.449086 AGTTGGGAAATTTTTATGTTAGACGGA 59.551 33.333 0.00 0.00 0.00 4.69
5943 13341 8.911662 CAAGTTGGGAAATTTTTATGTTAGACG 58.088 33.333 0.00 0.00 0.00 4.18
5944 13342 9.758651 ACAAGTTGGGAAATTTTTATGTTAGAC 57.241 29.630 7.96 0.00 0.00 2.59
5962 13390 5.261209 TCATTTCCTGAAACACAAGTTGG 57.739 39.130 7.96 0.00 38.17 3.77
6110 13538 3.486383 CACTAGTTTTCCTTCCTGCCAA 58.514 45.455 0.00 0.00 0.00 4.52
6272 13700 0.320374 ACATCCGAGGAAAGACGCAA 59.680 50.000 0.00 0.00 0.00 4.85
6325 13753 9.030301 GCATCTTTAATTACTTGAGTCTCTCTC 57.970 37.037 0.65 0.00 43.03 3.20
6327 13755 7.043059 CCGCATCTTTAATTACTTGAGTCTCTC 60.043 40.741 0.65 0.00 0.00 3.20
6329 13757 6.535508 ACCGCATCTTTAATTACTTGAGTCTC 59.464 38.462 0.00 0.00 0.00 3.36
6331 13759 6.092259 ACACCGCATCTTTAATTACTTGAGTC 59.908 38.462 0.00 0.00 0.00 3.36
6333 13761 6.422776 ACACCGCATCTTTAATTACTTGAG 57.577 37.500 0.00 0.00 0.00 3.02
6334 13762 6.811253 AACACCGCATCTTTAATTACTTGA 57.189 33.333 0.00 0.00 0.00 3.02
6337 13765 6.811253 TCAAACACCGCATCTTTAATTACT 57.189 33.333 0.00 0.00 0.00 2.24
6338 13766 7.593644 AGTTTCAAACACCGCATCTTTAATTAC 59.406 33.333 2.41 0.00 0.00 1.89
6342 13792 5.508200 AGTTTCAAACACCGCATCTTTAA 57.492 34.783 2.41 0.00 0.00 1.52
6358 13808 9.609346 AAACAACTAGCTAGAGTTAAAGTTTCA 57.391 29.630 27.45 0.00 37.57 2.69
6361 13811 8.208903 TGGAAACAACTAGCTAGAGTTAAAGTT 58.791 33.333 27.45 11.76 37.57 2.66
6368 13818 7.719871 TTAGATGGAAACAACTAGCTAGAGT 57.280 36.000 27.45 20.24 45.08 3.24
6369 13819 8.470805 TCTTTAGATGGAAACAACTAGCTAGAG 58.529 37.037 27.45 19.62 45.08 2.43
6370 13820 8.362464 TCTTTAGATGGAAACAACTAGCTAGA 57.638 34.615 27.45 2.17 45.08 2.43
6371 13821 9.436957 TTTCTTTAGATGGAAACAACTAGCTAG 57.563 33.333 19.44 19.44 45.08 3.42
6372 13822 9.959721 ATTTCTTTAGATGGAAACAACTAGCTA 57.040 29.630 0.00 0.00 45.08 3.32
6373 13823 8.870075 ATTTCTTTAGATGGAAACAACTAGCT 57.130 30.769 0.00 0.00 45.08 3.32
6415 13881 0.684535 TCCTCCACAAACATCTGCGA 59.315 50.000 0.00 0.00 0.00 5.10
6416 13882 1.466167 CTTCCTCCACAAACATCTGCG 59.534 52.381 0.00 0.00 0.00 5.18
6417 13883 2.485814 GACTTCCTCCACAAACATCTGC 59.514 50.000 0.00 0.00 0.00 4.26
6418 13884 3.743521 TGACTTCCTCCACAAACATCTG 58.256 45.455 0.00 0.00 0.00 2.90
6462 13928 2.682856 ACCAACCATAGCATTACGCAAG 59.317 45.455 0.00 0.00 46.13 4.01
6540 14006 1.936547 GAAGGATTTGCTACCAGCTCG 59.063 52.381 0.00 0.00 42.97 5.03
6624 14090 1.990799 TGACTGTATTTCTCACCGCG 58.009 50.000 0.00 0.00 0.00 6.46
6790 14478 8.682710 AGTTGCATTTCTAAAAGTTGTAACAGA 58.317 29.630 9.55 0.00 0.00 3.41
6791 14479 8.856490 AGTTGCATTTCTAAAAGTTGTAACAG 57.144 30.769 9.55 0.00 0.00 3.16
6910 14611 7.947890 AGGGAACTAACCTCAAAATATTCAACA 59.052 33.333 0.00 0.00 40.61 3.33
6933 14634 5.220854 CCAATCGAAACATGTAAGCTAAGGG 60.221 44.000 0.00 0.00 0.00 3.95
6990 14729 7.445121 TGCAATAACAACATCATGGGTTTTAA 58.555 30.769 2.70 0.00 0.00 1.52
6991 14730 6.997655 TGCAATAACAACATCATGGGTTTTA 58.002 32.000 2.70 1.80 0.00 1.52
6992 14731 5.862845 TGCAATAACAACATCATGGGTTTT 58.137 33.333 2.70 0.00 0.00 2.43
6994 14733 5.680594 ATGCAATAACAACATCATGGGTT 57.319 34.783 0.00 2.92 0.00 4.11
6996 14735 4.271533 GCAATGCAATAACAACATCATGGG 59.728 41.667 0.00 0.00 0.00 4.00
6999 14738 5.113383 CCTGCAATGCAATAACAACATCAT 58.887 37.500 9.92 0.00 38.41 2.45
7000 14739 4.496360 CCTGCAATGCAATAACAACATCA 58.504 39.130 9.92 0.00 38.41 3.07
7001 14740 3.307782 GCCTGCAATGCAATAACAACATC 59.692 43.478 9.92 0.00 38.41 3.06
7002 14741 3.264104 GCCTGCAATGCAATAACAACAT 58.736 40.909 9.92 0.00 38.41 2.71
7150 14993 6.760298 GTGAAAGGTTGGCTACTTACCTATAC 59.240 42.308 0.00 0.00 41.33 1.47
7185 15051 2.290641 ACTCTGTTTCAACAACCATCGC 59.709 45.455 0.00 0.00 38.66 4.58
7213 15136 9.299963 TGTGCATATATAGAAAACAATTGCAAC 57.700 29.630 0.00 0.00 39.06 4.17
7219 15142 9.618890 ACTCAGTGTGCATATATAGAAAACAAT 57.381 29.630 0.00 0.00 0.00 2.71
7261 15188 3.119137 AGTTCTTGGTTTTTCCTGCACAC 60.119 43.478 0.00 0.00 37.07 3.82
7264 15191 6.478512 AATAAGTTCTTGGTTTTTCCTGCA 57.521 33.333 0.00 0.00 37.07 4.41
7544 15486 4.136051 ACTCCATAGAAGCTACGTACTCC 58.864 47.826 0.00 0.00 0.00 3.85
7545 15487 5.512473 CAACTCCATAGAAGCTACGTACTC 58.488 45.833 0.00 0.00 0.00 2.59
7546 15488 4.202030 GCAACTCCATAGAAGCTACGTACT 60.202 45.833 0.00 0.00 0.00 2.73
7547 15489 4.043073 GCAACTCCATAGAAGCTACGTAC 58.957 47.826 0.00 0.00 0.00 3.67
7548 15490 3.952323 AGCAACTCCATAGAAGCTACGTA 59.048 43.478 0.00 0.00 35.60 3.57
7549 15491 2.761208 AGCAACTCCATAGAAGCTACGT 59.239 45.455 0.00 0.00 35.60 3.57
7550 15492 3.444703 AGCAACTCCATAGAAGCTACG 57.555 47.619 0.00 0.00 35.60 3.51
7566 15508 6.655078 AGAAGAAGAAAAAGGCATTAGCAA 57.345 33.333 0.00 0.00 44.61 3.91
7567 15509 6.491403 AGAAGAAGAAGAAAAAGGCATTAGCA 59.509 34.615 0.00 0.00 44.61 3.49
7568 15510 6.918626 AGAAGAAGAAGAAAAAGGCATTAGC 58.081 36.000 0.00 0.00 41.10 3.09
7582 15524 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
7584 15526 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
7585 15527 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
7586 15528 9.541143 GAAGAAGAAGAAGAAGAAGAAGAAGAA 57.459 33.333 0.00 0.00 0.00 2.52
7587 15529 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
7588 15530 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
7589 15531 9.541143 GAAGAAGAAGAAGAAGAAGAAGAAGAA 57.459 33.333 0.00 0.00 0.00 2.52
7590 15532 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
7591 15533 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
7592 15534 9.541143 GAAGAAGAAGAAGAAGAAGAAGAAGAA 57.459 33.333 0.00 0.00 0.00 2.52
7593 15535 8.923270 AGAAGAAGAAGAAGAAGAAGAAGAAGA 58.077 33.333 0.00 0.00 0.00 2.87
7594 15536 9.546428 AAGAAGAAGAAGAAGAAGAAGAAGAAG 57.454 33.333 0.00 0.00 0.00 2.85
7612 15554 9.033481 TGCACAAAAATCAAACATAAGAAGAAG 57.967 29.630 0.00 0.00 0.00 2.85
7613 15555 8.939201 TGCACAAAAATCAAACATAAGAAGAA 57.061 26.923 0.00 0.00 0.00 2.52
7615 15557 8.578308 TCTGCACAAAAATCAAACATAAGAAG 57.422 30.769 0.00 0.00 0.00 2.85
7670 15624 1.227764 AGCAGCATATGTGGCTCCG 60.228 57.895 14.90 0.00 40.23 4.63
7679 15633 4.197750 CAAGGAAGAAGACAGCAGCATAT 58.802 43.478 0.00 0.00 0.00 1.78
7721 15675 2.121291 TTGACACAACAGGCTGAACA 57.879 45.000 23.66 8.48 0.00 3.18
7751 15705 2.350102 CGCCTTTTCACGGTAGAAAACC 60.350 50.000 11.70 7.43 41.22 3.27
7928 16294 0.937304 CGTGTATTCAATCCCCTGCG 59.063 55.000 0.00 0.00 0.00 5.18
8103 16469 3.819337 GGTTCCAAAGAGGGAGTACAAAC 59.181 47.826 0.00 0.00 38.42 2.93
8183 16563 2.017049 ACCAACGAATCTGGCTAATGC 58.983 47.619 0.00 0.00 37.48 3.56
8184 16564 3.181497 CCAACCAACGAATCTGGCTAATG 60.181 47.826 0.00 0.00 37.48 1.90
8230 16624 2.580962 TCAACTGCAACAATAGCACCA 58.419 42.857 0.00 0.00 37.02 4.17
8231 16625 3.855689 ATCAACTGCAACAATAGCACC 57.144 42.857 0.00 0.00 37.02 5.01
8232 16626 4.662145 GGTATCAACTGCAACAATAGCAC 58.338 43.478 0.00 0.00 37.02 4.40
8233 16627 3.373748 CGGTATCAACTGCAACAATAGCA 59.626 43.478 0.00 0.00 40.19 3.49
8234 16628 3.621268 TCGGTATCAACTGCAACAATAGC 59.379 43.478 0.00 0.00 31.50 2.97
8235 16629 5.755375 AGATCGGTATCAACTGCAACAATAG 59.245 40.000 0.00 0.00 34.28 1.73
8538 16937 7.460296 TCATATACACACAAACAAACGCTATG 58.540 34.615 0.00 0.00 0.00 2.23
8541 16940 5.933187 TCATATACACACAAACAAACGCT 57.067 34.783 0.00 0.00 0.00 5.07
8542 16941 6.033407 CCATTCATATACACACAAACAAACGC 59.967 38.462 0.00 0.00 0.00 4.84
8543 16942 7.301789 TCCATTCATATACACACAAACAAACG 58.698 34.615 0.00 0.00 0.00 3.60
8544 16943 8.296713 ACTCCATTCATATACACACAAACAAAC 58.703 33.333 0.00 0.00 0.00 2.93
8545 16944 8.402798 ACTCCATTCATATACACACAAACAAA 57.597 30.769 0.00 0.00 0.00 2.83
8663 17071 6.804783 GTGAAACAGAACCGAAAGAAGAAAAA 59.195 34.615 0.00 0.00 36.32 1.94
8664 17072 6.319399 GTGAAACAGAACCGAAAGAAGAAAA 58.681 36.000 0.00 0.00 36.32 2.29
8665 17073 5.163693 GGTGAAACAGAACCGAAAGAAGAAA 60.164 40.000 0.00 0.00 39.98 2.52
8666 17074 4.334481 GGTGAAACAGAACCGAAAGAAGAA 59.666 41.667 0.00 0.00 39.98 2.52
8667 17075 3.875134 GGTGAAACAGAACCGAAAGAAGA 59.125 43.478 0.00 0.00 39.98 2.87
8668 17076 3.625764 TGGTGAAACAGAACCGAAAGAAG 59.374 43.478 0.00 0.00 39.98 2.85
8669 17077 3.611970 TGGTGAAACAGAACCGAAAGAA 58.388 40.909 0.00 0.00 39.98 2.52
8670 17078 3.269538 TGGTGAAACAGAACCGAAAGA 57.730 42.857 0.00 0.00 39.98 2.52
8671 17079 4.036262 TCAATGGTGAAACAGAACCGAAAG 59.964 41.667 0.00 0.00 39.98 2.62
8672 17080 3.948473 TCAATGGTGAAACAGAACCGAAA 59.052 39.130 0.00 0.00 39.98 3.46
8673 17081 3.546724 TCAATGGTGAAACAGAACCGAA 58.453 40.909 0.00 0.00 39.98 4.30
8674 17082 3.201353 TCAATGGTGAAACAGAACCGA 57.799 42.857 0.00 0.00 39.98 4.69
8675 17083 5.818136 ATATCAATGGTGAAACAGAACCG 57.182 39.130 0.00 0.00 39.98 4.44
8680 17088 9.663904 CCGTATTTAATATCAATGGTGAAACAG 57.336 33.333 0.00 0.00 39.98 3.16
8681 17089 9.397280 TCCGTATTTAATATCAATGGTGAAACA 57.603 29.630 0.00 0.00 39.98 2.83
8697 17105 9.819267 ACCAAAAATGAACTTTTCCGTATTTAA 57.181 25.926 0.00 0.00 36.01 1.52
8698 17106 9.250624 CACCAAAAATGAACTTTTCCGTATTTA 57.749 29.630 0.00 0.00 36.01 1.40
8699 17107 7.766738 ACACCAAAAATGAACTTTTCCGTATTT 59.233 29.630 0.00 0.00 36.01 1.40
8700 17108 7.223777 CACACCAAAAATGAACTTTTCCGTATT 59.776 33.333 0.00 0.00 36.01 1.89
8701 17109 6.699642 CACACCAAAAATGAACTTTTCCGTAT 59.300 34.615 0.00 0.00 36.01 3.06
8702 17110 6.037098 CACACCAAAAATGAACTTTTCCGTA 58.963 36.000 0.00 0.00 36.01 4.02
8703 17111 4.867608 CACACCAAAAATGAACTTTTCCGT 59.132 37.500 0.00 0.00 36.01 4.69
8704 17112 5.105752 TCACACCAAAAATGAACTTTTCCG 58.894 37.500 0.00 0.00 36.01 4.30
8705 17113 6.976636 TTCACACCAAAAATGAACTTTTCC 57.023 33.333 0.00 0.00 36.01 3.13
8706 17114 8.028540 AGTTTCACACCAAAAATGAACTTTTC 57.971 30.769 0.00 0.00 36.01 2.29
8707 17115 7.977789 AGTTTCACACCAAAAATGAACTTTT 57.022 28.000 0.00 0.00 38.73 2.27
8708 17116 8.311109 ACTAGTTTCACACCAAAAATGAACTTT 58.689 29.630 0.00 0.00 32.21 2.66
8709 17117 7.836842 ACTAGTTTCACACCAAAAATGAACTT 58.163 30.769 0.00 0.00 32.21 2.66
8710 17118 7.339466 AGACTAGTTTCACACCAAAAATGAACT 59.661 33.333 0.00 0.00 32.21 3.01
8711 17119 7.480810 AGACTAGTTTCACACCAAAAATGAAC 58.519 34.615 0.00 0.00 32.21 3.18
8712 17120 7.639113 AGACTAGTTTCACACCAAAAATGAA 57.361 32.000 0.00 0.00 0.00 2.57
8713 17121 8.740123 TTAGACTAGTTTCACACCAAAAATGA 57.260 30.769 0.00 0.00 0.00 2.57
8714 17122 9.450807 CTTTAGACTAGTTTCACACCAAAAATG 57.549 33.333 0.00 0.00 0.00 2.32
8715 17123 8.135529 GCTTTAGACTAGTTTCACACCAAAAAT 58.864 33.333 0.00 0.00 0.00 1.82
8716 17124 7.121463 TGCTTTAGACTAGTTTCACACCAAAAA 59.879 33.333 0.00 0.00 0.00 1.94
8717 17125 6.600032 TGCTTTAGACTAGTTTCACACCAAAA 59.400 34.615 0.00 0.00 0.00 2.44
8718 17126 6.116806 TGCTTTAGACTAGTTTCACACCAAA 58.883 36.000 0.00 0.00 0.00 3.28
8719 17127 5.676552 TGCTTTAGACTAGTTTCACACCAA 58.323 37.500 0.00 0.00 0.00 3.67
8720 17128 5.163343 ACTGCTTTAGACTAGTTTCACACCA 60.163 40.000 0.00 0.00 0.00 4.17
8721 17129 5.298347 ACTGCTTTAGACTAGTTTCACACC 58.702 41.667 0.00 0.00 0.00 4.16
8722 17130 6.846325 AACTGCTTTAGACTAGTTTCACAC 57.154 37.500 0.00 0.00 29.65 3.82
8723 17131 6.260050 CCAAACTGCTTTAGACTAGTTTCACA 59.740 38.462 0.00 0.00 40.32 3.58
8724 17132 6.260271 ACCAAACTGCTTTAGACTAGTTTCAC 59.740 38.462 0.00 0.00 40.32 3.18
8725 17133 6.354130 ACCAAACTGCTTTAGACTAGTTTCA 58.646 36.000 0.00 0.00 40.32 2.69
8726 17134 6.073167 GGACCAAACTGCTTTAGACTAGTTTC 60.073 42.308 0.00 0.00 40.32 2.78
8727 17135 5.763698 GGACCAAACTGCTTTAGACTAGTTT 59.236 40.000 0.00 0.00 42.31 2.66
8728 17136 5.071923 AGGACCAAACTGCTTTAGACTAGTT 59.928 40.000 0.00 0.00 35.06 2.24
8729 17137 4.593634 AGGACCAAACTGCTTTAGACTAGT 59.406 41.667 0.00 0.00 0.00 2.57
8730 17138 5.153950 AGGACCAAACTGCTTTAGACTAG 57.846 43.478 0.00 0.00 0.00 2.57
8731 17139 4.591498 TGAGGACCAAACTGCTTTAGACTA 59.409 41.667 0.00 0.00 0.00 2.59
8732 17140 3.391296 TGAGGACCAAACTGCTTTAGACT 59.609 43.478 0.00 0.00 0.00 3.24
8733 17141 3.740115 TGAGGACCAAACTGCTTTAGAC 58.260 45.455 0.00 0.00 0.00 2.59
8734 17142 4.431416 TTGAGGACCAAACTGCTTTAGA 57.569 40.909 0.00 0.00 0.00 2.10
8735 17143 5.474876 AGAATTGAGGACCAAACTGCTTTAG 59.525 40.000 0.00 0.00 38.43 1.85
8736 17144 5.385198 AGAATTGAGGACCAAACTGCTTTA 58.615 37.500 0.00 0.00 38.43 1.85
8737 17145 4.218312 AGAATTGAGGACCAAACTGCTTT 58.782 39.130 0.00 0.00 38.43 3.51
8738 17146 3.837355 AGAATTGAGGACCAAACTGCTT 58.163 40.909 0.00 0.00 38.43 3.91
8739 17147 3.515602 AGAATTGAGGACCAAACTGCT 57.484 42.857 0.00 0.00 38.43 4.24
8740 17148 5.189180 AGATAGAATTGAGGACCAAACTGC 58.811 41.667 0.00 0.00 38.43 4.40
8741 17149 6.648192 AGAGATAGAATTGAGGACCAAACTG 58.352 40.000 0.00 0.00 38.43 3.16
8742 17150 6.882768 AGAGATAGAATTGAGGACCAAACT 57.117 37.500 0.00 0.00 38.43 2.66
8743 17151 7.787028 AGTAGAGATAGAATTGAGGACCAAAC 58.213 38.462 0.00 0.00 38.43 2.93
8744 17152 7.979786 AGTAGAGATAGAATTGAGGACCAAA 57.020 36.000 0.00 0.00 38.43 3.28
8745 17153 7.228906 CGTAGTAGAGATAGAATTGAGGACCAA 59.771 40.741 0.00 0.00 39.41 3.67
8746 17154 6.711194 CGTAGTAGAGATAGAATTGAGGACCA 59.289 42.308 0.00 0.00 0.00 4.02
8747 17155 6.348704 GCGTAGTAGAGATAGAATTGAGGACC 60.349 46.154 0.00 0.00 0.00 4.46
8748 17156 6.205076 TGCGTAGTAGAGATAGAATTGAGGAC 59.795 42.308 0.00 0.00 0.00 3.85
8749 17157 6.205076 GTGCGTAGTAGAGATAGAATTGAGGA 59.795 42.308 0.00 0.00 0.00 3.71
8750 17158 6.375377 GTGCGTAGTAGAGATAGAATTGAGG 58.625 44.000 0.00 0.00 0.00 3.86
8751 17159 6.074642 CGTGCGTAGTAGAGATAGAATTGAG 58.925 44.000 0.00 0.00 0.00 3.02
8752 17160 5.526479 ACGTGCGTAGTAGAGATAGAATTGA 59.474 40.000 0.00 0.00 0.00 2.57
8753 17161 5.749620 ACGTGCGTAGTAGAGATAGAATTG 58.250 41.667 0.00 0.00 0.00 2.32
8754 17162 6.705381 AGTACGTGCGTAGTAGAGATAGAATT 59.295 38.462 9.97 0.00 32.98 2.17
8755 17163 6.222389 AGTACGTGCGTAGTAGAGATAGAAT 58.778 40.000 9.97 0.00 32.98 2.40
8756 17164 5.595885 AGTACGTGCGTAGTAGAGATAGAA 58.404 41.667 9.97 0.00 32.98 2.10
8757 17165 5.193663 AGTACGTGCGTAGTAGAGATAGA 57.806 43.478 9.97 0.00 32.98 1.98
8765 17173 3.595173 TCCAACTAGTACGTGCGTAGTA 58.405 45.455 15.63 15.63 35.96 1.82
8766 17174 2.426522 TCCAACTAGTACGTGCGTAGT 58.573 47.619 15.11 15.11 37.87 2.73
8767 17175 3.120060 ACTTCCAACTAGTACGTGCGTAG 60.120 47.826 4.58 3.54 0.00 3.51
8768 17176 2.813754 ACTTCCAACTAGTACGTGCGTA 59.186 45.455 0.00 0.00 0.00 4.42
8769 17177 1.610522 ACTTCCAACTAGTACGTGCGT 59.389 47.619 0.00 2.05 0.00 5.24
8770 17178 2.342910 ACTTCCAACTAGTACGTGCG 57.657 50.000 0.00 0.00 0.00 5.34
8771 17179 7.703621 TGATAAATACTTCCAACTAGTACGTGC 59.296 37.037 0.00 0.00 31.37 5.34
8772 17180 9.017669 GTGATAAATACTTCCAACTAGTACGTG 57.982 37.037 0.00 0.00 31.37 4.49
8773 17181 8.964772 AGTGATAAATACTTCCAACTAGTACGT 58.035 33.333 0.00 0.00 31.37 3.57
8774 17182 9.448294 GAGTGATAAATACTTCCAACTAGTACG 57.552 37.037 0.00 0.00 31.37 3.67
8775 17183 9.448294 CGAGTGATAAATACTTCCAACTAGTAC 57.552 37.037 0.00 0.00 31.37 2.73
8776 17184 9.399797 TCGAGTGATAAATACTTCCAACTAGTA 57.600 33.333 0.00 0.00 33.00 1.82
8777 17185 8.189460 GTCGAGTGATAAATACTTCCAACTAGT 58.811 37.037 0.00 0.00 0.00 2.57
8778 17186 8.407064 AGTCGAGTGATAAATACTTCCAACTAG 58.593 37.037 0.00 0.00 0.00 2.57
8779 17187 8.289939 AGTCGAGTGATAAATACTTCCAACTA 57.710 34.615 0.00 0.00 0.00 2.24
8780 17188 7.171630 AGTCGAGTGATAAATACTTCCAACT 57.828 36.000 0.00 0.00 0.00 3.16
8781 17189 6.196724 CGAGTCGAGTGATAAATACTTCCAAC 59.803 42.308 6.73 0.00 0.00 3.77
8782 17190 6.263344 CGAGTCGAGTGATAAATACTTCCAA 58.737 40.000 6.73 0.00 0.00 3.53
8783 17191 5.732528 GCGAGTCGAGTGATAAATACTTCCA 60.733 44.000 18.61 0.00 0.00 3.53
8784 17192 4.676018 GCGAGTCGAGTGATAAATACTTCC 59.324 45.833 18.61 0.00 0.00 3.46
8785 17193 4.676018 GGCGAGTCGAGTGATAAATACTTC 59.324 45.833 18.61 0.00 0.00 3.01
8786 17194 4.338682 AGGCGAGTCGAGTGATAAATACTT 59.661 41.667 18.61 0.00 0.00 2.24
8787 17195 3.884091 AGGCGAGTCGAGTGATAAATACT 59.116 43.478 18.61 0.00 0.00 2.12
8788 17196 4.023878 AGAGGCGAGTCGAGTGATAAATAC 60.024 45.833 18.61 0.00 0.00 1.89
8789 17197 4.135306 AGAGGCGAGTCGAGTGATAAATA 58.865 43.478 18.61 0.00 0.00 1.40
8790 17198 2.952978 AGAGGCGAGTCGAGTGATAAAT 59.047 45.455 18.61 0.00 0.00 1.40
8791 17199 2.355132 GAGAGGCGAGTCGAGTGATAAA 59.645 50.000 18.61 0.00 0.00 1.40
8792 17200 1.941294 GAGAGGCGAGTCGAGTGATAA 59.059 52.381 18.61 0.00 0.00 1.75
8793 17201 1.584175 GAGAGGCGAGTCGAGTGATA 58.416 55.000 18.61 0.00 0.00 2.15
8794 17202 1.098712 GGAGAGGCGAGTCGAGTGAT 61.099 60.000 18.61 0.00 0.00 3.06
8795 17203 1.745864 GGAGAGGCGAGTCGAGTGA 60.746 63.158 18.61 0.00 0.00 3.41
8796 17204 2.766400 GGGAGAGGCGAGTCGAGTG 61.766 68.421 18.61 0.00 0.00 3.51
8797 17205 2.438795 GGGAGAGGCGAGTCGAGT 60.439 66.667 18.61 0.90 0.00 4.18
8798 17206 2.124487 AGGGAGAGGCGAGTCGAG 60.124 66.667 18.61 0.00 0.00 4.04
8799 17207 2.124653 GAGGGAGAGGCGAGTCGA 60.125 66.667 18.61 0.00 0.00 4.20
8800 17208 3.213402 GGAGGGAGAGGCGAGTCG 61.213 72.222 8.54 8.54 0.00 4.18
8801 17209 2.835895 GGGAGGGAGAGGCGAGTC 60.836 72.222 0.00 0.00 0.00 3.36
8802 17210 3.351885 AGGGAGGGAGAGGCGAGT 61.352 66.667 0.00 0.00 0.00 4.18
8803 17211 2.520741 GAGGGAGGGAGAGGCGAG 60.521 72.222 0.00 0.00 0.00 5.03
8804 17212 4.144727 GGAGGGAGGGAGAGGCGA 62.145 72.222 0.00 0.00 0.00 5.54
8806 17214 3.767044 GAGGGAGGGAGGGAGAGGC 62.767 73.684 0.00 0.00 0.00 4.70
8807 17215 2.612251 GAGGGAGGGAGGGAGAGG 59.388 72.222 0.00 0.00 0.00 3.69
8808 17216 2.612251 GGAGGGAGGGAGGGAGAG 59.388 72.222 0.00 0.00 0.00 3.20
8809 17217 3.036959 GGGAGGGAGGGAGGGAGA 61.037 72.222 0.00 0.00 0.00 3.71
8810 17218 3.039526 AGGGAGGGAGGGAGGGAG 61.040 72.222 0.00 0.00 0.00 4.30
8811 17219 3.036959 GAGGGAGGGAGGGAGGGA 61.037 72.222 0.00 0.00 0.00 4.20
8812 17220 4.179599 GGAGGGAGGGAGGGAGGG 62.180 77.778 0.00 0.00 0.00 4.30
8813 17221 4.179599 GGGAGGGAGGGAGGGAGG 62.180 77.778 0.00 0.00 0.00 4.30
8814 17222 3.039526 AGGGAGGGAGGGAGGGAG 61.040 72.222 0.00 0.00 0.00 4.30
8815 17223 3.036959 GAGGGAGGGAGGGAGGGA 61.037 72.222 0.00 0.00 0.00 4.20
8816 17224 4.179599 GGAGGGAGGGAGGGAGGG 62.180 77.778 0.00 0.00 0.00 4.30
8817 17225 3.039526 AGGAGGGAGGGAGGGAGG 61.040 72.222 0.00 0.00 0.00 4.30
8818 17226 2.018086 AGAGGAGGGAGGGAGGGAG 61.018 68.421 0.00 0.00 0.00 4.30
8819 17227 2.133201 AGAGGAGGGAGGGAGGGA 59.867 66.667 0.00 0.00 0.00 4.20
8820 17228 1.673928 ATCAGAGGAGGGAGGGAGGG 61.674 65.000 0.00 0.00 0.00 4.30
8821 17229 1.162505 TATCAGAGGAGGGAGGGAGG 58.837 60.000 0.00 0.00 0.00 4.30
8822 17230 3.077391 AGAATATCAGAGGAGGGAGGGAG 59.923 52.174 0.00 0.00 0.00 4.30
8823 17231 3.075181 AGAATATCAGAGGAGGGAGGGA 58.925 50.000 0.00 0.00 0.00 4.20
8824 17232 3.558608 AGAATATCAGAGGAGGGAGGG 57.441 52.381 0.00 0.00 0.00 4.30
8825 17233 5.004361 TGTAGAATATCAGAGGAGGGAGG 57.996 47.826 0.00 0.00 0.00 4.30
8826 17234 5.640147 ACTGTAGAATATCAGAGGAGGGAG 58.360 45.833 0.00 0.00 35.84 4.30
8827 17235 5.671463 ACTGTAGAATATCAGAGGAGGGA 57.329 43.478 0.00 0.00 35.84 4.20
8828 17236 5.949354 CCTACTGTAGAATATCAGAGGAGGG 59.051 48.000 16.22 0.00 34.30 4.30
8829 17237 6.548321 ACCTACTGTAGAATATCAGAGGAGG 58.452 44.000 16.22 0.00 36.58 4.30
8830 17238 9.391006 GATACCTACTGTAGAATATCAGAGGAG 57.609 40.741 21.70 6.04 35.30 3.69
8831 17239 8.891501 TGATACCTACTGTAGAATATCAGAGGA 58.108 37.037 23.60 11.30 35.30 3.71
8832 17240 9.693739 ATGATACCTACTGTAGAATATCAGAGG 57.306 37.037 27.23 12.92 37.24 3.69
8834 17242 8.961634 GCATGATACCTACTGTAGAATATCAGA 58.038 37.037 27.23 16.35 37.24 3.27
8835 17243 8.743714 TGCATGATACCTACTGTAGAATATCAG 58.256 37.037 27.23 22.62 37.24 2.90
8836 17244 8.650143 TGCATGATACCTACTGTAGAATATCA 57.350 34.615 26.49 26.49 37.71 2.15
8837 17245 9.526713 CATGCATGATACCTACTGTAGAATATC 57.473 37.037 22.59 19.11 31.61 1.63
8838 17246 7.984050 GCATGCATGATACCTACTGTAGAATAT 59.016 37.037 30.64 12.47 31.61 1.28
8839 17247 7.039082 TGCATGCATGATACCTACTGTAGAATA 60.039 37.037 30.64 8.50 31.61 1.75
8840 17248 6.169094 GCATGCATGATACCTACTGTAGAAT 58.831 40.000 30.64 9.01 31.61 2.40
8841 17249 5.070313 TGCATGCATGATACCTACTGTAGAA 59.930 40.000 30.64 4.54 31.61 2.10
8842 17250 4.588528 TGCATGCATGATACCTACTGTAGA 59.411 41.667 30.64 0.00 31.61 2.59
8843 17251 4.886579 TGCATGCATGATACCTACTGTAG 58.113 43.478 30.64 7.87 31.61 2.74
8844 17252 4.953940 TGCATGCATGATACCTACTGTA 57.046 40.909 30.64 0.00 0.00 2.74
8845 17253 3.843893 TGCATGCATGATACCTACTGT 57.156 42.857 30.64 0.00 0.00 3.55
8861 17269 1.616865 GCACTAATCCCATGCATGCAT 59.383 47.619 27.46 27.46 39.23 3.96
8862 17270 1.034356 GCACTAATCCCATGCATGCA 58.966 50.000 25.04 25.04 39.23 3.96
8863 17271 1.325355 AGCACTAATCCCATGCATGC 58.675 50.000 21.69 11.82 41.97 4.06
8864 17272 3.382227 TCAAAGCACTAATCCCATGCATG 59.618 43.478 20.19 20.19 41.97 4.06
8865 17273 3.634504 TCAAAGCACTAATCCCATGCAT 58.365 40.909 0.00 0.00 41.97 3.96
8866 17274 3.084536 TCAAAGCACTAATCCCATGCA 57.915 42.857 0.00 0.00 41.97 3.96
8867 17275 4.660789 ATTCAAAGCACTAATCCCATGC 57.339 40.909 0.00 0.00 39.74 4.06
8868 17276 6.211587 TCAATTCAAAGCACTAATCCCATG 57.788 37.500 0.00 0.00 0.00 3.66
8869 17277 7.427989 AATCAATTCAAAGCACTAATCCCAT 57.572 32.000 0.00 0.00 0.00 4.00
8870 17278 6.855763 AATCAATTCAAAGCACTAATCCCA 57.144 33.333 0.00 0.00 0.00 4.37
8871 17279 7.322664 TCAAATCAATTCAAAGCACTAATCCC 58.677 34.615 0.00 0.00 0.00 3.85
8872 17280 8.937634 ATCAAATCAATTCAAAGCACTAATCC 57.062 30.769 0.00 0.00 0.00 3.01
8875 17283 9.761504 TCAAATCAAATCAATTCAAAGCACTAA 57.238 25.926 0.00 0.00 0.00 2.24
8876 17284 9.761504 TTCAAATCAAATCAATTCAAAGCACTA 57.238 25.926 0.00 0.00 0.00 2.74
8877 17285 8.665643 TTCAAATCAAATCAATTCAAAGCACT 57.334 26.923 0.00 0.00 0.00 4.40
8878 17286 9.887406 AATTCAAATCAAATCAATTCAAAGCAC 57.113 25.926 0.00 0.00 0.00 4.40
8879 17287 9.885934 CAATTCAAATCAAATCAATTCAAAGCA 57.114 25.926 0.00 0.00 0.00 3.91
8880 17288 9.337091 CCAATTCAAATCAAATCAATTCAAAGC 57.663 29.630 0.00 0.00 0.00 3.51
8883 17291 8.784994 CCACCAATTCAAATCAAATCAATTCAA 58.215 29.630 0.00 0.00 0.00 2.69
8884 17292 7.094720 GCCACCAATTCAAATCAAATCAATTCA 60.095 33.333 0.00 0.00 0.00 2.57
8885 17293 7.094720 TGCCACCAATTCAAATCAAATCAATTC 60.095 33.333 0.00 0.00 0.00 2.17
8886 17294 6.715718 TGCCACCAATTCAAATCAAATCAATT 59.284 30.769 0.00 0.00 0.00 2.32
8887 17295 6.239396 TGCCACCAATTCAAATCAAATCAAT 58.761 32.000 0.00 0.00 0.00 2.57
8888 17296 5.618236 TGCCACCAATTCAAATCAAATCAA 58.382 33.333 0.00 0.00 0.00 2.57
8889 17297 5.224821 TGCCACCAATTCAAATCAAATCA 57.775 34.783 0.00 0.00 0.00 2.57
8890 17298 7.711772 TGATATGCCACCAATTCAAATCAAATC 59.288 33.333 0.00 0.00 0.00 2.17
8891 17299 7.566569 TGATATGCCACCAATTCAAATCAAAT 58.433 30.769 0.00 0.00 0.00 2.32
8892 17300 6.944096 TGATATGCCACCAATTCAAATCAAA 58.056 32.000 0.00 0.00 0.00 2.69
8893 17301 6.541934 TGATATGCCACCAATTCAAATCAA 57.458 33.333 0.00 0.00 0.00 2.57
8894 17302 6.541934 TTGATATGCCACCAATTCAAATCA 57.458 33.333 0.00 0.00 0.00 2.57
8895 17303 8.441312 AATTTGATATGCCACCAATTCAAATC 57.559 30.769 8.60 0.00 41.13 2.17
8896 17304 8.810990 AAATTTGATATGCCACCAATTCAAAT 57.189 26.923 0.00 0.00 42.33 2.32
8897 17305 8.632906 AAAATTTGATATGCCACCAATTCAAA 57.367 26.923 0.00 0.00 38.80 2.69
8898 17306 8.512956 CAAAAATTTGATATGCCACCAATTCAA 58.487 29.630 0.00 0.00 40.55 2.69
8899 17307 7.361885 GCAAAAATTTGATATGCCACCAATTCA 60.362 33.333 9.96 0.00 40.55 2.57
8900 17308 6.968335 GCAAAAATTTGATATGCCACCAATTC 59.032 34.615 9.96 0.00 40.55 2.17
8901 17309 6.854778 GCAAAAATTTGATATGCCACCAATT 58.145 32.000 9.96 0.00 40.55 2.32
8902 17310 6.439675 GCAAAAATTTGATATGCCACCAAT 57.560 33.333 9.96 0.00 40.55 3.16
8903 17311 5.876612 GCAAAAATTTGATATGCCACCAA 57.123 34.783 9.96 0.00 40.55 3.67
8909 17317 2.935201 TGCCGGCAAAAATTTGATATGC 59.065 40.909 30.74 8.99 40.55 3.14
8910 17318 4.492247 CGTTGCCGGCAAAAATTTGATATG 60.492 41.667 41.60 18.66 40.55 1.78
8911 17319 3.616379 CGTTGCCGGCAAAAATTTGATAT 59.384 39.130 41.60 0.00 40.55 1.63
8912 17320 2.989840 CGTTGCCGGCAAAAATTTGATA 59.010 40.909 41.60 15.25 40.55 2.15
8913 17321 1.797635 CGTTGCCGGCAAAAATTTGAT 59.202 42.857 41.60 0.00 40.55 2.57
8914 17322 1.202417 TCGTTGCCGGCAAAAATTTGA 60.202 42.857 41.60 26.87 39.84 2.69
8915 17323 1.192090 CTCGTTGCCGGCAAAAATTTG 59.808 47.619 41.60 25.24 41.03 2.32
8916 17324 1.067821 TCTCGTTGCCGGCAAAAATTT 59.932 42.857 41.60 0.00 37.70 1.82
8917 17325 0.671251 TCTCGTTGCCGGCAAAAATT 59.329 45.000 41.60 0.00 37.70 1.82
8918 17326 0.671251 TTCTCGTTGCCGGCAAAAAT 59.329 45.000 41.60 0.00 37.70 1.82
8919 17327 0.456221 TTTCTCGTTGCCGGCAAAAA 59.544 45.000 41.60 32.47 37.70 1.94
8920 17328 0.456221 TTTTCTCGTTGCCGGCAAAA 59.544 45.000 41.60 29.01 37.70 2.44
8921 17329 0.248702 GTTTTCTCGTTGCCGGCAAA 60.249 50.000 41.60 26.93 37.70 3.68
8922 17330 1.357334 GTTTTCTCGTTGCCGGCAA 59.643 52.632 37.30 37.30 33.95 4.52
8923 17331 1.781025 CTGTTTTCTCGTTGCCGGCA 61.781 55.000 29.03 29.03 33.95 5.69
8924 17332 1.082104 CTGTTTTCTCGTTGCCGGC 60.082 57.895 22.73 22.73 33.95 6.13
8925 17333 1.128692 GATCTGTTTTCTCGTTGCCGG 59.871 52.381 0.00 0.00 33.95 6.13
8926 17334 1.128692 GGATCTGTTTTCTCGTTGCCG 59.871 52.381 0.00 0.00 0.00 5.69
8927 17335 2.151202 TGGATCTGTTTTCTCGTTGCC 58.849 47.619 0.00 0.00 0.00 4.52
8928 17336 2.413371 GCTGGATCTGTTTTCTCGTTGC 60.413 50.000 0.00 0.00 0.00 4.17
8929 17337 2.807967 TGCTGGATCTGTTTTCTCGTTG 59.192 45.455 0.00 0.00 0.00 4.10
8930 17338 3.126001 TGCTGGATCTGTTTTCTCGTT 57.874 42.857 0.00 0.00 0.00 3.85
8931 17339 2.839486 TGCTGGATCTGTTTTCTCGT 57.161 45.000 0.00 0.00 0.00 4.18
8932 17340 3.070018 ACTTGCTGGATCTGTTTTCTCG 58.930 45.455 0.00 0.00 0.00 4.04
8933 17341 4.067896 TGACTTGCTGGATCTGTTTTCTC 58.932 43.478 0.00 0.00 0.00 2.87
8934 17342 4.090761 TGACTTGCTGGATCTGTTTTCT 57.909 40.909 0.00 0.00 0.00 2.52
8935 17343 4.036734 TGTTGACTTGCTGGATCTGTTTTC 59.963 41.667 0.00 0.00 0.00 2.29
8936 17344 3.953612 TGTTGACTTGCTGGATCTGTTTT 59.046 39.130 0.00 0.00 0.00 2.43
8937 17345 3.554934 TGTTGACTTGCTGGATCTGTTT 58.445 40.909 0.00 0.00 0.00 2.83
8938 17346 3.213206 TGTTGACTTGCTGGATCTGTT 57.787 42.857 0.00 0.00 0.00 3.16
8939 17347 2.936919 TGTTGACTTGCTGGATCTGT 57.063 45.000 0.00 0.00 0.00 3.41
8940 17348 2.422479 CCATGTTGACTTGCTGGATCTG 59.578 50.000 0.00 0.00 0.00 2.90
8941 17349 2.719739 CCATGTTGACTTGCTGGATCT 58.280 47.619 0.00 0.00 0.00 2.75
8942 17350 1.133790 GCCATGTTGACTTGCTGGATC 59.866 52.381 0.00 0.00 0.00 3.36
8943 17351 1.180029 GCCATGTTGACTTGCTGGAT 58.820 50.000 0.00 0.00 0.00 3.41
8944 17352 1.236616 CGCCATGTTGACTTGCTGGA 61.237 55.000 0.00 0.00 0.00 3.86
8945 17353 1.210931 CGCCATGTTGACTTGCTGG 59.789 57.895 0.00 0.00 0.00 4.85
8946 17354 0.386352 CACGCCATGTTGACTTGCTG 60.386 55.000 0.00 0.00 0.00 4.41
8947 17355 1.518056 CCACGCCATGTTGACTTGCT 61.518 55.000 0.00 0.00 0.00 3.91
8948 17356 1.081242 CCACGCCATGTTGACTTGC 60.081 57.895 0.00 0.00 0.00 4.01
8949 17357 0.238289 GACCACGCCATGTTGACTTG 59.762 55.000 0.00 0.00 0.00 3.16
8950 17358 0.889186 GGACCACGCCATGTTGACTT 60.889 55.000 0.00 0.00 0.00 3.01
8951 17359 1.302511 GGACCACGCCATGTTGACT 60.303 57.895 0.00 0.00 0.00 3.41
8952 17360 2.677003 CGGACCACGCCATGTTGAC 61.677 63.158 0.00 0.00 34.82 3.18
8953 17361 2.358125 CGGACCACGCCATGTTGA 60.358 61.111 0.00 0.00 34.82 3.18
8969 17377 0.595053 ATAGTGTCGAATCCGCTGCG 60.595 55.000 16.34 16.34 35.37 5.18
8970 17378 1.523095 GAATAGTGTCGAATCCGCTGC 59.477 52.381 0.00 0.00 35.37 5.25
8971 17379 3.085443 AGAATAGTGTCGAATCCGCTG 57.915 47.619 0.00 0.00 35.37 5.18
8972 17380 3.802948 AAGAATAGTGTCGAATCCGCT 57.197 42.857 0.00 0.00 35.37 5.52
8973 17381 4.859629 AAAAGAATAGTGTCGAATCCGC 57.140 40.909 0.00 0.00 35.37 5.54
8992 17400 4.210331 AGAAGCAGAGGAAAGCAGAAAAA 58.790 39.130 0.00 0.00 0.00 1.94
8993 17401 3.825328 AGAAGCAGAGGAAAGCAGAAAA 58.175 40.909 0.00 0.00 0.00 2.29
8994 17402 3.498774 AGAAGCAGAGGAAAGCAGAAA 57.501 42.857 0.00 0.00 0.00 2.52
8995 17403 4.833478 ATAGAAGCAGAGGAAAGCAGAA 57.167 40.909 0.00 0.00 0.00 3.02
8996 17404 4.469227 AGAATAGAAGCAGAGGAAAGCAGA 59.531 41.667 0.00 0.00 0.00 4.26
8997 17405 4.768583 AGAATAGAAGCAGAGGAAAGCAG 58.231 43.478 0.00 0.00 0.00 4.24
8998 17406 4.469227 AGAGAATAGAAGCAGAGGAAAGCA 59.531 41.667 0.00 0.00 0.00 3.91
8999 17407 5.022282 AGAGAATAGAAGCAGAGGAAAGC 57.978 43.478 0.00 0.00 0.00 3.51
9000 17408 7.920160 AAAAGAGAATAGAAGCAGAGGAAAG 57.080 36.000 0.00 0.00 0.00 2.62
9054 17462 0.033228 CGATGCCAACCCTGCAAAAA 59.967 50.000 0.00 0.00 42.92 1.94
9055 17463 1.664873 CGATGCCAACCCTGCAAAA 59.335 52.632 0.00 0.00 42.92 2.44
9056 17464 2.929903 GCGATGCCAACCCTGCAAA 61.930 57.895 0.00 0.00 42.92 3.68
9057 17465 3.372730 GCGATGCCAACCCTGCAA 61.373 61.111 0.00 0.00 42.92 4.08
9068 17476 2.348966 GCTTTTCGAATAGAGGCGATGC 60.349 50.000 18.30 2.57 36.31 3.91
9069 17477 2.221981 GGCTTTTCGAATAGAGGCGATG 59.778 50.000 18.30 0.00 36.31 3.84
9070 17478 2.484889 GGCTTTTCGAATAGAGGCGAT 58.515 47.619 18.30 0.00 36.31 4.58
9071 17479 1.935933 GGCTTTTCGAATAGAGGCGA 58.064 50.000 18.30 0.00 34.32 5.54
9073 17481 0.938008 CCGGCTTTTCGAATAGAGGC 59.062 55.000 18.30 16.80 0.00 4.70
9074 17482 2.100916 TCTCCGGCTTTTCGAATAGAGG 59.899 50.000 18.30 18.03 0.00 3.69
9075 17483 3.438297 TCTCCGGCTTTTCGAATAGAG 57.562 47.619 18.30 10.99 0.00 2.43
9076 17484 3.880047 TTCTCCGGCTTTTCGAATAGA 57.120 42.857 18.30 2.29 0.00 1.98
9077 17485 5.529791 TCTATTCTCCGGCTTTTCGAATAG 58.470 41.667 10.85 10.85 42.10 1.73
9078 17486 5.524971 TCTATTCTCCGGCTTTTCGAATA 57.475 39.130 0.00 0.00 0.00 1.75
9079 17487 4.402056 TCTATTCTCCGGCTTTTCGAAT 57.598 40.909 0.00 0.69 0.00 3.34
9080 17488 3.880047 TCTATTCTCCGGCTTTTCGAA 57.120 42.857 0.00 0.00 0.00 3.71
9081 17489 3.880047 TTCTATTCTCCGGCTTTTCGA 57.120 42.857 0.00 0.00 0.00 3.71
9082 17490 3.248602 CCATTCTATTCTCCGGCTTTTCG 59.751 47.826 0.00 0.00 0.00 3.46
9083 17491 3.565902 CCCATTCTATTCTCCGGCTTTTC 59.434 47.826 0.00 0.00 0.00 2.29
9084 17492 3.555966 CCCATTCTATTCTCCGGCTTTT 58.444 45.455 0.00 0.00 0.00 2.27
9085 17493 2.158608 CCCCATTCTATTCTCCGGCTTT 60.159 50.000 0.00 0.00 0.00 3.51
9086 17494<