Multiple sequence alignment - TraesCS5B01G571100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G571100 chr5B 100.000 5500 0 0 1 5500 712479314 712473815 0.000000e+00 10157.0
1 TraesCS5B01G571100 chr5B 81.900 221 21 6 3104 3311 712429342 712429556 9.480000e-38 169.0
2 TraesCS5B01G571100 chr5B 90.265 113 11 0 465 577 669302586 669302698 1.230000e-31 148.0
3 TraesCS5B01G571100 chr5B 90.141 71 7 0 2422 2492 275685996 275686066 5.870000e-15 93.5
4 TraesCS5B01G571100 chr5B 79.720 143 14 8 5213 5350 712465294 712465162 7.590000e-14 89.8
5 TraesCS5B01G571100 chr5B 81.897 116 10 7 5182 5296 712442802 712442697 2.730000e-13 87.9
6 TraesCS5B01G571100 chr5B 92.453 53 4 0 5443 5495 106964548 106964600 5.910000e-10 76.8
7 TraesCS5B01G571100 chr5B 81.915 94 6 3 5410 5492 394664906 394664999 9.890000e-08 69.4
8 TraesCS5B01G571100 chr5B 85.507 69 6 2 5018 5082 712430344 712430412 9.890000e-08 69.4
9 TraesCS5B01G571100 chr5D 86.829 820 68 11 3735 4534 562086763 562085964 0.000000e+00 880.0
10 TraesCS5B01G571100 chr5D 89.280 653 41 11 1738 2369 562089324 562088680 0.000000e+00 791.0
11 TraesCS5B01G571100 chr5D 88.852 610 39 12 3103 3696 562087372 562086776 0.000000e+00 723.0
12 TraesCS5B01G571100 chr5D 97.059 136 4 0 2568 2703 562088666 562088531 4.290000e-56 230.0
13 TraesCS5B01G571100 chr5D 93.496 123 3 3 2988 3105 562088532 562088410 1.570000e-40 178.0
14 TraesCS5B01G571100 chr5D 92.708 96 7 0 1904 1999 486829656 486829561 7.430000e-29 139.0
15 TraesCS5B01G571100 chr5D 88.764 89 9 1 5208 5296 562068088 562068001 2.100000e-19 108.0
16 TraesCS5B01G571100 chr5D 91.549 71 6 0 2422 2492 486829113 486829043 1.260000e-16 99.0
17 TraesCS5B01G571100 chr5D 87.097 93 4 5 5208 5296 562080883 562080795 1.260000e-16 99.0
18 TraesCS5B01G571100 chr5D 95.745 47 2 0 5369 5415 333399672 333399718 5.910000e-10 76.8
19 TraesCS5B01G571100 chr7B 87.370 768 61 11 3754 4497 605593 606348 0.000000e+00 848.0
20 TraesCS5B01G571100 chr7B 89.293 495 39 11 3193 3678 605057 605546 4.710000e-170 608.0
21 TraesCS5B01G571100 chr7B 88.235 289 22 6 1714 1999 603995 604274 8.830000e-88 335.0
22 TraesCS5B01G571100 chr7B 88.083 193 14 4 2772 2962 74277497 74277682 2.580000e-53 220.0
23 TraesCS5B01G571100 chr7B 84.834 211 23 3 2422 2631 74277210 74277412 2.600000e-48 204.0
24 TraesCS5B01G571100 chr7B 88.983 118 13 0 463 580 34609641 34609758 4.440000e-31 147.0
25 TraesCS5B01G571100 chr7B 82.540 126 7 9 5182 5305 627335 627447 4.530000e-16 97.1
26 TraesCS5B01G571100 chr7B 96.226 53 2 0 5443 5495 45174361 45174413 2.730000e-13 87.9
27 TraesCS5B01G571100 chr7B 82.292 96 12 5 614 706 67705779 67705686 1.640000e-10 78.7
28 TraesCS5B01G571100 chr7B 100.000 39 0 0 4745 4783 668262 668224 7.640000e-09 73.1
29 TraesCS5B01G571100 chr7D 88.542 192 18 3 2772 2962 163352510 163352698 4.290000e-56 230.0
30 TraesCS5B01G571100 chr7D 80.569 211 32 3 2424 2633 163352225 163352427 2.650000e-33 154.0
31 TraesCS5B01G571100 chr7D 88.983 118 12 1 469 585 271752841 271752958 1.600000e-30 145.0
32 TraesCS5B01G571100 chr7D 90.625 96 8 1 1904 1999 163351595 163351689 5.780000e-25 126.0
33 TraesCS5B01G571100 chr7D 81.600 125 22 1 583 706 216006760 216006884 9.750000e-18 102.0
34 TraesCS5B01G571100 chr7D 95.745 47 2 0 5369 5415 464154880 464154834 5.910000e-10 76.8
35 TraesCS5B01G571100 chr7D 93.878 49 3 0 5367 5415 27178505 27178553 2.120000e-09 75.0
36 TraesCS5B01G571100 chr2B 88.542 192 19 3 2772 2962 671015622 671015433 4.290000e-56 230.0
37 TraesCS5B01G571100 chr2B 88.525 122 12 2 457 578 456339331 456339450 4.440000e-31 147.0
38 TraesCS5B01G571100 chr2B 77.778 225 29 4 2422 2645 671015897 671015693 9.680000e-23 119.0
39 TraesCS5B01G571100 chr2B 87.368 95 11 1 1904 1998 671016480 671016387 2.100000e-19 108.0
40 TraesCS5B01G571100 chr2B 96.226 53 1 1 5443 5495 233124062 233124113 9.820000e-13 86.1
41 TraesCS5B01G571100 chr2B 100.000 35 0 0 2664 2698 671015616 671015582 1.280000e-06 65.8
42 TraesCS5B01G571100 chr1D 87.500 192 20 3 2772 2962 113881476 113881664 9.280000e-53 219.0
43 TraesCS5B01G571100 chr1D 80.095 211 33 3 2424 2633 113881191 113881393 1.230000e-31 148.0
44 TraesCS5B01G571100 chr1D 88.983 118 12 1 460 577 85196233 85196117 1.600000e-30 145.0
45 TraesCS5B01G571100 chr1D 89.583 96 9 1 1904 1999 113880561 113880655 2.690000e-23 121.0
46 TraesCS5B01G571100 chr1D 88.333 60 3 4 5436 5495 67002868 67002923 9.890000e-08 69.4
47 TraesCS5B01G571100 chr3D 86.458 192 22 3 2772 2962 574515927 574515739 2.010000e-49 207.0
48 TraesCS5B01G571100 chr3D 78.924 223 38 3 2424 2645 574516212 574515998 5.740000e-30 143.0
49 TraesCS5B01G571100 chr3D 97.368 38 0 1 5458 5495 609882430 609882394 4.600000e-06 63.9
50 TraesCS5B01G571100 chr4A 90.244 123 9 3 458 580 539752692 539752573 2.050000e-34 158.0
51 TraesCS5B01G571100 chr4D 91.071 112 10 0 466 577 360762928 360763039 9.540000e-33 152.0
52 TraesCS5B01G571100 chr4D 87.500 120 15 0 464 583 65128005 65128124 7.430000e-29 139.0
53 TraesCS5B01G571100 chr4B 75.920 299 66 6 2 298 639041473 639041179 1.230000e-31 148.0
54 TraesCS5B01G571100 chr4B 95.745 47 2 0 5369 5415 74669967 74669921 5.910000e-10 76.8
55 TraesCS5B01G571100 chr5A 90.179 112 10 1 470 581 651518341 651518451 1.600000e-30 145.0
56 TraesCS5B01G571100 chr5A 96.226 53 2 0 5443 5495 522101193 522101141 2.730000e-13 87.9
57 TraesCS5B01G571100 chr2D 89.091 110 10 2 2854 2962 399994039 399994147 9.610000e-28 135.0
58 TraesCS5B01G571100 chr2D 79.592 147 7 6 5368 5492 644674742 644674887 3.530000e-12 84.2
59 TraesCS5B01G571100 chr2D 95.745 47 2 0 5367 5413 552068137 552068091 5.910000e-10 76.8
60 TraesCS5B01G571100 chr2D 81.579 76 13 1 630 705 131051214 131051288 1.650000e-05 62.1
61 TraesCS5B01G571100 chr2A 86.047 129 15 3 582 708 650208026 650208153 9.610000e-28 135.0
62 TraesCS5B01G571100 chr2A 95.745 47 2 0 5368 5414 685980151 685980105 5.910000e-10 76.8
63 TraesCS5B01G571100 chr2A 94.737 38 2 0 5413 5450 565328452 565328489 5.950000e-05 60.2
64 TraesCS5B01G571100 chr3A 82.051 117 17 4 591 705 527383070 527382956 4.530000e-16 97.1
65 TraesCS5B01G571100 chr1A 80.000 125 23 2 582 705 584937191 584937068 2.110000e-14 91.6
66 TraesCS5B01G571100 chr1A 96.875 32 0 1 592 623 32746897 32746867 1.000000e-02 52.8
67 TraesCS5B01G571100 chrUn 93.103 58 2 2 5438 5495 49499638 49499693 3.530000e-12 84.2
68 TraesCS5B01G571100 chr3B 97.872 47 1 0 5369 5415 790315693 790315739 1.270000e-11 82.4
69 TraesCS5B01G571100 chr3B 95.833 48 1 1 5368 5415 422494532 422494486 5.910000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G571100 chr5B 712473815 712479314 5499 True 10157.0 10157 100.000000 1 5500 1 chr5B.!!$R3 5499
1 TraesCS5B01G571100 chr5D 562085964 562089324 3360 True 560.4 880 91.103200 1738 4534 5 chr5D.!!$R4 2796
2 TraesCS5B01G571100 chr7B 603995 606348 2353 False 597.0 848 88.299333 1714 4497 3 chr7B.!!$F4 2783


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
962 963 0.033366 GGAAACGGCTGTGGCAATTT 59.967 50.0 0.00 0.00 40.87 1.82 F
1045 1046 0.034477 CCACCTCCACCACCATTACC 60.034 60.0 0.00 0.00 0.00 2.85 F
1435 1436 0.036388 TGAACGAGCAGGGGATCAAC 60.036 55.0 0.00 0.00 0.00 3.18 F
1681 1682 0.254462 TGTCACCACAGTCCAAAGCA 59.746 50.0 0.00 0.00 0.00 3.91 F
2876 2988 0.322277 ACTGAAGACATGGGCTGCAG 60.322 55.0 19.08 19.08 43.40 4.41 F
2877 2989 0.322277 CTGAAGACATGGGCTGCAGT 60.322 55.0 16.64 0.00 34.85 4.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2857 2969 0.322277 CTGCAGCCCATGTCTTCAGT 60.322 55.0 0.00 0.00 0.00 3.41 R
2862 2974 0.692476 TGTTACTGCAGCCCATGTCT 59.308 50.0 15.27 0.00 0.00 3.41 R
3254 4448 0.329261 TCCCTCCTTCCAACTGCATG 59.671 55.0 0.00 0.00 0.00 4.06 R
3538 4738 0.245266 TCATAGTCTGCCGCGAAACA 59.755 50.0 8.23 1.24 0.00 2.83 R
3991 5206 0.830444 TCAGGTAGTTGGACACGCCT 60.830 55.0 0.00 0.00 36.46 5.52 R
4782 6017 1.029681 GCTGCTGCATCCATTGATCA 58.970 50.0 11.11 0.00 39.41 2.92 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.727429 TGGTTGGGTAACTAGGGACT 57.273 50.000 0.00 0.00 36.99 3.85
21 22 2.994355 TGGTTGGGTAACTAGGGACTT 58.006 47.619 0.00 0.00 36.99 3.01
22 23 3.329277 TGGTTGGGTAACTAGGGACTTT 58.671 45.455 0.00 0.00 36.99 2.66
23 24 3.328637 TGGTTGGGTAACTAGGGACTTTC 59.671 47.826 0.00 0.00 36.99 2.62
24 25 3.307975 GGTTGGGTAACTAGGGACTTTCC 60.308 52.174 0.00 0.00 36.99 3.13
25 26 3.307975 GTTGGGTAACTAGGGACTTTCCC 60.308 52.174 2.68 2.68 44.07 3.97
26 27 5.797562 GTTGGGTAACTAGGGACTTTCCCA 61.798 50.000 13.87 4.62 45.09 4.37
27 28 7.052878 GTTGGGTAACTAGGGACTTTCCCAT 62.053 48.000 13.87 1.77 45.09 4.00
28 29 8.763861 GTTGGGTAACTAGGGACTTTCCCATC 62.764 50.000 13.87 5.41 45.09 3.51
39 40 6.361768 GGACTTTCCCATCCCTATAGTAAG 57.638 45.833 0.00 0.00 0.00 2.34
40 41 5.845065 GGACTTTCCCATCCCTATAGTAAGT 59.155 44.000 0.00 0.00 0.00 2.24
41 42 7.015064 GGACTTTCCCATCCCTATAGTAAGTA 58.985 42.308 0.00 0.00 0.00 2.24
42 43 7.679025 GGACTTTCCCATCCCTATAGTAAGTAT 59.321 40.741 0.00 0.00 0.00 2.12
43 44 9.102453 GACTTTCCCATCCCTATAGTAAGTATT 57.898 37.037 0.00 0.00 0.00 1.89
44 45 9.102453 ACTTTCCCATCCCTATAGTAAGTATTC 57.898 37.037 0.00 0.00 0.00 1.75
45 46 8.445361 TTTCCCATCCCTATAGTAAGTATTCC 57.555 38.462 0.00 0.00 0.00 3.01
46 47 7.123560 TCCCATCCCTATAGTAAGTATTCCA 57.876 40.000 0.00 0.00 0.00 3.53
47 48 7.729350 TCCCATCCCTATAGTAAGTATTCCAT 58.271 38.462 0.00 0.00 0.00 3.41
48 49 8.863125 TCCCATCCCTATAGTAAGTATTCCATA 58.137 37.037 0.00 0.00 0.00 2.74
49 50 9.676129 CCCATCCCTATAGTAAGTATTCCATAT 57.324 37.037 0.00 0.00 0.00 1.78
60 61 9.574516 AGTAAGTATTCCATATCAATTGAACCC 57.425 33.333 13.09 0.00 0.00 4.11
61 62 9.349713 GTAAGTATTCCATATCAATTGAACCCA 57.650 33.333 13.09 0.00 0.00 4.51
63 64 8.413309 AGTATTCCATATCAATTGAACCCATG 57.587 34.615 13.09 12.60 0.00 3.66
64 65 5.534207 TTCCATATCAATTGAACCCATGC 57.466 39.130 13.09 0.00 0.00 4.06
65 66 4.806892 TCCATATCAATTGAACCCATGCT 58.193 39.130 13.09 0.00 0.00 3.79
66 67 5.951204 TCCATATCAATTGAACCCATGCTA 58.049 37.500 13.09 0.00 0.00 3.49
67 68 6.372104 TCCATATCAATTGAACCCATGCTAA 58.628 36.000 13.09 0.98 0.00 3.09
68 69 6.838090 TCCATATCAATTGAACCCATGCTAAA 59.162 34.615 13.09 0.00 0.00 1.85
69 70 7.510001 TCCATATCAATTGAACCCATGCTAAAT 59.490 33.333 13.09 0.00 0.00 1.40
70 71 7.816031 CCATATCAATTGAACCCATGCTAAATC 59.184 37.037 13.09 0.00 0.00 2.17
71 72 5.596836 TCAATTGAACCCATGCTAAATCC 57.403 39.130 5.45 0.00 0.00 3.01
72 73 5.271598 TCAATTGAACCCATGCTAAATCCT 58.728 37.500 5.45 0.00 0.00 3.24
73 74 5.127519 TCAATTGAACCCATGCTAAATCCTG 59.872 40.000 5.45 0.00 0.00 3.86
74 75 2.378038 TGAACCCATGCTAAATCCTGC 58.622 47.619 0.00 0.00 0.00 4.85
75 76 2.025037 TGAACCCATGCTAAATCCTGCT 60.025 45.455 0.00 0.00 0.00 4.24
76 77 2.834638 ACCCATGCTAAATCCTGCTT 57.165 45.000 0.00 0.00 0.00 3.91
77 78 3.951563 ACCCATGCTAAATCCTGCTTA 57.048 42.857 0.00 0.00 0.00 3.09
78 79 4.459852 ACCCATGCTAAATCCTGCTTAT 57.540 40.909 0.00 0.00 0.00 1.73
79 80 4.808042 ACCCATGCTAAATCCTGCTTATT 58.192 39.130 0.00 0.00 0.00 1.40
80 81 4.586001 ACCCATGCTAAATCCTGCTTATTG 59.414 41.667 0.00 0.00 0.00 1.90
81 82 4.828939 CCCATGCTAAATCCTGCTTATTGA 59.171 41.667 0.00 0.00 0.00 2.57
82 83 5.302568 CCCATGCTAAATCCTGCTTATTGAA 59.697 40.000 0.00 0.00 0.00 2.69
83 84 6.444633 CCATGCTAAATCCTGCTTATTGAAG 58.555 40.000 0.00 0.00 35.60 3.02
84 85 6.263842 CCATGCTAAATCCTGCTTATTGAAGA 59.736 38.462 0.00 0.00 34.25 2.87
85 86 7.201848 CCATGCTAAATCCTGCTTATTGAAGAA 60.202 37.037 0.00 0.00 34.25 2.52
86 87 7.088589 TGCTAAATCCTGCTTATTGAAGAAC 57.911 36.000 0.00 0.00 34.25 3.01
87 88 6.886459 TGCTAAATCCTGCTTATTGAAGAACT 59.114 34.615 0.00 0.00 34.25 3.01
88 89 7.394359 TGCTAAATCCTGCTTATTGAAGAACTT 59.606 33.333 0.00 0.00 34.25 2.66
89 90 7.699812 GCTAAATCCTGCTTATTGAAGAACTTG 59.300 37.037 0.00 0.00 34.25 3.16
90 91 7.765695 AAATCCTGCTTATTGAAGAACTTGA 57.234 32.000 0.00 0.00 34.25 3.02
91 92 7.765695 AATCCTGCTTATTGAAGAACTTGAA 57.234 32.000 0.00 0.00 34.25 2.69
92 93 7.951347 ATCCTGCTTATTGAAGAACTTGAAT 57.049 32.000 4.87 4.87 34.25 2.57
93 94 9.466497 AATCCTGCTTATTGAAGAACTTGAATA 57.534 29.630 3.19 3.19 34.25 1.75
94 95 8.498054 TCCTGCTTATTGAAGAACTTGAATAG 57.502 34.615 6.57 4.07 32.03 1.73
95 96 7.554118 TCCTGCTTATTGAAGAACTTGAATAGG 59.446 37.037 9.92 9.92 32.03 2.57
96 97 7.554118 CCTGCTTATTGAAGAACTTGAATAGGA 59.446 37.037 15.48 7.86 31.12 2.94
97 98 8.862325 TGCTTATTGAAGAACTTGAATAGGAA 57.138 30.769 15.48 6.36 31.12 3.36
98 99 9.466497 TGCTTATTGAAGAACTTGAATAGGAAT 57.534 29.630 15.48 0.00 31.12 3.01
116 117 9.490379 AATAGGAATTTAGTAAGTAATGCTCCG 57.510 33.333 0.00 0.00 0.00 4.63
117 118 6.885922 AGGAATTTAGTAAGTAATGCTCCGT 58.114 36.000 0.00 0.00 0.00 4.69
118 119 6.761714 AGGAATTTAGTAAGTAATGCTCCGTG 59.238 38.462 0.00 0.00 0.00 4.94
119 120 6.018180 GGAATTTAGTAAGTAATGCTCCGTGG 60.018 42.308 0.00 0.00 0.00 4.94
120 121 5.410355 TTTAGTAAGTAATGCTCCGTGGT 57.590 39.130 0.00 0.00 0.00 4.16
121 122 3.975168 AGTAAGTAATGCTCCGTGGTT 57.025 42.857 0.00 0.00 0.00 3.67
122 123 3.596214 AGTAAGTAATGCTCCGTGGTTG 58.404 45.455 0.00 0.00 0.00 3.77
123 124 1.165270 AAGTAATGCTCCGTGGTTGC 58.835 50.000 0.00 1.00 0.00 4.17
124 125 0.036164 AGTAATGCTCCGTGGTTGCA 59.964 50.000 10.54 10.54 41.13 4.08
126 127 4.421365 ATGCTCCGTGGTTGCATT 57.579 50.000 13.38 2.87 43.85 3.56
127 128 2.183409 ATGCTCCGTGGTTGCATTC 58.817 52.632 13.38 0.00 43.85 2.67
128 129 0.322816 ATGCTCCGTGGTTGCATTCT 60.323 50.000 13.38 0.00 43.85 2.40
129 130 1.236616 TGCTCCGTGGTTGCATTCTG 61.237 55.000 0.00 0.00 0.00 3.02
130 131 0.955428 GCTCCGTGGTTGCATTCTGA 60.955 55.000 0.00 0.00 0.00 3.27
131 132 1.081892 CTCCGTGGTTGCATTCTGAG 58.918 55.000 0.00 0.00 0.00 3.35
132 133 0.684535 TCCGTGGTTGCATTCTGAGA 59.315 50.000 0.00 0.00 0.00 3.27
133 134 1.278985 TCCGTGGTTGCATTCTGAGAT 59.721 47.619 0.00 0.00 0.00 2.75
134 135 1.667724 CCGTGGTTGCATTCTGAGATC 59.332 52.381 0.00 0.00 0.00 2.75
135 136 2.349590 CGTGGTTGCATTCTGAGATCA 58.650 47.619 0.00 0.00 0.00 2.92
136 137 2.743664 CGTGGTTGCATTCTGAGATCAA 59.256 45.455 0.00 0.00 0.00 2.57
137 138 3.181513 CGTGGTTGCATTCTGAGATCAAG 60.182 47.826 0.00 0.00 0.00 3.02
138 139 2.751259 TGGTTGCATTCTGAGATCAAGC 59.249 45.455 11.95 11.95 36.17 4.01
139 140 2.751259 GGTTGCATTCTGAGATCAAGCA 59.249 45.455 13.19 5.97 35.82 3.91
140 141 3.427233 GGTTGCATTCTGAGATCAAGCAC 60.427 47.826 13.19 4.63 35.82 4.40
141 142 3.062122 TGCATTCTGAGATCAAGCACA 57.938 42.857 0.00 0.00 0.00 4.57
142 143 2.745821 TGCATTCTGAGATCAAGCACAC 59.254 45.455 0.00 0.00 0.00 3.82
143 144 2.097142 GCATTCTGAGATCAAGCACACC 59.903 50.000 0.00 0.00 0.00 4.16
144 145 3.607741 CATTCTGAGATCAAGCACACCT 58.392 45.455 0.00 0.00 0.00 4.00
145 146 4.763073 CATTCTGAGATCAAGCACACCTA 58.237 43.478 0.00 0.00 0.00 3.08
146 147 4.462508 TTCTGAGATCAAGCACACCTAG 57.537 45.455 0.00 0.00 0.00 3.02
147 148 2.762887 TCTGAGATCAAGCACACCTAGG 59.237 50.000 7.41 7.41 0.00 3.02
148 149 1.208052 TGAGATCAAGCACACCTAGGC 59.792 52.381 9.30 0.00 0.00 3.93
149 150 0.543749 AGATCAAGCACACCTAGGCC 59.456 55.000 9.30 0.00 0.00 5.19
150 151 0.253044 GATCAAGCACACCTAGGCCA 59.747 55.000 9.30 0.00 0.00 5.36
151 152 0.035056 ATCAAGCACACCTAGGCCAC 60.035 55.000 9.30 0.00 0.00 5.01
152 153 1.675641 CAAGCACACCTAGGCCACC 60.676 63.158 9.30 0.00 0.00 4.61
153 154 1.847968 AAGCACACCTAGGCCACCT 60.848 57.895 9.30 0.00 37.71 4.00
154 155 2.045926 GCACACCTAGGCCACCTG 60.046 66.667 9.30 1.14 34.61 4.00
155 156 2.045926 CACACCTAGGCCACCTGC 60.046 66.667 9.30 0.00 34.61 4.85
156 157 2.529136 ACACCTAGGCCACCTGCA 60.529 61.111 9.30 0.00 43.89 4.41
157 158 2.045926 CACCTAGGCCACCTGCAC 60.046 66.667 9.30 0.00 43.89 4.57
158 159 2.203998 ACCTAGGCCACCTGCACT 60.204 61.111 9.30 0.00 43.89 4.40
159 160 1.847968 ACCTAGGCCACCTGCACTT 60.848 57.895 9.30 0.00 43.89 3.16
160 161 1.380302 CCTAGGCCACCTGCACTTT 59.620 57.895 5.01 0.00 43.89 2.66
161 162 0.251341 CCTAGGCCACCTGCACTTTT 60.251 55.000 5.01 0.00 43.89 2.27
162 163 1.004277 CCTAGGCCACCTGCACTTTTA 59.996 52.381 5.01 0.00 43.89 1.52
163 164 2.359900 CTAGGCCACCTGCACTTTTAG 58.640 52.381 5.01 0.00 43.89 1.85
164 165 0.251341 AGGCCACCTGCACTTTTAGG 60.251 55.000 5.01 0.00 43.89 2.69
165 166 0.251165 GGCCACCTGCACTTTTAGGA 60.251 55.000 0.00 0.00 43.89 2.94
166 167 1.616159 GCCACCTGCACTTTTAGGAA 58.384 50.000 0.00 0.00 40.77 3.36
167 168 1.541588 GCCACCTGCACTTTTAGGAAG 59.458 52.381 0.00 0.00 40.77 3.46
168 169 2.814097 GCCACCTGCACTTTTAGGAAGA 60.814 50.000 0.00 0.00 40.77 2.87
169 170 2.814336 CCACCTGCACTTTTAGGAAGAC 59.186 50.000 0.00 0.00 37.52 3.01
170 171 3.476552 CACCTGCACTTTTAGGAAGACA 58.523 45.455 0.00 0.00 37.52 3.41
171 172 4.074970 CACCTGCACTTTTAGGAAGACAT 58.925 43.478 0.00 0.00 37.52 3.06
172 173 5.245531 CACCTGCACTTTTAGGAAGACATA 58.754 41.667 0.00 0.00 37.52 2.29
173 174 5.122396 CACCTGCACTTTTAGGAAGACATAC 59.878 44.000 0.00 0.00 37.52 2.39
174 175 5.013183 ACCTGCACTTTTAGGAAGACATACT 59.987 40.000 0.00 0.00 37.52 2.12
175 176 5.940470 CCTGCACTTTTAGGAAGACATACTT 59.060 40.000 0.00 0.00 42.03 2.24
176 177 6.431234 CCTGCACTTTTAGGAAGACATACTTT 59.569 38.462 0.00 0.00 39.13 2.66
177 178 7.040409 CCTGCACTTTTAGGAAGACATACTTTT 60.040 37.037 0.00 0.00 39.13 2.27
178 179 8.232913 TGCACTTTTAGGAAGACATACTTTTT 57.767 30.769 0.00 0.00 39.13 1.94
179 180 8.349983 TGCACTTTTAGGAAGACATACTTTTTC 58.650 33.333 0.00 0.00 39.13 2.29
180 181 7.808381 GCACTTTTAGGAAGACATACTTTTTCC 59.192 37.037 0.00 0.00 39.13 3.13
181 182 8.297426 CACTTTTAGGAAGACATACTTTTTCCC 58.703 37.037 0.00 0.00 39.91 3.97
182 183 8.002459 ACTTTTAGGAAGACATACTTTTTCCCA 58.998 33.333 0.00 0.00 39.91 4.37
183 184 8.950007 TTTTAGGAAGACATACTTTTTCCCAT 57.050 30.769 0.00 0.00 39.91 4.00
184 185 8.950007 TTTAGGAAGACATACTTTTTCCCATT 57.050 30.769 0.00 0.00 39.91 3.16
185 186 8.950007 TTAGGAAGACATACTTTTTCCCATTT 57.050 30.769 0.00 0.00 39.91 2.32
186 187 7.855784 AGGAAGACATACTTTTTCCCATTTT 57.144 32.000 0.00 0.00 39.91 1.82
187 188 8.950007 AGGAAGACATACTTTTTCCCATTTTA 57.050 30.769 0.00 0.00 39.91 1.52
188 189 8.803235 AGGAAGACATACTTTTTCCCATTTTAC 58.197 33.333 0.00 0.00 39.91 2.01
189 190 8.581578 GGAAGACATACTTTTTCCCATTTTACA 58.418 33.333 0.00 0.00 39.13 2.41
190 191 9.974980 GAAGACATACTTTTTCCCATTTTACAA 57.025 29.630 0.00 0.00 39.13 2.41
191 192 9.981114 AAGACATACTTTTTCCCATTTTACAAG 57.019 29.630 0.00 0.00 34.94 3.16
192 193 8.585018 AGACATACTTTTTCCCATTTTACAAGG 58.415 33.333 0.00 0.00 0.00 3.61
193 194 7.158697 ACATACTTTTTCCCATTTTACAAGGC 58.841 34.615 0.00 0.00 0.00 4.35
194 195 5.622346 ACTTTTTCCCATTTTACAAGGCA 57.378 34.783 0.00 0.00 0.00 4.75
195 196 6.186420 ACTTTTTCCCATTTTACAAGGCAT 57.814 33.333 0.00 0.00 0.00 4.40
196 197 6.600388 ACTTTTTCCCATTTTACAAGGCATT 58.400 32.000 0.00 0.00 0.00 3.56
197 198 7.059788 ACTTTTTCCCATTTTACAAGGCATTT 58.940 30.769 0.00 0.00 0.00 2.32
198 199 7.559533 ACTTTTTCCCATTTTACAAGGCATTTT 59.440 29.630 0.00 0.00 0.00 1.82
199 200 8.980481 TTTTTCCCATTTTACAAGGCATTTTA 57.020 26.923 0.00 0.00 0.00 1.52
200 201 7.971183 TTTCCCATTTTACAAGGCATTTTAC 57.029 32.000 0.00 0.00 0.00 2.01
201 202 6.043854 TCCCATTTTACAAGGCATTTTACC 57.956 37.500 0.00 0.00 0.00 2.85
202 203 5.544176 TCCCATTTTACAAGGCATTTTACCA 59.456 36.000 0.00 0.00 0.00 3.25
203 204 6.214412 TCCCATTTTACAAGGCATTTTACCAT 59.786 34.615 0.00 0.00 0.00 3.55
204 205 6.315891 CCCATTTTACAAGGCATTTTACCATG 59.684 38.462 0.00 0.00 32.18 3.66
214 215 5.459110 GCATTTTACCATGCTTGTTGATG 57.541 39.130 0.00 0.00 45.35 3.07
215 216 4.201744 GCATTTTACCATGCTTGTTGATGC 60.202 41.667 0.00 4.05 45.35 3.91
216 217 3.591196 TTTACCATGCTTGTTGATGCC 57.409 42.857 0.00 0.00 0.00 4.40
217 218 1.473258 TACCATGCTTGTTGATGCCC 58.527 50.000 0.00 0.00 0.00 5.36
218 219 0.251922 ACCATGCTTGTTGATGCCCT 60.252 50.000 0.00 0.00 0.00 5.19
219 220 0.899720 CCATGCTTGTTGATGCCCTT 59.100 50.000 0.00 0.00 0.00 3.95
220 221 1.404986 CCATGCTTGTTGATGCCCTTG 60.405 52.381 0.00 0.00 0.00 3.61
221 222 0.248289 ATGCTTGTTGATGCCCTTGC 59.752 50.000 0.00 0.00 38.26 4.01
222 223 1.079612 GCTTGTTGATGCCCTTGCC 60.080 57.895 0.00 0.00 36.33 4.52
223 224 1.818959 GCTTGTTGATGCCCTTGCCA 61.819 55.000 0.00 0.00 36.33 4.92
224 225 0.899720 CTTGTTGATGCCCTTGCCAT 59.100 50.000 0.00 0.00 36.33 4.40
225 226 2.101783 CTTGTTGATGCCCTTGCCATA 58.898 47.619 0.00 0.00 36.33 2.74
226 227 1.473258 TGTTGATGCCCTTGCCATAC 58.527 50.000 0.00 0.00 36.33 2.39
227 228 0.746659 GTTGATGCCCTTGCCATACC 59.253 55.000 0.00 0.00 36.33 2.73
228 229 0.334335 TTGATGCCCTTGCCATACCA 59.666 50.000 0.00 0.00 36.33 3.25
229 230 0.106569 TGATGCCCTTGCCATACCAG 60.107 55.000 0.00 0.00 36.33 4.00
230 231 0.183492 GATGCCCTTGCCATACCAGA 59.817 55.000 0.00 0.00 36.33 3.86
231 232 0.184451 ATGCCCTTGCCATACCAGAG 59.816 55.000 0.00 0.00 36.33 3.35
232 233 1.152881 GCCCTTGCCATACCAGAGG 60.153 63.158 0.00 0.00 0.00 3.69
233 234 1.635817 GCCCTTGCCATACCAGAGGA 61.636 60.000 0.00 0.00 0.00 3.71
234 235 0.918983 CCCTTGCCATACCAGAGGAA 59.081 55.000 0.00 0.00 0.00 3.36
235 236 1.284785 CCCTTGCCATACCAGAGGAAA 59.715 52.381 0.00 0.00 0.00 3.13
236 237 2.369394 CCTTGCCATACCAGAGGAAAC 58.631 52.381 0.00 0.00 0.00 2.78
238 239 3.562176 CCTTGCCATACCAGAGGAAACTT 60.562 47.826 0.00 0.00 44.43 2.66
239 240 3.350219 TGCCATACCAGAGGAAACTTC 57.650 47.619 0.00 0.00 44.43 3.01
240 241 2.912956 TGCCATACCAGAGGAAACTTCT 59.087 45.455 0.00 0.00 44.43 2.85
241 242 3.330701 TGCCATACCAGAGGAAACTTCTT 59.669 43.478 0.00 0.00 44.43 2.52
242 243 4.534500 TGCCATACCAGAGGAAACTTCTTA 59.466 41.667 0.00 0.00 44.43 2.10
243 244 5.191722 TGCCATACCAGAGGAAACTTCTTAT 59.808 40.000 0.00 0.00 44.43 1.73
244 245 6.385759 TGCCATACCAGAGGAAACTTCTTATA 59.614 38.462 0.00 0.00 44.43 0.98
245 246 6.931840 GCCATACCAGAGGAAACTTCTTATAG 59.068 42.308 0.00 0.00 44.43 1.31
246 247 7.202011 GCCATACCAGAGGAAACTTCTTATAGA 60.202 40.741 0.00 0.00 44.43 1.98
247 248 8.875168 CCATACCAGAGGAAACTTCTTATAGAT 58.125 37.037 0.00 0.00 44.43 1.98
251 252 9.674068 ACCAGAGGAAACTTCTTATAGATTTTC 57.326 33.333 0.00 0.00 44.43 2.29
252 253 9.114952 CCAGAGGAAACTTCTTATAGATTTTCC 57.885 37.037 15.77 15.77 44.43 3.13
253 254 9.672673 CAGAGGAAACTTCTTATAGATTTTCCA 57.327 33.333 20.98 0.00 42.98 3.53
285 286 7.636150 CAAGAATTGTAAATGGGACTCTGAT 57.364 36.000 0.00 0.00 42.34 2.90
286 287 7.478322 CAAGAATTGTAAATGGGACTCTGATG 58.522 38.462 0.00 0.00 42.34 3.07
287 288 5.591877 AGAATTGTAAATGGGACTCTGATGC 59.408 40.000 0.00 0.00 0.00 3.91
288 289 3.998913 TGTAAATGGGACTCTGATGCA 57.001 42.857 0.00 0.00 0.00 3.96
289 290 4.299586 TGTAAATGGGACTCTGATGCAA 57.700 40.909 0.00 0.00 0.00 4.08
290 291 4.009675 TGTAAATGGGACTCTGATGCAAC 58.990 43.478 0.00 0.00 0.00 4.17
291 292 2.885135 AATGGGACTCTGATGCAACA 57.115 45.000 0.00 0.00 0.00 3.33
292 293 2.119801 ATGGGACTCTGATGCAACAC 57.880 50.000 0.00 0.00 0.00 3.32
293 294 0.764271 TGGGACTCTGATGCAACACA 59.236 50.000 0.00 0.00 0.00 3.72
294 295 1.352017 TGGGACTCTGATGCAACACAT 59.648 47.619 0.00 0.00 43.54 3.21
295 296 2.224843 TGGGACTCTGATGCAACACATT 60.225 45.455 0.00 0.00 39.84 2.71
296 297 2.163010 GGGACTCTGATGCAACACATTG 59.837 50.000 0.00 0.00 39.84 2.82
307 308 3.316071 CAACACATTGCTATTTGGCCA 57.684 42.857 0.00 0.00 0.00 5.36
308 309 2.995258 CAACACATTGCTATTTGGCCAC 59.005 45.455 3.88 0.00 0.00 5.01
309 310 1.202114 ACACATTGCTATTTGGCCACG 59.798 47.619 3.88 0.00 0.00 4.94
310 311 1.472082 CACATTGCTATTTGGCCACGA 59.528 47.619 3.88 0.00 0.00 4.35
311 312 2.099592 CACATTGCTATTTGGCCACGAT 59.900 45.455 3.88 5.33 0.00 3.73
312 313 2.760092 ACATTGCTATTTGGCCACGATT 59.240 40.909 3.88 0.00 0.00 3.34
313 314 3.951037 ACATTGCTATTTGGCCACGATTA 59.049 39.130 3.88 0.00 0.00 1.75
314 315 4.584325 ACATTGCTATTTGGCCACGATTAT 59.416 37.500 3.88 0.00 0.00 1.28
315 316 5.068987 ACATTGCTATTTGGCCACGATTATT 59.931 36.000 3.88 0.00 0.00 1.40
316 317 5.590530 TTGCTATTTGGCCACGATTATTT 57.409 34.783 3.88 0.00 0.00 1.40
317 318 4.930963 TGCTATTTGGCCACGATTATTTG 58.069 39.130 3.88 0.00 0.00 2.32
318 319 4.202101 TGCTATTTGGCCACGATTATTTGG 60.202 41.667 3.88 0.00 35.81 3.28
319 320 3.817709 ATTTGGCCACGATTATTTGGG 57.182 42.857 3.88 0.00 33.01 4.12
320 321 2.516227 TTGGCCACGATTATTTGGGA 57.484 45.000 3.88 0.00 33.01 4.37
321 322 2.746279 TGGCCACGATTATTTGGGAT 57.254 45.000 0.00 0.00 33.01 3.85
322 323 3.025322 TGGCCACGATTATTTGGGATT 57.975 42.857 0.00 0.00 33.01 3.01
323 324 4.171878 TGGCCACGATTATTTGGGATTA 57.828 40.909 0.00 0.00 33.01 1.75
324 325 3.886505 TGGCCACGATTATTTGGGATTAC 59.113 43.478 0.00 0.00 33.01 1.89
325 326 4.142038 GGCCACGATTATTTGGGATTACT 58.858 43.478 0.00 0.00 33.01 2.24
326 327 5.163184 TGGCCACGATTATTTGGGATTACTA 60.163 40.000 0.00 0.00 33.01 1.82
327 328 5.944007 GGCCACGATTATTTGGGATTACTAT 59.056 40.000 0.00 0.00 33.01 2.12
328 329 6.433093 GGCCACGATTATTTGGGATTACTATT 59.567 38.462 0.00 0.00 33.01 1.73
329 330 7.039993 GGCCACGATTATTTGGGATTACTATTT 60.040 37.037 0.00 0.00 33.01 1.40
330 331 9.005777 GCCACGATTATTTGGGATTACTATTTA 57.994 33.333 0.00 0.00 33.01 1.40
364 365 7.768807 AATAAGTACATTTACTGTTTGGCCA 57.231 32.000 0.00 0.00 38.65 5.36
365 366 7.954666 ATAAGTACATTTACTGTTTGGCCAT 57.045 32.000 6.09 0.00 38.65 4.40
366 367 5.643379 AGTACATTTACTGTTTGGCCATG 57.357 39.130 6.09 0.00 37.15 3.66
367 368 5.321102 AGTACATTTACTGTTTGGCCATGA 58.679 37.500 6.09 0.00 37.15 3.07
368 369 5.951747 AGTACATTTACTGTTTGGCCATGAT 59.048 36.000 6.09 0.00 37.15 2.45
369 370 5.743636 ACATTTACTGTTTGGCCATGATT 57.256 34.783 6.09 0.00 32.90 2.57
370 371 6.849085 ACATTTACTGTTTGGCCATGATTA 57.151 33.333 6.09 0.00 32.90 1.75
371 372 6.630071 ACATTTACTGTTTGGCCATGATTAC 58.370 36.000 6.09 0.62 32.90 1.89
372 373 6.437162 ACATTTACTGTTTGGCCATGATTACT 59.563 34.615 6.09 0.00 32.90 2.24
373 374 6.509418 TTTACTGTTTGGCCATGATTACTC 57.491 37.500 6.09 0.00 0.00 2.59
374 375 4.307032 ACTGTTTGGCCATGATTACTCT 57.693 40.909 6.09 0.00 0.00 3.24
375 376 4.666512 ACTGTTTGGCCATGATTACTCTT 58.333 39.130 6.09 0.00 0.00 2.85
376 377 4.702131 ACTGTTTGGCCATGATTACTCTTC 59.298 41.667 6.09 0.00 0.00 2.87
377 378 3.689161 TGTTTGGCCATGATTACTCTTCG 59.311 43.478 6.09 0.00 0.00 3.79
378 379 3.627395 TTGGCCATGATTACTCTTCGT 57.373 42.857 6.09 0.00 0.00 3.85
379 380 2.905075 TGGCCATGATTACTCTTCGTG 58.095 47.619 0.00 0.00 0.00 4.35
386 387 6.040962 CATGATTACTCTTCGTGGACATTG 57.959 41.667 0.00 0.00 0.00 2.82
387 388 5.147330 TGATTACTCTTCGTGGACATTGT 57.853 39.130 0.00 0.00 0.00 2.71
388 389 5.547465 TGATTACTCTTCGTGGACATTGTT 58.453 37.500 0.00 0.00 0.00 2.83
389 390 5.637810 TGATTACTCTTCGTGGACATTGTTC 59.362 40.000 0.00 0.00 0.00 3.18
390 391 3.469008 ACTCTTCGTGGACATTGTTCA 57.531 42.857 0.00 0.00 0.00 3.18
391 392 3.131396 ACTCTTCGTGGACATTGTTCAC 58.869 45.455 16.90 16.90 38.58 3.18
392 393 3.181465 ACTCTTCGTGGACATTGTTCACT 60.181 43.478 22.66 3.51 39.70 3.41
393 394 3.804036 TCTTCGTGGACATTGTTCACTT 58.196 40.909 22.66 0.00 39.70 3.16
394 395 3.559655 TCTTCGTGGACATTGTTCACTTG 59.440 43.478 22.66 13.63 39.70 3.16
395 396 1.601903 TCGTGGACATTGTTCACTTGC 59.398 47.619 22.66 0.63 39.70 4.01
396 397 1.334960 CGTGGACATTGTTCACTTGCC 60.335 52.381 22.66 4.36 39.70 4.52
397 398 1.680735 GTGGACATTGTTCACTTGCCA 59.319 47.619 19.12 4.21 38.86 4.92
398 399 2.297033 GTGGACATTGTTCACTTGCCAT 59.703 45.455 19.12 0.00 38.86 4.40
399 400 2.296752 TGGACATTGTTCACTTGCCATG 59.703 45.455 0.00 0.00 0.00 3.66
400 401 2.297033 GGACATTGTTCACTTGCCATGT 59.703 45.455 0.00 0.00 0.00 3.21
401 402 3.311106 GACATTGTTCACTTGCCATGTG 58.689 45.455 4.43 4.43 36.82 3.21
402 403 2.694628 ACATTGTTCACTTGCCATGTGT 59.305 40.909 10.15 0.00 36.83 3.72
403 404 3.243501 ACATTGTTCACTTGCCATGTGTC 60.244 43.478 10.15 6.27 36.83 3.67
404 405 2.049888 TGTTCACTTGCCATGTGTCA 57.950 45.000 10.15 8.36 36.83 3.58
405 406 2.373224 TGTTCACTTGCCATGTGTCAA 58.627 42.857 10.15 0.00 36.83 3.18
406 407 2.957680 TGTTCACTTGCCATGTGTCAAT 59.042 40.909 10.15 0.00 36.83 2.57
407 408 3.384146 TGTTCACTTGCCATGTGTCAATT 59.616 39.130 10.15 0.00 36.83 2.32
408 409 4.141981 TGTTCACTTGCCATGTGTCAATTT 60.142 37.500 10.15 0.00 36.83 1.82
409 410 4.241590 TCACTTGCCATGTGTCAATTTC 57.758 40.909 10.15 0.00 36.83 2.17
410 411 3.635836 TCACTTGCCATGTGTCAATTTCA 59.364 39.130 10.15 0.00 36.83 2.69
411 412 3.985279 CACTTGCCATGTGTCAATTTCAG 59.015 43.478 2.71 0.00 0.00 3.02
412 413 3.890756 ACTTGCCATGTGTCAATTTCAGA 59.109 39.130 0.00 0.00 0.00 3.27
413 414 4.341806 ACTTGCCATGTGTCAATTTCAGAA 59.658 37.500 0.00 0.00 0.00 3.02
414 415 4.933505 TGCCATGTGTCAATTTCAGAAA 57.066 36.364 0.00 0.00 0.00 2.52
415 416 4.873817 TGCCATGTGTCAATTTCAGAAAG 58.126 39.130 1.28 0.00 0.00 2.62
416 417 3.676646 GCCATGTGTCAATTTCAGAAAGC 59.323 43.478 1.28 0.00 0.00 3.51
417 418 4.796946 GCCATGTGTCAATTTCAGAAAGCA 60.797 41.667 1.28 0.00 0.00 3.91
418 419 4.682860 CCATGTGTCAATTTCAGAAAGCAC 59.317 41.667 1.28 8.28 0.00 4.40
419 420 5.508489 CCATGTGTCAATTTCAGAAAGCACT 60.508 40.000 16.62 6.56 0.00 4.40
420 421 5.581126 TGTGTCAATTTCAGAAAGCACTT 57.419 34.783 16.62 0.86 0.00 3.16
421 422 5.342433 TGTGTCAATTTCAGAAAGCACTTG 58.658 37.500 16.62 10.46 0.00 3.16
422 423 5.125257 TGTGTCAATTTCAGAAAGCACTTGA 59.875 36.000 16.62 12.02 0.00 3.02
423 424 6.035843 GTGTCAATTTCAGAAAGCACTTGAA 58.964 36.000 10.06 1.76 0.00 2.69
424 425 6.698766 GTGTCAATTTCAGAAAGCACTTGAAT 59.301 34.615 10.06 0.00 0.00 2.57
425 426 7.223387 GTGTCAATTTCAGAAAGCACTTGAATT 59.777 33.333 10.06 0.00 0.00 2.17
426 427 7.765360 TGTCAATTTCAGAAAGCACTTGAATTT 59.235 29.630 10.06 0.00 0.00 1.82
427 428 8.606602 GTCAATTTCAGAAAGCACTTGAATTTT 58.393 29.630 10.06 0.00 0.00 1.82
428 429 9.165035 TCAATTTCAGAAAGCACTTGAATTTTT 57.835 25.926 7.05 0.00 0.00 1.94
446 447 2.615986 TTTTTAAAGGAGGGAGCCCC 57.384 50.000 0.91 2.16 45.90 5.80
460 461 2.123425 CCCCTAGCTGAGCGGGTA 60.123 66.667 15.01 0.00 36.18 3.69
461 462 1.534235 CCCCTAGCTGAGCGGGTAT 60.534 63.158 15.01 0.00 36.18 2.73
462 463 0.251653 CCCCTAGCTGAGCGGGTATA 60.252 60.000 15.01 0.00 36.18 1.47
463 464 1.629043 CCCTAGCTGAGCGGGTATAA 58.371 55.000 15.75 0.00 33.16 0.98
464 465 2.180276 CCCTAGCTGAGCGGGTATAAT 58.820 52.381 15.75 0.00 33.16 1.28
465 466 3.362706 CCCTAGCTGAGCGGGTATAATA 58.637 50.000 15.75 0.00 33.16 0.98
466 467 3.961408 CCCTAGCTGAGCGGGTATAATAT 59.039 47.826 15.75 0.00 33.16 1.28
467 468 5.138276 CCCTAGCTGAGCGGGTATAATATA 58.862 45.833 15.75 0.00 33.16 0.86
468 469 5.241949 CCCTAGCTGAGCGGGTATAATATAG 59.758 48.000 15.75 1.88 33.16 1.31
469 470 5.828859 CCTAGCTGAGCGGGTATAATATAGT 59.171 44.000 10.48 0.00 0.00 2.12
470 471 6.996879 CCTAGCTGAGCGGGTATAATATAGTA 59.003 42.308 10.48 0.00 0.00 1.82
471 472 6.696441 AGCTGAGCGGGTATAATATAGTAC 57.304 41.667 0.00 0.00 0.00 2.73
472 473 6.424883 AGCTGAGCGGGTATAATATAGTACT 58.575 40.000 0.00 0.00 0.00 2.73
473 474 6.543100 AGCTGAGCGGGTATAATATAGTACTC 59.457 42.308 0.00 0.00 0.00 2.59
474 475 6.238703 GCTGAGCGGGTATAATATAGTACTCC 60.239 46.154 0.00 0.00 0.00 3.85
475 476 6.125029 TGAGCGGGTATAATATAGTACTCCC 58.875 44.000 0.00 0.00 0.00 4.30
476 477 6.069206 TGAGCGGGTATAATATAGTACTCCCT 60.069 42.308 0.00 1.65 0.00 4.20
477 478 7.127801 TGAGCGGGTATAATATAGTACTCCCTA 59.872 40.741 0.00 0.00 0.00 3.53
478 479 8.054931 AGCGGGTATAATATAGTACTCCCTAT 57.945 38.462 0.00 0.00 0.00 2.57
479 480 7.943447 AGCGGGTATAATATAGTACTCCCTATG 59.057 40.741 0.00 5.75 0.00 2.23
480 481 7.309073 GCGGGTATAATATAGTACTCCCTATGC 60.309 44.444 0.00 9.99 0.00 3.14
481 482 7.943447 CGGGTATAATATAGTACTCCCTATGCT 59.057 40.741 0.00 0.00 0.00 3.79
482 483 9.657728 GGGTATAATATAGTACTCCCTATGCTT 57.342 37.037 0.00 0.00 0.00 3.91
494 495 9.708092 GTACTCCCTATGCTTACTTTTATAAGG 57.292 37.037 0.00 0.00 35.61 2.69
495 496 8.333226 ACTCCCTATGCTTACTTTTATAAGGT 57.667 34.615 0.00 0.00 35.61 3.50
496 497 8.211629 ACTCCCTATGCTTACTTTTATAAGGTG 58.788 37.037 0.00 0.00 35.61 4.00
497 498 8.097791 TCCCTATGCTTACTTTTATAAGGTGT 57.902 34.615 0.00 0.00 35.61 4.16
498 499 8.554011 TCCCTATGCTTACTTTTATAAGGTGTT 58.446 33.333 0.00 0.00 35.61 3.32
499 500 8.621286 CCCTATGCTTACTTTTATAAGGTGTTG 58.379 37.037 0.00 0.00 35.61 3.33
500 501 9.174166 CCTATGCTTACTTTTATAAGGTGTTGT 57.826 33.333 0.00 0.00 35.61 3.32
503 504 9.953565 ATGCTTACTTTTATAAGGTGTTGTAGA 57.046 29.630 0.00 0.00 35.61 2.59
504 505 9.211485 TGCTTACTTTTATAAGGTGTTGTAGAC 57.789 33.333 0.00 0.00 35.61 2.59
505 506 9.211485 GCTTACTTTTATAAGGTGTTGTAGACA 57.789 33.333 0.00 0.00 35.61 3.41
515 516 7.730364 AAGGTGTTGTAGACATTTTAGACAG 57.270 36.000 0.00 0.00 41.10 3.51
516 517 5.701290 AGGTGTTGTAGACATTTTAGACAGC 59.299 40.000 4.67 4.67 41.10 4.40
517 518 5.389516 GGTGTTGTAGACATTTTAGACAGCG 60.390 44.000 0.00 0.00 41.10 5.18
518 519 5.176958 GTGTTGTAGACATTTTAGACAGCGT 59.823 40.000 0.00 0.00 41.10 5.07
519 520 5.176774 TGTTGTAGACATTTTAGACAGCGTG 59.823 40.000 0.00 0.00 32.00 5.34
520 521 4.878439 TGTAGACATTTTAGACAGCGTGT 58.122 39.130 0.00 0.00 0.00 4.49
521 522 6.016213 TGTAGACATTTTAGACAGCGTGTA 57.984 37.500 0.00 0.00 0.00 2.90
522 523 6.448852 TGTAGACATTTTAGACAGCGTGTAA 58.551 36.000 0.00 0.00 0.00 2.41
523 524 6.924612 TGTAGACATTTTAGACAGCGTGTAAA 59.075 34.615 6.84 6.84 31.16 2.01
524 525 6.854496 AGACATTTTAGACAGCGTGTAAAA 57.146 33.333 18.48 18.48 42.42 1.52
525 526 6.656003 AGACATTTTAGACAGCGTGTAAAAC 58.344 36.000 18.52 10.97 41.56 2.43
526 527 5.754778 ACATTTTAGACAGCGTGTAAAACC 58.245 37.500 18.52 0.00 41.56 3.27
527 528 4.455917 TTTTAGACAGCGTGTAAAACCG 57.544 40.909 14.83 0.00 36.71 4.44
534 535 2.325509 GCGTGTAAAACCGCTCAATT 57.674 45.000 0.00 0.00 46.08 2.32
535 536 2.657184 GCGTGTAAAACCGCTCAATTT 58.343 42.857 0.00 0.00 46.08 1.82
536 537 2.655001 GCGTGTAAAACCGCTCAATTTC 59.345 45.455 0.00 0.00 46.08 2.17
537 538 3.850374 GCGTGTAAAACCGCTCAATTTCA 60.850 43.478 0.00 0.00 46.08 2.69
538 539 4.472286 CGTGTAAAACCGCTCAATTTCAT 58.528 39.130 0.00 0.00 0.00 2.57
539 540 4.915085 CGTGTAAAACCGCTCAATTTCATT 59.085 37.500 0.00 0.00 0.00 2.57
540 541 5.401079 CGTGTAAAACCGCTCAATTTCATTT 59.599 36.000 0.00 0.00 0.00 2.32
541 542 6.580476 GTGTAAAACCGCTCAATTTCATTTG 58.420 36.000 0.00 0.00 0.00 2.32
542 543 6.200097 GTGTAAAACCGCTCAATTTCATTTGT 59.800 34.615 0.00 0.00 0.00 2.83
543 544 5.905480 AAAACCGCTCAATTTCATTTGTC 57.095 34.783 0.00 0.00 0.00 3.18
544 545 4.853924 AACCGCTCAATTTCATTTGTCT 57.146 36.364 0.00 0.00 0.00 3.41
545 546 4.164822 ACCGCTCAATTTCATTTGTCTG 57.835 40.909 0.00 0.00 0.00 3.51
546 547 3.820467 ACCGCTCAATTTCATTTGTCTGA 59.180 39.130 0.00 0.00 0.00 3.27
547 548 4.278170 ACCGCTCAATTTCATTTGTCTGAA 59.722 37.500 0.00 0.00 33.42 3.02
548 549 5.221224 ACCGCTCAATTTCATTTGTCTGAAA 60.221 36.000 2.11 2.11 46.13 2.69
549 550 5.117592 CCGCTCAATTTCATTTGTCTGAAAC 59.882 40.000 1.68 0.00 45.21 2.78
550 551 5.164254 CGCTCAATTTCATTTGTCTGAAACG 60.164 40.000 1.68 0.00 45.21 3.60
551 552 5.914635 GCTCAATTTCATTTGTCTGAAACGA 59.085 36.000 1.68 2.14 45.21 3.85
552 553 6.129352 GCTCAATTTCATTTGTCTGAAACGAC 60.129 38.462 1.68 0.00 45.21 4.34
553 554 7.026631 TCAATTTCATTTGTCTGAAACGACT 57.973 32.000 1.68 0.00 45.21 4.18
554 555 7.479980 TCAATTTCATTTGTCTGAAACGACTT 58.520 30.769 1.68 0.00 45.21 3.01
555 556 8.616942 TCAATTTCATTTGTCTGAAACGACTTA 58.383 29.630 1.68 0.00 45.21 2.24
556 557 9.398170 CAATTTCATTTGTCTGAAACGACTTAT 57.602 29.630 1.68 0.00 45.21 1.73
563 564 9.878599 ATTTGTCTGAAACGACTTATAAAAGTG 57.121 29.630 0.00 0.00 46.09 3.16
564 565 8.651391 TTGTCTGAAACGACTTATAAAAGTGA 57.349 30.769 0.00 0.00 46.09 3.41
565 566 8.651391 TGTCTGAAACGACTTATAAAAGTGAA 57.349 30.769 0.00 0.00 46.09 3.18
566 567 8.545420 TGTCTGAAACGACTTATAAAAGTGAAC 58.455 33.333 0.00 0.00 46.09 3.18
567 568 7.734726 GTCTGAAACGACTTATAAAAGTGAACG 59.265 37.037 0.00 0.00 46.09 3.95
568 569 6.879962 TGAAACGACTTATAAAAGTGAACGG 58.120 36.000 0.00 0.00 46.09 4.44
569 570 6.700960 TGAAACGACTTATAAAAGTGAACGGA 59.299 34.615 0.00 0.00 46.09 4.69
570 571 6.701432 AACGACTTATAAAAGTGAACGGAG 57.299 37.500 0.00 0.00 46.09 4.63
571 572 5.166398 ACGACTTATAAAAGTGAACGGAGG 58.834 41.667 0.00 0.00 46.09 4.30
572 573 4.565564 CGACTTATAAAAGTGAACGGAGGG 59.434 45.833 0.00 0.00 46.09 4.30
573 574 5.622914 CGACTTATAAAAGTGAACGGAGGGA 60.623 44.000 0.00 0.00 46.09 4.20
574 575 5.731591 ACTTATAAAAGTGAACGGAGGGAG 58.268 41.667 0.00 0.00 44.40 4.30
575 576 5.247792 ACTTATAAAAGTGAACGGAGGGAGT 59.752 40.000 0.00 0.00 44.40 3.85
576 577 6.438425 ACTTATAAAAGTGAACGGAGGGAGTA 59.562 38.462 0.00 0.00 44.40 2.59
577 578 3.679824 AAAAGTGAACGGAGGGAGTAG 57.320 47.619 0.00 0.00 0.00 2.57
578 579 2.305858 AAGTGAACGGAGGGAGTAGT 57.694 50.000 0.00 0.00 0.00 2.73
579 580 3.446442 AAGTGAACGGAGGGAGTAGTA 57.554 47.619 0.00 0.00 0.00 1.82
580 581 3.666345 AGTGAACGGAGGGAGTAGTAT 57.334 47.619 0.00 0.00 0.00 2.12
581 582 4.785346 AGTGAACGGAGGGAGTAGTATA 57.215 45.455 0.00 0.00 0.00 1.47
582 583 5.321934 AGTGAACGGAGGGAGTAGTATAT 57.678 43.478 0.00 0.00 0.00 0.86
583 584 6.445451 AGTGAACGGAGGGAGTAGTATATA 57.555 41.667 0.00 0.00 0.00 0.86
584 585 7.030234 AGTGAACGGAGGGAGTAGTATATAT 57.970 40.000 0.00 0.00 0.00 0.86
585 586 6.885376 AGTGAACGGAGGGAGTAGTATATATG 59.115 42.308 0.00 0.00 0.00 1.78
586 587 5.651139 TGAACGGAGGGAGTAGTATATATGC 59.349 44.000 0.00 0.00 0.00 3.14
587 588 4.534797 ACGGAGGGAGTAGTATATATGCC 58.465 47.826 0.00 0.00 0.00 4.40
588 589 3.564644 CGGAGGGAGTAGTATATATGCCG 59.435 52.174 0.00 0.00 0.00 5.69
589 590 4.685302 CGGAGGGAGTAGTATATATGCCGA 60.685 50.000 0.00 0.00 36.21 5.54
590 591 5.198965 GGAGGGAGTAGTATATATGCCGAA 58.801 45.833 0.00 0.00 0.00 4.30
591 592 5.655532 GGAGGGAGTAGTATATATGCCGAAA 59.344 44.000 0.00 0.00 0.00 3.46
592 593 6.154021 GGAGGGAGTAGTATATATGCCGAAAA 59.846 42.308 0.00 0.00 0.00 2.29
593 594 7.147707 GGAGGGAGTAGTATATATGCCGAAAAT 60.148 40.741 0.00 0.00 0.00 1.82
594 595 7.556844 AGGGAGTAGTATATATGCCGAAAATG 58.443 38.462 0.00 0.00 0.00 2.32
595 596 7.180408 AGGGAGTAGTATATATGCCGAAAATGT 59.820 37.037 0.00 0.00 0.00 2.71
596 597 8.472413 GGGAGTAGTATATATGCCGAAAATGTA 58.528 37.037 0.00 0.00 0.00 2.29
597 598 9.865321 GGAGTAGTATATATGCCGAAAATGTAA 57.135 33.333 0.00 0.00 0.00 2.41
611 612 7.358450 CGAAAATGTAATAAATTTCGTCCGG 57.642 36.000 10.37 0.00 45.32 5.14
612 613 6.962678 CGAAAATGTAATAAATTTCGTCCGGT 59.037 34.615 0.00 0.00 45.32 5.28
613 614 7.482428 CGAAAATGTAATAAATTTCGTCCGGTT 59.518 33.333 0.00 0.00 45.32 4.44
614 615 9.131416 GAAAATGTAATAAATTTCGTCCGGTTT 57.869 29.630 0.00 0.00 0.00 3.27
625 626 6.607735 TTTCGTCCGGTTTATATGAAATCC 57.392 37.500 0.00 0.00 0.00 3.01
626 627 5.279255 TCGTCCGGTTTATATGAAATCCA 57.721 39.130 0.00 0.00 0.00 3.41
627 628 5.051816 TCGTCCGGTTTATATGAAATCCAC 58.948 41.667 0.00 0.00 0.00 4.02
628 629 5.054477 CGTCCGGTTTATATGAAATCCACT 58.946 41.667 0.00 0.00 0.00 4.00
629 630 5.050363 CGTCCGGTTTATATGAAATCCACTG 60.050 44.000 0.00 0.00 0.00 3.66
630 631 5.238650 GTCCGGTTTATATGAAATCCACTGG 59.761 44.000 0.00 0.00 0.00 4.00
631 632 5.104277 TCCGGTTTATATGAAATCCACTGGT 60.104 40.000 0.00 0.00 32.01 4.00
632 633 5.592688 CCGGTTTATATGAAATCCACTGGTT 59.407 40.000 0.00 0.00 0.00 3.67
633 634 6.096282 CCGGTTTATATGAAATCCACTGGTTT 59.904 38.462 0.00 0.00 0.00 3.27
634 635 6.972328 CGGTTTATATGAAATCCACTGGTTTG 59.028 38.462 0.00 0.00 0.00 2.93
635 636 6.756542 GGTTTATATGAAATCCACTGGTTTGC 59.243 38.462 0.00 0.00 0.00 3.68
636 637 7.319646 GTTTATATGAAATCCACTGGTTTGCA 58.680 34.615 2.46 2.46 0.00 4.08
637 638 7.658525 TTATATGAAATCCACTGGTTTGCAT 57.341 32.000 14.50 14.50 35.50 3.96
638 639 3.663995 TGAAATCCACTGGTTTGCATG 57.336 42.857 0.00 0.00 0.00 4.06
639 640 3.229293 TGAAATCCACTGGTTTGCATGA 58.771 40.909 0.00 0.00 0.00 3.07
640 641 3.640498 TGAAATCCACTGGTTTGCATGAA 59.360 39.130 0.00 0.00 0.00 2.57
641 642 4.100653 TGAAATCCACTGGTTTGCATGAAA 59.899 37.500 0.00 0.00 0.00 2.69
642 643 4.895668 AATCCACTGGTTTGCATGAAAT 57.104 36.364 0.00 0.00 0.00 2.17
643 644 4.895668 ATCCACTGGTTTGCATGAAATT 57.104 36.364 0.00 0.00 0.00 1.82
644 645 4.255833 TCCACTGGTTTGCATGAAATTC 57.744 40.909 0.00 0.00 0.00 2.17
645 646 3.640498 TCCACTGGTTTGCATGAAATTCA 59.360 39.130 0.00 0.00 0.00 2.57
646 647 4.283978 TCCACTGGTTTGCATGAAATTCAT 59.716 37.500 2.07 2.07 37.65 2.57
647 648 4.998672 CCACTGGTTTGCATGAAATTCATT 59.001 37.500 5.63 0.00 34.28 2.57
648 649 5.121142 CCACTGGTTTGCATGAAATTCATTC 59.879 40.000 5.63 1.93 34.28 2.67
649 650 4.925054 ACTGGTTTGCATGAAATTCATTCG 59.075 37.500 5.63 0.00 41.18 3.34
650 651 5.131594 TGGTTTGCATGAAATTCATTCGA 57.868 34.783 5.63 0.00 41.18 3.71
651 652 5.722263 TGGTTTGCATGAAATTCATTCGAT 58.278 33.333 5.63 0.00 41.18 3.59
652 653 6.164876 TGGTTTGCATGAAATTCATTCGATT 58.835 32.000 5.63 0.00 41.18 3.34
653 654 6.649973 TGGTTTGCATGAAATTCATTCGATTT 59.350 30.769 5.63 0.00 41.18 2.17
654 655 7.172875 TGGTTTGCATGAAATTCATTCGATTTT 59.827 29.630 5.63 0.00 41.18 1.82
655 656 8.655092 GGTTTGCATGAAATTCATTCGATTTTA 58.345 29.630 5.63 0.00 41.18 1.52
659 660 9.583765 TGCATGAAATTCATTCGATTTTATTGA 57.416 25.926 5.63 0.00 41.18 2.57
681 682 7.159437 TGAAAAAGTGTTTGAAATGTATGCG 57.841 32.000 0.00 0.00 0.00 4.73
682 683 5.574815 AAAAGTGTTTGAAATGTATGCGC 57.425 34.783 0.00 0.00 0.00 6.09
683 684 2.850321 AGTGTTTGAAATGTATGCGCG 58.150 42.857 0.00 0.00 0.00 6.86
684 685 1.317319 GTGTTTGAAATGTATGCGCGC 59.683 47.619 27.26 27.26 0.00 6.86
685 686 1.068954 TGTTTGAAATGTATGCGCGCA 60.069 42.857 38.27 38.27 0.00 6.09
686 687 1.578915 GTTTGAAATGTATGCGCGCAG 59.421 47.619 38.44 0.72 0.00 5.18
708 709 3.249189 GGATGGCCGCCTCCCATA 61.249 66.667 11.61 0.00 42.94 2.74
709 710 2.606587 GGATGGCCGCCTCCCATAT 61.607 63.158 11.61 0.00 42.94 1.78
710 711 1.078143 GATGGCCGCCTCCCATATC 60.078 63.158 11.61 0.00 42.94 1.63
711 712 2.859273 GATGGCCGCCTCCCATATCG 62.859 65.000 11.61 0.00 42.94 2.92
712 713 4.394712 GGCCGCCTCCCATATCGG 62.395 72.222 0.71 0.00 44.29 4.18
713 714 3.311110 GCCGCCTCCCATATCGGA 61.311 66.667 3.51 0.00 44.23 4.55
714 715 2.660064 GCCGCCTCCCATATCGGAT 61.660 63.158 3.51 0.00 44.23 4.18
715 716 1.327690 GCCGCCTCCCATATCGGATA 61.328 60.000 0.00 0.00 44.23 2.59
716 717 0.460311 CCGCCTCCCATATCGGATAC 59.540 60.000 0.00 0.00 44.23 2.24
717 718 0.460311 CGCCTCCCATATCGGATACC 59.540 60.000 0.00 0.00 36.56 2.73
737 738 3.623848 GGGGGAATTTTGGTGTTGC 57.376 52.632 0.00 0.00 0.00 4.17
738 739 0.036164 GGGGGAATTTTGGTGTTGCC 59.964 55.000 0.00 0.00 35.34 4.52
739 740 0.320334 GGGGAATTTTGGTGTTGCCG 60.320 55.000 0.00 0.00 41.21 5.69
740 741 0.391228 GGGAATTTTGGTGTTGCCGT 59.609 50.000 0.00 0.00 41.21 5.68
741 742 1.202592 GGGAATTTTGGTGTTGCCGTT 60.203 47.619 0.00 0.00 41.21 4.44
742 743 1.864082 GGAATTTTGGTGTTGCCGTTG 59.136 47.619 0.00 0.00 41.21 4.10
743 744 1.864082 GAATTTTGGTGTTGCCGTTGG 59.136 47.619 0.00 0.00 41.21 3.77
744 745 1.115467 ATTTTGGTGTTGCCGTTGGA 58.885 45.000 0.00 0.00 41.21 3.53
745 746 0.457851 TTTTGGTGTTGCCGTTGGAG 59.542 50.000 0.00 0.00 41.21 3.86
746 747 1.388065 TTTGGTGTTGCCGTTGGAGG 61.388 55.000 0.00 0.00 41.21 4.30
747 748 2.203294 GGTGTTGCCGTTGGAGGT 60.203 61.111 0.00 0.00 0.00 3.85
748 749 2.551912 GGTGTTGCCGTTGGAGGTG 61.552 63.158 0.00 0.00 0.00 4.00
749 750 2.904866 TGTTGCCGTTGGAGGTGC 60.905 61.111 0.00 0.00 0.00 5.01
750 751 3.670377 GTTGCCGTTGGAGGTGCC 61.670 66.667 0.00 0.00 37.10 5.01
751 752 4.966787 TTGCCGTTGGAGGTGCCC 62.967 66.667 0.00 0.00 34.97 5.36
753 754 3.712907 GCCGTTGGAGGTGCCCTA 61.713 66.667 0.00 0.00 31.76 3.53
754 755 3.074281 CCGTTGGAGGTGCCCTAA 58.926 61.111 0.00 0.00 31.76 2.69
755 756 1.078426 CCGTTGGAGGTGCCCTAAG 60.078 63.158 0.00 0.00 31.76 2.18
756 757 1.078426 CGTTGGAGGTGCCCTAAGG 60.078 63.158 0.00 0.00 31.76 2.69
758 759 1.151677 TTGGAGGTGCCCTAAGGGT 60.152 57.895 0.00 0.00 46.51 4.34
759 760 0.119561 TTGGAGGTGCCCTAAGGGTA 59.880 55.000 0.00 0.00 46.51 3.69
766 767 1.488390 TGCCCTAAGGGTACGTAAGG 58.512 55.000 0.00 0.00 46.51 2.69
767 768 1.006998 TGCCCTAAGGGTACGTAAGGA 59.993 52.381 11.13 0.00 46.51 3.36
768 769 2.110578 GCCCTAAGGGTACGTAAGGAA 58.889 52.381 11.13 0.00 46.51 3.36
769 770 2.501316 GCCCTAAGGGTACGTAAGGAAA 59.499 50.000 11.13 0.00 46.51 3.13
770 771 3.135348 GCCCTAAGGGTACGTAAGGAAAT 59.865 47.826 11.13 0.00 46.51 2.17
771 772 4.344968 GCCCTAAGGGTACGTAAGGAAATA 59.655 45.833 11.13 0.00 46.51 1.40
772 773 5.163311 GCCCTAAGGGTACGTAAGGAAATAA 60.163 44.000 11.13 0.00 46.51 1.40
773 774 6.632445 GCCCTAAGGGTACGTAAGGAAATAAA 60.632 42.308 11.13 0.00 46.51 1.40
774 775 6.763135 CCCTAAGGGTACGTAAGGAAATAAAC 59.237 42.308 11.13 0.00 39.24 2.01
775 776 6.476706 CCTAAGGGTACGTAAGGAAATAAACG 59.523 42.308 4.51 0.00 46.39 3.60
776 777 4.183865 AGGGTACGTAAGGAAATAAACGC 58.816 43.478 0.00 0.00 46.39 4.84
777 778 3.000222 GGGTACGTAAGGAAATAAACGCG 60.000 47.826 3.53 3.53 46.39 6.01
778 779 2.793268 ACGTAAGGAAATAAACGCGC 57.207 45.000 5.73 0.00 46.39 6.86
779 780 1.059549 ACGTAAGGAAATAAACGCGCG 59.940 47.619 30.96 30.96 46.39 6.86
780 781 1.321148 CGTAAGGAAATAAACGCGCGA 59.679 47.619 39.36 15.84 0.00 5.87
781 782 2.593582 CGTAAGGAAATAAACGCGCGAG 60.594 50.000 39.36 10.29 0.00 5.03
782 783 1.717194 AAGGAAATAAACGCGCGAGA 58.283 45.000 39.36 20.98 0.00 4.04
783 784 1.717194 AGGAAATAAACGCGCGAGAA 58.283 45.000 39.36 20.70 0.00 2.87
784 785 1.392510 AGGAAATAAACGCGCGAGAAC 59.607 47.619 39.36 18.79 0.00 3.01
785 786 1.127213 GGAAATAAACGCGCGAGAACA 59.873 47.619 39.36 16.48 0.00 3.18
786 787 2.222953 GGAAATAAACGCGCGAGAACAT 60.223 45.455 39.36 18.04 0.00 2.71
787 788 3.413558 GAAATAAACGCGCGAGAACATT 58.586 40.909 39.36 22.47 0.00 2.71
788 789 2.435685 ATAAACGCGCGAGAACATTG 57.564 45.000 39.36 3.76 0.00 2.82
789 790 1.420378 TAAACGCGCGAGAACATTGA 58.580 45.000 39.36 9.48 0.00 2.57
790 791 0.584396 AAACGCGCGAGAACATTGAA 59.416 45.000 39.36 0.00 0.00 2.69
791 792 0.584396 AACGCGCGAGAACATTGAAA 59.416 45.000 39.36 0.00 0.00 2.69
792 793 0.584396 ACGCGCGAGAACATTGAAAA 59.416 45.000 39.36 0.00 0.00 2.29
793 794 1.196808 ACGCGCGAGAACATTGAAAAT 59.803 42.857 39.36 5.15 0.00 1.82
794 795 2.241722 CGCGCGAGAACATTGAAAATT 58.758 42.857 28.94 0.00 0.00 1.82
795 796 2.656422 CGCGCGAGAACATTGAAAATTT 59.344 40.909 28.94 0.00 0.00 1.82
796 797 3.478598 CGCGCGAGAACATTGAAAATTTG 60.479 43.478 28.94 0.00 0.00 2.32
797 798 3.181541 GCGCGAGAACATTGAAAATTTGG 60.182 43.478 12.10 0.00 0.00 3.28
798 799 3.364621 CGCGAGAACATTGAAAATTTGGG 59.635 43.478 0.00 0.00 0.00 4.12
799 800 3.679502 GCGAGAACATTGAAAATTTGGGG 59.320 43.478 0.00 0.00 0.00 4.96
800 801 3.679502 CGAGAACATTGAAAATTTGGGGC 59.320 43.478 0.00 0.00 0.00 5.80
801 802 4.640364 GAGAACATTGAAAATTTGGGGCA 58.360 39.130 0.00 0.00 0.00 5.36
802 803 5.046288 AGAACATTGAAAATTTGGGGCAA 57.954 34.783 0.00 0.00 0.00 4.52
803 804 5.065235 AGAACATTGAAAATTTGGGGCAAG 58.935 37.500 0.00 0.00 0.00 4.01
804 805 4.436113 ACATTGAAAATTTGGGGCAAGT 57.564 36.364 0.00 0.00 0.00 3.16
805 806 4.790937 ACATTGAAAATTTGGGGCAAGTT 58.209 34.783 0.00 0.00 0.00 2.66
806 807 5.934781 ACATTGAAAATTTGGGGCAAGTTA 58.065 33.333 0.00 0.00 0.00 2.24
807 808 6.541907 ACATTGAAAATTTGGGGCAAGTTAT 58.458 32.000 0.00 0.00 0.00 1.89
808 809 7.003482 ACATTGAAAATTTGGGGCAAGTTATT 58.997 30.769 0.00 0.00 0.00 1.40
809 810 7.505248 ACATTGAAAATTTGGGGCAAGTTATTT 59.495 29.630 0.00 0.00 0.00 1.40
810 811 7.888250 TTGAAAATTTGGGGCAAGTTATTTT 57.112 28.000 0.00 0.00 29.61 1.82
811 812 7.888250 TGAAAATTTGGGGCAAGTTATTTTT 57.112 28.000 0.00 0.00 28.16 1.94
812 813 8.980481 TGAAAATTTGGGGCAAGTTATTTTTA 57.020 26.923 0.00 0.00 28.16 1.52
813 814 9.408648 TGAAAATTTGGGGCAAGTTATTTTTAA 57.591 25.926 0.00 0.00 28.16 1.52
816 817 9.579932 AAATTTGGGGCAAGTTATTTTTAATGA 57.420 25.926 0.00 0.00 0.00 2.57
817 818 9.579932 AATTTGGGGCAAGTTATTTTTAATGAA 57.420 25.926 0.00 0.00 0.00 2.57
818 819 8.980481 TTTGGGGCAAGTTATTTTTAATGAAA 57.020 26.923 0.00 0.00 0.00 2.69
819 820 8.980481 TTGGGGCAAGTTATTTTTAATGAAAA 57.020 26.923 0.00 0.00 41.20 2.29
820 821 8.614469 TGGGGCAAGTTATTTTTAATGAAAAG 57.386 30.769 0.00 0.00 40.35 2.27
821 822 8.214364 TGGGGCAAGTTATTTTTAATGAAAAGT 58.786 29.630 0.00 0.00 40.35 2.66
822 823 8.717821 GGGGCAAGTTATTTTTAATGAAAAGTC 58.282 33.333 0.00 0.00 40.35 3.01
823 824 8.432359 GGGCAAGTTATTTTTAATGAAAAGTCG 58.568 33.333 0.00 0.00 40.35 4.18
824 825 9.187455 GGCAAGTTATTTTTAATGAAAAGTCGA 57.813 29.630 0.00 0.00 40.35 4.20
868 869 8.855804 TTTATAATAAGAAGAGGGTCTCAGGT 57.144 34.615 0.00 0.00 32.06 4.00
869 870 8.855804 TTATAATAAGAAGAGGGTCTCAGGTT 57.144 34.615 0.00 0.00 32.06 3.50
870 871 7.757242 ATAATAAGAAGAGGGTCTCAGGTTT 57.243 36.000 0.00 0.00 32.06 3.27
871 872 3.778954 AAGAAGAGGGTCTCAGGTTTG 57.221 47.619 0.00 0.00 32.06 2.93
872 873 1.981495 AGAAGAGGGTCTCAGGTTTGG 59.019 52.381 0.00 0.00 32.06 3.28
873 874 1.700186 GAAGAGGGTCTCAGGTTTGGT 59.300 52.381 0.00 0.00 32.06 3.67
874 875 1.821088 AGAGGGTCTCAGGTTTGGTT 58.179 50.000 0.00 0.00 32.06 3.67
875 876 2.136026 AGAGGGTCTCAGGTTTGGTTT 58.864 47.619 0.00 0.00 32.06 3.27
876 877 2.106684 AGAGGGTCTCAGGTTTGGTTTC 59.893 50.000 0.00 0.00 32.06 2.78
877 878 2.106684 GAGGGTCTCAGGTTTGGTTTCT 59.893 50.000 0.00 0.00 0.00 2.52
878 879 2.158608 AGGGTCTCAGGTTTGGTTTCTG 60.159 50.000 0.00 0.00 0.00 3.02
879 880 2.422945 GGGTCTCAGGTTTGGTTTCTGT 60.423 50.000 0.00 0.00 0.00 3.41
880 881 2.879026 GGTCTCAGGTTTGGTTTCTGTC 59.121 50.000 0.00 0.00 0.00 3.51
881 882 2.544267 GTCTCAGGTTTGGTTTCTGTCG 59.456 50.000 0.00 0.00 0.00 4.35
882 883 1.264288 CTCAGGTTTGGTTTCTGTCGC 59.736 52.381 0.00 0.00 0.00 5.19
883 884 0.310854 CAGGTTTGGTTTCTGTCGCC 59.689 55.000 0.00 0.00 0.00 5.54
884 885 0.106918 AGGTTTGGTTTCTGTCGCCA 60.107 50.000 0.00 0.00 0.00 5.69
885 886 0.958822 GGTTTGGTTTCTGTCGCCAT 59.041 50.000 0.00 0.00 31.71 4.40
886 887 1.068541 GGTTTGGTTTCTGTCGCCATC 60.069 52.381 0.00 0.00 31.71 3.51
887 888 1.880027 GTTTGGTTTCTGTCGCCATCT 59.120 47.619 0.00 0.00 31.71 2.90
888 889 1.808411 TTGGTTTCTGTCGCCATCTC 58.192 50.000 0.00 0.00 31.71 2.75
889 890 0.684535 TGGTTTCTGTCGCCATCTCA 59.315 50.000 0.00 0.00 0.00 3.27
890 891 1.278985 TGGTTTCTGTCGCCATCTCAT 59.721 47.619 0.00 0.00 0.00 2.90
891 892 2.290260 TGGTTTCTGTCGCCATCTCATT 60.290 45.455 0.00 0.00 0.00 2.57
892 893 2.352960 GGTTTCTGTCGCCATCTCATTC 59.647 50.000 0.00 0.00 0.00 2.67
893 894 3.265791 GTTTCTGTCGCCATCTCATTCT 58.734 45.455 0.00 0.00 0.00 2.40
894 895 2.591571 TCTGTCGCCATCTCATTCTG 57.408 50.000 0.00 0.00 0.00 3.02
895 896 2.102578 TCTGTCGCCATCTCATTCTGA 58.897 47.619 0.00 0.00 0.00 3.27
896 897 2.100418 TCTGTCGCCATCTCATTCTGAG 59.900 50.000 0.00 0.00 45.59 3.35
912 913 8.690203 TCATTCTGAGAAGGAAAATACAAACA 57.310 30.769 7.13 0.00 0.00 2.83
913 914 9.300681 TCATTCTGAGAAGGAAAATACAAACAT 57.699 29.630 7.13 0.00 0.00 2.71
914 915 9.918630 CATTCTGAGAAGGAAAATACAAACATT 57.081 29.630 0.00 0.00 0.00 2.71
947 948 8.910351 TTTTTGTGAGAAAAAGGAAAAGGAAA 57.090 26.923 0.00 0.00 31.05 3.13
948 949 7.899178 TTTGTGAGAAAAAGGAAAAGGAAAC 57.101 32.000 0.00 0.00 0.00 2.78
949 950 5.646606 TGTGAGAAAAAGGAAAAGGAAACG 58.353 37.500 0.00 0.00 0.00 3.60
950 951 5.041287 GTGAGAAAAAGGAAAAGGAAACGG 58.959 41.667 0.00 0.00 0.00 4.44
951 952 4.049186 GAGAAAAAGGAAAAGGAAACGGC 58.951 43.478 0.00 0.00 0.00 5.68
952 953 3.704566 AGAAAAAGGAAAAGGAAACGGCT 59.295 39.130 0.00 0.00 0.00 5.52
953 954 3.452755 AAAAGGAAAAGGAAACGGCTG 57.547 42.857 0.00 0.00 0.00 4.85
954 955 2.067365 AAGGAAAAGGAAACGGCTGT 57.933 45.000 0.00 0.00 0.00 4.40
955 956 1.318576 AGGAAAAGGAAACGGCTGTG 58.681 50.000 0.00 0.00 0.00 3.66
956 957 0.313987 GGAAAAGGAAACGGCTGTGG 59.686 55.000 0.00 0.00 0.00 4.17
957 958 0.318699 GAAAAGGAAACGGCTGTGGC 60.319 55.000 0.00 0.00 37.82 5.01
958 959 1.040339 AAAAGGAAACGGCTGTGGCA 61.040 50.000 0.00 0.00 40.87 4.92
959 960 1.040339 AAAGGAAACGGCTGTGGCAA 61.040 50.000 0.00 0.00 40.87 4.52
960 961 0.827507 AAGGAAACGGCTGTGGCAAT 60.828 50.000 0.00 0.00 40.87 3.56
961 962 0.827507 AGGAAACGGCTGTGGCAATT 60.828 50.000 0.00 0.00 40.87 2.32
962 963 0.033366 GGAAACGGCTGTGGCAATTT 59.967 50.000 0.00 0.00 40.87 1.82
963 964 1.540146 GGAAACGGCTGTGGCAATTTT 60.540 47.619 0.00 0.00 40.87 1.82
964 965 1.526464 GAAACGGCTGTGGCAATTTTG 59.474 47.619 0.00 0.00 40.87 2.44
965 966 0.249826 AACGGCTGTGGCAATTTTGG 60.250 50.000 0.00 0.00 40.87 3.28
966 967 1.112315 ACGGCTGTGGCAATTTTGGA 61.112 50.000 0.00 0.00 40.87 3.53
967 968 0.247185 CGGCTGTGGCAATTTTGGAT 59.753 50.000 0.00 0.00 40.87 3.41
968 969 1.476085 CGGCTGTGGCAATTTTGGATA 59.524 47.619 0.00 0.00 40.87 2.59
969 970 2.735126 CGGCTGTGGCAATTTTGGATAC 60.735 50.000 0.00 0.00 40.87 2.24
970 971 2.418609 GGCTGTGGCAATTTTGGATACC 60.419 50.000 0.00 0.00 40.87 2.73
971 972 2.233431 GCTGTGGCAATTTTGGATACCA 59.767 45.455 0.00 0.00 38.54 3.25
972 973 3.306641 GCTGTGGCAATTTTGGATACCAA 60.307 43.478 0.00 0.00 38.95 3.67
973 974 4.497300 CTGTGGCAATTTTGGATACCAAG 58.503 43.478 3.49 0.00 44.84 3.61
974 975 4.155709 TGTGGCAATTTTGGATACCAAGA 58.844 39.130 3.49 0.09 44.84 3.02
975 976 4.590647 TGTGGCAATTTTGGATACCAAGAA 59.409 37.500 3.49 2.97 44.84 2.52
976 977 5.170748 GTGGCAATTTTGGATACCAAGAAG 58.829 41.667 3.49 0.00 44.84 2.85
977 978 5.047377 GTGGCAATTTTGGATACCAAGAAGA 60.047 40.000 3.49 0.00 44.84 2.87
978 979 5.185635 TGGCAATTTTGGATACCAAGAAGAG 59.814 40.000 3.49 0.00 44.84 2.85
979 980 5.394553 GGCAATTTTGGATACCAAGAAGAGG 60.395 44.000 3.49 0.00 44.84 3.69
980 981 5.394553 GCAATTTTGGATACCAAGAAGAGGG 60.395 44.000 3.49 0.00 44.84 4.30
981 982 5.796502 ATTTTGGATACCAAGAAGAGGGA 57.203 39.130 3.49 0.00 44.84 4.20
982 983 4.844349 TTTGGATACCAAGAAGAGGGAG 57.156 45.455 3.49 0.00 44.84 4.30
983 984 2.764269 TGGATACCAAGAAGAGGGAGG 58.236 52.381 0.00 0.00 0.00 4.30
984 985 1.418264 GGATACCAAGAAGAGGGAGGC 59.582 57.143 0.00 0.00 0.00 4.70
985 986 1.069358 GATACCAAGAAGAGGGAGGCG 59.931 57.143 0.00 0.00 0.00 5.52
986 987 0.976073 TACCAAGAAGAGGGAGGCGG 60.976 60.000 0.00 0.00 0.00 6.13
987 988 1.990060 CCAAGAAGAGGGAGGCGGA 60.990 63.158 0.00 0.00 0.00 5.54
988 989 1.341156 CCAAGAAGAGGGAGGCGGAT 61.341 60.000 0.00 0.00 0.00 4.18
989 990 1.414158 CAAGAAGAGGGAGGCGGATA 58.586 55.000 0.00 0.00 0.00 2.59
990 991 1.342819 CAAGAAGAGGGAGGCGGATAG 59.657 57.143 0.00 0.00 0.00 2.08
991 992 0.178947 AGAAGAGGGAGGCGGATAGG 60.179 60.000 0.00 0.00 0.00 2.57
992 993 1.152226 AAGAGGGAGGCGGATAGGG 60.152 63.158 0.00 0.00 0.00 3.53
993 994 1.665948 AAGAGGGAGGCGGATAGGGA 61.666 60.000 0.00 0.00 0.00 4.20
994 995 1.608046 GAGGGAGGCGGATAGGGAG 60.608 68.421 0.00 0.00 0.00 4.30
995 996 2.201771 GGGAGGCGGATAGGGAGT 59.798 66.667 0.00 0.00 0.00 3.85
996 997 2.210711 GGGAGGCGGATAGGGAGTG 61.211 68.421 0.00 0.00 0.00 3.51
997 998 2.210711 GGAGGCGGATAGGGAGTGG 61.211 68.421 0.00 0.00 0.00 4.00
998 999 2.122813 AGGCGGATAGGGAGTGGG 60.123 66.667 0.00 0.00 0.00 4.61
999 1000 3.942439 GGCGGATAGGGAGTGGGC 61.942 72.222 0.00 0.00 0.00 5.36
1000 1001 3.161450 GCGGATAGGGAGTGGGCA 61.161 66.667 0.00 0.00 0.00 5.36
1001 1002 2.520536 GCGGATAGGGAGTGGGCAT 61.521 63.158 0.00 0.00 0.00 4.40
1002 1003 1.372683 CGGATAGGGAGTGGGCATG 59.627 63.158 0.00 0.00 0.00 4.06
1003 1004 1.763770 GGATAGGGAGTGGGCATGG 59.236 63.158 0.00 0.00 0.00 3.66
1004 1005 1.073897 GATAGGGAGTGGGCATGGC 59.926 63.158 11.56 11.56 0.00 4.40
1005 1006 2.738213 GATAGGGAGTGGGCATGGCG 62.738 65.000 13.76 0.00 0.00 5.69
1026 1027 4.083862 GCCGTCCACCTCCACCTC 62.084 72.222 0.00 0.00 0.00 3.85
1027 1028 3.391382 CCGTCCACCTCCACCTCC 61.391 72.222 0.00 0.00 0.00 4.30
1028 1029 2.603473 CGTCCACCTCCACCTCCA 60.603 66.667 0.00 0.00 0.00 3.86
1029 1030 2.943978 CGTCCACCTCCACCTCCAC 61.944 68.421 0.00 0.00 0.00 4.02
1030 1031 2.203938 TCCACCTCCACCTCCACC 60.204 66.667 0.00 0.00 0.00 4.61
1031 1032 2.203998 CCACCTCCACCTCCACCT 60.204 66.667 0.00 0.00 0.00 4.00
1032 1033 2.294078 CCACCTCCACCTCCACCTC 61.294 68.421 0.00 0.00 0.00 3.85
1033 1034 2.122954 ACCTCCACCTCCACCTCC 59.877 66.667 0.00 0.00 0.00 4.30
1034 1035 2.122729 CCTCCACCTCCACCTCCA 59.877 66.667 0.00 0.00 0.00 3.86
1035 1036 2.294078 CCTCCACCTCCACCTCCAC 61.294 68.421 0.00 0.00 0.00 4.02
1036 1037 2.203938 TCCACCTCCACCTCCACC 60.204 66.667 0.00 0.00 0.00 4.61
1037 1038 2.529136 CCACCTCCACCTCCACCA 60.529 66.667 0.00 0.00 0.00 4.17
1038 1039 2.750350 CACCTCCACCTCCACCAC 59.250 66.667 0.00 0.00 0.00 4.16
1039 1040 2.529389 ACCTCCACCTCCACCACC 60.529 66.667 0.00 0.00 0.00 4.61
1040 1041 2.529136 CCTCCACCTCCACCACCA 60.529 66.667 0.00 0.00 0.00 4.17
1041 1042 1.925455 CCTCCACCTCCACCACCAT 60.925 63.158 0.00 0.00 0.00 3.55
1042 1043 1.500783 CCTCCACCTCCACCACCATT 61.501 60.000 0.00 0.00 0.00 3.16
1043 1044 1.285280 CTCCACCTCCACCACCATTA 58.715 55.000 0.00 0.00 0.00 1.90
1044 1045 0.988832 TCCACCTCCACCACCATTAC 59.011 55.000 0.00 0.00 0.00 1.89
1045 1046 0.034477 CCACCTCCACCACCATTACC 60.034 60.000 0.00 0.00 0.00 2.85
1046 1047 0.991920 CACCTCCACCACCATTACCT 59.008 55.000 0.00 0.00 0.00 3.08
1047 1048 1.065418 CACCTCCACCACCATTACCTC 60.065 57.143 0.00 0.00 0.00 3.85
1048 1049 0.546598 CCTCCACCACCATTACCTCC 59.453 60.000 0.00 0.00 0.00 4.30
1049 1050 1.584724 CTCCACCACCATTACCTCCT 58.415 55.000 0.00 0.00 0.00 3.69
1050 1051 1.486726 CTCCACCACCATTACCTCCTC 59.513 57.143 0.00 0.00 0.00 3.71
1051 1052 0.546598 CCACCACCATTACCTCCTCC 59.453 60.000 0.00 0.00 0.00 4.30
1052 1053 0.178068 CACCACCATTACCTCCTCCG 59.822 60.000 0.00 0.00 0.00 4.63
1053 1054 0.252558 ACCACCATTACCTCCTCCGT 60.253 55.000 0.00 0.00 0.00 4.69
1054 1055 0.464452 CCACCATTACCTCCTCCGTC 59.536 60.000 0.00 0.00 0.00 4.79
1055 1056 0.464452 CACCATTACCTCCTCCGTCC 59.536 60.000 0.00 0.00 0.00 4.79
1056 1057 0.042131 ACCATTACCTCCTCCGTCCA 59.958 55.000 0.00 0.00 0.00 4.02
1057 1058 1.344087 ACCATTACCTCCTCCGTCCAT 60.344 52.381 0.00 0.00 0.00 3.41
1058 1059 1.070758 CCATTACCTCCTCCGTCCATG 59.929 57.143 0.00 0.00 0.00 3.66
1059 1060 1.762957 CATTACCTCCTCCGTCCATGT 59.237 52.381 0.00 0.00 0.00 3.21
1060 1061 1.481871 TTACCTCCTCCGTCCATGTC 58.518 55.000 0.00 0.00 0.00 3.06
1061 1062 0.396695 TACCTCCTCCGTCCATGTCC 60.397 60.000 0.00 0.00 0.00 4.02
1062 1063 2.786495 CCTCCTCCGTCCATGTCCG 61.786 68.421 0.00 0.00 0.00 4.79
1063 1064 3.432051 CTCCTCCGTCCATGTCCGC 62.432 68.421 0.00 0.00 0.00 5.54
1064 1065 4.530857 CCTCCGTCCATGTCCGCC 62.531 72.222 0.00 0.00 0.00 6.13
1065 1066 4.873129 CTCCGTCCATGTCCGCCG 62.873 72.222 0.00 0.00 0.00 6.46
1084 1085 4.140599 CTCGGCGAGCCTGCTTCT 62.141 66.667 25.31 0.00 34.52 2.85
1085 1086 3.655810 CTCGGCGAGCCTGCTTCTT 62.656 63.158 25.31 0.00 34.52 2.52
1086 1087 3.191539 CGGCGAGCCTGCTTCTTC 61.192 66.667 12.70 0.00 34.52 2.87
1087 1088 2.267324 GGCGAGCCTGCTTCTTCT 59.733 61.111 6.90 0.00 34.52 2.85
1088 1089 1.813337 GGCGAGCCTGCTTCTTCTC 60.813 63.158 6.90 0.00 34.52 2.87
1089 1090 1.813337 GCGAGCCTGCTTCTTCTCC 60.813 63.158 0.00 0.00 0.00 3.71
1090 1091 1.896694 CGAGCCTGCTTCTTCTCCT 59.103 57.895 0.00 0.00 0.00 3.69
1091 1092 0.179113 CGAGCCTGCTTCTTCTCCTC 60.179 60.000 0.00 0.00 0.00 3.71
1092 1093 0.179113 GAGCCTGCTTCTTCTCCTCG 60.179 60.000 0.00 0.00 0.00 4.63
1093 1094 1.813337 GCCTGCTTCTTCTCCTCGC 60.813 63.158 0.00 0.00 0.00 5.03
1094 1095 1.153469 CCTGCTTCTTCTCCTCGCC 60.153 63.158 0.00 0.00 0.00 5.54
1095 1096 1.518133 CTGCTTCTTCTCCTCGCCG 60.518 63.158 0.00 0.00 0.00 6.46
1096 1097 2.219325 CTGCTTCTTCTCCTCGCCGT 62.219 60.000 0.00 0.00 0.00 5.68
1097 1098 1.807573 GCTTCTTCTCCTCGCCGTG 60.808 63.158 0.00 0.00 0.00 4.94
1098 1099 1.153745 CTTCTTCTCCTCGCCGTGG 60.154 63.158 0.00 0.00 0.00 4.94
1099 1100 3.296709 TTCTTCTCCTCGCCGTGGC 62.297 63.158 0.00 0.00 37.85 5.01
1140 1141 4.214327 CGCCTCCGCTCCTCCTTC 62.214 72.222 0.00 0.00 0.00 3.46
1141 1142 3.855853 GCCTCCGCTCCTCCTTCC 61.856 72.222 0.00 0.00 0.00 3.46
1142 1143 3.157949 CCTCCGCTCCTCCTTCCC 61.158 72.222 0.00 0.00 0.00 3.97
1143 1144 3.157949 CTCCGCTCCTCCTTCCCC 61.158 72.222 0.00 0.00 0.00 4.81
1161 1162 4.366684 GCCCCCACCTCCCACTTG 62.367 72.222 0.00 0.00 0.00 3.16
1162 1163 3.661648 CCCCCACCTCCCACTTGG 61.662 72.222 0.00 0.00 0.00 3.61
1163 1164 4.366684 CCCCACCTCCCACTTGGC 62.367 72.222 0.00 0.00 0.00 4.52
1164 1165 4.366684 CCCACCTCCCACTTGGCC 62.367 72.222 0.00 0.00 0.00 5.36
1165 1166 4.722700 CCACCTCCCACTTGGCCG 62.723 72.222 0.00 0.00 0.00 6.13
1166 1167 3.953775 CACCTCCCACTTGGCCGT 61.954 66.667 0.00 0.00 0.00 5.68
1167 1168 3.637273 ACCTCCCACTTGGCCGTC 61.637 66.667 0.00 0.00 0.00 4.79
1168 1169 4.760047 CCTCCCACTTGGCCGTCG 62.760 72.222 0.00 0.00 0.00 5.12
1181 1182 4.794439 CGTCGCCGGCACAGATGA 62.794 66.667 28.98 11.71 0.00 2.92
1182 1183 2.887568 GTCGCCGGCACAGATGAG 60.888 66.667 28.98 7.38 0.00 2.90
1183 1184 4.819761 TCGCCGGCACAGATGAGC 62.820 66.667 28.98 0.00 0.00 4.26
1187 1188 4.147449 CGGCACAGATGAGCGGGA 62.147 66.667 2.61 0.00 32.29 5.14
1188 1189 2.507944 GGCACAGATGAGCGGGAT 59.492 61.111 0.00 0.00 32.29 3.85
1189 1190 1.890979 GGCACAGATGAGCGGGATG 60.891 63.158 0.00 0.00 32.29 3.51
1190 1191 2.541120 GCACAGATGAGCGGGATGC 61.541 63.158 0.00 0.00 46.98 3.91
1199 1200 3.849951 GCGGGATGCGGAGGAGAA 61.850 66.667 0.00 0.00 0.00 2.87
1200 1201 2.419198 CGGGATGCGGAGGAGAAG 59.581 66.667 0.00 0.00 0.00 2.85
1201 1202 2.825264 GGGATGCGGAGGAGAAGG 59.175 66.667 0.00 0.00 0.00 3.46
1202 1203 1.762460 GGGATGCGGAGGAGAAGGA 60.762 63.158 0.00 0.00 0.00 3.36
1203 1204 1.745264 GGATGCGGAGGAGAAGGAG 59.255 63.158 0.00 0.00 0.00 3.69
1204 1205 1.745264 GATGCGGAGGAGAAGGAGG 59.255 63.158 0.00 0.00 0.00 4.30
1205 1206 0.757188 GATGCGGAGGAGAAGGAGGA 60.757 60.000 0.00 0.00 0.00 3.71
1206 1207 0.758685 ATGCGGAGGAGAAGGAGGAG 60.759 60.000 0.00 0.00 0.00 3.69
1207 1208 1.380650 GCGGAGGAGAAGGAGGAGT 60.381 63.158 0.00 0.00 0.00 3.85
1208 1209 0.973496 GCGGAGGAGAAGGAGGAGTT 60.973 60.000 0.00 0.00 0.00 3.01
1209 1210 1.107945 CGGAGGAGAAGGAGGAGTTC 58.892 60.000 0.00 0.00 0.00 3.01
1210 1211 1.107945 GGAGGAGAAGGAGGAGTTCG 58.892 60.000 0.00 0.00 0.00 3.95
1211 1212 1.617533 GGAGGAGAAGGAGGAGTTCGT 60.618 57.143 0.00 0.00 0.00 3.85
1212 1213 1.474879 GAGGAGAAGGAGGAGTTCGTG 59.525 57.143 0.00 0.00 0.00 4.35
1213 1214 0.533032 GGAGAAGGAGGAGTTCGTGG 59.467 60.000 0.00 0.00 0.00 4.94
1214 1215 1.258676 GAGAAGGAGGAGTTCGTGGT 58.741 55.000 0.00 0.00 0.00 4.16
1215 1216 1.202817 GAGAAGGAGGAGTTCGTGGTC 59.797 57.143 0.00 0.00 0.00 4.02
1216 1217 0.109226 GAAGGAGGAGTTCGTGGTCG 60.109 60.000 0.00 0.00 38.55 4.79
1217 1218 0.826672 AAGGAGGAGTTCGTGGTCGT 60.827 55.000 0.00 0.00 38.33 4.34
1218 1219 0.826672 AGGAGGAGTTCGTGGTCGTT 60.827 55.000 0.00 0.00 38.33 3.85
1219 1220 0.883833 GGAGGAGTTCGTGGTCGTTA 59.116 55.000 0.00 0.00 38.33 3.18
1220 1221 1.402062 GGAGGAGTTCGTGGTCGTTAC 60.402 57.143 0.00 0.00 38.33 2.50
1221 1222 0.600057 AGGAGTTCGTGGTCGTTACC 59.400 55.000 0.00 0.00 46.98 2.85
1222 1223 0.600057 GGAGTTCGTGGTCGTTACCT 59.400 55.000 0.00 0.00 46.91 3.08
1223 1224 1.000171 GGAGTTCGTGGTCGTTACCTT 60.000 52.381 0.00 0.00 46.91 3.50
1224 1225 2.323059 GAGTTCGTGGTCGTTACCTTC 58.677 52.381 0.00 0.00 46.91 3.46
1225 1226 1.959282 AGTTCGTGGTCGTTACCTTCT 59.041 47.619 0.00 0.00 46.91 2.85
1226 1227 3.149196 AGTTCGTGGTCGTTACCTTCTA 58.851 45.455 0.00 0.00 46.91 2.10
1227 1228 3.057946 AGTTCGTGGTCGTTACCTTCTAC 60.058 47.826 0.00 0.00 46.91 2.59
1228 1229 2.503331 TCGTGGTCGTTACCTTCTACA 58.497 47.619 0.00 0.00 46.91 2.74
1229 1230 2.884012 TCGTGGTCGTTACCTTCTACAA 59.116 45.455 0.00 0.00 46.91 2.41
1230 1231 3.058016 TCGTGGTCGTTACCTTCTACAAG 60.058 47.826 0.00 0.00 46.91 3.16
1231 1232 2.991866 GTGGTCGTTACCTTCTACAAGC 59.008 50.000 0.00 0.00 46.91 4.01
1232 1233 2.895404 TGGTCGTTACCTTCTACAAGCT 59.105 45.455 0.00 0.00 46.91 3.74
1233 1234 3.251571 GGTCGTTACCTTCTACAAGCTG 58.748 50.000 0.00 0.00 43.08 4.24
1234 1235 3.251571 GTCGTTACCTTCTACAAGCTGG 58.748 50.000 0.00 0.00 0.00 4.85
1235 1236 2.000447 CGTTACCTTCTACAAGCTGGC 59.000 52.381 0.00 0.00 0.00 4.85
1236 1237 2.353803 CGTTACCTTCTACAAGCTGGCT 60.354 50.000 0.00 0.00 0.00 4.75
1237 1238 3.263261 GTTACCTTCTACAAGCTGGCTC 58.737 50.000 0.00 0.00 0.00 4.70
1238 1239 0.615850 ACCTTCTACAAGCTGGCTCC 59.384 55.000 0.00 0.00 0.00 4.70
1239 1240 0.107459 CCTTCTACAAGCTGGCTCCC 60.107 60.000 0.00 0.00 0.00 4.30
1240 1241 0.460987 CTTCTACAAGCTGGCTCCCG 60.461 60.000 0.00 0.00 0.00 5.14
1241 1242 1.192146 TTCTACAAGCTGGCTCCCGT 61.192 55.000 0.00 0.00 0.00 5.28
1242 1243 1.448540 CTACAAGCTGGCTCCCGTG 60.449 63.158 0.00 0.00 0.00 4.94
1243 1244 2.859273 CTACAAGCTGGCTCCCGTGG 62.859 65.000 0.00 0.00 0.00 4.94
1244 1245 4.020617 CAAGCTGGCTCCCGTGGA 62.021 66.667 0.00 0.00 0.00 4.02
1283 1284 4.379243 CGCGCACCTCCACTTCCT 62.379 66.667 8.75 0.00 0.00 3.36
1284 1285 2.435059 GCGCACCTCCACTTCCTC 60.435 66.667 0.30 0.00 0.00 3.71
1285 1286 2.266055 CGCACCTCCACTTCCTCC 59.734 66.667 0.00 0.00 0.00 4.30
1286 1287 2.583441 CGCACCTCCACTTCCTCCA 61.583 63.158 0.00 0.00 0.00 3.86
1287 1288 1.298014 GCACCTCCACTTCCTCCAG 59.702 63.158 0.00 0.00 0.00 3.86
1288 1289 1.986413 CACCTCCACTTCCTCCAGG 59.014 63.158 0.00 0.00 0.00 4.45
1289 1290 0.838122 CACCTCCACTTCCTCCAGGT 60.838 60.000 0.00 0.00 38.02 4.00
1290 1291 0.545548 ACCTCCACTTCCTCCAGGTC 60.546 60.000 0.00 0.00 31.41 3.85
1291 1292 1.268283 CCTCCACTTCCTCCAGGTCC 61.268 65.000 0.00 0.00 36.34 4.46
1292 1293 1.608717 CTCCACTTCCTCCAGGTCCG 61.609 65.000 0.00 0.00 36.34 4.79
1293 1294 1.913762 CCACTTCCTCCAGGTCCGT 60.914 63.158 0.00 0.00 36.34 4.69
1294 1295 1.592223 CACTTCCTCCAGGTCCGTC 59.408 63.158 0.00 0.00 36.34 4.79
1295 1296 1.609794 ACTTCCTCCAGGTCCGTCC 60.610 63.158 0.00 0.00 36.34 4.79
1296 1297 2.284405 TTCCTCCAGGTCCGTCCC 60.284 66.667 0.00 0.00 36.75 4.46
1297 1298 3.918328 TTCCTCCAGGTCCGTCCCC 62.918 68.421 0.00 0.00 36.75 4.81
1302 1303 4.078516 CAGGTCCGTCCCCCGAAC 62.079 72.222 0.00 0.00 39.56 3.95
1305 1306 3.396570 GTCCGTCCCCCGAACCAT 61.397 66.667 0.00 0.00 39.56 3.55
1306 1307 2.608368 TCCGTCCCCCGAACCATT 60.608 61.111 0.00 0.00 39.56 3.16
1307 1308 2.124860 CCGTCCCCCGAACCATTC 60.125 66.667 0.00 0.00 39.56 2.67
1308 1309 2.666207 CGTCCCCCGAACCATTCA 59.334 61.111 0.00 0.00 39.56 2.57
1309 1310 1.223487 CGTCCCCCGAACCATTCAT 59.777 57.895 0.00 0.00 39.56 2.57
1310 1311 0.393808 CGTCCCCCGAACCATTCATT 60.394 55.000 0.00 0.00 39.56 2.57
1311 1312 1.134340 CGTCCCCCGAACCATTCATTA 60.134 52.381 0.00 0.00 39.56 1.90
1312 1313 2.486548 CGTCCCCCGAACCATTCATTAT 60.487 50.000 0.00 0.00 39.56 1.28
1313 1314 2.884639 GTCCCCCGAACCATTCATTATG 59.115 50.000 0.00 0.00 0.00 1.90
1337 1338 9.917887 ATGGATATCTGAAAGTCTGAATCTTTT 57.082 29.630 2.05 0.00 35.62 2.27
1354 1355 9.602568 TGAATCTTTTACTACTTTACACACACA 57.397 29.630 0.00 0.00 0.00 3.72
1355 1356 9.859692 GAATCTTTTACTACTTTACACACACAC 57.140 33.333 0.00 0.00 0.00 3.82
1356 1357 8.951787 ATCTTTTACTACTTTACACACACACA 57.048 30.769 0.00 0.00 0.00 3.72
1357 1358 8.774890 TCTTTTACTACTTTACACACACACAA 57.225 30.769 0.00 0.00 0.00 3.33
1358 1359 9.217278 TCTTTTACTACTTTACACACACACAAA 57.783 29.630 0.00 0.00 0.00 2.83
1359 1360 9.828852 CTTTTACTACTTTACACACACACAAAA 57.171 29.630 0.00 0.00 0.00 2.44
1386 1387 9.812347 AATAATAATTGCATATCTCCTGAACCA 57.188 29.630 0.00 0.00 0.00 3.67
1387 1388 7.756395 AATAATTGCATATCTCCTGAACCAG 57.244 36.000 0.00 0.00 0.00 4.00
1397 1398 2.351777 CTGAACCAGGGACGAGACA 58.648 57.895 0.00 0.00 0.00 3.41
1398 1399 0.898320 CTGAACCAGGGACGAGACAT 59.102 55.000 0.00 0.00 0.00 3.06
1399 1400 2.100197 CTGAACCAGGGACGAGACATA 58.900 52.381 0.00 0.00 0.00 2.29
1400 1401 1.822990 TGAACCAGGGACGAGACATAC 59.177 52.381 0.00 0.00 0.00 2.39
1401 1402 1.822990 GAACCAGGGACGAGACATACA 59.177 52.381 0.00 0.00 0.00 2.29
1402 1403 1.183549 ACCAGGGACGAGACATACAC 58.816 55.000 0.00 0.00 0.00 2.90
1403 1404 0.100682 CCAGGGACGAGACATACACG 59.899 60.000 0.00 0.00 38.45 4.49
1404 1405 0.100682 CAGGGACGAGACATACACGG 59.899 60.000 0.00 0.00 36.94 4.94
1405 1406 0.323178 AGGGACGAGACATACACGGT 60.323 55.000 0.00 0.00 36.94 4.83
1406 1407 0.100146 GGGACGAGACATACACGGTC 59.900 60.000 0.00 0.00 36.94 4.79
1407 1408 0.247974 GGACGAGACATACACGGTCG 60.248 60.000 0.00 0.00 40.20 4.79
1408 1409 0.860618 GACGAGACATACACGGTCGC 60.861 60.000 0.00 0.00 40.20 5.19
1409 1410 1.135939 CGAGACATACACGGTCGCA 59.864 57.895 0.00 0.00 40.20 5.10
1410 1411 0.248498 CGAGACATACACGGTCGCAT 60.248 55.000 0.00 0.00 40.20 4.73
1411 1412 1.478137 GAGACATACACGGTCGCATC 58.522 55.000 0.00 0.00 40.20 3.91
1412 1413 1.065701 GAGACATACACGGTCGCATCT 59.934 52.381 0.00 0.00 40.20 2.90
1413 1414 2.289820 GAGACATACACGGTCGCATCTA 59.710 50.000 0.00 0.00 40.20 1.98
1414 1415 2.033049 AGACATACACGGTCGCATCTAC 59.967 50.000 0.00 0.00 40.20 2.59
1415 1416 1.746787 ACATACACGGTCGCATCTACA 59.253 47.619 0.00 0.00 0.00 2.74
1416 1417 2.361119 ACATACACGGTCGCATCTACAT 59.639 45.455 0.00 0.00 0.00 2.29
1417 1418 2.485266 TACACGGTCGCATCTACATG 57.515 50.000 0.00 0.00 0.00 3.21
1418 1419 0.815095 ACACGGTCGCATCTACATGA 59.185 50.000 0.00 0.00 30.57 3.07
1419 1420 1.203758 ACACGGTCGCATCTACATGAA 59.796 47.619 0.00 0.00 30.57 2.57
1420 1421 1.588404 CACGGTCGCATCTACATGAAC 59.412 52.381 0.00 0.00 30.57 3.18
1421 1422 0.846401 CGGTCGCATCTACATGAACG 59.154 55.000 0.00 0.00 30.57 3.95
1422 1423 1.533129 CGGTCGCATCTACATGAACGA 60.533 52.381 0.00 0.00 35.78 3.85
1423 1424 2.120232 GGTCGCATCTACATGAACGAG 58.880 52.381 0.00 0.00 37.78 4.18
1424 1425 1.518929 GTCGCATCTACATGAACGAGC 59.481 52.381 0.00 0.00 37.78 5.03
1425 1426 1.134175 TCGCATCTACATGAACGAGCA 59.866 47.619 0.00 0.00 34.09 4.26
1426 1427 1.520174 CGCATCTACATGAACGAGCAG 59.480 52.381 0.00 0.00 32.31 4.24
1427 1428 1.863454 GCATCTACATGAACGAGCAGG 59.137 52.381 0.00 0.00 30.57 4.85
1428 1429 2.477825 CATCTACATGAACGAGCAGGG 58.522 52.381 0.00 0.00 30.57 4.45
1429 1430 0.824109 TCTACATGAACGAGCAGGGG 59.176 55.000 0.00 0.00 0.00 4.79
1430 1431 0.824109 CTACATGAACGAGCAGGGGA 59.176 55.000 0.00 0.00 0.00 4.81
1431 1432 1.414181 CTACATGAACGAGCAGGGGAT 59.586 52.381 0.00 0.00 0.00 3.85
1432 1433 0.179000 ACATGAACGAGCAGGGGATC 59.821 55.000 0.00 0.00 0.00 3.36
1433 1434 0.178767 CATGAACGAGCAGGGGATCA 59.821 55.000 0.00 0.00 0.00 2.92
1434 1435 0.911769 ATGAACGAGCAGGGGATCAA 59.088 50.000 0.00 0.00 0.00 2.57
1435 1436 0.036388 TGAACGAGCAGGGGATCAAC 60.036 55.000 0.00 0.00 0.00 3.18
1436 1437 1.079127 AACGAGCAGGGGATCAACG 60.079 57.895 0.00 0.00 0.00 4.10
1437 1438 2.892425 CGAGCAGGGGATCAACGC 60.892 66.667 0.00 0.00 0.00 4.84
1438 1439 2.586792 GAGCAGGGGATCAACGCT 59.413 61.111 0.00 0.00 35.14 5.07
1439 1440 1.522580 GAGCAGGGGATCAACGCTC 60.523 63.158 9.10 9.10 41.98 5.03
1440 1441 2.244117 GAGCAGGGGATCAACGCTCA 62.244 60.000 16.31 0.00 46.55 4.26
1441 1442 1.817099 GCAGGGGATCAACGCTCAG 60.817 63.158 0.00 0.00 0.00 3.35
1442 1443 1.153289 CAGGGGATCAACGCTCAGG 60.153 63.158 0.00 0.00 0.00 3.86
1443 1444 1.613630 AGGGGATCAACGCTCAGGT 60.614 57.895 0.00 0.00 0.00 4.00
1444 1445 0.325296 AGGGGATCAACGCTCAGGTA 60.325 55.000 0.00 0.00 0.00 3.08
1445 1446 0.539986 GGGGATCAACGCTCAGGTAA 59.460 55.000 0.00 0.00 0.00 2.85
1446 1447 1.141053 GGGGATCAACGCTCAGGTAAT 59.859 52.381 0.00 0.00 0.00 1.89
1447 1448 2.484889 GGGATCAACGCTCAGGTAATC 58.515 52.381 0.00 0.00 0.00 1.75
1448 1449 2.484889 GGATCAACGCTCAGGTAATCC 58.515 52.381 0.00 0.00 0.00 3.01
1449 1450 2.158957 GGATCAACGCTCAGGTAATCCA 60.159 50.000 0.00 0.00 35.89 3.41
1450 1451 3.531538 GATCAACGCTCAGGTAATCCAA 58.468 45.455 0.00 0.00 35.89 3.53
1451 1452 3.410631 TCAACGCTCAGGTAATCCAAA 57.589 42.857 0.00 0.00 35.89 3.28
1452 1453 3.071479 TCAACGCTCAGGTAATCCAAAC 58.929 45.455 0.00 0.00 35.89 2.93
1453 1454 2.109425 ACGCTCAGGTAATCCAAACC 57.891 50.000 0.00 0.00 37.27 3.27
1454 1455 1.339727 ACGCTCAGGTAATCCAAACCC 60.340 52.381 0.00 0.00 37.77 4.11
1455 1456 1.339631 CGCTCAGGTAATCCAAACCCA 60.340 52.381 0.00 0.00 37.77 4.51
1456 1457 2.802719 GCTCAGGTAATCCAAACCCAA 58.197 47.619 0.00 0.00 37.77 4.12
1457 1458 3.161866 GCTCAGGTAATCCAAACCCAAA 58.838 45.455 0.00 0.00 37.77 3.28
1458 1459 3.576550 GCTCAGGTAATCCAAACCCAAAA 59.423 43.478 0.00 0.00 37.77 2.44
1459 1460 4.039852 GCTCAGGTAATCCAAACCCAAAAA 59.960 41.667 0.00 0.00 37.77 1.94
1460 1461 5.538118 CTCAGGTAATCCAAACCCAAAAAC 58.462 41.667 0.00 0.00 37.77 2.43
1461 1462 4.962995 TCAGGTAATCCAAACCCAAAAACA 59.037 37.500 0.00 0.00 37.77 2.83
1462 1463 5.053811 CAGGTAATCCAAACCCAAAAACAC 58.946 41.667 0.00 0.00 37.77 3.32
1463 1464 4.966168 AGGTAATCCAAACCCAAAAACACT 59.034 37.500 0.00 0.00 37.77 3.55
1464 1465 5.427157 AGGTAATCCAAACCCAAAAACACTT 59.573 36.000 0.00 0.00 37.77 3.16
1465 1466 5.525745 GGTAATCCAAACCCAAAAACACTTG 59.474 40.000 0.00 0.00 0.00 3.16
1466 1467 2.979240 TCCAAACCCAAAAACACTTGC 58.021 42.857 0.00 0.00 0.00 4.01
1467 1468 2.569404 TCCAAACCCAAAAACACTTGCT 59.431 40.909 0.00 0.00 0.00 3.91
1468 1469 2.935849 CCAAACCCAAAAACACTTGCTC 59.064 45.455 0.00 0.00 0.00 4.26
1469 1470 3.369366 CCAAACCCAAAAACACTTGCTCT 60.369 43.478 0.00 0.00 0.00 4.09
1470 1471 3.525268 AACCCAAAAACACTTGCTCTG 57.475 42.857 0.00 0.00 0.00 3.35
1471 1472 1.756538 ACCCAAAAACACTTGCTCTGG 59.243 47.619 0.00 0.00 0.00 3.86
1472 1473 1.756538 CCCAAAAACACTTGCTCTGGT 59.243 47.619 0.00 0.00 0.00 4.00
1473 1474 2.168313 CCCAAAAACACTTGCTCTGGTT 59.832 45.455 0.00 0.00 0.00 3.67
1474 1475 3.369366 CCCAAAAACACTTGCTCTGGTTT 60.369 43.478 0.00 0.00 35.15 3.27
1475 1476 4.252878 CCAAAAACACTTGCTCTGGTTTT 58.747 39.130 0.00 0.00 43.15 2.43
1501 1502 7.783090 TTTTTAATCAATGCACACACATGTT 57.217 28.000 0.00 0.00 36.72 2.71
1502 1503 8.877808 TTTTTAATCAATGCACACACATGTTA 57.122 26.923 0.00 0.00 36.72 2.41
1503 1504 9.486497 TTTTTAATCAATGCACACACATGTTAT 57.514 25.926 0.00 0.00 36.72 1.89
1504 1505 8.463456 TTTAATCAATGCACACACATGTTATG 57.537 30.769 0.00 0.00 36.72 1.90
1505 1506 3.835779 TCAATGCACACACATGTTATGC 58.164 40.909 15.61 15.61 36.72 3.14
1506 1507 3.255149 TCAATGCACACACATGTTATGCA 59.745 39.130 23.47 23.47 38.99 3.96
1507 1508 2.702898 TGCACACACATGTTATGCAC 57.297 45.000 19.49 8.04 36.72 4.57
1508 1509 2.228925 TGCACACACATGTTATGCACT 58.771 42.857 19.49 0.00 36.72 4.40
1509 1510 2.030981 TGCACACACATGTTATGCACTG 60.031 45.455 19.49 7.60 36.72 3.66
1510 1511 2.030893 GCACACACATGTTATGCACTGT 60.031 45.455 16.96 0.00 36.72 3.55
1511 1512 3.188254 GCACACACATGTTATGCACTGTA 59.812 43.478 16.96 0.00 36.72 2.74
1512 1513 4.320129 GCACACACATGTTATGCACTGTAA 60.320 41.667 16.96 0.00 36.72 2.41
1513 1514 5.756849 CACACACATGTTATGCACTGTAAA 58.243 37.500 0.00 0.00 36.72 2.01
1514 1515 6.380995 CACACACATGTTATGCACTGTAAAT 58.619 36.000 0.00 0.00 36.72 1.40
1515 1516 7.525759 CACACACATGTTATGCACTGTAAATA 58.474 34.615 0.00 0.00 36.72 1.40
1516 1517 8.020244 CACACACATGTTATGCACTGTAAATAA 58.980 33.333 0.00 0.00 36.72 1.40
1517 1518 8.739039 ACACACATGTTATGCACTGTAAATAAT 58.261 29.630 0.00 0.00 34.46 1.28
1518 1519 9.012448 CACACATGTTATGCACTGTAAATAATG 57.988 33.333 0.00 0.00 0.00 1.90
1519 1520 8.955388 ACACATGTTATGCACTGTAAATAATGA 58.045 29.630 0.00 0.00 0.00 2.57
1520 1521 9.955208 CACATGTTATGCACTGTAAATAATGAT 57.045 29.630 0.00 0.00 0.00 2.45
1521 1522 9.955208 ACATGTTATGCACTGTAAATAATGATG 57.045 29.630 0.00 10.85 0.00 3.07
1529 1530 9.394767 TGCACTGTAAATAATGATGATTGTACT 57.605 29.630 0.00 0.00 0.00 2.73
1539 1540 7.959689 AATGATGATTGTACTACATCTCTGC 57.040 36.000 19.53 0.00 40.39 4.26
1540 1541 6.469782 TGATGATTGTACTACATCTCTGCA 57.530 37.500 19.53 0.00 40.39 4.41
1541 1542 6.877236 TGATGATTGTACTACATCTCTGCAA 58.123 36.000 19.53 0.00 40.39 4.08
1542 1543 6.982724 TGATGATTGTACTACATCTCTGCAAG 59.017 38.462 19.53 0.00 40.39 4.01
1543 1544 6.286240 TGATTGTACTACATCTCTGCAAGT 57.714 37.500 0.00 0.00 33.76 3.16
1544 1545 6.701340 TGATTGTACTACATCTCTGCAAGTT 58.299 36.000 0.00 0.00 33.76 2.66
1545 1546 7.161404 TGATTGTACTACATCTCTGCAAGTTT 58.839 34.615 0.00 0.00 33.76 2.66
1546 1547 6.785488 TTGTACTACATCTCTGCAAGTTTG 57.215 37.500 0.00 0.00 33.76 2.93
1547 1548 6.096673 TGTACTACATCTCTGCAAGTTTGA 57.903 37.500 0.00 0.00 33.76 2.69
1548 1549 6.159293 TGTACTACATCTCTGCAAGTTTGAG 58.841 40.000 0.00 0.00 33.76 3.02
1549 1550 5.474578 ACTACATCTCTGCAAGTTTGAGA 57.525 39.130 5.20 5.20 40.52 3.27
1550 1551 5.233988 ACTACATCTCTGCAAGTTTGAGAC 58.766 41.667 4.87 0.00 39.29 3.36
1551 1552 4.077300 ACATCTCTGCAAGTTTGAGACA 57.923 40.909 4.87 0.00 39.29 3.41
1552 1553 4.063689 ACATCTCTGCAAGTTTGAGACAG 58.936 43.478 4.87 4.30 39.29 3.51
1553 1554 3.827008 TCTCTGCAAGTTTGAGACAGT 57.173 42.857 0.00 0.00 32.63 3.55
1554 1555 4.142609 TCTCTGCAAGTTTGAGACAGTT 57.857 40.909 0.00 0.00 32.63 3.16
1555 1556 4.122776 TCTCTGCAAGTTTGAGACAGTTC 58.877 43.478 0.00 0.00 32.63 3.01
1556 1557 4.125703 CTCTGCAAGTTTGAGACAGTTCT 58.874 43.478 0.00 0.00 33.76 3.01
1557 1558 3.873361 TCTGCAAGTTTGAGACAGTTCTG 59.127 43.478 0.00 0.00 33.76 3.02
1558 1559 3.872696 TGCAAGTTTGAGACAGTTCTGA 58.127 40.909 6.83 0.00 29.47 3.27
1559 1560 4.260985 TGCAAGTTTGAGACAGTTCTGAA 58.739 39.130 6.83 0.00 29.47 3.02
1560 1561 4.094887 TGCAAGTTTGAGACAGTTCTGAAC 59.905 41.667 12.54 12.54 29.47 3.18
1561 1562 4.094887 GCAAGTTTGAGACAGTTCTGAACA 59.905 41.667 21.50 0.00 31.36 3.18
1562 1563 5.220931 GCAAGTTTGAGACAGTTCTGAACAT 60.221 40.000 21.50 9.85 31.36 2.71
1563 1564 6.017934 GCAAGTTTGAGACAGTTCTGAACATA 60.018 38.462 21.50 0.00 31.36 2.29
1564 1565 7.308229 GCAAGTTTGAGACAGTTCTGAACATAT 60.308 37.037 21.50 7.40 31.36 1.78
1565 1566 9.208022 CAAGTTTGAGACAGTTCTGAACATATA 57.792 33.333 21.50 1.48 31.36 0.86
1566 1567 9.950496 AAGTTTGAGACAGTTCTGAACATATAT 57.050 29.630 21.50 4.66 31.36 0.86
1571 1572 9.634021 TGAGACAGTTCTGAACATATATAGTCT 57.366 33.333 21.50 18.54 34.50 3.24
1573 1574 9.634021 AGACAGTTCTGAACATATATAGTCTCA 57.366 33.333 21.50 0.00 0.00 3.27
1574 1575 9.891828 GACAGTTCTGAACATATATAGTCTCAG 57.108 37.037 21.50 9.78 33.21 3.35
1575 1576 9.634021 ACAGTTCTGAACATATATAGTCTCAGA 57.366 33.333 21.50 12.87 37.97 3.27
1580 1581 9.072375 TCTGAACATATATAGTCTCAGAACTGG 57.928 37.037 13.87 0.00 37.08 4.00
1581 1582 8.768501 TGAACATATATAGTCTCAGAACTGGT 57.231 34.615 1.93 0.00 0.00 4.00
1582 1583 9.201989 TGAACATATATAGTCTCAGAACTGGTT 57.798 33.333 1.93 0.00 0.00 3.67
1590 1591 8.779354 ATAGTCTCAGAACTGGTTTAACAATC 57.221 34.615 0.00 0.00 0.00 2.67
1591 1592 6.591935 AGTCTCAGAACTGGTTTAACAATCA 58.408 36.000 0.00 0.00 0.00 2.57
1592 1593 7.054124 AGTCTCAGAACTGGTTTAACAATCAA 58.946 34.615 0.00 0.00 0.00 2.57
1593 1594 7.227512 AGTCTCAGAACTGGTTTAACAATCAAG 59.772 37.037 0.00 0.00 0.00 3.02
1594 1595 7.012421 GTCTCAGAACTGGTTTAACAATCAAGT 59.988 37.037 0.00 0.00 0.00 3.16
1595 1596 7.556275 TCTCAGAACTGGTTTAACAATCAAGTT 59.444 33.333 0.00 0.00 35.55 2.66
1596 1597 8.740123 TCAGAACTGGTTTAACAATCAAGTTA 57.260 30.769 0.00 0.00 33.07 2.24
1597 1598 9.179909 TCAGAACTGGTTTAACAATCAAGTTAA 57.820 29.630 0.00 0.00 40.96 2.01
1598 1599 9.965824 CAGAACTGGTTTAACAATCAAGTTAAT 57.034 29.630 0.00 0.00 41.89 1.40
1599 1600 9.965824 AGAACTGGTTTAACAATCAAGTTAATG 57.034 29.630 0.00 0.00 41.89 1.90
1600 1601 9.744468 GAACTGGTTTAACAATCAAGTTAATGT 57.256 29.630 0.00 0.00 41.89 2.71
1601 1602 9.744468 AACTGGTTTAACAATCAAGTTAATGTC 57.256 29.630 0.00 0.00 41.89 3.06
1602 1603 8.908903 ACTGGTTTAACAATCAAGTTAATGTCA 58.091 29.630 0.00 0.00 41.89 3.58
1603 1604 9.180678 CTGGTTTAACAATCAAGTTAATGTCAC 57.819 33.333 0.00 0.00 41.89 3.67
1604 1605 8.687242 TGGTTTAACAATCAAGTTAATGTCACA 58.313 29.630 0.00 0.00 41.89 3.58
1605 1606 8.964150 GGTTTAACAATCAAGTTAATGTCACAC 58.036 33.333 0.00 0.00 41.89 3.82
1606 1607 9.509855 GTTTAACAATCAAGTTAATGTCACACA 57.490 29.630 0.00 0.00 41.89 3.72
1607 1608 9.509855 TTTAACAATCAAGTTAATGTCACACAC 57.490 29.630 0.00 0.00 41.89 3.82
1608 1609 6.942532 ACAATCAAGTTAATGTCACACACT 57.057 33.333 0.00 0.00 0.00 3.55
1609 1610 7.333528 ACAATCAAGTTAATGTCACACACTT 57.666 32.000 0.00 0.00 0.00 3.16
1610 1611 7.771183 ACAATCAAGTTAATGTCACACACTTT 58.229 30.769 0.00 0.00 0.00 2.66
1611 1612 8.898761 ACAATCAAGTTAATGTCACACACTTTA 58.101 29.630 0.00 0.00 0.00 1.85
1612 1613 9.729023 CAATCAAGTTAATGTCACACACTTTAA 57.271 29.630 0.00 0.00 34.03 1.52
1614 1615 9.897744 ATCAAGTTAATGTCACACACTTTAATG 57.102 29.630 0.00 0.00 37.11 1.90
1615 1616 7.860373 TCAAGTTAATGTCACACACTTTAATGC 59.140 33.333 0.00 0.00 37.11 3.56
1616 1617 7.270757 AGTTAATGTCACACACTTTAATGCA 57.729 32.000 0.00 0.00 37.11 3.96
1617 1618 7.885297 AGTTAATGTCACACACTTTAATGCAT 58.115 30.769 0.00 0.00 37.11 3.96
1618 1619 8.359642 AGTTAATGTCACACACTTTAATGCATT 58.640 29.630 17.56 17.56 37.11 3.56
1619 1620 9.619316 GTTAATGTCACACACTTTAATGCATTA 57.381 29.630 15.21 15.21 37.11 1.90
1621 1622 8.519492 AATGTCACACACTTTAATGCATTAAC 57.481 30.769 27.44 15.79 32.42 2.01
1622 1623 6.442952 TGTCACACACTTTAATGCATTAACC 58.557 36.000 27.44 10.23 32.42 2.85
1623 1624 5.861787 GTCACACACTTTAATGCATTAACCC 59.138 40.000 27.44 7.57 32.42 4.11
1624 1625 5.536538 TCACACACTTTAATGCATTAACCCA 59.463 36.000 27.44 14.80 32.42 4.51
1625 1626 6.040955 TCACACACTTTAATGCATTAACCCAA 59.959 34.615 27.44 14.48 32.42 4.12
1626 1627 6.145371 CACACACTTTAATGCATTAACCCAAC 59.855 38.462 27.44 0.00 32.42 3.77
1627 1628 6.183360 ACACACTTTAATGCATTAACCCAACA 60.183 34.615 27.44 13.52 32.42 3.33
1628 1629 6.703607 CACACTTTAATGCATTAACCCAACAA 59.296 34.615 27.44 12.89 32.42 2.83
1629 1630 6.704050 ACACTTTAATGCATTAACCCAACAAC 59.296 34.615 27.44 0.00 32.42 3.32
1630 1631 6.703607 CACTTTAATGCATTAACCCAACAACA 59.296 34.615 27.44 11.63 32.42 3.33
1631 1632 6.704050 ACTTTAATGCATTAACCCAACAACAC 59.296 34.615 27.44 0.00 32.42 3.32
1632 1633 4.953940 AATGCATTAACCCAACAACACT 57.046 36.364 11.02 0.00 0.00 3.55
1633 1634 7.526142 TTAATGCATTAACCCAACAACACTA 57.474 32.000 24.63 1.17 0.00 2.74
1634 1635 5.643379 ATGCATTAACCCAACAACACTAG 57.357 39.130 0.00 0.00 0.00 2.57
1635 1636 4.465886 TGCATTAACCCAACAACACTAGT 58.534 39.130 0.00 0.00 0.00 2.57
1636 1637 4.517453 TGCATTAACCCAACAACACTAGTC 59.483 41.667 0.00 0.00 0.00 2.59
1637 1638 4.760204 GCATTAACCCAACAACACTAGTCT 59.240 41.667 0.00 0.00 0.00 3.24
1638 1639 5.240844 GCATTAACCCAACAACACTAGTCTT 59.759 40.000 0.00 0.00 0.00 3.01
1639 1640 6.668323 CATTAACCCAACAACACTAGTCTTG 58.332 40.000 9.11 9.11 0.00 3.02
1640 1641 3.208747 ACCCAACAACACTAGTCTTGG 57.791 47.619 14.39 11.78 36.16 3.61
1641 1642 1.880027 CCCAACAACACTAGTCTTGGC 59.120 52.381 14.39 0.00 35.55 4.52
1642 1643 2.571212 CCAACAACACTAGTCTTGGCA 58.429 47.619 14.39 0.00 32.06 4.92
1643 1644 2.290641 CCAACAACACTAGTCTTGGCAC 59.709 50.000 14.39 0.00 32.06 5.01
1644 1645 2.942376 CAACAACACTAGTCTTGGCACA 59.058 45.455 14.39 0.00 0.00 4.57
1662 1663 7.416964 TGGCACAAGCAATATATTTAGGTTT 57.583 32.000 0.00 0.00 44.61 3.27
1663 1664 7.264221 TGGCACAAGCAATATATTTAGGTTTG 58.736 34.615 0.00 2.79 44.61 2.93
1664 1665 7.093552 TGGCACAAGCAATATATTTAGGTTTGT 60.094 33.333 9.34 9.34 44.61 2.83
1665 1666 7.435192 GGCACAAGCAATATATTTAGGTTTGTC 59.565 37.037 11.22 8.12 44.61 3.18
1666 1667 7.973388 GCACAAGCAATATATTTAGGTTTGTCA 59.027 33.333 11.22 0.00 41.58 3.58
1667 1668 9.289303 CACAAGCAATATATTTAGGTTTGTCAC 57.711 33.333 11.22 0.00 0.00 3.67
1676 1677 3.487576 GGTTTGTCACCACAGTCCA 57.512 52.632 0.00 0.00 46.42 4.02
1677 1678 1.757682 GGTTTGTCACCACAGTCCAA 58.242 50.000 0.00 0.00 46.42 3.53
1678 1679 2.096248 GGTTTGTCACCACAGTCCAAA 58.904 47.619 0.00 0.00 46.42 3.28
1679 1680 2.099098 GGTTTGTCACCACAGTCCAAAG 59.901 50.000 0.00 0.00 46.42 2.77
1680 1681 1.388547 TTGTCACCACAGTCCAAAGC 58.611 50.000 0.00 0.00 32.71 3.51
1681 1682 0.254462 TGTCACCACAGTCCAAAGCA 59.746 50.000 0.00 0.00 0.00 3.91
1682 1683 1.340502 TGTCACCACAGTCCAAAGCAA 60.341 47.619 0.00 0.00 0.00 3.91
1683 1684 1.956477 GTCACCACAGTCCAAAGCAAT 59.044 47.619 0.00 0.00 0.00 3.56
1684 1685 1.955778 TCACCACAGTCCAAAGCAATG 59.044 47.619 0.00 0.00 0.00 2.82
1685 1686 1.682854 CACCACAGTCCAAAGCAATGT 59.317 47.619 0.00 0.00 0.00 2.71
1686 1687 1.956477 ACCACAGTCCAAAGCAATGTC 59.044 47.619 0.00 0.00 0.00 3.06
1687 1688 1.955778 CCACAGTCCAAAGCAATGTCA 59.044 47.619 0.00 0.00 0.00 3.58
1688 1689 2.287788 CCACAGTCCAAAGCAATGTCAC 60.288 50.000 0.00 0.00 0.00 3.67
1689 1690 2.358582 CACAGTCCAAAGCAATGTCACA 59.641 45.455 0.00 0.00 0.00 3.58
1690 1691 3.005050 CACAGTCCAAAGCAATGTCACAT 59.995 43.478 0.00 0.00 0.00 3.21
1691 1692 3.254166 ACAGTCCAAAGCAATGTCACATC 59.746 43.478 0.00 0.00 0.00 3.06
1692 1693 3.504906 CAGTCCAAAGCAATGTCACATCT 59.495 43.478 0.00 0.00 0.00 2.90
1693 1694 3.755378 AGTCCAAAGCAATGTCACATCTC 59.245 43.478 0.00 0.00 0.00 2.75
1694 1695 3.084039 TCCAAAGCAATGTCACATCTCC 58.916 45.455 0.00 0.00 0.00 3.71
1695 1696 3.087031 CCAAAGCAATGTCACATCTCCT 58.913 45.455 0.00 0.00 0.00 3.69
1696 1697 3.128242 CCAAAGCAATGTCACATCTCCTC 59.872 47.826 0.00 0.00 0.00 3.71
1697 1698 3.708403 AAGCAATGTCACATCTCCTCA 57.292 42.857 0.00 0.00 0.00 3.86
1698 1699 2.983229 AGCAATGTCACATCTCCTCAC 58.017 47.619 0.00 0.00 0.00 3.51
1699 1700 2.303890 AGCAATGTCACATCTCCTCACA 59.696 45.455 0.00 0.00 0.00 3.58
1700 1701 3.076621 GCAATGTCACATCTCCTCACAA 58.923 45.455 0.00 0.00 0.00 3.33
1701 1702 3.120060 GCAATGTCACATCTCCTCACAAC 60.120 47.826 0.00 0.00 0.00 3.32
1702 1703 4.321718 CAATGTCACATCTCCTCACAACT 58.678 43.478 0.00 0.00 0.00 3.16
1703 1704 4.630644 ATGTCACATCTCCTCACAACTT 57.369 40.909 0.00 0.00 0.00 2.66
1704 1705 4.422073 TGTCACATCTCCTCACAACTTT 57.578 40.909 0.00 0.00 0.00 2.66
1705 1706 4.780815 TGTCACATCTCCTCACAACTTTT 58.219 39.130 0.00 0.00 0.00 2.27
1706 1707 4.576053 TGTCACATCTCCTCACAACTTTTG 59.424 41.667 0.00 0.00 0.00 2.44
1707 1708 4.576463 GTCACATCTCCTCACAACTTTTGT 59.424 41.667 0.00 0.00 46.75 2.83
1708 1709 5.758296 GTCACATCTCCTCACAACTTTTGTA 59.242 40.000 0.00 0.00 43.23 2.41
1709 1710 6.428159 GTCACATCTCCTCACAACTTTTGTAT 59.572 38.462 0.00 0.00 43.23 2.29
1710 1711 6.998074 TCACATCTCCTCACAACTTTTGTATT 59.002 34.615 0.00 0.00 43.23 1.89
1711 1712 7.173218 TCACATCTCCTCACAACTTTTGTATTC 59.827 37.037 0.00 0.00 43.23 1.75
1712 1713 6.147821 ACATCTCCTCACAACTTTTGTATTCG 59.852 38.462 0.00 0.00 43.23 3.34
1719 1720 7.384115 CCTCACAACTTTTGTATTCGTCTTAGA 59.616 37.037 0.00 0.00 43.23 2.10
1762 1766 5.817296 AGCGCAAAATATGAAGAGTGATACA 59.183 36.000 11.47 0.00 0.00 2.29
1765 1769 7.121911 CGCAAAATATGAAGAGTGATACACTG 58.878 38.462 9.15 0.00 45.44 3.66
1775 1779 9.799106 TGAAGAGTGATACACTGATATATCTGA 57.201 33.333 22.28 4.68 45.44 3.27
1799 1803 2.514592 GCCGCAGCTTCCAGCATA 60.515 61.111 0.00 0.00 45.56 3.14
1800 1804 2.828128 GCCGCAGCTTCCAGCATAC 61.828 63.158 0.00 0.00 45.56 2.39
1813 1817 6.598064 GCTTCCAGCATACCTACTTTTCTAAA 59.402 38.462 0.00 0.00 41.89 1.85
1816 1820 8.732746 TCCAGCATACCTACTTTTCTAAATTC 57.267 34.615 0.00 0.00 0.00 2.17
1885 1889 4.803426 CGCGGACTGGCTCAGGAC 62.803 72.222 0.00 1.66 35.51 3.85
1917 1921 5.457140 GCTTCTCTGATATACTCGTCCAAG 58.543 45.833 0.00 0.00 0.00 3.61
1933 1937 1.662026 CCAAGTTTCGCCAGCGTTAAC 60.662 52.381 12.32 16.00 40.74 2.01
1952 1956 2.491621 GGGCATGCTTTTCCTCGC 59.508 61.111 18.92 0.00 0.00 5.03
1976 1980 3.313803 TCAAACTGCGCTACAAACAATCA 59.686 39.130 9.73 0.00 0.00 2.57
2168 2258 8.758633 TTAGTTCTAGTCACAAGTCTAAATGC 57.241 34.615 0.00 0.00 0.00 3.56
2199 2289 6.045318 ACATAGCAACAGATATGTGACTGTC 58.955 40.000 6.90 0.00 44.94 3.51
2200 2290 4.815533 AGCAACAGATATGTGACTGTCT 57.184 40.909 6.90 3.27 44.94 3.41
2201 2291 4.502016 AGCAACAGATATGTGACTGTCTG 58.498 43.478 6.90 9.65 44.94 3.51
2232 2331 3.941483 CCATTTCAGCTCATAACCTCGTT 59.059 43.478 0.00 0.00 0.00 3.85
2240 2339 4.863131 AGCTCATAACCTCGTTTTCTTACG 59.137 41.667 0.00 0.00 42.68 3.18
2245 2344 3.294816 ACCTCGTTTTCTTACGACTCC 57.705 47.619 0.00 0.00 44.82 3.85
2246 2345 2.624838 ACCTCGTTTTCTTACGACTCCA 59.375 45.455 0.00 0.00 44.82 3.86
2249 2348 4.326548 CCTCGTTTTCTTACGACTCCAATC 59.673 45.833 0.00 0.00 44.82 2.67
2261 2360 3.186409 CGACTCCAATCACAATTTCACGT 59.814 43.478 0.00 0.00 0.00 4.49
2264 2363 5.519722 ACTCCAATCACAATTTCACGTTTC 58.480 37.500 0.00 0.00 0.00 2.78
2303 2402 4.251543 GGAGCTTCTCCTGATAACTAGC 57.748 50.000 5.65 0.00 46.41 3.42
2304 2403 3.639094 GGAGCTTCTCCTGATAACTAGCA 59.361 47.826 5.65 0.00 46.41 3.49
2305 2404 4.283212 GGAGCTTCTCCTGATAACTAGCAT 59.717 45.833 5.65 0.00 46.41 3.79
2306 2405 5.467035 AGCTTCTCCTGATAACTAGCATC 57.533 43.478 0.00 0.00 0.00 3.91
2307 2406 4.022416 AGCTTCTCCTGATAACTAGCATCG 60.022 45.833 0.00 0.00 0.00 3.84
2354 2466 7.387397 TCATTCAAAATGGTGGAATTAACTTGC 59.613 33.333 0.19 0.00 0.00 4.01
2388 2500 9.561069 ACAGATTTCTATTGAAACTAGTGTGTT 57.439 29.630 4.42 0.00 43.90 3.32
2396 2508 3.784488 GAAACTAGTGTGTTTCGCTTCG 58.216 45.455 0.00 0.00 43.85 3.79
2397 2509 1.137513 ACTAGTGTGTTTCGCTTCGC 58.862 50.000 0.00 0.00 38.01 4.70
2398 2510 1.269621 ACTAGTGTGTTTCGCTTCGCT 60.270 47.619 0.00 0.00 38.01 4.93
2399 2511 1.387084 CTAGTGTGTTTCGCTTCGCTC 59.613 52.381 0.00 0.00 38.01 5.03
2400 2512 1.204312 GTGTGTTTCGCTTCGCTCC 59.796 57.895 0.00 0.00 0.00 4.70
2401 2513 1.959226 TGTGTTTCGCTTCGCTCCC 60.959 57.895 0.00 0.00 0.00 4.30
2402 2514 2.358247 TGTTTCGCTTCGCTCCCC 60.358 61.111 0.00 0.00 0.00 4.81
2403 2515 3.125573 GTTTCGCTTCGCTCCCCC 61.126 66.667 0.00 0.00 0.00 5.40
2448 2560 9.859427 TCTTAATTTGTTTTCTGATAATGCTGG 57.141 29.630 0.00 0.00 0.00 4.85
2449 2561 9.090692 CTTAATTTGTTTTCTGATAATGCTGGG 57.909 33.333 0.00 0.00 0.00 4.45
2450 2562 4.454728 TTGTTTTCTGATAATGCTGGGC 57.545 40.909 0.00 0.00 0.00 5.36
2451 2563 2.760092 TGTTTTCTGATAATGCTGGGCC 59.240 45.455 0.00 0.00 0.00 5.80
2452 2564 2.760092 GTTTTCTGATAATGCTGGGCCA 59.240 45.455 5.85 5.85 0.00 5.36
2453 2565 2.824689 TTCTGATAATGCTGGGCCAA 57.175 45.000 8.04 0.00 0.00 4.52
2454 2566 2.353357 TCTGATAATGCTGGGCCAAG 57.647 50.000 8.04 1.30 0.00 3.61
2455 2567 0.672342 CTGATAATGCTGGGCCAAGC 59.328 55.000 26.51 26.51 43.82 4.01
2466 2578 3.356814 GGCCAAGCCCTTTCACTAA 57.643 52.632 0.00 0.00 44.06 2.24
2467 2579 1.627864 GGCCAAGCCCTTTCACTAAA 58.372 50.000 0.00 0.00 44.06 1.85
2468 2580 1.272490 GGCCAAGCCCTTTCACTAAAC 59.728 52.381 0.00 0.00 44.06 2.01
2469 2581 2.239400 GCCAAGCCCTTTCACTAAACT 58.761 47.619 0.00 0.00 0.00 2.66
2470 2582 3.418047 GCCAAGCCCTTTCACTAAACTA 58.582 45.455 0.00 0.00 0.00 2.24
2471 2583 3.440522 GCCAAGCCCTTTCACTAAACTAG 59.559 47.826 0.00 0.00 0.00 2.57
2472 2584 4.652822 CCAAGCCCTTTCACTAAACTAGT 58.347 43.478 0.00 0.00 40.28 2.57
2473 2585 4.695928 CCAAGCCCTTTCACTAAACTAGTC 59.304 45.833 0.00 0.00 36.76 2.59
2474 2586 4.189639 AGCCCTTTCACTAAACTAGTCG 57.810 45.455 0.00 0.00 36.76 4.18
2475 2587 3.056035 AGCCCTTTCACTAAACTAGTCGG 60.056 47.826 0.00 0.00 36.76 4.79
2476 2588 3.259902 CCCTTTCACTAAACTAGTCGGC 58.740 50.000 0.00 0.00 36.76 5.54
2477 2589 3.056035 CCCTTTCACTAAACTAGTCGGCT 60.056 47.826 0.00 0.00 36.76 5.52
2478 2590 4.159135 CCCTTTCACTAAACTAGTCGGCTA 59.841 45.833 0.00 0.00 36.76 3.93
2479 2591 5.337009 CCCTTTCACTAAACTAGTCGGCTAA 60.337 44.000 0.00 0.00 36.76 3.09
2493 2605 8.242739 ACTAGTCGGCTAAAACTCTAAAAGTAG 58.757 37.037 0.00 0.00 37.17 2.57
2494 2606 6.396450 AGTCGGCTAAAACTCTAAAAGTAGG 58.604 40.000 0.00 0.00 37.17 3.18
2495 2607 6.014755 AGTCGGCTAAAACTCTAAAAGTAGGT 60.015 38.462 0.00 0.00 37.17 3.08
2496 2608 6.648310 GTCGGCTAAAACTCTAAAAGTAGGTT 59.352 38.462 0.00 0.00 37.17 3.50
2497 2609 7.172190 GTCGGCTAAAACTCTAAAAGTAGGTTT 59.828 37.037 0.00 0.00 37.17 3.27
2498 2610 8.367156 TCGGCTAAAACTCTAAAAGTAGGTTTA 58.633 33.333 0.00 0.00 37.17 2.01
2499 2611 8.992073 CGGCTAAAACTCTAAAAGTAGGTTTAA 58.008 33.333 0.00 0.00 37.17 1.52
2505 2617 9.910267 AAACTCTAAAAGTAGGTTTAACCAAGA 57.090 29.630 17.10 6.22 37.83 3.02
2507 2619 9.722184 ACTCTAAAAGTAGGTTTAACCAAGATC 57.278 33.333 17.10 1.99 41.95 2.75
2508 2620 9.945904 CTCTAAAAGTAGGTTTAACCAAGATCT 57.054 33.333 17.10 4.17 41.95 2.75
2509 2621 9.720769 TCTAAAAGTAGGTTTAACCAAGATCTG 57.279 33.333 17.10 0.72 41.95 2.90
2510 2622 9.503399 CTAAAAGTAGGTTTAACCAAGATCTGT 57.497 33.333 17.10 0.00 41.95 3.41
2511 2623 7.745620 AAAGTAGGTTTAACCAAGATCTGTG 57.254 36.000 17.10 0.00 41.95 3.66
2512 2624 5.246307 AGTAGGTTTAACCAAGATCTGTGC 58.754 41.667 17.10 0.00 41.95 4.57
2513 2625 4.373156 AGGTTTAACCAAGATCTGTGCT 57.627 40.909 17.10 0.00 41.95 4.40
2514 2626 4.074970 AGGTTTAACCAAGATCTGTGCTG 58.925 43.478 17.10 0.00 41.95 4.41
2515 2627 3.821033 GGTTTAACCAAGATCTGTGCTGT 59.179 43.478 9.56 0.00 38.42 4.40
2516 2628 5.001232 GGTTTAACCAAGATCTGTGCTGTA 58.999 41.667 9.56 0.00 38.42 2.74
2517 2629 5.472137 GGTTTAACCAAGATCTGTGCTGTAA 59.528 40.000 9.56 0.00 38.42 2.41
2518 2630 6.371389 GTTTAACCAAGATCTGTGCTGTAAC 58.629 40.000 0.00 0.00 0.00 2.50
2519 2631 4.357918 AACCAAGATCTGTGCTGTAACT 57.642 40.909 0.00 0.00 0.00 2.24
2520 2632 4.357918 ACCAAGATCTGTGCTGTAACTT 57.642 40.909 0.00 0.00 0.00 2.66
2521 2633 4.718961 ACCAAGATCTGTGCTGTAACTTT 58.281 39.130 0.00 0.00 0.00 2.66
2522 2634 4.757149 ACCAAGATCTGTGCTGTAACTTTC 59.243 41.667 0.00 0.00 0.00 2.62
2523 2635 4.756642 CCAAGATCTGTGCTGTAACTTTCA 59.243 41.667 0.00 0.00 0.00 2.69
2524 2636 5.413833 CCAAGATCTGTGCTGTAACTTTCAT 59.586 40.000 0.00 0.00 0.00 2.57
2525 2637 6.312487 CAAGATCTGTGCTGTAACTTTCATG 58.688 40.000 0.00 0.00 0.00 3.07
2526 2638 5.798132 AGATCTGTGCTGTAACTTTCATGA 58.202 37.500 0.00 0.00 0.00 3.07
2527 2639 6.233434 AGATCTGTGCTGTAACTTTCATGAA 58.767 36.000 3.38 3.38 0.00 2.57
2528 2640 5.673337 TCTGTGCTGTAACTTTCATGAAC 57.327 39.130 7.89 0.00 0.00 3.18
2529 2641 4.211164 TCTGTGCTGTAACTTTCATGAACG 59.789 41.667 7.89 9.20 0.00 3.95
2530 2642 3.249799 TGTGCTGTAACTTTCATGAACGG 59.750 43.478 15.57 10.63 0.00 4.44
2531 2643 3.250040 GTGCTGTAACTTTCATGAACGGT 59.750 43.478 15.57 11.87 0.00 4.83
2532 2644 3.496884 TGCTGTAACTTTCATGAACGGTC 59.503 43.478 15.57 0.00 0.00 4.79
2533 2645 3.746492 GCTGTAACTTTCATGAACGGTCT 59.254 43.478 15.57 3.45 0.00 3.85
2534 2646 4.377431 GCTGTAACTTTCATGAACGGTCTG 60.377 45.833 15.57 8.65 0.00 3.51
2535 2647 4.699637 TGTAACTTTCATGAACGGTCTGT 58.300 39.130 15.57 3.60 0.00 3.41
2536 2648 5.120399 TGTAACTTTCATGAACGGTCTGTT 58.880 37.500 15.57 11.92 45.61 3.16
2537 2649 4.552166 AACTTTCATGAACGGTCTGTTG 57.448 40.909 15.57 0.00 42.09 3.33
2538 2650 3.541632 ACTTTCATGAACGGTCTGTTGT 58.458 40.909 15.57 0.00 42.09 3.32
2539 2651 3.945285 ACTTTCATGAACGGTCTGTTGTT 59.055 39.130 15.57 0.00 42.09 2.83
2540 2652 4.035208 ACTTTCATGAACGGTCTGTTGTTC 59.965 41.667 15.57 0.00 42.09 3.18
2543 2655 2.971660 TGAACGGTCTGTTGTTCAGA 57.028 45.000 0.33 0.00 46.86 3.27
2550 2662 2.839486 TCTGTTGTTCAGAGGCGAAT 57.161 45.000 0.00 0.00 46.77 3.34
2551 2663 3.126001 TCTGTTGTTCAGAGGCGAATT 57.874 42.857 0.00 0.00 46.77 2.17
2552 2664 3.476552 TCTGTTGTTCAGAGGCGAATTT 58.523 40.909 0.00 0.00 46.77 1.82
2553 2665 3.882888 TCTGTTGTTCAGAGGCGAATTTT 59.117 39.130 0.00 0.00 46.77 1.82
2554 2666 4.338118 TCTGTTGTTCAGAGGCGAATTTTT 59.662 37.500 0.00 0.00 46.77 1.94
2623 2735 6.680810 TGTCAAAGATACTGAAAATGCAAGG 58.319 36.000 0.00 0.00 0.00 3.61
2638 2750 0.447801 CAAGGCTGCACACCGAATAC 59.552 55.000 0.50 0.00 0.00 1.89
2661 2773 3.068873 GTGGACCAGTTCCTGCTAGATAG 59.931 52.174 0.00 0.00 46.10 2.08
2726 2838 9.914131 TTAGATGGTAGATAATGATCGTTCTTG 57.086 33.333 2.72 0.00 37.15 3.02
2727 2839 6.870965 AGATGGTAGATAATGATCGTTCTTGC 59.129 38.462 2.72 0.00 37.15 4.01
2728 2840 6.161855 TGGTAGATAATGATCGTTCTTGCT 57.838 37.500 2.72 0.75 37.15 3.91
2729 2841 6.216569 TGGTAGATAATGATCGTTCTTGCTC 58.783 40.000 2.72 0.00 37.15 4.26
2730 2842 6.040955 TGGTAGATAATGATCGTTCTTGCTCT 59.959 38.462 2.72 3.30 37.15 4.09
2731 2843 6.364706 GGTAGATAATGATCGTTCTTGCTCTG 59.635 42.308 2.72 0.00 37.15 3.35
2732 2844 5.911752 AGATAATGATCGTTCTTGCTCTGT 58.088 37.500 2.72 0.00 37.15 3.41
2733 2845 6.344500 AGATAATGATCGTTCTTGCTCTGTT 58.656 36.000 2.72 0.00 37.15 3.16
2734 2846 6.820656 AGATAATGATCGTTCTTGCTCTGTTT 59.179 34.615 2.72 0.00 37.15 2.83
2735 2847 7.981789 AGATAATGATCGTTCTTGCTCTGTTTA 59.018 33.333 2.72 0.00 37.15 2.01
2736 2848 6.801539 AATGATCGTTCTTGCTCTGTTTAA 57.198 33.333 0.00 0.00 0.00 1.52
2737 2849 5.845985 TGATCGTTCTTGCTCTGTTTAAG 57.154 39.130 0.00 0.00 0.00 1.85
2738 2850 5.538118 TGATCGTTCTTGCTCTGTTTAAGA 58.462 37.500 0.00 0.00 0.00 2.10
2739 2851 6.166279 TGATCGTTCTTGCTCTGTTTAAGAT 58.834 36.000 0.00 0.00 33.29 2.40
2740 2852 6.650807 TGATCGTTCTTGCTCTGTTTAAGATT 59.349 34.615 0.00 0.00 33.29 2.40
2741 2853 6.861065 TCGTTCTTGCTCTGTTTAAGATTT 57.139 33.333 0.00 0.00 33.29 2.17
2742 2854 6.888430 TCGTTCTTGCTCTGTTTAAGATTTC 58.112 36.000 0.00 0.00 33.29 2.17
2743 2855 6.706270 TCGTTCTTGCTCTGTTTAAGATTTCT 59.294 34.615 0.00 0.00 33.29 2.52
2744 2856 7.870954 TCGTTCTTGCTCTGTTTAAGATTTCTA 59.129 33.333 0.00 0.00 33.29 2.10
2745 2857 8.165428 CGTTCTTGCTCTGTTTAAGATTTCTAG 58.835 37.037 0.00 0.00 33.29 2.43
2746 2858 9.209175 GTTCTTGCTCTGTTTAAGATTTCTAGA 57.791 33.333 0.00 0.00 33.29 2.43
2747 2859 9.950496 TTCTTGCTCTGTTTAAGATTTCTAGAT 57.050 29.630 0.00 0.00 33.29 1.98
2784 2896 9.664332 AATCTACATGGTAGATAATGATTGCTC 57.336 33.333 16.75 0.00 33.49 4.26
2785 2897 8.427902 TCTACATGGTAGATAATGATTGCTCT 57.572 34.615 0.00 0.00 0.00 4.09
2786 2898 8.874156 TCTACATGGTAGATAATGATTGCTCTT 58.126 33.333 0.00 0.00 0.00 2.85
2787 2899 7.741027 ACATGGTAGATAATGATTGCTCTTG 57.259 36.000 0.00 0.00 0.00 3.02
2788 2900 6.206243 ACATGGTAGATAATGATTGCTCTTGC 59.794 38.462 0.00 0.00 40.20 4.01
2789 2901 5.933617 TGGTAGATAATGATTGCTCTTGCT 58.066 37.500 0.00 0.00 40.48 3.91
2790 2902 6.359804 TGGTAGATAATGATTGCTCTTGCTT 58.640 36.000 0.00 0.00 40.48 3.91
2791 2903 6.830324 TGGTAGATAATGATTGCTCTTGCTTT 59.170 34.615 0.00 0.00 40.48 3.51
2792 2904 7.137426 GGTAGATAATGATTGCTCTTGCTTTG 58.863 38.462 0.00 0.00 40.48 2.77
2793 2905 6.770746 AGATAATGATTGCTCTTGCTTTGT 57.229 33.333 0.00 0.00 40.48 2.83
2794 2906 7.166691 AGATAATGATTGCTCTTGCTTTGTT 57.833 32.000 0.00 0.00 40.48 2.83
2795 2907 7.609056 AGATAATGATTGCTCTTGCTTTGTTT 58.391 30.769 0.00 0.00 40.48 2.83
2796 2908 8.742777 AGATAATGATTGCTCTTGCTTTGTTTA 58.257 29.630 0.00 0.00 40.48 2.01
2797 2909 9.357652 GATAATGATTGCTCTTGCTTTGTTTAA 57.642 29.630 0.00 0.00 40.48 1.52
2798 2910 7.647907 AATGATTGCTCTTGCTTTGTTTAAG 57.352 32.000 0.00 0.00 40.48 1.85
2799 2911 6.389830 TGATTGCTCTTGCTTTGTTTAAGA 57.610 33.333 0.00 0.00 40.48 2.10
2800 2912 6.985117 TGATTGCTCTTGCTTTGTTTAAGAT 58.015 32.000 0.00 0.00 40.48 2.40
2801 2913 8.109705 TGATTGCTCTTGCTTTGTTTAAGATA 57.890 30.769 0.00 0.00 40.48 1.98
2802 2914 8.575589 TGATTGCTCTTGCTTTGTTTAAGATAA 58.424 29.630 0.00 0.00 40.48 1.75
2803 2915 8.976986 ATTGCTCTTGCTTTGTTTAAGATAAG 57.023 30.769 0.00 0.00 40.48 1.73
2804 2916 7.744087 TGCTCTTGCTTTGTTTAAGATAAGA 57.256 32.000 0.00 0.00 36.80 2.10
2805 2917 8.340618 TGCTCTTGCTTTGTTTAAGATAAGAT 57.659 30.769 0.00 0.00 37.66 2.40
2806 2918 9.448438 TGCTCTTGCTTTGTTTAAGATAAGATA 57.552 29.630 0.00 0.00 37.66 1.98
2846 2958 4.880886 AAAAACAAATGCTGAAAGTGCC 57.119 36.364 0.00 0.00 35.30 5.01
2847 2959 3.540314 AAACAAATGCTGAAAGTGCCA 57.460 38.095 0.00 0.00 35.30 4.92
2848 2960 2.806608 ACAAATGCTGAAAGTGCCAG 57.193 45.000 0.00 0.00 35.30 4.85
2849 2961 1.342174 ACAAATGCTGAAAGTGCCAGG 59.658 47.619 0.00 0.00 35.30 4.45
2850 2962 1.342174 CAAATGCTGAAAGTGCCAGGT 59.658 47.619 0.00 0.00 35.30 4.00
2851 2963 1.708341 AATGCTGAAAGTGCCAGGTT 58.292 45.000 0.00 0.00 35.30 3.50
2852 2964 1.708341 ATGCTGAAAGTGCCAGGTTT 58.292 45.000 0.00 0.00 35.30 3.27
2853 2965 2.356665 TGCTGAAAGTGCCAGGTTTA 57.643 45.000 0.00 0.00 35.30 2.01
2854 2966 1.953686 TGCTGAAAGTGCCAGGTTTAC 59.046 47.619 0.00 0.00 35.30 2.01
2855 2967 1.953686 GCTGAAAGTGCCAGGTTTACA 59.046 47.619 0.00 0.00 35.30 2.41
2856 2968 2.287608 GCTGAAAGTGCCAGGTTTACAC 60.288 50.000 0.00 0.00 35.30 2.90
2857 2969 2.948979 CTGAAAGTGCCAGGTTTACACA 59.051 45.455 0.00 0.00 36.76 3.72
2858 2970 2.685897 TGAAAGTGCCAGGTTTACACAC 59.314 45.455 0.00 0.00 36.76 3.82
2859 2971 2.729028 AAGTGCCAGGTTTACACACT 57.271 45.000 0.00 0.00 43.14 3.55
2860 2972 1.967319 AGTGCCAGGTTTACACACTG 58.033 50.000 0.00 0.00 39.97 3.66
2861 2973 1.488812 AGTGCCAGGTTTACACACTGA 59.511 47.619 0.00 0.00 39.97 3.41
2862 2974 2.092646 AGTGCCAGGTTTACACACTGAA 60.093 45.455 0.00 0.00 39.97 3.02
2863 2975 2.290641 GTGCCAGGTTTACACACTGAAG 59.709 50.000 0.00 0.00 34.21 3.02
2864 2976 2.171659 TGCCAGGTTTACACACTGAAGA 59.828 45.455 0.00 0.00 34.21 2.87
2865 2977 2.548480 GCCAGGTTTACACACTGAAGAC 59.452 50.000 0.00 0.00 34.21 3.01
2866 2978 3.804036 CCAGGTTTACACACTGAAGACA 58.196 45.455 0.00 0.00 34.21 3.41
2867 2979 4.389374 CCAGGTTTACACACTGAAGACAT 58.611 43.478 0.00 0.00 34.21 3.06
2868 2980 4.214119 CCAGGTTTACACACTGAAGACATG 59.786 45.833 0.00 0.00 34.21 3.21
2869 2981 4.214119 CAGGTTTACACACTGAAGACATGG 59.786 45.833 0.00 0.00 34.21 3.66
2870 2982 3.502211 GGTTTACACACTGAAGACATGGG 59.498 47.826 0.00 0.00 0.00 4.00
2871 2983 2.472695 TACACACTGAAGACATGGGC 57.527 50.000 0.00 0.00 0.00 5.36
2872 2984 0.767375 ACACACTGAAGACATGGGCT 59.233 50.000 0.00 0.00 0.00 5.19
2873 2985 1.162698 CACACTGAAGACATGGGCTG 58.837 55.000 0.00 0.00 0.00 4.85
2874 2986 0.607489 ACACTGAAGACATGGGCTGC 60.607 55.000 0.00 0.00 0.00 5.25
2875 2987 0.607217 CACTGAAGACATGGGCTGCA 60.607 55.000 0.50 0.00 0.00 4.41
2876 2988 0.322277 ACTGAAGACATGGGCTGCAG 60.322 55.000 19.08 19.08 43.40 4.41
2877 2989 0.322277 CTGAAGACATGGGCTGCAGT 60.322 55.000 16.64 0.00 34.85 4.40
2878 2990 0.983467 TGAAGACATGGGCTGCAGTA 59.017 50.000 16.64 2.57 0.00 2.74
2879 2991 1.350684 TGAAGACATGGGCTGCAGTAA 59.649 47.619 16.64 1.25 0.00 2.24
2880 2992 1.740025 GAAGACATGGGCTGCAGTAAC 59.260 52.381 16.64 6.53 0.00 2.50
2881 2993 0.692476 AGACATGGGCTGCAGTAACA 59.308 50.000 16.64 12.25 0.00 2.41
2882 2994 1.073763 AGACATGGGCTGCAGTAACAA 59.926 47.619 16.64 0.00 0.00 2.83
2883 2995 1.885887 GACATGGGCTGCAGTAACAAA 59.114 47.619 16.64 0.00 0.00 2.83
2884 2996 1.888512 ACATGGGCTGCAGTAACAAAG 59.111 47.619 16.64 11.00 0.00 2.77
2885 2997 1.888512 CATGGGCTGCAGTAACAAAGT 59.111 47.619 16.64 0.00 0.00 2.66
2886 2998 1.317613 TGGGCTGCAGTAACAAAGTG 58.682 50.000 16.64 0.00 0.00 3.16
2887 2999 1.318576 GGGCTGCAGTAACAAAGTGT 58.681 50.000 16.64 0.00 0.00 3.55
2888 3000 1.266989 GGGCTGCAGTAACAAAGTGTC 59.733 52.381 16.64 0.00 0.00 3.67
2889 3001 1.946768 GGCTGCAGTAACAAAGTGTCA 59.053 47.619 16.64 0.00 0.00 3.58
2890 3002 2.554032 GGCTGCAGTAACAAAGTGTCAT 59.446 45.455 16.64 0.00 0.00 3.06
2891 3003 3.751175 GGCTGCAGTAACAAAGTGTCATA 59.249 43.478 16.64 0.00 0.00 2.15
2892 3004 4.396166 GGCTGCAGTAACAAAGTGTCATAT 59.604 41.667 16.64 0.00 0.00 1.78
2893 3005 5.106157 GGCTGCAGTAACAAAGTGTCATATT 60.106 40.000 16.64 0.00 0.00 1.28
2894 3006 6.381801 GCTGCAGTAACAAAGTGTCATATTT 58.618 36.000 16.64 0.00 0.00 1.40
2895 3007 7.361713 GGCTGCAGTAACAAAGTGTCATATTTA 60.362 37.037 16.64 0.00 0.00 1.40
2896 3008 7.693951 GCTGCAGTAACAAAGTGTCATATTTAG 59.306 37.037 16.64 0.00 0.00 1.85
2897 3009 8.615878 TGCAGTAACAAAGTGTCATATTTAGT 57.384 30.769 0.00 0.00 0.00 2.24
2898 3010 9.062524 TGCAGTAACAAAGTGTCATATTTAGTT 57.937 29.630 0.00 0.00 0.00 2.24
2899 3011 9.543018 GCAGTAACAAAGTGTCATATTTAGTTC 57.457 33.333 0.00 0.00 0.00 3.01
2905 3017 8.784043 ACAAAGTGTCATATTTAGTTCAAGTCC 58.216 33.333 0.00 0.00 0.00 3.85
2906 3018 8.783093 CAAAGTGTCATATTTAGTTCAAGTCCA 58.217 33.333 0.00 0.00 0.00 4.02
2907 3019 7.907214 AGTGTCATATTTAGTTCAAGTCCAC 57.093 36.000 0.00 0.00 0.00 4.02
2908 3020 7.450074 AGTGTCATATTTAGTTCAAGTCCACA 58.550 34.615 0.00 0.00 0.00 4.17
2909 3021 7.936847 AGTGTCATATTTAGTTCAAGTCCACAA 59.063 33.333 0.00 0.00 0.00 3.33
2910 3022 8.015658 GTGTCATATTTAGTTCAAGTCCACAAC 58.984 37.037 0.00 0.00 0.00 3.32
2911 3023 7.717436 TGTCATATTTAGTTCAAGTCCACAACA 59.283 33.333 0.00 0.00 0.00 3.33
2912 3024 8.564574 GTCATATTTAGTTCAAGTCCACAACAA 58.435 33.333 0.00 0.00 0.00 2.83
2913 3025 9.295825 TCATATTTAGTTCAAGTCCACAACAAT 57.704 29.630 0.00 0.00 0.00 2.71
2914 3026 9.345517 CATATTTAGTTCAAGTCCACAACAATG 57.654 33.333 0.00 0.00 0.00 2.82
2915 3027 6.767524 TTTAGTTCAAGTCCACAACAATGT 57.232 33.333 0.00 0.00 41.61 2.71
2916 3028 6.767524 TTAGTTCAAGTCCACAACAATGTT 57.232 33.333 0.00 0.00 37.82 2.71
2917 3029 5.659440 AGTTCAAGTCCACAACAATGTTT 57.341 34.783 0.00 0.00 37.82 2.83
2918 3030 6.036577 AGTTCAAGTCCACAACAATGTTTT 57.963 33.333 0.00 0.00 37.82 2.43
2919 3031 6.099341 AGTTCAAGTCCACAACAATGTTTTC 58.901 36.000 0.00 0.00 37.82 2.29
2920 3032 5.651387 TCAAGTCCACAACAATGTTTTCA 57.349 34.783 0.00 0.00 37.82 2.69
2921 3033 6.030548 TCAAGTCCACAACAATGTTTTCAA 57.969 33.333 0.00 0.00 37.82 2.69
2922 3034 6.098679 TCAAGTCCACAACAATGTTTTCAAG 58.901 36.000 0.00 0.00 37.82 3.02
2923 3035 5.659440 AGTCCACAACAATGTTTTCAAGT 57.341 34.783 0.00 0.00 37.82 3.16
2924 3036 5.410067 AGTCCACAACAATGTTTTCAAGTG 58.590 37.500 0.00 1.21 37.82 3.16
2925 3037 5.047377 AGTCCACAACAATGTTTTCAAGTGT 60.047 36.000 11.01 0.00 37.82 3.55
2926 3038 6.151985 AGTCCACAACAATGTTTTCAAGTGTA 59.848 34.615 11.01 0.00 37.82 2.90
2927 3039 6.978080 GTCCACAACAATGTTTTCAAGTGTAT 59.022 34.615 11.01 0.00 37.82 2.29
2928 3040 7.491048 GTCCACAACAATGTTTTCAAGTGTATT 59.509 33.333 11.01 0.00 37.82 1.89
2929 3041 8.037758 TCCACAACAATGTTTTCAAGTGTATTT 58.962 29.630 11.01 0.00 37.82 1.40
2930 3042 8.327429 CCACAACAATGTTTTCAAGTGTATTTC 58.673 33.333 11.01 0.00 37.82 2.17
2931 3043 8.049592 CACAACAATGTTTTCAAGTGTATTTCG 58.950 33.333 0.00 0.00 37.82 3.46
2932 3044 7.757624 ACAACAATGTTTTCAAGTGTATTTCGT 59.242 29.630 0.00 0.00 35.91 3.85
2933 3045 7.678194 ACAATGTTTTCAAGTGTATTTCGTG 57.322 32.000 0.00 0.00 32.70 4.35
2934 3046 7.254852 ACAATGTTTTCAAGTGTATTTCGTGT 58.745 30.769 0.00 0.00 32.70 4.49
2935 3047 7.219917 ACAATGTTTTCAAGTGTATTTCGTGTG 59.780 33.333 0.00 0.00 32.70 3.82
2936 3048 6.424176 TGTTTTCAAGTGTATTTCGTGTGA 57.576 33.333 0.00 0.00 0.00 3.58
2937 3049 6.252281 TGTTTTCAAGTGTATTTCGTGTGAC 58.748 36.000 0.00 0.00 0.00 3.67
2938 3050 6.128254 TGTTTTCAAGTGTATTTCGTGTGACA 60.128 34.615 0.00 0.00 0.00 3.58
2939 3051 5.651172 TTCAAGTGTATTTCGTGTGACAG 57.349 39.130 0.00 0.00 0.00 3.51
2940 3052 4.689071 TCAAGTGTATTTCGTGTGACAGT 58.311 39.130 0.00 0.00 0.00 3.55
2941 3053 5.113383 TCAAGTGTATTTCGTGTGACAGTT 58.887 37.500 0.00 0.00 36.19 3.16
2942 3054 6.274579 TCAAGTGTATTTCGTGTGACAGTTA 58.725 36.000 0.00 0.00 34.49 2.24
2943 3055 6.926826 TCAAGTGTATTTCGTGTGACAGTTAT 59.073 34.615 0.00 0.00 34.49 1.89
2944 3056 6.706055 AGTGTATTTCGTGTGACAGTTATG 57.294 37.500 0.00 0.00 0.00 1.90
2945 3057 5.120208 AGTGTATTTCGTGTGACAGTTATGC 59.880 40.000 0.00 0.00 0.00 3.14
2946 3058 4.991687 TGTATTTCGTGTGACAGTTATGCA 59.008 37.500 0.00 0.00 0.00 3.96
2947 3059 4.668576 ATTTCGTGTGACAGTTATGCAG 57.331 40.909 0.00 0.00 0.00 4.41
2948 3060 2.812358 TCGTGTGACAGTTATGCAGT 57.188 45.000 0.00 0.00 0.00 4.40
2949 3061 2.672714 TCGTGTGACAGTTATGCAGTC 58.327 47.619 0.00 0.00 34.64 3.51
2950 3062 2.035321 TCGTGTGACAGTTATGCAGTCA 59.965 45.455 1.86 1.86 40.58 3.41
2951 3063 2.995939 CGTGTGACAGTTATGCAGTCAT 59.004 45.455 8.74 0.00 43.76 3.06
2952 3064 3.433274 CGTGTGACAGTTATGCAGTCATT 59.567 43.478 8.74 0.00 43.76 2.57
2953 3065 4.083855 CGTGTGACAGTTATGCAGTCATTT 60.084 41.667 8.74 0.00 43.76 2.32
2954 3066 5.385617 GTGTGACAGTTATGCAGTCATTTC 58.614 41.667 8.74 0.00 43.76 2.17
2955 3067 5.049474 GTGTGACAGTTATGCAGTCATTTCA 60.049 40.000 8.74 1.00 43.76 2.69
2956 3068 5.706833 TGTGACAGTTATGCAGTCATTTCAT 59.293 36.000 8.74 0.00 43.76 2.57
2957 3069 6.207221 TGTGACAGTTATGCAGTCATTTCATT 59.793 34.615 8.74 0.00 43.76 2.57
2958 3070 7.390162 TGTGACAGTTATGCAGTCATTTCATTA 59.610 33.333 8.74 0.00 43.76 1.90
2959 3071 8.400947 GTGACAGTTATGCAGTCATTTCATTAT 58.599 33.333 8.74 0.00 43.76 1.28
2960 3072 8.959548 TGACAGTTATGCAGTCATTTCATTATT 58.040 29.630 1.86 0.00 38.45 1.40
2961 3073 9.229784 GACAGTTATGCAGTCATTTCATTATTG 57.770 33.333 0.00 0.00 34.27 1.90
2962 3074 8.192774 ACAGTTATGCAGTCATTTCATTATTGG 58.807 33.333 0.00 0.00 34.22 3.16
2963 3075 8.192774 CAGTTATGCAGTCATTTCATTATTGGT 58.807 33.333 0.00 0.00 34.22 3.67
2964 3076 9.407380 AGTTATGCAGTCATTTCATTATTGGTA 57.593 29.630 0.00 0.00 34.22 3.25
2965 3077 9.669353 GTTATGCAGTCATTTCATTATTGGTAG 57.331 33.333 0.00 0.00 34.22 3.18
2966 3078 9.625747 TTATGCAGTCATTTCATTATTGGTAGA 57.374 29.630 0.00 0.00 34.22 2.59
2967 3079 8.701908 ATGCAGTCATTTCATTATTGGTAGAT 57.298 30.769 0.00 0.00 0.00 1.98
2968 3080 9.797642 ATGCAGTCATTTCATTATTGGTAGATA 57.202 29.630 0.00 0.00 0.00 1.98
2969 3081 9.625747 TGCAGTCATTTCATTATTGGTAGATAA 57.374 29.630 0.00 0.00 0.00 1.75
3021 3133 6.940739 ACAGTATTTAGACTTGAGAGCATGT 58.059 36.000 0.00 0.00 35.36 3.21
3038 3150 4.081420 AGCATGTGACTAGGTTCAGGTAAG 60.081 45.833 0.00 0.00 0.00 2.34
3068 3185 7.443272 TGGTATATCTGCTTTTCATCTCATGTG 59.557 37.037 0.00 0.00 0.00 3.21
3072 3189 5.072055 TCTGCTTTTCATCTCATGTGGAAA 58.928 37.500 0.00 0.00 0.00 3.13
3109 4290 2.104622 TCACATTGTCAGTCTGAAGCCA 59.895 45.455 3.51 0.00 0.00 4.75
3191 4380 8.977412 TGGTTTACTATATTCAGACTCATGTGA 58.023 33.333 0.94 0.00 0.00 3.58
3204 4398 6.096705 CAGACTCATGTGAAGAGATAAGTCCT 59.903 42.308 0.94 0.00 36.91 3.85
3205 4399 7.284261 CAGACTCATGTGAAGAGATAAGTCCTA 59.716 40.741 0.94 0.00 36.91 2.94
3252 4446 9.442047 CAGACATCTTATCTAGAAACAAAACCT 57.558 33.333 0.00 0.00 36.22 3.50
3253 4447 9.442047 AGACATCTTATCTAGAAACAAAACCTG 57.558 33.333 0.00 0.00 36.22 4.00
3254 4448 8.045176 ACATCTTATCTAGAAACAAAACCTGC 57.955 34.615 0.00 0.00 36.22 4.85
3255 4449 7.665559 ACATCTTATCTAGAAACAAAACCTGCA 59.334 33.333 0.00 0.00 36.22 4.41
3378 4573 1.207593 CGCCTTGAAACCGAAGCAG 59.792 57.895 0.00 0.00 0.00 4.24
3425 4623 5.703876 CTTTTGCTCCTTGATGTTAGGAAC 58.296 41.667 0.00 0.00 41.13 3.62
3436 4634 7.224167 CCTTGATGTTAGGAACGGTAAACTATC 59.776 40.741 0.00 0.00 34.56 2.08
3491 4689 5.048991 GTCTGTTATGTTTTGTGGGTCGATT 60.049 40.000 0.00 0.00 0.00 3.34
3522 4722 4.755266 GTGGTAATCACCTACTCCATGT 57.245 45.455 0.00 0.00 45.98 3.21
3525 4725 6.646267 GTGGTAATCACCTACTCCATGTTTA 58.354 40.000 0.00 0.00 45.98 2.01
3527 4727 7.608761 GTGGTAATCACCTACTCCATGTTTAAA 59.391 37.037 0.00 0.00 45.98 1.52
3528 4728 8.333235 TGGTAATCACCTACTCCATGTTTAAAT 58.667 33.333 0.00 0.00 45.98 1.40
3529 4729 8.837389 GGTAATCACCTACTCCATGTTTAAATC 58.163 37.037 0.00 0.00 42.11 2.17
3531 4731 6.636454 TCACCTACTCCATGTTTAAATCCT 57.364 37.500 0.00 0.00 0.00 3.24
3532 4732 7.743116 TCACCTACTCCATGTTTAAATCCTA 57.257 36.000 0.00 0.00 0.00 2.94
3533 4733 8.331931 TCACCTACTCCATGTTTAAATCCTAT 57.668 34.615 0.00 0.00 0.00 2.57
3534 4734 9.442062 TCACCTACTCCATGTTTAAATCCTATA 57.558 33.333 0.00 0.00 0.00 1.31
3545 4745 9.730420 ATGTTTAAATCCTATATGTTGTTTCGC 57.270 29.630 0.00 0.00 0.00 4.70
3547 4747 5.418310 AAATCCTATATGTTGTTTCGCGG 57.582 39.130 6.13 0.00 0.00 6.46
3647 4853 0.453793 CTGTCAGAGCAGGAGGTACG 59.546 60.000 0.00 0.00 33.11 3.67
3648 4854 0.965866 TGTCAGAGCAGGAGGTACGG 60.966 60.000 0.00 0.00 0.00 4.02
3649 4855 0.966370 GTCAGAGCAGGAGGTACGGT 60.966 60.000 0.00 0.00 0.00 4.83
3666 4872 3.097614 ACGGTACTCCTTGAGCTAATGT 58.902 45.455 0.00 0.00 32.04 2.71
3696 4908 4.615223 GCTGCGACGTAATCCATACATAGA 60.615 45.833 0.00 0.00 33.89 1.98
3698 4910 4.276431 TGCGACGTAATCCATACATAGACA 59.724 41.667 0.00 0.00 33.89 3.41
3699 4911 5.217393 GCGACGTAATCCATACATAGACAA 58.783 41.667 0.00 0.00 33.89 3.18
3700 4912 5.688621 GCGACGTAATCCATACATAGACAAA 59.311 40.000 0.00 0.00 33.89 2.83
3701 4913 6.345565 GCGACGTAATCCATACATAGACAAAC 60.346 42.308 0.00 0.00 33.89 2.93
3702 4914 6.143438 CGACGTAATCCATACATAGACAAACC 59.857 42.308 0.00 0.00 33.89 3.27
3707 4919 9.391006 GTAATCCATACATAGACAAACCAGAAA 57.609 33.333 0.00 0.00 34.46 2.52
3708 4920 7.865706 ATCCATACATAGACAAACCAGAAAC 57.134 36.000 0.00 0.00 0.00 2.78
3709 4921 7.016153 TCCATACATAGACAAACCAGAAACT 57.984 36.000 0.00 0.00 0.00 2.66
3710 4922 6.878923 TCCATACATAGACAAACCAGAAACTG 59.121 38.462 0.00 0.00 0.00 3.16
3714 4926 6.357367 ACATAGACAAACCAGAAACTGTCTT 58.643 36.000 8.70 0.00 44.71 3.01
3715 4927 7.506114 ACATAGACAAACCAGAAACTGTCTTA 58.494 34.615 8.70 0.00 44.71 2.10
3716 4928 7.441458 ACATAGACAAACCAGAAACTGTCTTAC 59.559 37.037 8.70 0.00 44.71 2.34
3717 4929 5.741011 AGACAAACCAGAAACTGTCTTACA 58.259 37.500 0.00 0.00 44.71 2.41
3718 4930 6.177610 AGACAAACCAGAAACTGTCTTACAA 58.822 36.000 0.00 0.00 44.71 2.41
3719 4931 6.657541 AGACAAACCAGAAACTGTCTTACAAA 59.342 34.615 0.00 0.00 44.71 2.83
3720 4932 7.175990 AGACAAACCAGAAACTGTCTTACAAAA 59.824 33.333 0.00 0.00 44.71 2.44
3721 4933 7.088272 ACAAACCAGAAACTGTCTTACAAAAC 58.912 34.615 0.00 0.00 32.70 2.43
3722 4934 5.830000 ACCAGAAACTGTCTTACAAAACC 57.170 39.130 0.00 0.00 32.70 3.27
3723 4935 5.258051 ACCAGAAACTGTCTTACAAAACCA 58.742 37.500 0.00 0.00 32.70 3.67
3724 4936 5.357032 ACCAGAAACTGTCTTACAAAACCAG 59.643 40.000 0.00 0.00 32.70 4.00
3725 4937 5.588648 CCAGAAACTGTCTTACAAAACCAGA 59.411 40.000 0.00 0.00 32.70 3.86
3726 4938 6.094881 CCAGAAACTGTCTTACAAAACCAGAA 59.905 38.462 0.00 0.00 32.70 3.02
3727 4939 7.201821 CCAGAAACTGTCTTACAAAACCAGAAT 60.202 37.037 0.00 0.00 32.70 2.40
3728 4940 7.645340 CAGAAACTGTCTTACAAAACCAGAATG 59.355 37.037 0.00 0.00 32.70 2.67
3729 4941 5.438761 ACTGTCTTACAAAACCAGAATGC 57.561 39.130 0.00 0.00 31.97 3.56
3730 4942 4.887071 ACTGTCTTACAAAACCAGAATGCA 59.113 37.500 0.00 0.00 31.97 3.96
3731 4943 5.359576 ACTGTCTTACAAAACCAGAATGCAA 59.640 36.000 0.00 0.00 31.97 4.08
3732 4944 5.587289 TGTCTTACAAAACCAGAATGCAAC 58.413 37.500 0.00 0.00 31.97 4.17
3733 4945 5.126222 TGTCTTACAAAACCAGAATGCAACA 59.874 36.000 0.00 0.00 31.97 3.33
3746 4958 6.090358 CCAGAATGCAACATTCTTGTTTCATC 59.910 38.462 17.85 0.96 45.14 2.92
3826 5038 7.555965 AGACAGACATATTAATGTACTGCACA 58.444 34.615 14.02 0.00 46.49 4.57
3841 5053 1.004628 TGCACAGGTGGCATAAGATGT 59.995 47.619 1.10 0.00 36.11 3.06
3847 5059 2.764010 AGGTGGCATAAGATGTGACGTA 59.236 45.455 0.00 0.00 0.00 3.57
3876 5088 9.893305 CTCAACGATTTTGAGGTAAATAAAAGT 57.107 29.630 6.17 0.00 41.54 2.66
3877 5089 9.672086 TCAACGATTTTGAGGTAAATAAAAGTG 57.328 29.630 0.00 0.00 0.00 3.16
3878 5090 9.458374 CAACGATTTTGAGGTAAATAAAAGTGT 57.542 29.630 0.00 0.00 0.00 3.55
3913 5125 1.065126 GCTATGGGATGGGTGGCTATC 60.065 57.143 0.00 0.00 0.00 2.08
3920 5135 3.450904 GGATGGGTGGCTATCTATACCA 58.549 50.000 0.00 0.00 34.89 3.25
3932 5147 8.314021 TGGCTATCTATACCATAATCTTGTGTG 58.686 37.037 0.00 0.00 0.00 3.82
3933 5148 8.314751 GGCTATCTATACCATAATCTTGTGTGT 58.685 37.037 0.00 0.00 0.00 3.72
3934 5149 9.144747 GCTATCTATACCATAATCTTGTGTGTG 57.855 37.037 0.00 0.00 0.00 3.82
3936 5151 8.893219 ATCTATACCATAATCTTGTGTGTGTG 57.107 34.615 0.00 0.00 0.00 3.82
3937 5152 5.818136 ATACCATAATCTTGTGTGTGTGC 57.182 39.130 0.00 0.00 0.00 4.57
3938 5153 2.483877 ACCATAATCTTGTGTGTGTGCG 59.516 45.455 0.00 0.00 0.00 5.34
3939 5154 2.508867 CATAATCTTGTGTGTGTGCGC 58.491 47.619 0.00 0.00 0.00 6.09
3991 5206 2.696526 ACCTGTACACTCTCAAGGGA 57.303 50.000 0.00 0.00 0.00 4.20
4009 5224 0.389948 GAGGCGTGTCCAACTACCTG 60.390 60.000 0.00 0.00 34.17 4.00
4014 5229 2.353803 GCGTGTCCAACTACCTGAAGAT 60.354 50.000 0.00 0.00 0.00 2.40
4015 5230 3.254060 CGTGTCCAACTACCTGAAGATG 58.746 50.000 0.00 0.00 0.00 2.90
4016 5231 3.600388 GTGTCCAACTACCTGAAGATGG 58.400 50.000 0.00 0.00 39.99 3.51
4117 5332 1.484444 AAGGCGCAGGAGAAGAAGGT 61.484 55.000 10.83 0.00 0.00 3.50
4122 5337 0.322008 GCAGGAGAAGAAGGTGGTGG 60.322 60.000 0.00 0.00 0.00 4.61
4129 5344 0.535102 AAGAAGGTGGTGGCGACAAG 60.535 55.000 0.00 0.00 46.06 3.16
4135 5350 4.410400 GGTGGCGACAAGGGGGAG 62.410 72.222 0.00 0.00 46.06 4.30
4136 5351 4.410400 GTGGCGACAAGGGGGAGG 62.410 72.222 0.00 0.00 46.06 4.30
4140 5355 2.347490 CGACAAGGGGGAGGTGTG 59.653 66.667 0.00 0.00 0.00 3.82
4147 5362 4.065281 GGGGAGGTGTGGTCGTCG 62.065 72.222 0.00 0.00 0.00 5.12
4150 5365 4.034258 GAGGTGTGGTCGTCGCGA 62.034 66.667 3.71 3.71 0.00 5.87
4196 5411 4.154347 CGGAGGTGGAGGAGCTGC 62.154 72.222 0.00 0.00 37.18 5.25
4243 5458 0.464452 GCAACCGGCTCTACCTGTAT 59.536 55.000 0.00 0.00 34.24 2.29
4300 5531 2.664402 AGGTTGAGATGCAGGTTGTT 57.336 45.000 0.00 0.00 0.00 2.83
4304 5535 3.304928 GGTTGAGATGCAGGTTGTTTCAG 60.305 47.826 0.00 0.00 0.00 3.02
4320 5551 1.896220 TCAGGTGAAGTGTGGAATGC 58.104 50.000 0.00 0.00 0.00 3.56
4322 5553 1.538512 CAGGTGAAGTGTGGAATGCAG 59.461 52.381 0.00 0.00 0.00 4.41
4332 5563 2.880268 TGTGGAATGCAGTGAACTGAAG 59.120 45.455 14.58 0.00 46.59 3.02
4339 5570 1.869767 GCAGTGAACTGAAGTGGAGTG 59.130 52.381 14.58 0.00 46.59 3.51
4340 5571 2.487934 CAGTGAACTGAAGTGGAGTGG 58.512 52.381 4.36 0.00 46.59 4.00
4388 5619 4.031129 CTGAGGGGCTGCTGCTGT 62.031 66.667 15.64 0.10 39.59 4.40
4390 5621 2.188994 GAGGGGCTGCTGCTGTAG 59.811 66.667 15.64 4.29 39.59 2.74
4483 5718 3.047718 GCGACGGACGACCATCTCA 62.048 63.158 4.48 0.00 45.77 3.27
4507 5742 2.980475 GCTGAGCTGAGCTGAGGT 59.020 61.111 21.96 4.00 40.13 3.85
4512 5747 1.886253 GAGCTGAGCTGAGGTGAGCA 61.886 60.000 23.84 0.00 39.88 4.26
4528 5763 2.286872 GAGCATCATCCAGTCCAAGTG 58.713 52.381 0.00 0.00 33.17 3.16
4534 5769 1.059098 ATCCAGTCCAAGTGCAGTCA 58.941 50.000 0.00 0.00 0.00 3.41
4535 5770 1.059098 TCCAGTCCAAGTGCAGTCAT 58.941 50.000 0.00 0.00 0.00 3.06
4536 5771 1.421268 TCCAGTCCAAGTGCAGTCATT 59.579 47.619 0.00 0.00 0.00 2.57
4537 5772 2.158623 TCCAGTCCAAGTGCAGTCATTT 60.159 45.455 0.00 0.00 0.00 2.32
4538 5773 2.030540 CCAGTCCAAGTGCAGTCATTTG 60.031 50.000 0.00 0.00 38.98 2.32
4539 5774 2.880268 CAGTCCAAGTGCAGTCATTTGA 59.120 45.455 0.00 0.00 40.93 2.69
4540 5775 3.316029 CAGTCCAAGTGCAGTCATTTGAA 59.684 43.478 0.00 0.00 40.93 2.69
4541 5776 3.567164 AGTCCAAGTGCAGTCATTTGAAG 59.433 43.478 0.00 0.00 40.93 3.02
4542 5777 3.316308 GTCCAAGTGCAGTCATTTGAAGT 59.684 43.478 0.00 0.00 40.93 3.01
4543 5778 4.515191 GTCCAAGTGCAGTCATTTGAAGTA 59.485 41.667 0.00 0.00 40.93 2.24
4544 5779 4.756642 TCCAAGTGCAGTCATTTGAAGTAG 59.243 41.667 0.00 0.00 40.93 2.57
4545 5780 4.516698 CCAAGTGCAGTCATTTGAAGTAGT 59.483 41.667 0.00 0.00 40.93 2.73
4546 5781 5.446709 CAAGTGCAGTCATTTGAAGTAGTG 58.553 41.667 0.00 0.00 40.93 2.74
4547 5782 4.067896 AGTGCAGTCATTTGAAGTAGTGG 58.932 43.478 0.00 0.00 0.00 4.00
4548 5783 2.813754 TGCAGTCATTTGAAGTAGTGGC 59.186 45.455 0.00 0.00 0.00 5.01
4549 5784 3.077359 GCAGTCATTTGAAGTAGTGGCT 58.923 45.455 0.00 0.00 0.00 4.75
4550 5785 3.503748 GCAGTCATTTGAAGTAGTGGCTT 59.496 43.478 0.00 0.00 0.00 4.35
4551 5786 4.378874 GCAGTCATTTGAAGTAGTGGCTTC 60.379 45.833 0.00 0.00 43.68 3.86
4558 5793 3.963428 GAAGTAGTGGCTTCAAGAGGA 57.037 47.619 0.00 0.00 43.10 3.71
4559 5794 4.479786 GAAGTAGTGGCTTCAAGAGGAT 57.520 45.455 0.00 0.00 43.10 3.24
4560 5795 4.837972 GAAGTAGTGGCTTCAAGAGGATT 58.162 43.478 0.00 0.00 43.10 3.01
4561 5796 5.978814 GAAGTAGTGGCTTCAAGAGGATTA 58.021 41.667 0.00 0.00 43.10 1.75
4562 5797 5.346181 AGTAGTGGCTTCAAGAGGATTAC 57.654 43.478 0.00 0.00 0.00 1.89
4563 5798 5.026790 AGTAGTGGCTTCAAGAGGATTACT 58.973 41.667 0.00 0.00 0.00 2.24
4564 5799 4.917906 AGTGGCTTCAAGAGGATTACTT 57.082 40.909 0.00 0.00 0.00 2.24
4565 5800 4.583871 AGTGGCTTCAAGAGGATTACTTG 58.416 43.478 0.00 0.00 43.92 3.16
4566 5801 4.042187 AGTGGCTTCAAGAGGATTACTTGT 59.958 41.667 0.00 0.00 43.30 3.16
4567 5802 4.154918 GTGGCTTCAAGAGGATTACTTGTG 59.845 45.833 0.00 0.00 43.30 3.33
4568 5803 4.202461 TGGCTTCAAGAGGATTACTTGTGT 60.202 41.667 0.00 0.00 43.30 3.72
4569 5804 5.012664 TGGCTTCAAGAGGATTACTTGTGTA 59.987 40.000 0.00 0.00 43.30 2.90
4570 5805 6.116126 GGCTTCAAGAGGATTACTTGTGTAT 58.884 40.000 0.00 0.00 43.30 2.29
4571 5806 7.093068 TGGCTTCAAGAGGATTACTTGTGTATA 60.093 37.037 0.00 0.00 43.30 1.47
4572 5807 7.934120 GGCTTCAAGAGGATTACTTGTGTATAT 59.066 37.037 0.00 0.00 43.30 0.86
4573 5808 9.982651 GCTTCAAGAGGATTACTTGTGTATATA 57.017 33.333 0.00 0.00 43.30 0.86
4585 5820 9.826574 TTACTTGTGTATATATTTCTGTGGGTC 57.173 33.333 0.00 0.00 0.00 4.46
4586 5821 6.984474 ACTTGTGTATATATTTCTGTGGGTCG 59.016 38.462 0.00 0.00 0.00 4.79
4587 5822 6.474140 TGTGTATATATTTCTGTGGGTCGT 57.526 37.500 0.00 0.00 0.00 4.34
4588 5823 7.585579 TGTGTATATATTTCTGTGGGTCGTA 57.414 36.000 0.00 0.00 0.00 3.43
4589 5824 7.428020 TGTGTATATATTTCTGTGGGTCGTAC 58.572 38.462 0.00 0.00 0.00 3.67
4590 5825 6.865205 GTGTATATATTTCTGTGGGTCGTACC 59.135 42.308 0.00 0.00 37.60 3.34
4591 5826 6.550481 TGTATATATTTCTGTGGGTCGTACCA 59.450 38.462 6.41 1.99 41.02 3.25
4599 5834 2.660670 TGGGTCGTACCACCATTTTT 57.339 45.000 12.01 0.00 41.02 1.94
4600 5835 2.506444 TGGGTCGTACCACCATTTTTC 58.494 47.619 12.01 0.00 41.02 2.29
4601 5836 2.106857 TGGGTCGTACCACCATTTTTCT 59.893 45.455 12.01 0.00 41.02 2.52
4602 5837 3.151554 GGGTCGTACCACCATTTTTCTT 58.848 45.455 12.01 0.00 41.02 2.52
4603 5838 3.057806 GGGTCGTACCACCATTTTTCTTG 60.058 47.826 12.01 0.00 41.02 3.02
4604 5839 3.561503 GTCGTACCACCATTTTTCTTGC 58.438 45.455 0.00 0.00 0.00 4.01
4605 5840 3.252458 GTCGTACCACCATTTTTCTTGCT 59.748 43.478 0.00 0.00 0.00 3.91
4606 5841 3.886505 TCGTACCACCATTTTTCTTGCTT 59.113 39.130 0.00 0.00 0.00 3.91
4607 5842 4.339814 TCGTACCACCATTTTTCTTGCTTT 59.660 37.500 0.00 0.00 0.00 3.51
4608 5843 4.679654 CGTACCACCATTTTTCTTGCTTTC 59.320 41.667 0.00 0.00 0.00 2.62
4609 5844 5.507315 CGTACCACCATTTTTCTTGCTTTCT 60.507 40.000 0.00 0.00 0.00 2.52
4610 5845 4.696455 ACCACCATTTTTCTTGCTTTCTG 58.304 39.130 0.00 0.00 0.00 3.02
4611 5846 4.405358 ACCACCATTTTTCTTGCTTTCTGA 59.595 37.500 0.00 0.00 0.00 3.27
4612 5847 5.070847 ACCACCATTTTTCTTGCTTTCTGAT 59.929 36.000 0.00 0.00 0.00 2.90
4613 5848 5.993441 CCACCATTTTTCTTGCTTTCTGATT 59.007 36.000 0.00 0.00 0.00 2.57
4614 5849 6.484308 CCACCATTTTTCTTGCTTTCTGATTT 59.516 34.615 0.00 0.00 0.00 2.17
4615 5850 7.349711 CACCATTTTTCTTGCTTTCTGATTTG 58.650 34.615 0.00 0.00 0.00 2.32
4616 5851 7.011669 CACCATTTTTCTTGCTTTCTGATTTGT 59.988 33.333 0.00 0.00 0.00 2.83
4617 5852 7.553760 ACCATTTTTCTTGCTTTCTGATTTGTT 59.446 29.630 0.00 0.00 0.00 2.83
4618 5853 7.853929 CCATTTTTCTTGCTTTCTGATTTGTTG 59.146 33.333 0.00 0.00 0.00 3.33
4619 5854 6.907206 TTTTCTTGCTTTCTGATTTGTTGG 57.093 33.333 0.00 0.00 0.00 3.77
4620 5855 5.596836 TTCTTGCTTTCTGATTTGTTGGT 57.403 34.783 0.00 0.00 0.00 3.67
4621 5856 4.935702 TCTTGCTTTCTGATTTGTTGGTG 58.064 39.130 0.00 0.00 0.00 4.17
4622 5857 3.096489 TGCTTTCTGATTTGTTGGTGC 57.904 42.857 0.00 0.00 0.00 5.01
4623 5858 2.429971 TGCTTTCTGATTTGTTGGTGCA 59.570 40.909 0.00 0.00 0.00 4.57
4624 5859 3.069872 TGCTTTCTGATTTGTTGGTGCAT 59.930 39.130 0.00 0.00 0.00 3.96
4625 5860 3.676646 GCTTTCTGATTTGTTGGTGCATC 59.323 43.478 0.00 0.00 0.00 3.91
4626 5861 4.560108 GCTTTCTGATTTGTTGGTGCATCT 60.560 41.667 0.00 0.00 0.00 2.90
4627 5862 5.534207 TTTCTGATTTGTTGGTGCATCTT 57.466 34.783 0.00 0.00 0.00 2.40
4628 5863 5.534207 TTCTGATTTGTTGGTGCATCTTT 57.466 34.783 0.00 0.00 0.00 2.52
4629 5864 5.534207 TCTGATTTGTTGGTGCATCTTTT 57.466 34.783 0.00 0.00 0.00 2.27
4630 5865 5.916318 TCTGATTTGTTGGTGCATCTTTTT 58.084 33.333 0.00 0.00 0.00 1.94
4666 5901 9.613428 TTTAATTGATAAGTACTAGCATGCAGT 57.387 29.630 21.98 21.45 0.00 4.40
4667 5902 7.488187 AATTGATAAGTACTAGCATGCAGTG 57.512 36.000 21.98 11.56 0.00 3.66
4668 5903 5.598416 TGATAAGTACTAGCATGCAGTGT 57.402 39.130 21.98 16.74 0.00 3.55
4669 5904 6.709018 TGATAAGTACTAGCATGCAGTGTA 57.291 37.500 21.98 15.73 0.00 2.90
4670 5905 6.739112 TGATAAGTACTAGCATGCAGTGTAG 58.261 40.000 21.98 14.79 0.00 2.74
4671 5906 6.321435 TGATAAGTACTAGCATGCAGTGTAGT 59.679 38.462 21.98 19.64 32.86 2.73
4672 5907 4.377839 AGTACTAGCATGCAGTGTAGTG 57.622 45.455 21.98 2.86 31.58 2.74
4673 5908 3.764434 AGTACTAGCATGCAGTGTAGTGT 59.236 43.478 21.98 7.88 31.58 3.55
4674 5909 4.948004 AGTACTAGCATGCAGTGTAGTGTA 59.052 41.667 21.98 7.58 31.58 2.90
4675 5910 4.377839 ACTAGCATGCAGTGTAGTGTAG 57.622 45.455 21.98 11.50 0.00 2.74
4676 5911 3.764434 ACTAGCATGCAGTGTAGTGTAGT 59.236 43.478 21.98 12.15 0.00 2.73
4677 5912 4.948004 ACTAGCATGCAGTGTAGTGTAGTA 59.052 41.667 21.98 0.00 0.00 1.82
4678 5913 4.377839 AGCATGCAGTGTAGTGTAGTAG 57.622 45.455 21.98 0.00 0.00 2.57
4679 5914 4.017126 AGCATGCAGTGTAGTGTAGTAGA 58.983 43.478 21.98 0.00 0.00 2.59
4680 5915 4.462834 AGCATGCAGTGTAGTGTAGTAGAA 59.537 41.667 21.98 0.00 0.00 2.10
4681 5916 4.800993 GCATGCAGTGTAGTGTAGTAGAAG 59.199 45.833 14.21 0.00 0.00 2.85
4682 5917 5.393135 GCATGCAGTGTAGTGTAGTAGAAGA 60.393 44.000 14.21 0.00 0.00 2.87
4683 5918 6.621613 CATGCAGTGTAGTGTAGTAGAAGAA 58.378 40.000 0.00 0.00 0.00 2.52
4684 5919 6.255596 TGCAGTGTAGTGTAGTAGAAGAAG 57.744 41.667 0.00 0.00 0.00 2.85
4685 5920 6.002082 TGCAGTGTAGTGTAGTAGAAGAAGA 58.998 40.000 0.00 0.00 0.00 2.87
4686 5921 6.489022 TGCAGTGTAGTGTAGTAGAAGAAGAA 59.511 38.462 0.00 0.00 0.00 2.52
4687 5922 7.024768 GCAGTGTAGTGTAGTAGAAGAAGAAG 58.975 42.308 0.00 0.00 0.00 2.85
4688 5923 7.094720 GCAGTGTAGTGTAGTAGAAGAAGAAGA 60.095 40.741 0.00 0.00 0.00 2.87
4689 5924 8.952278 CAGTGTAGTGTAGTAGAAGAAGAAGAT 58.048 37.037 0.00 0.00 0.00 2.40
4690 5925 8.952278 AGTGTAGTGTAGTAGAAGAAGAAGATG 58.048 37.037 0.00 0.00 0.00 2.90
4691 5926 8.948145 GTGTAGTGTAGTAGAAGAAGAAGATGA 58.052 37.037 0.00 0.00 0.00 2.92
4692 5927 9.168451 TGTAGTGTAGTAGAAGAAGAAGATGAG 57.832 37.037 0.00 0.00 0.00 2.90
4693 5928 7.639113 AGTGTAGTAGAAGAAGAAGATGAGG 57.361 40.000 0.00 0.00 0.00 3.86
4694 5929 7.179269 AGTGTAGTAGAAGAAGAAGATGAGGT 58.821 38.462 0.00 0.00 0.00 3.85
4695 5930 7.122055 AGTGTAGTAGAAGAAGAAGATGAGGTG 59.878 40.741 0.00 0.00 0.00 4.00
4696 5931 7.121463 GTGTAGTAGAAGAAGAAGATGAGGTGA 59.879 40.741 0.00 0.00 0.00 4.02
4697 5932 6.524101 AGTAGAAGAAGAAGATGAGGTGAC 57.476 41.667 0.00 0.00 0.00 3.67
4698 5933 6.013379 AGTAGAAGAAGAAGATGAGGTGACA 58.987 40.000 0.00 0.00 0.00 3.58
4699 5934 5.404466 AGAAGAAGAAGATGAGGTGACAG 57.596 43.478 0.00 0.00 0.00 3.51
4700 5935 5.083122 AGAAGAAGAAGATGAGGTGACAGA 58.917 41.667 0.00 0.00 0.00 3.41
4701 5936 5.185635 AGAAGAAGAAGATGAGGTGACAGAG 59.814 44.000 0.00 0.00 0.00 3.35
4702 5937 4.671831 AGAAGAAGATGAGGTGACAGAGA 58.328 43.478 0.00 0.00 0.00 3.10
4703 5938 4.706476 AGAAGAAGATGAGGTGACAGAGAG 59.294 45.833 0.00 0.00 0.00 3.20
4704 5939 4.314522 AGAAGATGAGGTGACAGAGAGA 57.685 45.455 0.00 0.00 0.00 3.10
4705 5940 4.272489 AGAAGATGAGGTGACAGAGAGAG 58.728 47.826 0.00 0.00 0.00 3.20
4706 5941 4.018506 AGAAGATGAGGTGACAGAGAGAGA 60.019 45.833 0.00 0.00 0.00 3.10
4707 5942 3.620488 AGATGAGGTGACAGAGAGAGAC 58.380 50.000 0.00 0.00 0.00 3.36
4708 5943 2.959465 TGAGGTGACAGAGAGAGACA 57.041 50.000 0.00 0.00 0.00 3.41
4709 5944 3.448093 TGAGGTGACAGAGAGAGACAT 57.552 47.619 0.00 0.00 0.00 3.06
4710 5945 3.772387 TGAGGTGACAGAGAGAGACATT 58.228 45.455 0.00 0.00 0.00 2.71
4711 5946 3.761218 TGAGGTGACAGAGAGAGACATTC 59.239 47.826 0.00 0.00 0.00 2.67
4712 5947 4.016444 GAGGTGACAGAGAGAGACATTCT 58.984 47.826 0.00 0.00 39.43 2.40
4713 5948 3.763360 AGGTGACAGAGAGAGACATTCTG 59.237 47.826 0.00 0.00 43.04 3.02
4718 5953 4.374843 CAGAGAGAGACATTCTGTGGAG 57.625 50.000 0.00 0.00 35.87 3.86
4719 5954 4.015764 CAGAGAGAGACATTCTGTGGAGA 58.984 47.826 0.00 0.00 35.87 3.71
4720 5955 4.462132 CAGAGAGAGACATTCTGTGGAGAA 59.538 45.833 0.00 0.00 42.53 2.87
4721 5956 4.462483 AGAGAGAGACATTCTGTGGAGAAC 59.538 45.833 0.00 0.00 41.12 3.01
4722 5957 4.415596 AGAGAGACATTCTGTGGAGAACT 58.584 43.478 0.00 0.00 41.12 3.01
4723 5958 4.837860 AGAGAGACATTCTGTGGAGAACTT 59.162 41.667 0.00 0.00 41.12 2.66
4724 5959 6.013379 AGAGAGACATTCTGTGGAGAACTTA 58.987 40.000 0.00 0.00 41.12 2.24
4725 5960 6.495181 AGAGAGACATTCTGTGGAGAACTTAA 59.505 38.462 0.00 0.00 41.12 1.85
4726 5961 6.696411 AGAGACATTCTGTGGAGAACTTAAG 58.304 40.000 0.00 0.00 41.12 1.85
4727 5962 6.268847 AGAGACATTCTGTGGAGAACTTAAGT 59.731 38.462 1.12 1.12 41.12 2.24
4728 5963 7.451877 AGAGACATTCTGTGGAGAACTTAAGTA 59.548 37.037 8.92 0.00 41.12 2.24
4729 5964 7.607250 AGACATTCTGTGGAGAACTTAAGTAG 58.393 38.462 8.92 0.60 41.12 2.57
4730 5965 7.451877 AGACATTCTGTGGAGAACTTAAGTAGA 59.548 37.037 8.92 3.21 41.12 2.59
4731 5966 7.607250 ACATTCTGTGGAGAACTTAAGTAGAG 58.393 38.462 8.92 0.82 41.12 2.43
4732 5967 5.646577 TCTGTGGAGAACTTAAGTAGAGC 57.353 43.478 8.92 0.00 0.00 4.09
4733 5968 5.077564 TCTGTGGAGAACTTAAGTAGAGCA 58.922 41.667 8.92 3.39 0.00 4.26
4734 5969 5.184096 TCTGTGGAGAACTTAAGTAGAGCAG 59.816 44.000 8.92 12.14 0.00 4.24
4735 5970 5.077564 TGTGGAGAACTTAAGTAGAGCAGA 58.922 41.667 8.92 0.00 0.00 4.26
4736 5971 5.717178 TGTGGAGAACTTAAGTAGAGCAGAT 59.283 40.000 8.92 0.00 0.00 2.90
4737 5972 6.039616 GTGGAGAACTTAAGTAGAGCAGATG 58.960 44.000 8.92 0.00 0.00 2.90
4738 5973 5.952347 TGGAGAACTTAAGTAGAGCAGATGA 59.048 40.000 8.92 0.00 0.00 2.92
4739 5974 6.096141 TGGAGAACTTAAGTAGAGCAGATGAG 59.904 42.308 8.92 0.00 0.00 2.90
4740 5975 6.320164 GGAGAACTTAAGTAGAGCAGATGAGA 59.680 42.308 8.92 0.00 0.00 3.27
4741 5976 7.333528 AGAACTTAAGTAGAGCAGATGAGAG 57.666 40.000 8.92 0.00 0.00 3.20
4742 5977 5.514274 ACTTAAGTAGAGCAGATGAGAGC 57.486 43.478 6.26 0.00 0.00 4.09
4743 5978 4.952957 ACTTAAGTAGAGCAGATGAGAGCA 59.047 41.667 6.26 0.00 0.00 4.26
4744 5979 5.067674 ACTTAAGTAGAGCAGATGAGAGCAG 59.932 44.000 6.26 0.00 0.00 4.24
4745 5980 3.295585 AGTAGAGCAGATGAGAGCAGA 57.704 47.619 0.00 0.00 0.00 4.26
4746 5981 3.836146 AGTAGAGCAGATGAGAGCAGAT 58.164 45.455 0.00 0.00 0.00 2.90
4747 5982 4.217510 AGTAGAGCAGATGAGAGCAGATT 58.782 43.478 0.00 0.00 0.00 2.40
4748 5983 5.384336 AGTAGAGCAGATGAGAGCAGATTA 58.616 41.667 0.00 0.00 0.00 1.75
4749 5984 5.832595 AGTAGAGCAGATGAGAGCAGATTAA 59.167 40.000 0.00 0.00 0.00 1.40
4750 5985 5.811796 AGAGCAGATGAGAGCAGATTAAT 57.188 39.130 0.00 0.00 0.00 1.40
4751 5986 5.543714 AGAGCAGATGAGAGCAGATTAATG 58.456 41.667 0.00 0.00 0.00 1.90
4752 5987 5.304871 AGAGCAGATGAGAGCAGATTAATGA 59.695 40.000 0.00 0.00 0.00 2.57
4753 5988 5.926663 AGCAGATGAGAGCAGATTAATGAA 58.073 37.500 0.00 0.00 0.00 2.57
4754 5989 6.354938 AGCAGATGAGAGCAGATTAATGAAA 58.645 36.000 0.00 0.00 0.00 2.69
4755 5990 6.999272 AGCAGATGAGAGCAGATTAATGAAAT 59.001 34.615 0.00 0.00 0.00 2.17
4756 5991 7.173562 AGCAGATGAGAGCAGATTAATGAAATC 59.826 37.037 0.00 0.00 43.81 2.17
4770 6005 8.915057 ATTAATGAAATCGACATTCTCATCCT 57.085 30.769 12.47 0.00 38.61 3.24
4771 6006 6.857777 AATGAAATCGACATTCTCATCCTC 57.142 37.500 12.47 0.00 33.46 3.71
4772 6007 5.604758 TGAAATCGACATTCTCATCCTCT 57.395 39.130 12.47 0.00 0.00 3.69
4773 6008 5.982356 TGAAATCGACATTCTCATCCTCTT 58.018 37.500 12.47 0.00 0.00 2.85
4774 6009 6.409704 TGAAATCGACATTCTCATCCTCTTT 58.590 36.000 12.47 0.00 0.00 2.52
4775 6010 7.555965 TGAAATCGACATTCTCATCCTCTTTA 58.444 34.615 12.47 0.00 0.00 1.85
4776 6011 8.040727 TGAAATCGACATTCTCATCCTCTTTAA 58.959 33.333 12.47 0.00 0.00 1.52
4777 6012 8.970859 AAATCGACATTCTCATCCTCTTTAAT 57.029 30.769 0.00 0.00 0.00 1.40
4778 6013 8.970859 AATCGACATTCTCATCCTCTTTAATT 57.029 30.769 0.00 0.00 0.00 1.40
4779 6014 7.776933 TCGACATTCTCATCCTCTTTAATTG 57.223 36.000 0.00 0.00 0.00 2.32
4780 6015 7.555965 TCGACATTCTCATCCTCTTTAATTGA 58.444 34.615 0.00 0.00 0.00 2.57
4781 6016 8.040727 TCGACATTCTCATCCTCTTTAATTGAA 58.959 33.333 0.00 0.00 0.00 2.69
4782 6017 8.834465 CGACATTCTCATCCTCTTTAATTGAAT 58.166 33.333 0.00 0.00 0.00 2.57
4783 6018 9.947669 GACATTCTCATCCTCTTTAATTGAATG 57.052 33.333 0.00 0.00 41.96 2.67
4784 6019 9.690913 ACATTCTCATCCTCTTTAATTGAATGA 57.309 29.630 15.66 0.31 40.00 2.57
4787 6022 9.910267 TTCTCATCCTCTTTAATTGAATGATCA 57.090 29.630 0.00 0.00 0.00 2.92
4798 6033 4.316205 TTGAATGATCAATGGATGCAGC 57.684 40.909 0.00 0.00 40.59 5.25
4799 6034 3.292460 TGAATGATCAATGGATGCAGCA 58.708 40.909 3.51 0.00 32.67 4.41
4800 6035 3.317993 TGAATGATCAATGGATGCAGCAG 59.682 43.478 3.51 0.00 32.67 4.24
4801 6036 1.029681 TGATCAATGGATGCAGCAGC 58.970 50.000 3.51 0.62 42.57 5.25
4819 6054 8.659925 GCAGCAGCATATATATACAATTCTCT 57.340 34.615 0.00 0.00 41.58 3.10
4820 6055 8.763356 GCAGCAGCATATATATACAATTCTCTC 58.237 37.037 0.00 0.00 41.58 3.20
4821 6056 9.813446 CAGCAGCATATATATACAATTCTCTCA 57.187 33.333 0.00 0.00 0.00 3.27
4836 6071 9.327628 ACAATTCTCTCATCATCAACTAATCTG 57.672 33.333 0.00 0.00 0.00 2.90
4837 6072 9.543783 CAATTCTCTCATCATCAACTAATCTGA 57.456 33.333 0.00 0.00 0.00 3.27
4838 6073 9.767228 AATTCTCTCATCATCAACTAATCTGAG 57.233 33.333 0.00 0.00 0.00 3.35
4839 6074 7.894753 TCTCTCATCATCAACTAATCTGAGT 57.105 36.000 0.00 0.00 32.49 3.41
4840 6075 8.986929 TCTCTCATCATCAACTAATCTGAGTA 57.013 34.615 0.00 0.00 32.49 2.59
4841 6076 9.413734 TCTCTCATCATCAACTAATCTGAGTAA 57.586 33.333 0.00 0.00 32.49 2.24
4842 6077 9.681692 CTCTCATCATCAACTAATCTGAGTAAG 57.318 37.037 0.00 0.00 32.49 2.34
4843 6078 9.194972 TCTCATCATCAACTAATCTGAGTAAGT 57.805 33.333 0.00 0.00 32.49 2.24
4849 6084 9.254133 CATCAACTAATCTGAGTAAGTACATGG 57.746 37.037 0.00 0.00 0.00 3.66
4850 6085 8.362464 TCAACTAATCTGAGTAAGTACATGGT 57.638 34.615 0.00 0.00 0.00 3.55
4851 6086 8.812972 TCAACTAATCTGAGTAAGTACATGGTT 58.187 33.333 0.00 0.00 0.00 3.67
4858 6093 8.589701 TCTGAGTAAGTACATGGTTAATCTCA 57.410 34.615 0.00 3.97 0.00 3.27
4859 6094 8.687242 TCTGAGTAAGTACATGGTTAATCTCAG 58.313 37.037 20.54 20.54 43.34 3.35
4860 6095 8.362464 TGAGTAAGTACATGGTTAATCTCAGT 57.638 34.615 0.00 0.00 0.00 3.41
4861 6096 9.470399 TGAGTAAGTACATGGTTAATCTCAGTA 57.530 33.333 0.00 0.00 0.00 2.74
4862 6097 9.953697 GAGTAAGTACATGGTTAATCTCAGTAG 57.046 37.037 0.00 0.00 0.00 2.57
4863 6098 9.476928 AGTAAGTACATGGTTAATCTCAGTAGT 57.523 33.333 0.00 0.00 0.00 2.73
4867 6102 9.251440 AGTACATGGTTAATCTCAGTAGTAACA 57.749 33.333 0.00 0.00 0.00 2.41
4869 6104 8.948631 ACATGGTTAATCTCAGTAGTAACATG 57.051 34.615 0.00 0.00 0.00 3.21
4870 6105 7.987458 ACATGGTTAATCTCAGTAGTAACATGG 59.013 37.037 0.00 0.00 0.00 3.66
4871 6106 7.727578 TGGTTAATCTCAGTAGTAACATGGA 57.272 36.000 0.00 0.00 0.00 3.41
4872 6107 8.319057 TGGTTAATCTCAGTAGTAACATGGAT 57.681 34.615 0.00 0.00 0.00 3.41
4873 6108 8.204160 TGGTTAATCTCAGTAGTAACATGGATG 58.796 37.037 0.00 0.00 0.00 3.51
4874 6109 7.657761 GGTTAATCTCAGTAGTAACATGGATGG 59.342 40.741 0.00 0.00 0.00 3.51
4875 6110 8.421784 GTTAATCTCAGTAGTAACATGGATGGA 58.578 37.037 0.00 0.00 0.00 3.41
4876 6111 7.623999 AATCTCAGTAGTAACATGGATGGAT 57.376 36.000 0.00 0.00 0.00 3.41
4877 6112 7.623999 ATCTCAGTAGTAACATGGATGGATT 57.376 36.000 0.00 0.00 0.00 3.01
4878 6113 7.437713 TCTCAGTAGTAACATGGATGGATTT 57.562 36.000 0.00 0.00 0.00 2.17
4879 6114 7.275183 TCTCAGTAGTAACATGGATGGATTTG 58.725 38.462 0.00 0.00 0.00 2.32
4880 6115 6.356556 TCAGTAGTAACATGGATGGATTTGG 58.643 40.000 0.00 0.00 0.00 3.28
4881 6116 6.069673 TCAGTAGTAACATGGATGGATTTGGT 60.070 38.462 0.00 0.00 0.00 3.67
4882 6117 6.260936 CAGTAGTAACATGGATGGATTTGGTC 59.739 42.308 0.00 0.00 0.00 4.02
4883 6118 5.456921 AGTAACATGGATGGATTTGGTCT 57.543 39.130 0.00 0.00 0.00 3.85
4884 6119 5.440610 AGTAACATGGATGGATTTGGTCTC 58.559 41.667 0.00 0.00 0.00 3.36
4885 6120 4.320546 AACATGGATGGATTTGGTCTCA 57.679 40.909 0.00 0.00 0.00 3.27
4886 6121 4.320546 ACATGGATGGATTTGGTCTCAA 57.679 40.909 0.00 0.00 0.00 3.02
4887 6122 4.019174 ACATGGATGGATTTGGTCTCAAC 58.981 43.478 0.00 0.00 31.78 3.18
4888 6123 4.264083 ACATGGATGGATTTGGTCTCAACT 60.264 41.667 0.00 0.00 31.78 3.16
4889 6124 3.955471 TGGATGGATTTGGTCTCAACTC 58.045 45.455 0.00 0.00 33.45 3.01
4890 6125 3.330405 TGGATGGATTTGGTCTCAACTCA 59.670 43.478 0.00 0.00 35.18 3.41
4891 6126 4.202556 TGGATGGATTTGGTCTCAACTCAA 60.203 41.667 0.00 0.00 35.18 3.02
4892 6127 4.156739 GGATGGATTTGGTCTCAACTCAAC 59.843 45.833 0.00 0.00 35.18 3.18
4893 6128 4.437682 TGGATTTGGTCTCAACTCAACT 57.562 40.909 0.00 0.00 35.18 3.16
4894 6129 4.389374 TGGATTTGGTCTCAACTCAACTC 58.611 43.478 0.00 0.00 35.18 3.01
4895 6130 4.141505 TGGATTTGGTCTCAACTCAACTCA 60.142 41.667 0.00 0.00 35.18 3.41
4896 6131 4.821805 GGATTTGGTCTCAACTCAACTCAA 59.178 41.667 0.00 0.00 35.18 3.02
4897 6132 5.049129 GGATTTGGTCTCAACTCAACTCAAG 60.049 44.000 0.00 0.00 35.18 3.02
4898 6133 4.487714 TTGGTCTCAACTCAACTCAAGT 57.512 40.909 0.00 0.00 0.00 3.16
4899 6134 4.060038 TGGTCTCAACTCAACTCAAGTC 57.940 45.455 0.00 0.00 0.00 3.01
4900 6135 3.450817 TGGTCTCAACTCAACTCAAGTCA 59.549 43.478 0.00 0.00 0.00 3.41
4901 6136 4.081142 TGGTCTCAACTCAACTCAAGTCAA 60.081 41.667 0.00 0.00 0.00 3.18
4902 6137 4.271291 GGTCTCAACTCAACTCAAGTCAAC 59.729 45.833 0.00 0.00 0.00 3.18
4903 6138 5.112686 GTCTCAACTCAACTCAAGTCAACT 58.887 41.667 0.00 0.00 0.00 3.16
4904 6139 5.233263 GTCTCAACTCAACTCAAGTCAACTC 59.767 44.000 0.00 0.00 0.00 3.01
4905 6140 5.084818 TCAACTCAACTCAAGTCAACTCA 57.915 39.130 0.00 0.00 0.00 3.41
4906 6141 5.487433 TCAACTCAACTCAAGTCAACTCAA 58.513 37.500 0.00 0.00 0.00 3.02
4907 6142 5.582269 TCAACTCAACTCAAGTCAACTCAAG 59.418 40.000 0.00 0.00 0.00 3.02
4908 6143 5.091261 ACTCAACTCAAGTCAACTCAAGT 57.909 39.130 0.00 0.00 0.00 3.16
4909 6144 4.872691 ACTCAACTCAAGTCAACTCAAGTG 59.127 41.667 0.00 0.00 0.00 3.16
4910 6145 5.084818 TCAACTCAAGTCAACTCAAGTGA 57.915 39.130 0.00 0.00 0.00 3.41
4911 6146 5.674525 TCAACTCAAGTCAACTCAAGTGAT 58.325 37.500 0.00 0.00 0.00 3.06
4912 6147 5.755375 TCAACTCAAGTCAACTCAAGTGATC 59.245 40.000 0.00 0.00 0.00 2.92
4913 6148 5.282055 ACTCAAGTCAACTCAAGTGATCA 57.718 39.130 0.00 0.00 0.00 2.92
4914 6149 5.862845 ACTCAAGTCAACTCAAGTGATCAT 58.137 37.500 0.00 0.00 0.00 2.45
4915 6150 5.699915 ACTCAAGTCAACTCAAGTGATCATG 59.300 40.000 0.00 0.00 0.00 3.07
4916 6151 4.999311 TCAAGTCAACTCAAGTGATCATGG 59.001 41.667 0.00 0.00 0.00 3.66
4917 6152 4.897509 AGTCAACTCAAGTGATCATGGA 57.102 40.909 0.00 0.00 0.00 3.41
4918 6153 5.432680 AGTCAACTCAAGTGATCATGGAT 57.567 39.130 0.00 0.00 0.00 3.41
4919 6154 5.183969 AGTCAACTCAAGTGATCATGGATG 58.816 41.667 0.00 0.00 0.00 3.51
4920 6155 4.334759 GTCAACTCAAGTGATCATGGATGG 59.665 45.833 0.00 0.00 0.00 3.51
4921 6156 3.572632 ACTCAAGTGATCATGGATGGG 57.427 47.619 0.00 0.00 0.00 4.00
4922 6157 2.174210 ACTCAAGTGATCATGGATGGGG 59.826 50.000 0.00 0.00 0.00 4.96
4923 6158 1.133699 TCAAGTGATCATGGATGGGGC 60.134 52.381 0.00 0.00 0.00 5.80
4924 6159 1.133575 CAAGTGATCATGGATGGGGCT 60.134 52.381 0.00 0.00 0.00 5.19
4925 6160 2.107031 CAAGTGATCATGGATGGGGCTA 59.893 50.000 0.00 0.00 0.00 3.93
4926 6161 1.983691 AGTGATCATGGATGGGGCTAG 59.016 52.381 0.00 0.00 0.00 3.42
4927 6162 0.694771 TGATCATGGATGGGGCTAGC 59.305 55.000 6.04 6.04 0.00 3.42
4928 6163 0.694771 GATCATGGATGGGGCTAGCA 59.305 55.000 18.24 0.00 0.00 3.49
4929 6164 1.074405 GATCATGGATGGGGCTAGCAA 59.926 52.381 18.24 1.28 0.00 3.91
4930 6165 0.925558 TCATGGATGGGGCTAGCAAA 59.074 50.000 18.24 0.87 0.00 3.68
4931 6166 1.035139 CATGGATGGGGCTAGCAAAC 58.965 55.000 18.24 6.32 0.00 2.93
4932 6167 0.929244 ATGGATGGGGCTAGCAAACT 59.071 50.000 18.24 0.00 0.00 2.66
4933 6168 0.255890 TGGATGGGGCTAGCAAACTC 59.744 55.000 18.24 7.50 0.00 3.01
4934 6169 0.255890 GGATGGGGCTAGCAAACTCA 59.744 55.000 18.24 5.70 0.00 3.41
4935 6170 1.673168 GATGGGGCTAGCAAACTCAG 58.327 55.000 18.24 0.00 0.00 3.35
4936 6171 0.995024 ATGGGGCTAGCAAACTCAGT 59.005 50.000 18.24 0.00 0.00 3.41
4937 6172 0.324943 TGGGGCTAGCAAACTCAGTC 59.675 55.000 18.24 0.00 0.00 3.51
4938 6173 0.324943 GGGGCTAGCAAACTCAGTCA 59.675 55.000 18.24 0.00 0.00 3.41
4939 6174 1.677217 GGGGCTAGCAAACTCAGTCAG 60.677 57.143 18.24 0.00 0.00 3.51
4940 6175 1.276421 GGGCTAGCAAACTCAGTCAGA 59.724 52.381 18.24 0.00 0.00 3.27
4952 6187 3.673902 CTCAGTCAGAGTCAGAGTCAGA 58.326 50.000 8.03 2.09 39.62 3.27
4953 6188 3.673902 TCAGTCAGAGTCAGAGTCAGAG 58.326 50.000 8.03 0.00 0.00 3.35
4954 6189 3.072330 TCAGTCAGAGTCAGAGTCAGAGT 59.928 47.826 8.03 5.20 0.00 3.24
4955 6190 3.436704 CAGTCAGAGTCAGAGTCAGAGTC 59.563 52.174 11.44 11.44 36.03 3.36
4956 6191 3.072330 AGTCAGAGTCAGAGTCAGAGTCA 59.928 47.826 19.23 0.78 37.80 3.41
4957 6192 4.009675 GTCAGAGTCAGAGTCAGAGTCAT 58.990 47.826 19.23 5.25 37.80 3.06
4958 6193 4.094887 GTCAGAGTCAGAGTCAGAGTCATC 59.905 50.000 19.23 7.91 37.80 2.92
4959 6194 4.009002 CAGAGTCAGAGTCAGAGTCATCA 58.991 47.826 19.23 0.00 37.80 3.07
4960 6195 4.095334 CAGAGTCAGAGTCAGAGTCATCAG 59.905 50.000 19.23 5.75 37.80 2.90
4961 6196 2.754552 AGTCAGAGTCAGAGTCATCAGC 59.245 50.000 8.03 0.00 0.00 4.26
4962 6197 2.491298 GTCAGAGTCAGAGTCATCAGCA 59.509 50.000 8.03 0.00 0.00 4.41
4963 6198 2.491298 TCAGAGTCAGAGTCATCAGCAC 59.509 50.000 8.03 0.00 0.00 4.40
4964 6199 1.824230 AGAGTCAGAGTCATCAGCACC 59.176 52.381 8.03 0.00 0.00 5.01
4965 6200 1.824230 GAGTCAGAGTCATCAGCACCT 59.176 52.381 0.00 0.00 0.00 4.00
4966 6201 1.824230 AGTCAGAGTCATCAGCACCTC 59.176 52.381 0.00 0.00 0.00 3.85
4967 6202 1.547820 GTCAGAGTCATCAGCACCTCA 59.452 52.381 0.00 0.00 0.00 3.86
4968 6203 2.028658 GTCAGAGTCATCAGCACCTCAA 60.029 50.000 0.00 0.00 0.00 3.02
4969 6204 2.233186 TCAGAGTCATCAGCACCTCAAG 59.767 50.000 0.00 0.00 0.00 3.02
4970 6205 2.233186 CAGAGTCATCAGCACCTCAAGA 59.767 50.000 0.00 0.00 0.00 3.02
4971 6206 3.106054 AGAGTCATCAGCACCTCAAGAT 58.894 45.455 0.00 0.00 0.00 2.40
4972 6207 3.118702 AGAGTCATCAGCACCTCAAGATG 60.119 47.826 0.00 0.00 39.29 2.90
4973 6208 2.570752 AGTCATCAGCACCTCAAGATGT 59.429 45.455 0.00 0.00 39.06 3.06
4974 6209 2.676839 GTCATCAGCACCTCAAGATGTG 59.323 50.000 0.00 1.72 39.06 3.21
4975 6210 2.568509 TCATCAGCACCTCAAGATGTGA 59.431 45.455 9.26 0.00 39.06 3.58
4976 6211 3.008266 TCATCAGCACCTCAAGATGTGAA 59.992 43.478 9.26 0.00 39.06 3.18
4977 6212 3.708403 TCAGCACCTCAAGATGTGAAT 57.292 42.857 9.26 0.00 35.22 2.57
4978 6213 3.340928 TCAGCACCTCAAGATGTGAATG 58.659 45.455 9.26 7.07 35.22 2.67
4979 6214 3.079578 CAGCACCTCAAGATGTGAATGT 58.920 45.455 9.26 0.00 35.22 2.71
4980 6215 3.079578 AGCACCTCAAGATGTGAATGTG 58.920 45.455 9.26 0.00 40.00 3.21
4981 6216 3.076621 GCACCTCAAGATGTGAATGTGA 58.923 45.455 9.26 0.00 39.66 3.58
4982 6217 3.693085 GCACCTCAAGATGTGAATGTGAT 59.307 43.478 9.26 0.00 39.66 3.06
4983 6218 4.201891 GCACCTCAAGATGTGAATGTGATC 60.202 45.833 9.26 0.00 39.66 2.92
4984 6219 4.334759 CACCTCAAGATGTGAATGTGATCC 59.665 45.833 0.00 0.00 39.66 3.36
4985 6220 4.226846 ACCTCAAGATGTGAATGTGATCCT 59.773 41.667 0.00 0.00 35.22 3.24
4986 6221 4.815308 CCTCAAGATGTGAATGTGATCCTC 59.185 45.833 0.00 0.00 35.22 3.71
4987 6222 4.774124 TCAAGATGTGAATGTGATCCTCC 58.226 43.478 0.00 0.00 31.51 4.30
4988 6223 4.225717 TCAAGATGTGAATGTGATCCTCCA 59.774 41.667 0.00 0.00 31.51 3.86
4989 6224 4.148128 AGATGTGAATGTGATCCTCCAC 57.852 45.455 0.00 0.00 37.55 4.02
4990 6225 2.787473 TGTGAATGTGATCCTCCACC 57.213 50.000 0.00 0.00 36.26 4.61
4991 6226 2.269023 TGTGAATGTGATCCTCCACCT 58.731 47.619 0.00 0.00 36.26 4.00
4992 6227 2.026915 TGTGAATGTGATCCTCCACCTG 60.027 50.000 0.00 0.00 36.26 4.00
4993 6228 2.026822 GTGAATGTGATCCTCCACCTGT 60.027 50.000 0.00 0.00 36.26 4.00
4994 6229 3.197766 GTGAATGTGATCCTCCACCTGTA 59.802 47.826 0.00 0.00 36.26 2.74
4995 6230 3.452264 TGAATGTGATCCTCCACCTGTAG 59.548 47.826 0.00 0.00 36.26 2.74
4996 6231 2.919772 TGTGATCCTCCACCTGTAGA 57.080 50.000 0.00 0.00 36.26 2.59
4997 6232 3.184382 TGTGATCCTCCACCTGTAGAA 57.816 47.619 0.00 0.00 36.26 2.10
4998 6233 3.724478 TGTGATCCTCCACCTGTAGAAT 58.276 45.455 0.00 0.00 36.26 2.40
4999 6234 4.878968 TGTGATCCTCCACCTGTAGAATA 58.121 43.478 0.00 0.00 36.26 1.75
5000 6235 4.895889 TGTGATCCTCCACCTGTAGAATAG 59.104 45.833 0.00 0.00 36.26 1.73
5001 6236 3.898123 TGATCCTCCACCTGTAGAATAGC 59.102 47.826 0.00 0.00 0.00 2.97
5002 6237 3.689872 TCCTCCACCTGTAGAATAGCT 57.310 47.619 0.00 0.00 0.00 3.32
5003 6238 3.995636 TCCTCCACCTGTAGAATAGCTT 58.004 45.455 0.00 0.00 0.00 3.74
5004 6239 4.362677 TCCTCCACCTGTAGAATAGCTTT 58.637 43.478 0.00 0.00 0.00 3.51
5005 6240 4.406003 TCCTCCACCTGTAGAATAGCTTTC 59.594 45.833 0.00 0.00 0.00 2.62
5006 6241 4.162320 CCTCCACCTGTAGAATAGCTTTCA 59.838 45.833 0.00 0.00 0.00 2.69
5007 6242 5.344743 TCCACCTGTAGAATAGCTTTCAG 57.655 43.478 0.00 0.00 0.00 3.02
5008 6243 5.023452 TCCACCTGTAGAATAGCTTTCAGA 58.977 41.667 0.00 0.00 32.70 3.27
5009 6244 5.663106 TCCACCTGTAGAATAGCTTTCAGAT 59.337 40.000 0.00 0.00 32.70 2.90
5010 6245 6.156949 TCCACCTGTAGAATAGCTTTCAGATT 59.843 38.462 0.00 0.00 32.70 2.40
5011 6246 6.259608 CCACCTGTAGAATAGCTTTCAGATTG 59.740 42.308 0.00 0.00 32.70 2.67
5012 6247 5.819901 ACCTGTAGAATAGCTTTCAGATTGC 59.180 40.000 0.00 0.00 32.70 3.56
5013 6248 5.819379 CCTGTAGAATAGCTTTCAGATTGCA 59.181 40.000 0.00 0.00 32.70 4.08
5014 6249 6.018098 CCTGTAGAATAGCTTTCAGATTGCAG 60.018 42.308 0.00 0.10 32.70 4.41
5015 6250 6.643388 TGTAGAATAGCTTTCAGATTGCAGA 58.357 36.000 0.00 0.00 0.00 4.26
5016 6251 7.105588 TGTAGAATAGCTTTCAGATTGCAGAA 58.894 34.615 0.00 0.00 0.00 3.02
5017 6252 7.772292 TGTAGAATAGCTTTCAGATTGCAGAAT 59.228 33.333 0.00 0.00 0.00 2.40
5018 6253 9.265901 GTAGAATAGCTTTCAGATTGCAGAATA 57.734 33.333 0.00 0.00 0.00 1.75
5019 6254 8.380743 AGAATAGCTTTCAGATTGCAGAATAG 57.619 34.615 0.00 0.00 0.00 1.73
5020 6255 4.897025 AGCTTTCAGATTGCAGAATAGC 57.103 40.909 10.09 10.09 32.81 2.97
5021 6256 4.267536 AGCTTTCAGATTGCAGAATAGCA 58.732 39.130 15.78 0.00 43.99 3.49
5022 6257 4.888239 AGCTTTCAGATTGCAGAATAGCAT 59.112 37.500 15.78 0.00 45.19 3.79
5023 6258 4.976731 GCTTTCAGATTGCAGAATAGCATG 59.023 41.667 11.84 0.00 45.19 4.06
5024 6259 5.450137 GCTTTCAGATTGCAGAATAGCATGT 60.450 40.000 0.00 0.00 45.19 3.21
5025 6260 5.494632 TTCAGATTGCAGAATAGCATGTG 57.505 39.130 0.00 0.00 45.19 3.21
5026 6261 4.773013 TCAGATTGCAGAATAGCATGTGA 58.227 39.130 0.00 0.00 45.19 3.58
5027 6262 5.374071 TCAGATTGCAGAATAGCATGTGAT 58.626 37.500 0.00 0.00 45.19 3.06
5028 6263 5.238650 TCAGATTGCAGAATAGCATGTGATG 59.761 40.000 0.00 0.00 45.19 3.07
5029 6264 5.008712 CAGATTGCAGAATAGCATGTGATGT 59.991 40.000 0.00 0.00 45.19 3.06
5030 6265 4.625972 TTGCAGAATAGCATGTGATGTG 57.374 40.909 0.00 0.00 45.19 3.21
5031 6266 3.876341 TGCAGAATAGCATGTGATGTGA 58.124 40.909 0.00 0.00 40.11 3.58
5032 6267 4.457466 TGCAGAATAGCATGTGATGTGAT 58.543 39.130 0.00 0.00 40.11 3.06
5033 6268 4.885325 TGCAGAATAGCATGTGATGTGATT 59.115 37.500 0.00 0.00 40.11 2.57
5034 6269 5.212934 GCAGAATAGCATGTGATGTGATTG 58.787 41.667 0.00 0.00 0.00 2.67
5035 6270 5.212934 CAGAATAGCATGTGATGTGATTGC 58.787 41.667 0.00 0.00 0.00 3.56
5036 6271 5.008712 CAGAATAGCATGTGATGTGATTGCT 59.991 40.000 0.00 1.08 45.10 3.91
5037 6272 5.593095 AGAATAGCATGTGATGTGATTGCTT 59.407 36.000 0.65 0.00 43.08 3.91
5038 6273 3.777465 AGCATGTGATGTGATTGCTTC 57.223 42.857 0.00 0.00 40.58 3.86
5039 6274 3.086282 AGCATGTGATGTGATTGCTTCA 58.914 40.909 0.00 0.00 40.58 3.02
5040 6275 3.699538 AGCATGTGATGTGATTGCTTCAT 59.300 39.130 0.00 0.00 40.58 2.57
5041 6276 4.042398 GCATGTGATGTGATTGCTTCATC 58.958 43.478 0.00 0.00 36.54 2.92
5042 6277 4.439563 GCATGTGATGTGATTGCTTCATCA 60.440 41.667 0.00 0.00 43.36 3.07
5043 6278 5.646606 CATGTGATGTGATTGCTTCATCAA 58.353 37.500 8.33 1.85 45.75 2.57
5044 6279 5.708877 TGTGATGTGATTGCTTCATCAAA 57.291 34.783 8.33 1.64 45.75 2.69
5045 6280 5.705902 TGTGATGTGATTGCTTCATCAAAG 58.294 37.500 8.33 0.00 45.75 2.77
5046 6281 5.100259 GTGATGTGATTGCTTCATCAAAGG 58.900 41.667 8.33 0.00 45.75 3.11
5047 6282 3.581024 TGTGATTGCTTCATCAAAGGC 57.419 42.857 0.00 0.00 36.54 4.35
5048 6283 2.231964 TGTGATTGCTTCATCAAAGGCC 59.768 45.455 0.00 0.00 36.54 5.19
5049 6284 1.826720 TGATTGCTTCATCAAAGGCCC 59.173 47.619 0.00 0.00 35.37 5.80
5050 6285 1.137675 GATTGCTTCATCAAAGGCCCC 59.862 52.381 0.00 0.00 35.37 5.80
5051 6286 0.178938 TTGCTTCATCAAAGGCCCCA 60.179 50.000 0.00 0.00 35.37 4.96
5052 6287 0.899717 TGCTTCATCAAAGGCCCCAC 60.900 55.000 0.00 0.00 35.37 4.61
5053 6288 1.607801 GCTTCATCAAAGGCCCCACC 61.608 60.000 0.00 0.00 35.37 4.61
5054 6289 0.972471 CTTCATCAAAGGCCCCACCC 60.972 60.000 0.00 0.00 40.58 4.61
5055 6290 1.734420 TTCATCAAAGGCCCCACCCA 61.734 55.000 0.00 0.00 40.58 4.51
5056 6291 1.002017 CATCAAAGGCCCCACCCAT 59.998 57.895 0.00 0.00 40.58 4.00
5057 6292 0.618393 CATCAAAGGCCCCACCCATT 60.618 55.000 0.00 0.00 40.58 3.16
5058 6293 0.118952 ATCAAAGGCCCCACCCATTT 59.881 50.000 0.00 0.00 40.58 2.32
5059 6294 0.104725 TCAAAGGCCCCACCCATTTT 60.105 50.000 0.00 0.00 40.58 1.82
5060 6295 0.770499 CAAAGGCCCCACCCATTTTT 59.230 50.000 0.00 0.00 40.58 1.94
5079 6314 5.947228 TTTTTAGCAGTCCATCTTGTCTG 57.053 39.130 0.00 0.00 0.00 3.51
5080 6315 3.616956 TTAGCAGTCCATCTTGTCTGG 57.383 47.619 0.00 0.00 34.93 3.86
5081 6316 1.649321 AGCAGTCCATCTTGTCTGGA 58.351 50.000 0.00 0.00 40.49 3.86
5082 6317 1.980765 AGCAGTCCATCTTGTCTGGAA 59.019 47.619 0.00 0.00 44.19 3.53
5083 6318 2.079925 GCAGTCCATCTTGTCTGGAAC 58.920 52.381 0.00 0.00 44.19 3.62
5084 6319 2.289945 GCAGTCCATCTTGTCTGGAACT 60.290 50.000 0.00 0.00 44.19 3.01
5085 6320 3.594134 CAGTCCATCTTGTCTGGAACTC 58.406 50.000 0.00 0.00 44.19 3.01
5086 6321 3.260380 CAGTCCATCTTGTCTGGAACTCT 59.740 47.826 0.00 0.00 44.19 3.24
5087 6322 3.260380 AGTCCATCTTGTCTGGAACTCTG 59.740 47.826 0.00 0.00 44.19 3.35
5088 6323 2.568956 TCCATCTTGTCTGGAACTCTGG 59.431 50.000 0.00 0.00 39.83 3.86
5089 6324 2.568956 CCATCTTGTCTGGAACTCTGGA 59.431 50.000 0.00 0.00 35.70 3.86
5090 6325 3.199508 CCATCTTGTCTGGAACTCTGGAT 59.800 47.826 0.00 0.00 35.70 3.41
5091 6326 4.324099 CCATCTTGTCTGGAACTCTGGATT 60.324 45.833 0.00 0.00 35.70 3.01
5092 6327 4.277515 TCTTGTCTGGAACTCTGGATTG 57.722 45.455 0.00 0.00 0.00 2.67
5093 6328 3.008375 TCTTGTCTGGAACTCTGGATTGG 59.992 47.826 0.00 0.00 0.00 3.16
5094 6329 2.619931 TGTCTGGAACTCTGGATTGGA 58.380 47.619 0.00 0.00 0.00 3.53
5095 6330 3.184628 TGTCTGGAACTCTGGATTGGAT 58.815 45.455 0.00 0.00 0.00 3.41
5096 6331 3.054875 TGTCTGGAACTCTGGATTGGATG 60.055 47.826 0.00 0.00 0.00 3.51
5097 6332 2.507058 TCTGGAACTCTGGATTGGATGG 59.493 50.000 0.00 0.00 0.00 3.51
5098 6333 2.507058 CTGGAACTCTGGATTGGATGGA 59.493 50.000 0.00 0.00 0.00 3.41
5099 6334 3.125656 TGGAACTCTGGATTGGATGGAT 58.874 45.455 0.00 0.00 0.00 3.41
5100 6335 3.117776 TGGAACTCTGGATTGGATGGATG 60.118 47.826 0.00 0.00 0.00 3.51
5101 6336 3.137176 GGAACTCTGGATTGGATGGATGA 59.863 47.826 0.00 0.00 0.00 2.92
5102 6337 3.853355 ACTCTGGATTGGATGGATGAC 57.147 47.619 0.00 0.00 0.00 3.06
5103 6338 3.117745 ACTCTGGATTGGATGGATGACA 58.882 45.455 0.00 0.00 0.00 3.58
5104 6339 3.524789 ACTCTGGATTGGATGGATGACAA 59.475 43.478 0.00 0.00 0.00 3.18
5105 6340 4.018141 ACTCTGGATTGGATGGATGACAAA 60.018 41.667 0.00 0.00 0.00 2.83
5106 6341 4.272489 TCTGGATTGGATGGATGACAAAC 58.728 43.478 0.00 0.00 0.00 2.93
5107 6342 3.364549 TGGATTGGATGGATGACAAACC 58.635 45.455 0.00 0.00 37.50 3.27
5108 6343 3.011595 TGGATTGGATGGATGACAAACCT 59.988 43.478 0.00 0.00 37.76 3.50
5109 6344 3.382546 GGATTGGATGGATGACAAACCTG 59.617 47.826 0.00 0.00 35.10 4.00
5110 6345 3.524095 TTGGATGGATGACAAACCTGT 57.476 42.857 4.17 0.00 38.98 4.00
5121 6356 4.425577 GACAAACCTGTCCAATCATCAC 57.574 45.455 0.00 0.00 45.41 3.06
5122 6357 3.820467 GACAAACCTGTCCAATCATCACA 59.180 43.478 0.00 0.00 45.41 3.58
5123 6358 3.569701 ACAAACCTGTCCAATCATCACAC 59.430 43.478 0.00 0.00 0.00 3.82
5124 6359 2.496899 ACCTGTCCAATCATCACACC 57.503 50.000 0.00 0.00 0.00 4.16
5125 6360 1.988107 ACCTGTCCAATCATCACACCT 59.012 47.619 0.00 0.00 0.00 4.00
5126 6361 2.290514 ACCTGTCCAATCATCACACCTG 60.291 50.000 0.00 0.00 0.00 4.00
5127 6362 1.741706 CTGTCCAATCATCACACCTGC 59.258 52.381 0.00 0.00 0.00 4.85
5128 6363 1.352017 TGTCCAATCATCACACCTGCT 59.648 47.619 0.00 0.00 0.00 4.24
5129 6364 1.741706 GTCCAATCATCACACCTGCTG 59.258 52.381 0.00 0.00 0.00 4.41
5130 6365 1.352017 TCCAATCATCACACCTGCTGT 59.648 47.619 0.00 0.00 0.00 4.40
5139 6374 3.076104 CACCTGCTGTGCTATCCTG 57.924 57.895 0.00 0.00 38.34 3.86
5140 6375 0.538584 CACCTGCTGTGCTATCCTGA 59.461 55.000 0.00 0.00 38.34 3.86
5141 6376 1.065926 CACCTGCTGTGCTATCCTGAA 60.066 52.381 0.00 0.00 38.34 3.02
5142 6377 1.630369 ACCTGCTGTGCTATCCTGAAA 59.370 47.619 0.00 0.00 0.00 2.69
5143 6378 2.012673 CCTGCTGTGCTATCCTGAAAC 58.987 52.381 0.00 0.00 0.00 2.78
5144 6379 2.355513 CCTGCTGTGCTATCCTGAAACT 60.356 50.000 0.00 0.00 0.00 2.66
5145 6380 2.676839 CTGCTGTGCTATCCTGAAACTG 59.323 50.000 0.00 0.00 0.00 3.16
5146 6381 2.302733 TGCTGTGCTATCCTGAAACTGA 59.697 45.455 0.00 0.00 0.00 3.41
5147 6382 3.244526 TGCTGTGCTATCCTGAAACTGAA 60.245 43.478 0.00 0.00 0.00 3.02
5148 6383 3.753272 GCTGTGCTATCCTGAAACTGAAA 59.247 43.478 0.00 0.00 0.00 2.69
5149 6384 4.142730 GCTGTGCTATCCTGAAACTGAAAG 60.143 45.833 0.00 0.00 42.29 2.62
5150 6385 5.227569 TGTGCTATCCTGAAACTGAAAGA 57.772 39.130 0.00 0.00 37.43 2.52
5151 6386 5.620206 TGTGCTATCCTGAAACTGAAAGAA 58.380 37.500 0.00 0.00 37.43 2.52
5152 6387 6.240894 TGTGCTATCCTGAAACTGAAAGAAT 58.759 36.000 0.00 0.00 37.43 2.40
5153 6388 6.372659 TGTGCTATCCTGAAACTGAAAGAATC 59.627 38.462 0.00 0.00 37.43 2.52
5154 6389 6.597280 GTGCTATCCTGAAACTGAAAGAATCT 59.403 38.462 0.00 0.00 37.43 2.40
5155 6390 6.820656 TGCTATCCTGAAACTGAAAGAATCTC 59.179 38.462 0.00 0.00 37.43 2.75
5156 6391 6.820656 GCTATCCTGAAACTGAAAGAATCTCA 59.179 38.462 0.00 0.00 37.43 3.27
5157 6392 7.335422 GCTATCCTGAAACTGAAAGAATCTCAA 59.665 37.037 0.00 0.00 37.43 3.02
5158 6393 6.867662 TCCTGAAACTGAAAGAATCTCAAC 57.132 37.500 0.00 0.00 37.43 3.18
5159 6394 6.356556 TCCTGAAACTGAAAGAATCTCAACA 58.643 36.000 0.00 0.00 37.43 3.33
5160 6395 6.828273 TCCTGAAACTGAAAGAATCTCAACAA 59.172 34.615 0.00 0.00 37.43 2.83
5161 6396 7.339212 TCCTGAAACTGAAAGAATCTCAACAAA 59.661 33.333 0.00 0.00 37.43 2.83
5162 6397 8.139989 CCTGAAACTGAAAGAATCTCAACAAAT 58.860 33.333 0.00 0.00 37.43 2.32
5163 6398 9.525409 CTGAAACTGAAAGAATCTCAACAAATT 57.475 29.630 0.00 0.00 37.43 1.82
5164 6399 9.520204 TGAAACTGAAAGAATCTCAACAAATTC 57.480 29.630 0.00 0.00 37.43 2.17
5165 6400 8.877808 AAACTGAAAGAATCTCAACAAATTCC 57.122 30.769 0.00 0.00 37.43 3.01
5166 6401 7.830099 ACTGAAAGAATCTCAACAAATTCCT 57.170 32.000 0.00 0.00 37.43 3.36
5167 6402 8.242729 ACTGAAAGAATCTCAACAAATTCCTT 57.757 30.769 0.00 0.00 37.43 3.36
5168 6403 8.139989 ACTGAAAGAATCTCAACAAATTCCTTG 58.860 33.333 0.00 0.00 38.12 3.61
5169 6404 8.236585 TGAAAGAATCTCAACAAATTCCTTGA 57.763 30.769 0.00 0.00 38.50 3.02
5170 6405 8.137437 TGAAAGAATCTCAACAAATTCCTTGAC 58.863 33.333 0.00 0.00 38.50 3.18
5171 6406 7.587037 AAGAATCTCAACAAATTCCTTGACA 57.413 32.000 0.00 0.00 38.50 3.58
5172 6407 6.974965 AGAATCTCAACAAATTCCTTGACAC 58.025 36.000 0.00 0.00 38.50 3.67
5173 6408 5.712152 ATCTCAACAAATTCCTTGACACC 57.288 39.130 0.00 0.00 38.50 4.16
5174 6409 4.792068 TCTCAACAAATTCCTTGACACCT 58.208 39.130 0.00 0.00 38.50 4.00
5175 6410 5.935945 TCTCAACAAATTCCTTGACACCTA 58.064 37.500 0.00 0.00 38.50 3.08
5176 6411 5.763204 TCTCAACAAATTCCTTGACACCTAC 59.237 40.000 0.00 0.00 38.50 3.18
5177 6412 4.513692 TCAACAAATTCCTTGACACCTACG 59.486 41.667 0.00 0.00 38.50 3.51
5178 6413 4.081322 ACAAATTCCTTGACACCTACGT 57.919 40.909 0.00 0.00 38.50 3.57
5179 6414 5.217978 ACAAATTCCTTGACACCTACGTA 57.782 39.130 0.00 0.00 38.50 3.57
5180 6415 4.992951 ACAAATTCCTTGACACCTACGTAC 59.007 41.667 0.00 0.00 38.50 3.67
5181 6416 4.877378 AATTCCTTGACACCTACGTACA 57.123 40.909 0.00 0.00 0.00 2.90
5182 6417 5.416271 AATTCCTTGACACCTACGTACAT 57.584 39.130 0.00 0.00 0.00 2.29
5183 6418 6.534475 AATTCCTTGACACCTACGTACATA 57.466 37.500 0.00 0.00 0.00 2.29
5184 6419 6.726490 ATTCCTTGACACCTACGTACATAT 57.274 37.500 0.00 0.00 0.00 1.78
5185 6420 5.509716 TCCTTGACACCTACGTACATATG 57.490 43.478 0.00 0.00 0.00 1.78
5186 6421 4.951715 TCCTTGACACCTACGTACATATGT 59.048 41.667 13.93 13.93 0.00 2.29
5187 6422 6.121590 TCCTTGACACCTACGTACATATGTA 58.878 40.000 11.62 11.62 0.00 2.29
5188 6423 6.774170 TCCTTGACACCTACGTACATATGTAT 59.226 38.462 18.27 6.54 32.54 2.29
5189 6424 6.861572 CCTTGACACCTACGTACATATGTATG 59.138 42.308 26.58 26.58 41.89 2.39
5190 6425 5.765176 TGACACCTACGTACATATGTATGC 58.235 41.667 27.65 12.68 40.30 3.14
5191 6426 5.533528 TGACACCTACGTACATATGTATGCT 59.466 40.000 27.65 19.14 40.30 3.79
5192 6427 6.711645 TGACACCTACGTACATATGTATGCTA 59.288 38.462 27.65 19.21 40.30 3.49
5193 6428 7.094933 TGACACCTACGTACATATGTATGCTAG 60.095 40.741 27.65 24.46 40.30 3.42
5194 6429 6.028368 CACCTACGTACATATGTATGCTAGC 58.972 44.000 27.65 8.10 40.30 3.42
5195 6430 5.944599 ACCTACGTACATATGTATGCTAGCT 59.055 40.000 27.65 14.81 40.30 3.32
5196 6431 6.433404 ACCTACGTACATATGTATGCTAGCTT 59.567 38.462 27.65 12.56 40.30 3.74
5197 6432 7.609146 ACCTACGTACATATGTATGCTAGCTTA 59.391 37.037 27.65 11.41 40.30 3.09
5198 6433 8.123575 CCTACGTACATATGTATGCTAGCTTAG 58.876 40.741 27.65 20.59 40.30 2.18
5199 6434 6.853720 ACGTACATATGTATGCTAGCTTAGG 58.146 40.000 27.65 9.68 40.30 2.69
5200 6435 6.657966 ACGTACATATGTATGCTAGCTTAGGA 59.342 38.462 27.65 4.18 40.30 2.94
5201 6436 6.967767 CGTACATATGTATGCTAGCTTAGGAC 59.032 42.308 19.51 7.56 37.19 3.85
5202 6437 5.955488 ACATATGTATGCTAGCTTAGGACG 58.045 41.667 17.23 4.70 37.19 4.79
5203 6438 5.477291 ACATATGTATGCTAGCTTAGGACGT 59.523 40.000 17.23 8.83 37.19 4.34
5204 6439 4.939052 ATGTATGCTAGCTTAGGACGTT 57.061 40.909 17.23 0.00 0.00 3.99
5205 6440 7.176165 ACATATGTATGCTAGCTTAGGACGTTA 59.824 37.037 17.23 2.45 37.19 3.18
5206 6441 6.591750 ATGTATGCTAGCTTAGGACGTTAT 57.408 37.500 17.23 0.00 0.00 1.89
5207 6442 6.401047 TGTATGCTAGCTTAGGACGTTATT 57.599 37.500 17.23 0.00 0.00 1.40
5208 6443 6.812998 TGTATGCTAGCTTAGGACGTTATTT 58.187 36.000 17.23 0.00 0.00 1.40
5209 6444 6.700081 TGTATGCTAGCTTAGGACGTTATTTG 59.300 38.462 17.23 0.00 0.00 2.32
5210 6445 5.080969 TGCTAGCTTAGGACGTTATTTGT 57.919 39.130 17.23 0.00 0.00 2.83
5211 6446 5.484715 TGCTAGCTTAGGACGTTATTTGTT 58.515 37.500 17.23 0.00 0.00 2.83
5212 6447 5.350365 TGCTAGCTTAGGACGTTATTTGTTG 59.650 40.000 17.23 0.00 0.00 3.33
5213 6448 5.220605 GCTAGCTTAGGACGTTATTTGTTGG 60.221 44.000 7.70 0.00 0.00 3.77
5214 6449 4.901868 AGCTTAGGACGTTATTTGTTGGA 58.098 39.130 0.00 0.00 0.00 3.53
5215 6450 5.497474 AGCTTAGGACGTTATTTGTTGGAT 58.503 37.500 0.00 0.00 0.00 3.41
5216 6451 5.944007 AGCTTAGGACGTTATTTGTTGGATT 59.056 36.000 0.00 0.00 0.00 3.01
5217 6452 6.433093 AGCTTAGGACGTTATTTGTTGGATTT 59.567 34.615 0.00 0.00 0.00 2.17
5218 6453 6.745907 GCTTAGGACGTTATTTGTTGGATTTC 59.254 38.462 0.00 0.00 0.00 2.17
5219 6454 7.574217 GCTTAGGACGTTATTTGTTGGATTTCA 60.574 37.037 0.00 0.00 0.00 2.69
5220 6455 6.642707 AGGACGTTATTTGTTGGATTTCAA 57.357 33.333 0.00 0.00 0.00 2.69
5221 6456 7.227049 AGGACGTTATTTGTTGGATTTCAAT 57.773 32.000 0.00 0.00 37.73 2.57
5222 6457 7.312899 AGGACGTTATTTGTTGGATTTCAATC 58.687 34.615 0.00 0.00 37.73 2.67
5223 6458 7.040062 AGGACGTTATTTGTTGGATTTCAATCA 60.040 33.333 0.00 0.00 37.73 2.57
5224 6459 7.759433 GGACGTTATTTGTTGGATTTCAATCAT 59.241 33.333 0.00 0.00 37.73 2.45
5225 6460 8.464770 ACGTTATTTGTTGGATTTCAATCATG 57.535 30.769 2.04 0.00 37.73 3.07
5226 6461 7.063308 ACGTTATTTGTTGGATTTCAATCATGC 59.937 33.333 2.04 0.00 37.73 4.06
5227 6462 7.063191 CGTTATTTGTTGGATTTCAATCATGCA 59.937 33.333 0.00 0.00 37.73 3.96
5228 6463 8.885722 GTTATTTGTTGGATTTCAATCATGCAT 58.114 29.630 0.00 0.00 37.73 3.96
5229 6464 6.971527 TTTGTTGGATTTCAATCATGCATC 57.028 33.333 0.00 0.00 37.73 3.91
5230 6465 5.662674 TGTTGGATTTCAATCATGCATCA 57.337 34.783 0.00 0.00 37.73 3.07
5231 6466 5.412640 TGTTGGATTTCAATCATGCATCAC 58.587 37.500 0.00 0.00 37.73 3.06
5232 6467 5.047235 TGTTGGATTTCAATCATGCATCACA 60.047 36.000 0.00 0.00 37.73 3.58
5233 6468 5.662674 TGGATTTCAATCATGCATCACAA 57.337 34.783 0.00 0.00 37.15 3.33
5234 6469 5.412640 TGGATTTCAATCATGCATCACAAC 58.587 37.500 0.00 0.00 37.15 3.32
5235 6470 5.047235 TGGATTTCAATCATGCATCACAACA 60.047 36.000 0.00 0.00 37.15 3.33
5236 6471 5.870433 GGATTTCAATCATGCATCACAACAA 59.130 36.000 0.00 0.00 37.15 2.83
5237 6472 6.183360 GGATTTCAATCATGCATCACAACAAC 60.183 38.462 0.00 0.00 37.15 3.32
5238 6473 5.456548 TTCAATCATGCATCACAACAACT 57.543 34.783 0.00 0.00 0.00 3.16
5239 6474 6.572167 TTCAATCATGCATCACAACAACTA 57.428 33.333 0.00 0.00 0.00 2.24
5240 6475 6.572167 TCAATCATGCATCACAACAACTAA 57.428 33.333 0.00 0.00 0.00 2.24
5241 6476 7.160547 TCAATCATGCATCACAACAACTAAT 57.839 32.000 0.00 0.00 0.00 1.73
5242 6477 7.604549 TCAATCATGCATCACAACAACTAATT 58.395 30.769 0.00 0.00 0.00 1.40
5243 6478 8.738106 TCAATCATGCATCACAACAACTAATTA 58.262 29.630 0.00 0.00 0.00 1.40
5244 6479 9.356433 CAATCATGCATCACAACAACTAATTAA 57.644 29.630 0.00 0.00 0.00 1.40
5245 6480 8.915871 ATCATGCATCACAACAACTAATTAAC 57.084 30.769 0.00 0.00 0.00 2.01
5246 6481 7.312154 TCATGCATCACAACAACTAATTAACC 58.688 34.615 0.00 0.00 0.00 2.85
5247 6482 6.641169 TGCATCACAACAACTAATTAACCA 57.359 33.333 0.00 0.00 0.00 3.67
5248 6483 7.225784 TGCATCACAACAACTAATTAACCAT 57.774 32.000 0.00 0.00 0.00 3.55
5249 6484 7.089538 TGCATCACAACAACTAATTAACCATG 58.910 34.615 0.00 0.00 0.00 3.66
5250 6485 6.034898 GCATCACAACAACTAATTAACCATGC 59.965 38.462 0.00 0.00 0.00 4.06
5251 6486 6.641169 TCACAACAACTAATTAACCATGCA 57.359 33.333 0.00 0.00 0.00 3.96
5252 6487 7.225784 TCACAACAACTAATTAACCATGCAT 57.774 32.000 0.00 0.00 0.00 3.96
5253 6488 7.089538 TCACAACAACTAATTAACCATGCATG 58.910 34.615 20.19 20.19 0.00 4.06
5254 6489 5.868801 ACAACAACTAATTAACCATGCATGC 59.131 36.000 21.69 11.82 0.00 4.06
5255 6490 5.920193 ACAACTAATTAACCATGCATGCT 57.080 34.783 21.69 12.49 0.00 3.79
5256 6491 6.284891 ACAACTAATTAACCATGCATGCTT 57.715 33.333 21.69 16.36 0.00 3.91
5257 6492 7.403312 ACAACTAATTAACCATGCATGCTTA 57.597 32.000 21.69 15.28 0.00 3.09
5258 6493 7.835822 ACAACTAATTAACCATGCATGCTTAA 58.164 30.769 23.01 23.01 0.00 1.85
5259 6494 8.477256 ACAACTAATTAACCATGCATGCTTAAT 58.523 29.630 24.75 24.75 32.67 1.40
5260 6495 9.316730 CAACTAATTAACCATGCATGCTTAATT 57.683 29.630 33.89 33.89 39.72 1.40
5264 6499 8.836268 AATTAACCATGCATGCTTAATTATGG 57.164 30.769 32.39 23.59 37.04 2.74
5265 6500 7.594351 TTAACCATGCATGCTTAATTATGGA 57.406 32.000 29.30 12.57 35.41 3.41
5266 6501 5.717078 ACCATGCATGCTTAATTATGGAG 57.283 39.130 29.30 11.80 35.41 3.86
5267 6502 5.142639 ACCATGCATGCTTAATTATGGAGT 58.857 37.500 29.30 12.57 35.41 3.85
5268 6503 6.306199 ACCATGCATGCTTAATTATGGAGTA 58.694 36.000 29.30 3.57 35.41 2.59
5269 6504 6.207417 ACCATGCATGCTTAATTATGGAGTAC 59.793 38.462 29.30 0.00 35.41 2.73
5270 6505 6.349611 CCATGCATGCTTAATTATGGAGTACC 60.350 42.308 21.97 0.00 34.43 3.34
5287 6522 6.819649 TGGAGTACCAAACTACAATTATTCCG 59.180 38.462 0.00 0.00 46.58 4.30
5288 6523 7.043565 GGAGTACCAAACTACAATTATTCCGA 58.956 38.462 0.00 0.00 39.11 4.55
5289 6524 7.010830 GGAGTACCAAACTACAATTATTCCGAC 59.989 40.741 0.00 0.00 39.11 4.79
5290 6525 7.618137 AGTACCAAACTACAATTATTCCGACT 58.382 34.615 0.00 0.00 36.36 4.18
5291 6526 6.980051 ACCAAACTACAATTATTCCGACTC 57.020 37.500 0.00 0.00 0.00 3.36
5292 6527 6.469410 ACCAAACTACAATTATTCCGACTCA 58.531 36.000 0.00 0.00 0.00 3.41
5293 6528 6.938030 ACCAAACTACAATTATTCCGACTCAA 59.062 34.615 0.00 0.00 0.00 3.02
5294 6529 7.094933 ACCAAACTACAATTATTCCGACTCAAC 60.095 37.037 0.00 0.00 0.00 3.18
5295 6530 7.119262 CCAAACTACAATTATTCCGACTCAACT 59.881 37.037 0.00 0.00 0.00 3.16
5296 6531 9.146984 CAAACTACAATTATTCCGACTCAACTA 57.853 33.333 0.00 0.00 0.00 2.24
5297 6532 8.699283 AACTACAATTATTCCGACTCAACTAC 57.301 34.615 0.00 0.00 0.00 2.73
5298 6533 8.064336 ACTACAATTATTCCGACTCAACTACT 57.936 34.615 0.00 0.00 0.00 2.57
5299 6534 7.974501 ACTACAATTATTCCGACTCAACTACTG 59.025 37.037 0.00 0.00 0.00 2.74
5300 6535 6.106673 ACAATTATTCCGACTCAACTACTGG 58.893 40.000 0.00 0.00 0.00 4.00
5301 6536 4.730949 TTATTCCGACTCAACTACTGGG 57.269 45.455 0.00 0.00 0.00 4.45
5302 6537 0.606604 TTCCGACTCAACTACTGGGC 59.393 55.000 0.00 0.00 0.00 5.36
5303 6538 0.541063 TCCGACTCAACTACTGGGCA 60.541 55.000 0.00 0.00 0.00 5.36
5304 6539 0.108615 CCGACTCAACTACTGGGCAG 60.109 60.000 0.00 0.00 0.00 4.85
5305 6540 0.888619 CGACTCAACTACTGGGCAGA 59.111 55.000 0.00 0.00 0.00 4.26
5306 6541 1.402984 CGACTCAACTACTGGGCAGAC 60.403 57.143 0.00 0.00 0.00 3.51
5307 6542 1.618837 GACTCAACTACTGGGCAGACA 59.381 52.381 0.00 0.00 0.00 3.41
5308 6543 1.344763 ACTCAACTACTGGGCAGACAC 59.655 52.381 0.00 0.00 0.00 3.67
5309 6544 0.685097 TCAACTACTGGGCAGACACC 59.315 55.000 0.00 0.00 0.00 4.16
5310 6545 0.687354 CAACTACTGGGCAGACACCT 59.313 55.000 0.00 0.00 0.00 4.00
5311 6546 0.977395 AACTACTGGGCAGACACCTC 59.023 55.000 0.00 0.00 0.00 3.85
5312 6547 0.115349 ACTACTGGGCAGACACCTCT 59.885 55.000 0.00 0.00 0.00 3.69
5313 6548 1.358103 ACTACTGGGCAGACACCTCTA 59.642 52.381 0.00 0.00 0.00 2.43
5314 6549 2.225293 ACTACTGGGCAGACACCTCTAA 60.225 50.000 0.00 0.00 0.00 2.10
5315 6550 1.729586 ACTGGGCAGACACCTCTAAA 58.270 50.000 0.00 0.00 0.00 1.85
5316 6551 2.269940 ACTGGGCAGACACCTCTAAAT 58.730 47.619 0.00 0.00 0.00 1.40
5317 6552 3.450904 ACTGGGCAGACACCTCTAAATA 58.549 45.455 0.00 0.00 0.00 1.40
5318 6553 3.197983 ACTGGGCAGACACCTCTAAATAC 59.802 47.826 0.00 0.00 0.00 1.89
5319 6554 2.504175 TGGGCAGACACCTCTAAATACC 59.496 50.000 0.00 0.00 0.00 2.73
5320 6555 2.483188 GGGCAGACACCTCTAAATACCG 60.483 54.545 0.00 0.00 0.00 4.02
5321 6556 2.483188 GGCAGACACCTCTAAATACCGG 60.483 54.545 0.00 0.00 0.00 5.28
5322 6557 2.822764 CAGACACCTCTAAATACCGGC 58.177 52.381 0.00 0.00 0.00 6.13
5323 6558 1.761198 AGACACCTCTAAATACCGGCC 59.239 52.381 0.00 0.00 0.00 6.13
5324 6559 0.462789 ACACCTCTAAATACCGGCCG 59.537 55.000 21.04 21.04 0.00 6.13
5325 6560 0.878961 CACCTCTAAATACCGGCCGC 60.879 60.000 22.85 0.00 0.00 6.53
5326 6561 1.332144 ACCTCTAAATACCGGCCGCA 61.332 55.000 22.85 10.36 0.00 5.69
5327 6562 0.034896 CCTCTAAATACCGGCCGCAT 59.965 55.000 22.85 12.57 0.00 4.73
5328 6563 1.429463 CTCTAAATACCGGCCGCATC 58.571 55.000 22.85 0.00 0.00 3.91
5329 6564 0.753867 TCTAAATACCGGCCGCATCA 59.246 50.000 22.85 3.85 0.00 3.07
5330 6565 1.139256 TCTAAATACCGGCCGCATCAA 59.861 47.619 22.85 2.16 0.00 2.57
5331 6566 1.263217 CTAAATACCGGCCGCATCAAC 59.737 52.381 22.85 0.00 0.00 3.18
5332 6567 1.381165 AAATACCGGCCGCATCAACC 61.381 55.000 22.85 0.00 0.00 3.77
5333 6568 3.767630 ATACCGGCCGCATCAACCC 62.768 63.158 22.85 0.00 0.00 4.11
5336 6571 3.585990 CGGCCGCATCAACCCATC 61.586 66.667 14.67 0.00 0.00 3.51
5337 6572 2.440065 GGCCGCATCAACCCATCA 60.440 61.111 0.00 0.00 0.00 3.07
5338 6573 2.051518 GGCCGCATCAACCCATCAA 61.052 57.895 0.00 0.00 0.00 2.57
5339 6574 1.139520 GCCGCATCAACCCATCAAC 59.860 57.895 0.00 0.00 0.00 3.18
5340 6575 1.594194 GCCGCATCAACCCATCAACA 61.594 55.000 0.00 0.00 0.00 3.33
5341 6576 0.887247 CCGCATCAACCCATCAACAA 59.113 50.000 0.00 0.00 0.00 2.83
5342 6577 1.477700 CCGCATCAACCCATCAACAAT 59.522 47.619 0.00 0.00 0.00 2.71
5343 6578 2.480073 CCGCATCAACCCATCAACAATC 60.480 50.000 0.00 0.00 0.00 2.67
5344 6579 2.480073 CGCATCAACCCATCAACAATCC 60.480 50.000 0.00 0.00 0.00 3.01
5345 6580 2.159057 GCATCAACCCATCAACAATCCC 60.159 50.000 0.00 0.00 0.00 3.85
5346 6581 3.368248 CATCAACCCATCAACAATCCCT 58.632 45.455 0.00 0.00 0.00 4.20
5347 6582 3.085952 TCAACCCATCAACAATCCCTC 57.914 47.619 0.00 0.00 0.00 4.30
5348 6583 2.378208 TCAACCCATCAACAATCCCTCA 59.622 45.455 0.00 0.00 0.00 3.86
5349 6584 3.164268 CAACCCATCAACAATCCCTCAA 58.836 45.455 0.00 0.00 0.00 3.02
5350 6585 2.807676 ACCCATCAACAATCCCTCAAC 58.192 47.619 0.00 0.00 0.00 3.18
5351 6586 1.745087 CCCATCAACAATCCCTCAACG 59.255 52.381 0.00 0.00 0.00 4.10
5352 6587 2.617788 CCCATCAACAATCCCTCAACGA 60.618 50.000 0.00 0.00 0.00 3.85
5353 6588 3.081061 CCATCAACAATCCCTCAACGAA 58.919 45.455 0.00 0.00 0.00 3.85
5354 6589 3.119849 CCATCAACAATCCCTCAACGAAC 60.120 47.826 0.00 0.00 0.00 3.95
5355 6590 2.500229 TCAACAATCCCTCAACGAACC 58.500 47.619 0.00 0.00 0.00 3.62
5356 6591 2.105821 TCAACAATCCCTCAACGAACCT 59.894 45.455 0.00 0.00 0.00 3.50
5357 6592 2.474410 ACAATCCCTCAACGAACCTC 57.526 50.000 0.00 0.00 0.00 3.85
5358 6593 1.697432 ACAATCCCTCAACGAACCTCA 59.303 47.619 0.00 0.00 0.00 3.86
5359 6594 2.105821 ACAATCCCTCAACGAACCTCAA 59.894 45.455 0.00 0.00 0.00 3.02
5360 6595 2.474410 ATCCCTCAACGAACCTCAAC 57.526 50.000 0.00 0.00 0.00 3.18
5361 6596 1.420430 TCCCTCAACGAACCTCAACT 58.580 50.000 0.00 0.00 0.00 3.16
5362 6597 1.766496 TCCCTCAACGAACCTCAACTT 59.234 47.619 0.00 0.00 0.00 2.66
5363 6598 2.171870 TCCCTCAACGAACCTCAACTTT 59.828 45.455 0.00 0.00 0.00 2.66
5364 6599 2.949644 CCCTCAACGAACCTCAACTTTT 59.050 45.455 0.00 0.00 0.00 2.27
5365 6600 3.380320 CCCTCAACGAACCTCAACTTTTT 59.620 43.478 0.00 0.00 0.00 1.94
5389 6624 3.364277 GAGCATCTACAACCGGACC 57.636 57.895 9.46 0.00 0.00 4.46
5390 6625 0.824759 GAGCATCTACAACCGGACCT 59.175 55.000 9.46 0.00 0.00 3.85
5391 6626 0.824759 AGCATCTACAACCGGACCTC 59.175 55.000 9.46 0.00 0.00 3.85
5392 6627 0.824759 GCATCTACAACCGGACCTCT 59.175 55.000 9.46 0.00 0.00 3.69
5393 6628 1.202428 GCATCTACAACCGGACCTCTC 60.202 57.143 9.46 0.00 0.00 3.20
5394 6629 2.100197 CATCTACAACCGGACCTCTCA 58.900 52.381 9.46 0.00 0.00 3.27
5395 6630 2.297698 TCTACAACCGGACCTCTCAA 57.702 50.000 9.46 0.00 0.00 3.02
5396 6631 2.600790 TCTACAACCGGACCTCTCAAA 58.399 47.619 9.46 0.00 0.00 2.69
5397 6632 2.298163 TCTACAACCGGACCTCTCAAAC 59.702 50.000 9.46 0.00 0.00 2.93
5398 6633 0.108019 ACAACCGGACCTCTCAAACC 59.892 55.000 9.46 0.00 0.00 3.27
5399 6634 0.605589 CAACCGGACCTCTCAAACCC 60.606 60.000 9.46 0.00 0.00 4.11
5400 6635 2.108278 AACCGGACCTCTCAAACCCG 62.108 60.000 9.46 0.00 39.85 5.28
5401 6636 2.580601 CCGGACCTCTCAAACCCGT 61.581 63.158 0.00 0.00 38.61 5.28
5402 6637 1.080025 CGGACCTCTCAAACCCGTC 60.080 63.158 0.00 0.00 35.83 4.79
5403 6638 1.533469 CGGACCTCTCAAACCCGTCT 61.533 60.000 0.00 0.00 35.83 4.18
5404 6639 0.246910 GGACCTCTCAAACCCGTCTC 59.753 60.000 0.00 0.00 0.00 3.36
5405 6640 0.966920 GACCTCTCAAACCCGTCTCA 59.033 55.000 0.00 0.00 0.00 3.27
5406 6641 1.550976 GACCTCTCAAACCCGTCTCAT 59.449 52.381 0.00 0.00 0.00 2.90
5407 6642 2.758979 GACCTCTCAAACCCGTCTCATA 59.241 50.000 0.00 0.00 0.00 2.15
5408 6643 3.170717 ACCTCTCAAACCCGTCTCATAA 58.829 45.455 0.00 0.00 0.00 1.90
5409 6644 3.195825 ACCTCTCAAACCCGTCTCATAAG 59.804 47.826 0.00 0.00 0.00 1.73
5410 6645 3.190874 CTCTCAAACCCGTCTCATAAGC 58.809 50.000 0.00 0.00 0.00 3.09
5411 6646 2.093658 TCTCAAACCCGTCTCATAAGCC 60.094 50.000 0.00 0.00 0.00 4.35
5412 6647 1.065709 TCAAACCCGTCTCATAAGCCC 60.066 52.381 0.00 0.00 0.00 5.19
5413 6648 0.107848 AAACCCGTCTCATAAGCCCG 60.108 55.000 0.00 0.00 0.00 6.13
5414 6649 1.968050 AACCCGTCTCATAAGCCCGG 61.968 60.000 0.00 0.00 36.84 5.73
5415 6650 2.432300 CCCGTCTCATAAGCCCGGT 61.432 63.158 0.00 0.00 35.92 5.28
5416 6651 1.067582 CCGTCTCATAAGCCCGGTC 59.932 63.158 0.00 0.00 34.15 4.79
5417 6652 1.672854 CCGTCTCATAAGCCCGGTCA 61.673 60.000 0.00 0.00 34.15 4.02
5418 6653 0.389391 CGTCTCATAAGCCCGGTCAT 59.611 55.000 0.00 0.00 0.00 3.06
5419 6654 1.869754 CGTCTCATAAGCCCGGTCATG 60.870 57.143 0.00 0.00 0.00 3.07
5420 6655 1.412710 GTCTCATAAGCCCGGTCATGA 59.587 52.381 0.00 2.60 0.00 3.07
5421 6656 2.037772 GTCTCATAAGCCCGGTCATGAT 59.962 50.000 0.00 0.00 0.00 2.45
5422 6657 2.705658 TCTCATAAGCCCGGTCATGATT 59.294 45.455 0.00 0.00 0.00 2.57
5423 6658 3.136443 TCTCATAAGCCCGGTCATGATTT 59.864 43.478 0.00 0.00 0.00 2.17
5424 6659 3.885297 CTCATAAGCCCGGTCATGATTTT 59.115 43.478 0.00 0.00 0.00 1.82
5425 6660 4.277476 TCATAAGCCCGGTCATGATTTTT 58.723 39.130 0.00 0.00 0.00 1.94
5447 6682 4.033776 CCAGGCGGGCCTCTCAAA 62.034 66.667 9.77 0.00 46.28 2.69
5448 6683 2.747855 CAGGCGGGCCTCTCAAAC 60.748 66.667 9.77 0.00 46.28 2.93
5449 6684 4.394712 AGGCGGGCCTCTCAAACG 62.395 66.667 6.34 0.00 44.43 3.60
5454 6689 4.388499 GGCCTCTCAAACGCCCGA 62.388 66.667 0.00 0.00 36.63 5.14
5455 6690 2.815647 GCCTCTCAAACGCCCGAG 60.816 66.667 0.00 0.00 0.00 4.63
5456 6691 2.815647 CCTCTCAAACGCCCGAGC 60.816 66.667 0.00 0.00 0.00 5.03
5457 6692 2.262915 CTCTCAAACGCCCGAGCT 59.737 61.111 0.00 0.00 36.60 4.09
5458 6693 2.048222 TCTCAAACGCCCGAGCTG 60.048 61.111 0.00 0.00 36.60 4.24
5459 6694 2.048222 CTCAAACGCCCGAGCTGA 60.048 61.111 0.00 0.00 36.60 4.26
5460 6695 2.357034 TCAAACGCCCGAGCTGAC 60.357 61.111 0.00 0.00 36.60 3.51
5461 6696 3.423154 CAAACGCCCGAGCTGACC 61.423 66.667 0.00 0.00 36.60 4.02
5473 6708 3.164269 CTGACCGGCAGCCCCTAT 61.164 66.667 5.63 0.00 37.90 2.57
5474 6709 1.837051 CTGACCGGCAGCCCCTATA 60.837 63.158 5.63 0.00 37.90 1.31
5475 6710 1.152118 TGACCGGCAGCCCCTATAT 60.152 57.895 5.63 0.00 0.00 0.86
5476 6711 1.192146 TGACCGGCAGCCCCTATATC 61.192 60.000 5.63 0.00 0.00 1.63
5477 6712 1.900545 GACCGGCAGCCCCTATATCC 61.901 65.000 5.63 0.00 0.00 2.59
5478 6713 1.918293 CCGGCAGCCCCTATATCCA 60.918 63.158 5.63 0.00 0.00 3.41
5479 6714 1.599047 CGGCAGCCCCTATATCCAG 59.401 63.158 5.63 0.00 0.00 3.86
5480 6715 1.301293 GGCAGCCCCTATATCCAGC 59.699 63.158 0.00 0.00 0.00 4.85
5481 6716 1.301293 GCAGCCCCTATATCCAGCC 59.699 63.158 0.00 0.00 0.00 4.85
5482 6717 1.994463 CAGCCCCTATATCCAGCCC 59.006 63.158 0.00 0.00 0.00 5.19
5483 6718 0.842030 CAGCCCCTATATCCAGCCCA 60.842 60.000 0.00 0.00 0.00 5.36
5484 6719 0.103930 AGCCCCTATATCCAGCCCAA 60.104 55.000 0.00 0.00 0.00 4.12
5485 6720 0.777446 GCCCCTATATCCAGCCCAAA 59.223 55.000 0.00 0.00 0.00 3.28
5486 6721 1.359130 GCCCCTATATCCAGCCCAAAT 59.641 52.381 0.00 0.00 0.00 2.32
5487 6722 2.580783 GCCCCTATATCCAGCCCAAATA 59.419 50.000 0.00 0.00 0.00 1.40
5488 6723 3.205282 GCCCCTATATCCAGCCCAAATAT 59.795 47.826 0.00 0.00 0.00 1.28
5489 6724 4.796606 CCCCTATATCCAGCCCAAATATG 58.203 47.826 0.00 0.00 0.00 1.78
5498 6733 3.977244 CCAAATATGGGGCGCGCC 61.977 66.667 41.63 41.63 43.51 6.53
5499 6734 2.906897 CAAATATGGGGCGCGCCT 60.907 61.111 45.23 30.73 36.10 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.994355 AGTCCCTAGTTACCCAACCAA 58.006 47.619 0.00 0.00 35.05 3.67
1 2 2.727429 AGTCCCTAGTTACCCAACCA 57.273 50.000 0.00 0.00 35.05 3.67
2 3 3.307975 GGAAAGTCCCTAGTTACCCAACC 60.308 52.174 0.00 0.00 35.05 3.77
3 4 3.947868 GGAAAGTCCCTAGTTACCCAAC 58.052 50.000 0.00 0.00 34.67 3.77
16 17 5.845065 ACTTACTATAGGGATGGGAAAGTCC 59.155 44.000 4.43 0.00 35.23 3.85
17 18 6.997942 ACTTACTATAGGGATGGGAAAGTC 57.002 41.667 4.43 0.00 0.00 3.01
18 19 9.102453 GAATACTTACTATAGGGATGGGAAAGT 57.898 37.037 4.43 3.74 32.42 2.66
19 20 8.541234 GGAATACTTACTATAGGGATGGGAAAG 58.459 40.741 4.43 0.00 0.00 2.62
20 21 8.020253 TGGAATACTTACTATAGGGATGGGAAA 58.980 37.037 4.43 0.00 0.00 3.13
21 22 7.550042 TGGAATACTTACTATAGGGATGGGAA 58.450 38.462 4.43 0.00 0.00 3.97
22 23 7.123560 TGGAATACTTACTATAGGGATGGGA 57.876 40.000 4.43 0.00 0.00 4.37
23 24 7.996758 ATGGAATACTTACTATAGGGATGGG 57.003 40.000 4.43 0.00 0.00 4.00
34 35 9.574516 GGGTTCAATTGATATGGAATACTTACT 57.425 33.333 9.40 0.00 0.00 2.24
35 36 9.349713 TGGGTTCAATTGATATGGAATACTTAC 57.650 33.333 9.40 0.00 0.00 2.34
37 38 8.863086 CATGGGTTCAATTGATATGGAATACTT 58.137 33.333 9.40 0.00 0.00 2.24
38 39 7.039504 GCATGGGTTCAATTGATATGGAATACT 60.040 37.037 9.40 0.00 0.00 2.12
39 40 7.039504 AGCATGGGTTCAATTGATATGGAATAC 60.040 37.037 9.40 1.49 0.00 1.89
40 41 7.011994 AGCATGGGTTCAATTGATATGGAATA 58.988 34.615 9.40 0.00 0.00 1.75
41 42 5.842328 AGCATGGGTTCAATTGATATGGAAT 59.158 36.000 9.40 0.00 0.00 3.01
42 43 5.210430 AGCATGGGTTCAATTGATATGGAA 58.790 37.500 9.40 0.00 0.00 3.53
43 44 4.806892 AGCATGGGTTCAATTGATATGGA 58.193 39.130 9.40 0.00 0.00 3.41
44 45 6.653526 TTAGCATGGGTTCAATTGATATGG 57.346 37.500 9.40 0.00 0.00 2.74
45 46 7.816031 GGATTTAGCATGGGTTCAATTGATATG 59.184 37.037 9.40 12.21 0.00 1.78
46 47 7.731688 AGGATTTAGCATGGGTTCAATTGATAT 59.268 33.333 9.40 0.00 0.00 1.63
47 48 7.014518 CAGGATTTAGCATGGGTTCAATTGATA 59.985 37.037 9.40 0.00 0.00 2.15
48 49 5.901276 AGGATTTAGCATGGGTTCAATTGAT 59.099 36.000 9.40 0.00 0.00 2.57
49 50 5.127519 CAGGATTTAGCATGGGTTCAATTGA 59.872 40.000 3.38 3.38 0.00 2.57
50 51 5.353938 CAGGATTTAGCATGGGTTCAATTG 58.646 41.667 0.00 0.00 0.00 2.32
51 52 4.141869 GCAGGATTTAGCATGGGTTCAATT 60.142 41.667 0.00 0.00 0.00 2.32
52 53 3.385755 GCAGGATTTAGCATGGGTTCAAT 59.614 43.478 0.00 0.00 0.00 2.57
53 54 2.760092 GCAGGATTTAGCATGGGTTCAA 59.240 45.455 0.00 0.00 0.00 2.69
54 55 2.025037 AGCAGGATTTAGCATGGGTTCA 60.025 45.455 0.00 0.00 0.00 3.18
55 56 2.659428 AGCAGGATTTAGCATGGGTTC 58.341 47.619 0.00 0.00 0.00 3.62
56 57 2.834638 AGCAGGATTTAGCATGGGTT 57.165 45.000 0.00 0.00 0.00 4.11
57 58 2.834638 AAGCAGGATTTAGCATGGGT 57.165 45.000 0.00 0.00 0.00 4.51
58 59 4.828939 TCAATAAGCAGGATTTAGCATGGG 59.171 41.667 0.00 0.00 0.00 4.00
59 60 6.263842 TCTTCAATAAGCAGGATTTAGCATGG 59.736 38.462 0.00 0.00 32.36 3.66
60 61 7.268199 TCTTCAATAAGCAGGATTTAGCATG 57.732 36.000 0.00 0.00 32.36 4.06
61 62 7.559170 AGTTCTTCAATAAGCAGGATTTAGCAT 59.441 33.333 0.00 0.00 32.36 3.79
62 63 6.886459 AGTTCTTCAATAAGCAGGATTTAGCA 59.114 34.615 0.00 0.00 32.36 3.49
63 64 7.326968 AGTTCTTCAATAAGCAGGATTTAGC 57.673 36.000 0.00 0.00 32.36 3.09
64 65 8.950210 TCAAGTTCTTCAATAAGCAGGATTTAG 58.050 33.333 0.00 0.00 32.36 1.85
65 66 8.862325 TCAAGTTCTTCAATAAGCAGGATTTA 57.138 30.769 0.00 0.00 32.36 1.40
66 67 7.765695 TCAAGTTCTTCAATAAGCAGGATTT 57.234 32.000 0.00 0.00 32.36 2.17
67 68 7.765695 TTCAAGTTCTTCAATAAGCAGGATT 57.234 32.000 0.00 0.00 32.36 3.01
68 69 7.951347 ATTCAAGTTCTTCAATAAGCAGGAT 57.049 32.000 0.00 0.00 32.36 3.24
69 70 7.554118 CCTATTCAAGTTCTTCAATAAGCAGGA 59.446 37.037 0.00 0.00 32.36 3.86
70 71 7.554118 TCCTATTCAAGTTCTTCAATAAGCAGG 59.446 37.037 0.00 0.00 32.36 4.85
71 72 8.498054 TCCTATTCAAGTTCTTCAATAAGCAG 57.502 34.615 0.00 0.00 32.36 4.24
72 73 8.862325 TTCCTATTCAAGTTCTTCAATAAGCA 57.138 30.769 0.00 0.00 32.36 3.91
90 91 9.490379 CGGAGCATTACTTACTAAATTCCTATT 57.510 33.333 0.00 0.00 0.00 1.73
91 92 8.648693 ACGGAGCATTACTTACTAAATTCCTAT 58.351 33.333 0.00 0.00 0.00 2.57
92 93 7.924412 CACGGAGCATTACTTACTAAATTCCTA 59.076 37.037 0.00 0.00 0.00 2.94
93 94 6.761714 CACGGAGCATTACTTACTAAATTCCT 59.238 38.462 0.00 0.00 0.00 3.36
94 95 6.018180 CCACGGAGCATTACTTACTAAATTCC 60.018 42.308 0.00 0.00 0.00 3.01
95 96 6.537660 ACCACGGAGCATTACTTACTAAATTC 59.462 38.462 0.00 0.00 0.00 2.17
96 97 6.412214 ACCACGGAGCATTACTTACTAAATT 58.588 36.000 0.00 0.00 0.00 1.82
97 98 5.985911 ACCACGGAGCATTACTTACTAAAT 58.014 37.500 0.00 0.00 0.00 1.40
98 99 5.410355 ACCACGGAGCATTACTTACTAAA 57.590 39.130 0.00 0.00 0.00 1.85
99 100 5.172934 CAACCACGGAGCATTACTTACTAA 58.827 41.667 0.00 0.00 0.00 2.24
100 101 4.751060 CAACCACGGAGCATTACTTACTA 58.249 43.478 0.00 0.00 0.00 1.82
101 102 3.596214 CAACCACGGAGCATTACTTACT 58.404 45.455 0.00 0.00 0.00 2.24
102 103 2.095372 GCAACCACGGAGCATTACTTAC 59.905 50.000 0.00 0.00 0.00 2.34
103 104 2.289756 TGCAACCACGGAGCATTACTTA 60.290 45.455 4.30 0.00 32.55 2.24
104 105 1.165270 GCAACCACGGAGCATTACTT 58.835 50.000 0.00 0.00 0.00 2.24
105 106 0.036164 TGCAACCACGGAGCATTACT 59.964 50.000 4.30 0.00 32.55 2.24
106 107 1.094785 ATGCAACCACGGAGCATTAC 58.905 50.000 12.71 0.00 45.98 1.89
107 108 3.568000 ATGCAACCACGGAGCATTA 57.432 47.368 12.71 0.00 45.98 1.90
108 109 4.421365 ATGCAACCACGGAGCATT 57.579 50.000 12.71 1.72 45.98 3.56
110 111 1.073025 AGAATGCAACCACGGAGCA 59.927 52.632 9.66 9.66 43.14 4.26
111 112 0.955428 TCAGAATGCAACCACGGAGC 60.955 55.000 0.00 0.00 34.76 4.70
112 113 1.081892 CTCAGAATGCAACCACGGAG 58.918 55.000 0.00 0.00 34.76 4.63
113 114 0.684535 TCTCAGAATGCAACCACGGA 59.315 50.000 0.00 0.00 34.76 4.69
114 115 1.667724 GATCTCAGAATGCAACCACGG 59.332 52.381 0.00 0.00 34.76 4.94
115 116 2.349590 TGATCTCAGAATGCAACCACG 58.650 47.619 0.00 0.00 34.76 4.94
116 117 3.427233 GCTTGATCTCAGAATGCAACCAC 60.427 47.826 0.00 0.00 34.76 4.16
117 118 2.751259 GCTTGATCTCAGAATGCAACCA 59.249 45.455 0.00 0.00 34.76 3.67
118 119 2.751259 TGCTTGATCTCAGAATGCAACC 59.249 45.455 0.00 0.00 34.76 3.77
119 120 3.189910 TGTGCTTGATCTCAGAATGCAAC 59.810 43.478 0.00 0.00 34.76 4.17
120 121 3.189910 GTGTGCTTGATCTCAGAATGCAA 59.810 43.478 0.00 0.00 34.76 4.08
121 122 2.745821 GTGTGCTTGATCTCAGAATGCA 59.254 45.455 0.00 0.00 34.76 3.96
122 123 2.097142 GGTGTGCTTGATCTCAGAATGC 59.903 50.000 0.00 0.00 34.76 3.56
123 124 3.607741 AGGTGTGCTTGATCTCAGAATG 58.392 45.455 0.00 0.00 37.54 2.67
124 125 3.996921 AGGTGTGCTTGATCTCAGAAT 57.003 42.857 0.00 0.00 0.00 2.40
125 126 3.196469 CCTAGGTGTGCTTGATCTCAGAA 59.804 47.826 0.00 0.00 0.00 3.02
126 127 2.762887 CCTAGGTGTGCTTGATCTCAGA 59.237 50.000 0.00 0.00 0.00 3.27
127 128 2.741228 GCCTAGGTGTGCTTGATCTCAG 60.741 54.545 11.31 0.00 0.00 3.35
128 129 1.208052 GCCTAGGTGTGCTTGATCTCA 59.792 52.381 11.31 0.00 0.00 3.27
129 130 1.474143 GGCCTAGGTGTGCTTGATCTC 60.474