Multiple sequence alignment - TraesCS5B01G568500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G568500 chr5B 100.000 8552 0 0 1 8552 711591522 711600073 0.000000e+00 15793.0
1 TraesCS5B01G568500 chr5D 94.521 3650 119 31 4018 7634 561686382 561689983 0.000000e+00 5557.0
2 TraesCS5B01G568500 chr5D 90.788 2030 121 30 1993 3988 561684137 561686134 0.000000e+00 2652.0
3 TraesCS5B01G568500 chr5D 88.040 602 31 17 7958 8552 561690303 561690870 0.000000e+00 675.0
4 TraesCS5B01G568500 chr5D 86.024 415 31 11 2394 2796 504137092 504137491 3.690000e-113 420.0
5 TraesCS5B01G568500 chr5D 89.644 309 17 7 1648 1948 561683837 561684138 6.270000e-101 379.0
6 TraesCS5B01G568500 chr5D 82.979 282 38 8 2860 3138 69536787 69536513 6.630000e-61 246.0
7 TraesCS5B01G568500 chr5D 90.741 162 12 3 1171 1331 561683482 561683641 6.720000e-51 213.0
8 TraesCS5B01G568500 chr5D 85.211 142 18 3 920 1058 561683258 561683399 8.950000e-30 143.0
9 TraesCS5B01G568500 chr5D 100.000 28 0 0 1153 1180 561683455 561683482 1.600000e-02 52.8
10 TraesCS5B01G568500 chr7B 95.277 3303 102 24 4018 7313 1273325 1270070 0.000000e+00 5186.0
11 TraesCS5B01G568500 chr7B 90.498 2368 145 32 1651 3988 1275890 1273573 0.000000e+00 3053.0
12 TraesCS5B01G568500 chr7B 89.672 610 38 17 7951 8552 1269543 1268951 0.000000e+00 754.0
13 TraesCS5B01G568500 chr7B 81.181 728 97 23 6561 7277 744334208 744333510 4.510000e-152 549.0
14 TraesCS5B01G568500 chr7B 86.198 384 43 7 5319 5699 744334730 744334354 2.870000e-109 407.0
15 TraesCS5B01G568500 chr7B 94.163 257 13 2 7386 7642 1270023 1269769 2.890000e-104 390.0
16 TraesCS5B01G568500 chr7B 90.492 305 11 11 984 1285 1276475 1276186 3.740000e-103 387.0
17 TraesCS5B01G568500 chr7B 87.413 286 28 5 4745 5024 744335089 744334806 1.070000e-83 322.0
18 TraesCS5B01G568500 chr7B 86.397 272 23 6 3063 3332 577362195 577361936 1.410000e-72 285.0
19 TraesCS5B01G568500 chr7B 84.127 126 15 4 278 400 728873259 728873382 5.420000e-22 117.0
20 TraesCS5B01G568500 chr4D 88.309 556 58 5 5154 5704 4292740 4292187 0.000000e+00 660.0
21 TraesCS5B01G568500 chr4D 86.463 458 46 6 6172 6629 4291907 4291466 9.980000e-134 488.0
22 TraesCS5B01G568500 chr6A 86.856 563 62 6 5151 5704 48547851 48548410 3.390000e-173 619.0
23 TraesCS5B01G568500 chr6A 85.133 565 55 12 6172 6736 48548857 48549392 1.250000e-152 551.0
24 TraesCS5B01G568500 chrUn 85.971 556 61 12 6182 6736 356835915 356835376 5.760000e-161 579.0
25 TraesCS5B01G568500 chr4A 85.231 562 66 12 6176 6736 643558206 643558751 5.800000e-156 562.0
26 TraesCS5B01G568500 chr4A 88.406 414 29 10 2395 2797 638475185 638475590 1.670000e-131 481.0
27 TraesCS5B01G568500 chr4A 82.206 281 41 7 2860 3138 380811987 380811714 5.160000e-57 233.0
28 TraesCS5B01G568500 chr7A 88.395 405 28 10 2404 2797 668745319 668744923 3.610000e-128 470.0
29 TraesCS5B01G568500 chr7A 86.747 415 35 11 2395 2797 32210833 32210427 2.190000e-120 444.0
30 TraesCS5B01G568500 chr7A 79.888 179 22 13 156 328 439079026 439079196 1.510000e-22 119.0
31 TraesCS5B01G568500 chr5A 87.681 414 31 12 2395 2797 135147218 135146814 1.680000e-126 464.0
32 TraesCS5B01G568500 chr5A 77.619 420 70 18 154 558 119523935 119523525 5.160000e-57 233.0
33 TraesCS5B01G568500 chr1B 86.988 415 33 10 2394 2796 573513978 573513573 1.690000e-121 448.0
34 TraesCS5B01G568500 chr3B 90.400 250 20 2 3085 3332 45147036 45146789 8.280000e-85 326.0
35 TraesCS5B01G568500 chr3B 91.192 193 13 1 2605 2797 11696364 11696552 8.520000e-65 259.0
36 TraesCS5B01G568500 chr6B 88.603 272 21 4 3063 3332 632000432 632000169 1.070000e-83 322.0
37 TraesCS5B01G568500 chr6B 81.786 280 39 10 2860 3138 221926766 221926498 3.110000e-54 224.0
38 TraesCS5B01G568500 chr6B 81.429 280 41 9 2860 3138 221872636 221872367 1.450000e-52 219.0
39 TraesCS5B01G568500 chr4B 91.192 193 13 1 2605 2797 477966648 477966460 8.520000e-65 259.0
40 TraesCS5B01G568500 chr1D 85.887 248 25 5 5154 5397 208423226 208422985 1.100000e-63 255.0
41 TraesCS5B01G568500 chr1D 83.178 107 12 4 278 378 370524112 370524218 9.140000e-15 93.5
42 TraesCS5B01G568500 chr2A 84.064 251 30 5 5151 5397 197543259 197543503 5.160000e-57 233.0
43 TraesCS5B01G568500 chr2D 81.495 281 43 7 2860 3138 284241826 284242099 1.120000e-53 222.0
44 TraesCS5B01G568500 chr2D 96.296 54 2 0 5324 5377 534329282 534329335 1.180000e-13 89.8
45 TraesCS5B01G568500 chr7D 81.139 281 44 7 2860 3138 537255602 537255329 5.200000e-52 217.0
46 TraesCS5B01G568500 chr7D 83.108 148 18 4 257 400 627441523 627441667 2.510000e-25 128.0
47 TraesCS5B01G568500 chr7D 78.571 140 22 5 776 909 209788744 209788607 1.530000e-12 86.1
48 TraesCS5B01G568500 chr2B 81.139 281 44 7 2860 3138 440991800 440991527 5.200000e-52 217.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G568500 chr5B 711591522 711600073 8551 False 15793.000000 15793 100.000000 1 8552 1 chr5B.!!$F1 8551
1 TraesCS5B01G568500 chr5D 561683258 561690870 7612 False 1381.685714 5557 91.277857 920 8552 7 chr5D.!!$F2 7632
2 TraesCS5B01G568500 chr7B 1268951 1276475 7524 True 1954.000000 5186 92.020400 984 8552 5 chr7B.!!$R2 7568
3 TraesCS5B01G568500 chr7B 744333510 744335089 1579 True 426.000000 549 84.930667 4745 7277 3 chr7B.!!$R3 2532
4 TraesCS5B01G568500 chr4D 4291466 4292740 1274 True 574.000000 660 87.386000 5154 6629 2 chr4D.!!$R1 1475
5 TraesCS5B01G568500 chr6A 48547851 48549392 1541 False 585.000000 619 85.994500 5151 6736 2 chr6A.!!$F1 1585
6 TraesCS5B01G568500 chrUn 356835376 356835915 539 True 579.000000 579 85.971000 6182 6736 1 chrUn.!!$R1 554
7 TraesCS5B01G568500 chr4A 643558206 643558751 545 False 562.000000 562 85.231000 6176 6736 1 chr4A.!!$F2 560


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
108 109 0.035439 AAGCCGGGTTGACCACATAG 60.035 55.000 20.03 0.00 40.22 2.23 F
1070 1074 0.032217 CTCCTCCTCCTCCTCTGCTT 60.032 60.000 0.00 0.00 0.00 3.91 F
1075 1079 0.032217 CCTCCTCCTCTGCTTCCTCT 60.032 60.000 0.00 0.00 0.00 3.69 F
1553 1674 0.034574 AGCCACTCACCACAACACAA 60.035 50.000 0.00 0.00 0.00 3.33 F
1646 1767 0.036164 GAATTTTGGGTTGGGTGGCC 59.964 55.000 0.00 0.00 0.00 5.36 F
2227 2363 0.168128 CCCGTTCCATTTTCGCTGAC 59.832 55.000 0.00 0.00 0.00 3.51 F
4175 4573 0.101759 AACAGCAACAGCAACAGCAG 59.898 50.000 0.00 0.00 0.00 4.24 F
4211 4609 0.101759 AACAACAGCAACAGCAGCAG 59.898 50.000 0.00 0.00 0.00 4.24 F
4235 4633 0.173255 AACAACAGCACCAACAGCAC 59.827 50.000 0.00 0.00 0.00 4.40 F
4411 4812 0.323087 ACAGGAAATACCGTTGGGCC 60.323 55.000 0.00 0.00 44.74 5.80 F
4743 5144 1.892329 GCATTGAAGAAAGGGCCCTCA 60.892 52.381 28.84 16.57 0.00 3.86 F
5037 5444 2.177394 TGTGCCAGAGCGTTCAAATA 57.823 45.000 1.01 0.00 44.31 1.40 F
7000 7701 0.250684 TTGCACGGTGGTCATGATGT 60.251 50.000 10.60 0.00 0.00 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1627 1748 0.036164 GGCCACCCAACCCAAAATTC 59.964 55.000 0.00 0.00 0.00 2.17 R
2610 2767 0.946528 GCAGCACATGTGACTTGACA 59.053 50.000 29.80 0.00 0.00 3.58 R
2993 3158 0.959372 CTGCCCTGAAGTTGCCTGAG 60.959 60.000 0.00 0.00 0.00 3.35 R
3371 3540 0.035739 TTTTCACTAGGACACCCGGC 59.964 55.000 0.00 0.00 37.58 6.13 R
3429 3598 0.955428 TAGCCACAGCAAGCCGAAAG 60.955 55.000 0.00 0.00 43.56 2.62 R
4204 4602 0.101759 CTGTTGTTGTTGCTGCTGCT 59.898 50.000 17.00 0.00 40.48 4.24 R
5814 6452 0.444260 GAGTTACAGAAGCTTGGCGC 59.556 55.000 2.10 0.00 39.57 6.53 R
5815 6453 1.079503 GGAGTTACAGAAGCTTGGCG 58.920 55.000 2.10 0.00 0.00 5.69 R
5816 6454 2.185004 TGGAGTTACAGAAGCTTGGC 57.815 50.000 2.10 0.00 0.00 4.52 R
5917 6575 2.351738 GCAAGTACCCACATGCTTTGAC 60.352 50.000 0.00 0.00 44.14 3.18 R
6611 7294 1.272704 GGGAGGAATGCCCAAGAAAGT 60.273 52.381 0.00 0.00 45.31 2.66 R
7006 7707 0.170116 CACGTTGCACAAACACCTGT 59.830 50.000 0.00 0.00 38.84 4.00 R
8398 9237 0.357894 GACAACGACGACGACGAATG 59.642 55.000 25.15 22.29 42.66 2.67 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 3.689414 TACTGGATCGCACCGTGT 58.311 55.556 0.00 0.00 0.00 4.49
18 19 1.509463 TACTGGATCGCACCGTGTC 59.491 57.895 0.00 0.00 0.00 3.67
19 20 0.963856 TACTGGATCGCACCGTGTCT 60.964 55.000 0.00 0.00 0.00 3.41
20 21 0.963856 ACTGGATCGCACCGTGTCTA 60.964 55.000 0.00 0.00 0.00 2.59
21 22 0.248661 CTGGATCGCACCGTGTCTAG 60.249 60.000 0.00 0.00 0.00 2.43
22 23 0.963856 TGGATCGCACCGTGTCTAGT 60.964 55.000 0.00 0.00 0.00 2.57
23 24 0.172803 GGATCGCACCGTGTCTAGTT 59.827 55.000 0.00 0.00 0.00 2.24
24 25 1.402968 GGATCGCACCGTGTCTAGTTA 59.597 52.381 0.00 0.00 0.00 2.24
25 26 2.159338 GGATCGCACCGTGTCTAGTTAA 60.159 50.000 0.00 0.00 0.00 2.01
26 27 3.504863 GATCGCACCGTGTCTAGTTAAA 58.495 45.455 0.00 0.00 0.00 1.52
27 28 2.664916 TCGCACCGTGTCTAGTTAAAC 58.335 47.619 0.00 0.00 0.00 2.01
28 29 2.034432 TCGCACCGTGTCTAGTTAAACA 59.966 45.455 0.00 0.00 0.00 2.83
29 30 2.991190 CGCACCGTGTCTAGTTAAACAT 59.009 45.455 0.00 0.00 0.00 2.71
30 31 3.430895 CGCACCGTGTCTAGTTAAACATT 59.569 43.478 0.00 0.00 0.00 2.71
31 32 4.622313 CGCACCGTGTCTAGTTAAACATTA 59.378 41.667 0.00 0.00 0.00 1.90
32 33 5.290158 CGCACCGTGTCTAGTTAAACATTAT 59.710 40.000 0.00 0.00 0.00 1.28
33 34 6.475207 GCACCGTGTCTAGTTAAACATTATG 58.525 40.000 0.00 0.00 0.00 1.90
34 35 6.311935 GCACCGTGTCTAGTTAAACATTATGA 59.688 38.462 0.00 0.00 0.00 2.15
35 36 7.011109 GCACCGTGTCTAGTTAAACATTATGAT 59.989 37.037 0.00 0.00 0.00 2.45
36 37 8.328146 CACCGTGTCTAGTTAAACATTATGATG 58.672 37.037 0.00 0.00 39.25 3.07
37 38 8.255206 ACCGTGTCTAGTTAAACATTATGATGA 58.745 33.333 4.20 0.00 36.73 2.92
38 39 8.540492 CCGTGTCTAGTTAAACATTATGATGAC 58.460 37.037 4.20 0.00 36.73 3.06
39 40 8.540492 CGTGTCTAGTTAAACATTATGATGACC 58.460 37.037 4.20 0.00 36.73 4.02
40 41 9.601217 GTGTCTAGTTAAACATTATGATGACCT 57.399 33.333 4.20 0.00 36.73 3.85
43 44 9.613428 TCTAGTTAAACATTATGATGACCTTGG 57.387 33.333 4.20 0.00 36.73 3.61
44 45 9.396022 CTAGTTAAACATTATGATGACCTTGGT 57.604 33.333 4.20 0.00 36.73 3.67
45 46 8.055279 AGTTAAACATTATGATGACCTTGGTG 57.945 34.615 4.20 0.00 36.73 4.17
46 47 7.888021 AGTTAAACATTATGATGACCTTGGTGA 59.112 33.333 4.20 0.00 36.73 4.02
47 48 8.519526 GTTAAACATTATGATGACCTTGGTGAA 58.480 33.333 4.20 0.00 36.73 3.18
48 49 7.722949 AAACATTATGATGACCTTGGTGAAT 57.277 32.000 4.20 0.00 36.73 2.57
49 50 6.949352 ACATTATGATGACCTTGGTGAATC 57.051 37.500 4.20 1.42 36.73 2.52
50 51 5.829924 ACATTATGATGACCTTGGTGAATCC 59.170 40.000 4.20 0.00 36.73 3.01
51 52 2.806945 TGATGACCTTGGTGAATCCC 57.193 50.000 0.00 0.00 34.77 3.85
52 53 1.991813 TGATGACCTTGGTGAATCCCA 59.008 47.619 0.00 0.00 34.77 4.37
53 54 2.290896 TGATGACCTTGGTGAATCCCAC 60.291 50.000 0.00 0.00 44.95 4.61
65 66 5.659440 GTGAATCCCACAACCAATGTTAT 57.341 39.130 0.00 0.00 45.03 1.89
66 67 5.650543 GTGAATCCCACAACCAATGTTATC 58.349 41.667 0.00 0.00 45.03 1.75
67 68 4.397730 TGAATCCCACAACCAATGTTATCG 59.602 41.667 0.00 0.00 41.46 2.92
68 69 3.426787 TCCCACAACCAATGTTATCGT 57.573 42.857 0.00 0.00 41.46 3.73
69 70 3.340034 TCCCACAACCAATGTTATCGTC 58.660 45.455 0.00 0.00 41.46 4.20
70 71 3.008594 TCCCACAACCAATGTTATCGTCT 59.991 43.478 0.00 0.00 41.46 4.18
71 72 4.223255 TCCCACAACCAATGTTATCGTCTA 59.777 41.667 0.00 0.00 41.46 2.59
72 73 5.104693 TCCCACAACCAATGTTATCGTCTAT 60.105 40.000 0.00 0.00 41.46 1.98
73 74 5.236478 CCCACAACCAATGTTATCGTCTATC 59.764 44.000 0.00 0.00 41.46 2.08
74 75 5.236478 CCACAACCAATGTTATCGTCTATCC 59.764 44.000 0.00 0.00 41.46 2.59
75 76 5.047847 ACAACCAATGTTATCGTCTATCCG 58.952 41.667 0.00 0.00 40.06 4.18
76 77 4.252971 ACCAATGTTATCGTCTATCCGG 57.747 45.455 0.00 0.00 0.00 5.14
77 78 3.893200 ACCAATGTTATCGTCTATCCGGA 59.107 43.478 6.61 6.61 0.00 5.14
78 79 4.022242 ACCAATGTTATCGTCTATCCGGAG 60.022 45.833 11.34 0.00 0.00 4.63
79 80 4.217767 CCAATGTTATCGTCTATCCGGAGA 59.782 45.833 11.34 3.76 0.00 3.71
80 81 5.105716 CCAATGTTATCGTCTATCCGGAGAT 60.106 44.000 11.34 9.39 36.44 2.75
81 82 6.095021 CCAATGTTATCGTCTATCCGGAGATA 59.905 42.308 11.34 8.30 33.67 1.98
82 83 7.362660 CCAATGTTATCGTCTATCCGGAGATAA 60.363 40.741 11.34 14.00 34.53 1.75
83 84 6.738832 TGTTATCGTCTATCCGGAGATAAG 57.261 41.667 18.46 10.34 35.34 1.73
84 85 5.123502 TGTTATCGTCTATCCGGAGATAAGC 59.876 44.000 18.46 14.57 35.34 3.09
85 86 2.434428 TCGTCTATCCGGAGATAAGCC 58.566 52.381 11.34 0.00 34.53 4.35
93 94 1.499049 CGGAGATAAGCCGTTAAGCC 58.501 55.000 0.00 0.00 43.66 4.35
94 95 1.499049 GGAGATAAGCCGTTAAGCCG 58.501 55.000 0.00 0.00 0.00 5.52
101 102 3.569902 CCGTTAAGCCGGGTTGAC 58.430 61.111 28.60 27.39 44.32 3.18
102 103 2.036571 CCGTTAAGCCGGGTTGACC 61.037 63.158 28.87 16.03 44.32 4.02
103 104 1.301874 CGTTAAGCCGGGTTGACCA 60.302 57.895 28.87 8.97 40.22 4.02
104 105 1.571215 CGTTAAGCCGGGTTGACCAC 61.571 60.000 28.87 18.45 40.22 4.16
105 106 0.535553 GTTAAGCCGGGTTGACCACA 60.536 55.000 28.60 4.49 40.22 4.17
106 107 0.402504 TTAAGCCGGGTTGACCACAT 59.597 50.000 28.60 1.87 40.22 3.21
107 108 1.277579 TAAGCCGGGTTGACCACATA 58.722 50.000 28.60 2.85 40.22 2.29
108 109 0.035439 AAGCCGGGTTGACCACATAG 60.035 55.000 20.03 0.00 40.22 2.23
109 110 1.198759 AGCCGGGTTGACCACATAGT 61.199 55.000 0.00 0.00 40.22 2.12
110 111 0.322187 GCCGGGTTGACCACATAGTT 60.322 55.000 2.18 0.00 40.22 2.24
111 112 1.448985 CCGGGTTGACCACATAGTTG 58.551 55.000 2.12 0.00 40.22 3.16
112 113 1.448985 CGGGTTGACCACATAGTTGG 58.551 55.000 2.12 0.00 43.04 3.77
113 114 1.002659 CGGGTTGACCACATAGTTGGA 59.997 52.381 2.12 0.00 39.24 3.53
114 115 2.433436 GGGTTGACCACATAGTTGGAC 58.567 52.381 2.12 0.00 39.24 4.02
115 116 2.433436 GGTTGACCACATAGTTGGACC 58.567 52.381 0.00 0.00 39.24 4.46
116 117 2.039879 GGTTGACCACATAGTTGGACCT 59.960 50.000 0.00 0.00 39.24 3.85
117 118 3.074412 GTTGACCACATAGTTGGACCTG 58.926 50.000 0.00 0.00 39.24 4.00
118 119 1.003118 TGACCACATAGTTGGACCTGC 59.997 52.381 0.00 0.00 39.24 4.85
119 120 1.003118 GACCACATAGTTGGACCTGCA 59.997 52.381 0.00 0.00 39.24 4.41
120 121 1.635487 ACCACATAGTTGGACCTGCAT 59.365 47.619 0.00 0.00 39.24 3.96
121 122 2.019249 CCACATAGTTGGACCTGCATG 58.981 52.381 0.00 0.00 39.24 4.06
122 123 2.019249 CACATAGTTGGACCTGCATGG 58.981 52.381 0.00 0.00 42.93 3.66
123 124 1.064463 ACATAGTTGGACCTGCATGGG 60.064 52.381 7.06 0.00 41.11 4.00
124 125 0.106519 ATAGTTGGACCTGCATGGGC 60.107 55.000 7.06 3.64 45.48 5.36
125 126 1.207488 TAGTTGGACCTGCATGGGCT 61.207 55.000 7.81 0.00 45.52 5.19
126 127 1.207488 AGTTGGACCTGCATGGGCTA 61.207 55.000 7.81 0.00 45.52 3.93
127 128 1.032114 GTTGGACCTGCATGGGCTAC 61.032 60.000 7.81 3.89 45.52 3.58
128 129 2.193248 GGACCTGCATGGGCTACC 59.807 66.667 7.81 0.00 45.52 3.18
137 138 2.994699 TGGGCTACCAATGACGGG 59.005 61.111 0.00 0.00 45.87 5.28
138 139 2.192175 GGGCTACCAATGACGGGG 59.808 66.667 0.00 0.00 36.50 5.73
139 140 2.516225 GGCTACCAATGACGGGGC 60.516 66.667 0.00 0.00 0.00 5.80
140 141 2.590092 GCTACCAATGACGGGGCT 59.410 61.111 0.00 0.00 0.00 5.19
141 142 1.692173 GGCTACCAATGACGGGGCTA 61.692 60.000 0.00 0.00 0.00 3.93
142 143 0.179468 GCTACCAATGACGGGGCTAA 59.821 55.000 0.00 0.00 0.00 3.09
143 144 1.407712 GCTACCAATGACGGGGCTAAA 60.408 52.381 0.00 0.00 0.00 1.85
144 145 2.748465 GCTACCAATGACGGGGCTAAAT 60.748 50.000 0.00 0.00 0.00 1.40
145 146 2.052782 ACCAATGACGGGGCTAAATC 57.947 50.000 0.00 0.00 0.00 2.17
146 147 1.318576 CCAATGACGGGGCTAAATCC 58.681 55.000 0.00 0.00 0.00 3.01
156 157 4.287766 GGGGCTAAATCCGACAATATCT 57.712 45.455 0.00 0.00 0.00 1.98
157 158 4.254492 GGGGCTAAATCCGACAATATCTC 58.746 47.826 0.00 0.00 0.00 2.75
158 159 3.927142 GGGCTAAATCCGACAATATCTCG 59.073 47.826 0.00 0.00 0.00 4.04
167 168 4.624336 CGACAATATCTCGGATAGAGGG 57.376 50.000 0.00 0.00 46.82 4.30
168 169 4.011023 CGACAATATCTCGGATAGAGGGT 58.989 47.826 0.00 0.00 46.82 4.34
169 170 4.095185 CGACAATATCTCGGATAGAGGGTC 59.905 50.000 0.00 0.00 46.82 4.46
170 171 4.345854 ACAATATCTCGGATAGAGGGTCC 58.654 47.826 0.00 0.00 46.82 4.46
171 172 3.673543 ATATCTCGGATAGAGGGTCCC 57.326 52.381 0.00 0.00 46.82 4.46
172 173 1.158904 ATCTCGGATAGAGGGTCCCA 58.841 55.000 11.55 0.00 46.82 4.37
173 174 0.931468 TCTCGGATAGAGGGTCCCAA 59.069 55.000 11.55 0.00 46.82 4.12
174 175 1.133450 TCTCGGATAGAGGGTCCCAAG 60.133 57.143 11.55 0.00 46.82 3.61
175 176 0.759436 TCGGATAGAGGGTCCCAAGC 60.759 60.000 11.55 0.00 31.87 4.01
176 177 0.760945 CGGATAGAGGGTCCCAAGCT 60.761 60.000 11.55 6.93 31.87 3.74
177 178 0.761802 GGATAGAGGGTCCCAAGCTG 59.238 60.000 11.55 0.00 0.00 4.24
178 179 0.761802 GATAGAGGGTCCCAAGCTGG 59.238 60.000 11.55 0.00 37.25 4.85
179 180 0.044855 ATAGAGGGTCCCAAGCTGGT 59.955 55.000 11.55 0.00 35.17 4.00
180 181 0.909610 TAGAGGGTCCCAAGCTGGTG 60.910 60.000 11.55 0.00 35.17 4.17
181 182 2.121963 AGGGTCCCAAGCTGGTGA 60.122 61.111 11.55 0.00 35.17 4.02
182 183 1.542375 AGGGTCCCAAGCTGGTGAT 60.542 57.895 11.55 0.00 35.17 3.06
183 184 1.077429 GGGTCCCAAGCTGGTGATC 60.077 63.158 1.78 0.00 35.17 2.92
184 185 1.566298 GGGTCCCAAGCTGGTGATCT 61.566 60.000 1.78 0.00 35.17 2.75
185 186 0.329596 GGTCCCAAGCTGGTGATCTT 59.670 55.000 0.00 0.00 35.17 2.40
186 187 1.457346 GTCCCAAGCTGGTGATCTTG 58.543 55.000 0.00 0.00 39.38 3.02
189 190 3.261250 CAAGCTGGTGATCTTGGCT 57.739 52.632 0.00 0.00 36.83 4.75
190 191 2.408271 CAAGCTGGTGATCTTGGCTA 57.592 50.000 0.00 0.00 36.83 3.93
191 192 2.286872 CAAGCTGGTGATCTTGGCTAG 58.713 52.381 0.00 0.00 36.83 3.42
192 193 0.835941 AGCTGGTGATCTTGGCTAGG 59.164 55.000 0.00 0.00 0.00 3.02
193 194 0.833287 GCTGGTGATCTTGGCTAGGA 59.167 55.000 0.00 0.00 0.00 2.94
194 195 1.210478 GCTGGTGATCTTGGCTAGGAA 59.790 52.381 0.00 0.00 0.00 3.36
195 196 2.356125 GCTGGTGATCTTGGCTAGGAAA 60.356 50.000 0.00 0.00 0.00 3.13
196 197 3.686691 GCTGGTGATCTTGGCTAGGAAAT 60.687 47.826 0.00 0.00 0.00 2.17
197 198 4.444876 GCTGGTGATCTTGGCTAGGAAATA 60.445 45.833 0.00 0.00 0.00 1.40
198 199 5.684704 CTGGTGATCTTGGCTAGGAAATAA 58.315 41.667 0.00 0.00 0.00 1.40
199 200 6.266131 TGGTGATCTTGGCTAGGAAATAAT 57.734 37.500 0.00 0.00 0.00 1.28
200 201 7.387265 TGGTGATCTTGGCTAGGAAATAATA 57.613 36.000 0.00 0.00 0.00 0.98
201 202 7.453393 TGGTGATCTTGGCTAGGAAATAATAG 58.547 38.462 0.00 0.00 0.00 1.73
202 203 6.881602 GGTGATCTTGGCTAGGAAATAATAGG 59.118 42.308 0.00 0.00 0.00 2.57
203 204 7.256691 GGTGATCTTGGCTAGGAAATAATAGGA 60.257 40.741 0.00 0.00 0.00 2.94
204 205 8.325046 GTGATCTTGGCTAGGAAATAATAGGAT 58.675 37.037 0.00 0.00 0.00 3.24
205 206 8.324306 TGATCTTGGCTAGGAAATAATAGGATG 58.676 37.037 0.00 0.00 0.00 3.51
206 207 7.872061 TCTTGGCTAGGAAATAATAGGATGA 57.128 36.000 0.00 0.00 0.00 2.92
207 208 8.275187 TCTTGGCTAGGAAATAATAGGATGAA 57.725 34.615 0.00 0.00 0.00 2.57
208 209 8.157476 TCTTGGCTAGGAAATAATAGGATGAAC 58.843 37.037 0.00 0.00 0.00 3.18
209 210 7.387265 TGGCTAGGAAATAATAGGATGAACA 57.613 36.000 0.00 0.00 0.00 3.18
210 211 7.224297 TGGCTAGGAAATAATAGGATGAACAC 58.776 38.462 0.00 0.00 0.00 3.32
211 212 6.369065 GGCTAGGAAATAATAGGATGAACACG 59.631 42.308 0.00 0.00 0.00 4.49
212 213 7.152645 GCTAGGAAATAATAGGATGAACACGA 58.847 38.462 0.00 0.00 0.00 4.35
213 214 7.329717 GCTAGGAAATAATAGGATGAACACGAG 59.670 40.741 0.00 0.00 0.00 4.18
214 215 7.361457 AGGAAATAATAGGATGAACACGAGA 57.639 36.000 0.00 0.00 0.00 4.04
215 216 7.210873 AGGAAATAATAGGATGAACACGAGAC 58.789 38.462 0.00 0.00 0.00 3.36
216 217 6.984474 GGAAATAATAGGATGAACACGAGACA 59.016 38.462 0.00 0.00 0.00 3.41
217 218 7.042658 GGAAATAATAGGATGAACACGAGACAC 60.043 40.741 0.00 0.00 0.00 3.67
218 219 4.801330 AATAGGATGAACACGAGACACA 57.199 40.909 0.00 0.00 0.00 3.72
219 220 2.732412 AGGATGAACACGAGACACAG 57.268 50.000 0.00 0.00 0.00 3.66
220 221 1.964223 AGGATGAACACGAGACACAGT 59.036 47.619 0.00 0.00 0.00 3.55
221 222 3.154710 AGGATGAACACGAGACACAGTA 58.845 45.455 0.00 0.00 0.00 2.74
222 223 3.764434 AGGATGAACACGAGACACAGTAT 59.236 43.478 0.00 0.00 0.00 2.12
223 224 4.220821 AGGATGAACACGAGACACAGTATT 59.779 41.667 0.00 0.00 0.00 1.89
224 225 4.929808 GGATGAACACGAGACACAGTATTT 59.070 41.667 0.00 0.00 0.00 1.40
225 226 6.071560 AGGATGAACACGAGACACAGTATTTA 60.072 38.462 0.00 0.00 0.00 1.40
226 227 6.034683 GGATGAACACGAGACACAGTATTTAC 59.965 42.308 0.00 0.00 0.00 2.01
227 228 5.224888 TGAACACGAGACACAGTATTTACC 58.775 41.667 0.00 0.00 0.00 2.85
228 229 5.010314 TGAACACGAGACACAGTATTTACCT 59.990 40.000 0.00 0.00 0.00 3.08
229 230 6.207221 TGAACACGAGACACAGTATTTACCTA 59.793 38.462 0.00 0.00 0.00 3.08
230 231 6.192234 ACACGAGACACAGTATTTACCTAG 57.808 41.667 0.00 0.00 0.00 3.02
231 232 5.125097 ACACGAGACACAGTATTTACCTAGG 59.875 44.000 7.41 7.41 0.00 3.02
232 233 5.125097 CACGAGACACAGTATTTACCTAGGT 59.875 44.000 20.57 20.57 0.00 3.08
233 234 5.713861 ACGAGACACAGTATTTACCTAGGTT 59.286 40.000 22.11 4.52 0.00 3.50
234 235 6.127786 ACGAGACACAGTATTTACCTAGGTTC 60.128 42.308 22.11 7.28 0.00 3.62
235 236 6.127814 CGAGACACAGTATTTACCTAGGTTCA 60.128 42.308 22.11 7.52 0.00 3.18
236 237 7.171630 AGACACAGTATTTACCTAGGTTCAG 57.828 40.000 22.11 6.22 0.00 3.02
237 238 6.724905 AGACACAGTATTTACCTAGGTTCAGT 59.275 38.462 22.11 6.88 0.00 3.41
238 239 6.932947 ACACAGTATTTACCTAGGTTCAGTC 58.067 40.000 22.11 8.70 0.00 3.51
239 240 6.070938 ACACAGTATTTACCTAGGTTCAGTCC 60.071 42.308 22.11 4.45 0.00 3.85
240 241 6.154706 CACAGTATTTACCTAGGTTCAGTCCT 59.845 42.308 22.11 6.79 41.20 3.85
241 242 6.380560 ACAGTATTTACCTAGGTTCAGTCCTC 59.619 42.308 22.11 4.05 38.86 3.71
242 243 6.608002 CAGTATTTACCTAGGTTCAGTCCTCT 59.392 42.308 22.11 6.25 38.86 3.69
243 244 6.834969 AGTATTTACCTAGGTTCAGTCCTCTC 59.165 42.308 22.11 1.36 38.86 3.20
244 245 2.131776 ACCTAGGTTCAGTCCTCTCG 57.868 55.000 9.21 0.00 38.86 4.04
245 246 1.634459 ACCTAGGTTCAGTCCTCTCGA 59.366 52.381 9.21 0.00 38.86 4.04
246 247 2.041350 ACCTAGGTTCAGTCCTCTCGAA 59.959 50.000 9.21 0.00 38.86 3.71
247 248 2.685897 CCTAGGTTCAGTCCTCTCGAAG 59.314 54.545 0.00 0.00 38.86 3.79
248 249 2.588464 AGGTTCAGTCCTCTCGAAGA 57.412 50.000 0.00 0.00 31.32 2.87
262 263 2.579873 TCGAAGAGGTAATCCCCTACG 58.420 52.381 0.00 0.00 34.03 3.51
263 264 2.092212 TCGAAGAGGTAATCCCCTACGT 60.092 50.000 0.00 0.00 34.03 3.57
264 265 2.292845 CGAAGAGGTAATCCCCTACGTC 59.707 54.545 0.00 0.00 37.08 4.34
265 266 2.378378 AGAGGTAATCCCCTACGTCC 57.622 55.000 0.00 0.00 37.38 4.79
266 267 1.858246 AGAGGTAATCCCCTACGTCCT 59.142 52.381 0.00 0.00 37.38 3.85
267 268 1.962100 GAGGTAATCCCCTACGTCCTG 59.038 57.143 0.00 0.00 34.03 3.86
268 269 0.391966 GGTAATCCCCTACGTCCTGC 59.608 60.000 0.00 0.00 0.00 4.85
269 270 1.411041 GTAATCCCCTACGTCCTGCT 58.589 55.000 0.00 0.00 0.00 4.24
270 271 1.761198 GTAATCCCCTACGTCCTGCTT 59.239 52.381 0.00 0.00 0.00 3.91
271 272 1.286248 AATCCCCTACGTCCTGCTTT 58.714 50.000 0.00 0.00 0.00 3.51
272 273 1.286248 ATCCCCTACGTCCTGCTTTT 58.714 50.000 0.00 0.00 0.00 2.27
273 274 0.323629 TCCCCTACGTCCTGCTTTTG 59.676 55.000 0.00 0.00 0.00 2.44
291 292 7.585286 GCTTTTGCTTTATTGATTGTGATGA 57.415 32.000 0.00 0.00 43.35 2.92
292 293 8.020861 GCTTTTGCTTTATTGATTGTGATGAA 57.979 30.769 0.00 0.00 43.35 2.57
293 294 8.166706 GCTTTTGCTTTATTGATTGTGATGAAG 58.833 33.333 0.00 0.00 43.35 3.02
294 295 9.199982 CTTTTGCTTTATTGATTGTGATGAAGT 57.800 29.630 0.00 0.00 0.00 3.01
296 297 9.624697 TTTGCTTTATTGATTGTGATGAAGTAC 57.375 29.630 0.00 0.00 0.00 2.73
297 298 8.334263 TGCTTTATTGATTGTGATGAAGTACA 57.666 30.769 0.00 0.00 0.00 2.90
298 299 8.791675 TGCTTTATTGATTGTGATGAAGTACAA 58.208 29.630 0.00 0.00 40.65 2.41
299 300 9.624697 GCTTTATTGATTGTGATGAAGTACAAA 57.375 29.630 0.00 0.00 39.89 2.83
304 305 8.669946 TTGATTGTGATGAAGTACAAAGTACA 57.330 30.769 9.68 0.00 39.89 2.90
305 306 8.846943 TGATTGTGATGAAGTACAAAGTACAT 57.153 30.769 9.68 0.00 39.89 2.29
306 307 8.720562 TGATTGTGATGAAGTACAAAGTACATG 58.279 33.333 9.68 0.00 39.89 3.21
307 308 8.621532 ATTGTGATGAAGTACAAAGTACATGT 57.378 30.769 2.69 2.69 39.89 3.21
308 309 8.445275 TTGTGATGAAGTACAAAGTACATGTT 57.555 30.769 2.30 0.00 34.17 2.71
309 310 7.860613 TGTGATGAAGTACAAAGTACATGTTG 58.139 34.615 2.30 0.00 32.27 3.33
310 311 7.713073 TGTGATGAAGTACAAAGTACATGTTGA 59.287 33.333 2.30 0.00 32.27 3.18
311 312 8.721478 GTGATGAAGTACAAAGTACATGTTGAT 58.279 33.333 2.30 0.00 32.27 2.57
312 313 8.935844 TGATGAAGTACAAAGTACATGTTGATC 58.064 33.333 2.30 5.55 32.27 2.92
313 314 9.155975 GATGAAGTACAAAGTACATGTTGATCT 57.844 33.333 2.30 0.00 32.27 2.75
315 316 9.419297 TGAAGTACAAAGTACATGTTGATCTAC 57.581 33.333 2.30 0.00 32.27 2.59
316 317 8.462143 AAGTACAAAGTACATGTTGATCTACG 57.538 34.615 2.30 0.00 32.27 3.51
317 318 7.600065 AGTACAAAGTACATGTTGATCTACGT 58.400 34.615 2.30 0.00 32.27 3.57
318 319 6.946229 ACAAAGTACATGTTGATCTACGTC 57.054 37.500 2.30 0.00 0.00 4.34
319 320 5.571741 ACAAAGTACATGTTGATCTACGTCG 59.428 40.000 2.30 0.00 0.00 5.12
320 321 5.556355 AAGTACATGTTGATCTACGTCGA 57.444 39.130 2.30 0.00 0.00 4.20
321 322 5.158101 AGTACATGTTGATCTACGTCGAG 57.842 43.478 2.30 0.00 0.00 4.04
322 323 4.874396 AGTACATGTTGATCTACGTCGAGA 59.126 41.667 2.30 0.00 0.00 4.04
323 324 4.902443 ACATGTTGATCTACGTCGAGAT 57.098 40.909 0.00 0.35 38.94 2.75
329 330 3.336928 GATCTACGTCGAGATCGTACG 57.663 52.381 9.53 9.53 41.79 3.67
330 331 2.475200 TCTACGTCGAGATCGTACGA 57.525 50.000 21.93 21.93 41.59 3.43
331 332 2.797491 TCTACGTCGAGATCGTACGAA 58.203 47.619 23.56 1.59 41.59 3.85
332 333 3.375642 TCTACGTCGAGATCGTACGAAT 58.624 45.455 23.56 14.14 41.59 3.34
333 334 2.364243 ACGTCGAGATCGTACGAATG 57.636 50.000 23.56 12.97 41.59 2.67
334 335 1.662629 ACGTCGAGATCGTACGAATGT 59.337 47.619 23.56 13.65 41.59 2.71
335 336 2.027695 CGTCGAGATCGTACGAATGTG 58.972 52.381 23.56 12.78 41.59 3.21
336 337 2.536329 CGTCGAGATCGTACGAATGTGT 60.536 50.000 23.56 4.81 41.59 3.72
337 338 3.027710 GTCGAGATCGTACGAATGTGTC 58.972 50.000 23.56 14.63 40.12 3.67
338 339 2.934553 TCGAGATCGTACGAATGTGTCT 59.065 45.455 23.56 19.30 40.80 3.41
339 340 4.026228 GTCGAGATCGTACGAATGTGTCTA 60.026 45.833 23.56 3.38 40.12 2.59
340 341 4.567959 TCGAGATCGTACGAATGTGTCTAA 59.432 41.667 23.56 8.83 40.80 2.10
341 342 4.665292 CGAGATCGTACGAATGTGTCTAAC 59.335 45.833 23.56 8.05 34.11 2.34
342 343 4.918037 AGATCGTACGAATGTGTCTAACC 58.082 43.478 23.56 0.00 0.00 2.85
343 344 4.639310 AGATCGTACGAATGTGTCTAACCT 59.361 41.667 23.56 0.00 0.00 3.50
344 345 4.346734 TCGTACGAATGTGTCTAACCTC 57.653 45.455 17.11 0.00 0.00 3.85
345 346 4.005650 TCGTACGAATGTGTCTAACCTCT 58.994 43.478 17.11 0.00 0.00 3.69
346 347 4.093998 TCGTACGAATGTGTCTAACCTCTC 59.906 45.833 17.11 0.00 0.00 3.20
347 348 4.094590 CGTACGAATGTGTCTAACCTCTCT 59.905 45.833 10.44 0.00 0.00 3.10
348 349 5.292834 CGTACGAATGTGTCTAACCTCTCTA 59.707 44.000 10.44 0.00 0.00 2.43
349 350 5.564048 ACGAATGTGTCTAACCTCTCTAC 57.436 43.478 0.00 0.00 0.00 2.59
350 351 4.398673 ACGAATGTGTCTAACCTCTCTACC 59.601 45.833 0.00 0.00 0.00 3.18
351 352 4.202030 CGAATGTGTCTAACCTCTCTACCC 60.202 50.000 0.00 0.00 0.00 3.69
352 353 4.611564 ATGTGTCTAACCTCTCTACCCT 57.388 45.455 0.00 0.00 0.00 4.34
353 354 5.728937 ATGTGTCTAACCTCTCTACCCTA 57.271 43.478 0.00 0.00 0.00 3.53
354 355 5.728937 TGTGTCTAACCTCTCTACCCTAT 57.271 43.478 0.00 0.00 0.00 2.57
355 356 5.446860 TGTGTCTAACCTCTCTACCCTATG 58.553 45.833 0.00 0.00 0.00 2.23
356 357 4.828387 GTGTCTAACCTCTCTACCCTATGG 59.172 50.000 0.00 0.00 37.80 2.74
357 358 4.730392 TGTCTAACCTCTCTACCCTATGGA 59.270 45.833 0.00 0.00 34.81 3.41
358 359 5.072055 GTCTAACCTCTCTACCCTATGGAC 58.928 50.000 0.00 0.00 34.81 4.02
359 360 4.982956 TCTAACCTCTCTACCCTATGGACT 59.017 45.833 0.00 0.00 34.81 3.85
360 361 6.044171 GTCTAACCTCTCTACCCTATGGACTA 59.956 46.154 0.00 0.00 34.81 2.59
361 362 5.745988 AACCTCTCTACCCTATGGACTAA 57.254 43.478 0.00 0.00 34.81 2.24
362 363 5.745988 ACCTCTCTACCCTATGGACTAAA 57.254 43.478 0.00 0.00 34.81 1.85
363 364 5.456779 ACCTCTCTACCCTATGGACTAAAC 58.543 45.833 0.00 0.00 34.81 2.01
364 365 4.833938 CCTCTCTACCCTATGGACTAAACC 59.166 50.000 0.00 0.00 34.81 3.27
365 366 4.812653 TCTCTACCCTATGGACTAAACCC 58.187 47.826 0.00 0.00 34.81 4.11
366 367 4.485021 TCTCTACCCTATGGACTAAACCCT 59.515 45.833 0.00 0.00 34.81 4.34
367 368 4.812653 TCTACCCTATGGACTAAACCCTC 58.187 47.826 0.00 0.00 34.81 4.30
368 369 2.395619 ACCCTATGGACTAAACCCTCG 58.604 52.381 0.00 0.00 34.81 4.63
369 370 1.692519 CCCTATGGACTAAACCCTCGG 59.307 57.143 0.00 0.00 0.00 4.63
370 371 1.070289 CCTATGGACTAAACCCTCGGC 59.930 57.143 0.00 0.00 0.00 5.54
371 372 2.040178 CTATGGACTAAACCCTCGGCT 58.960 52.381 0.00 0.00 0.00 5.52
372 373 1.286248 ATGGACTAAACCCTCGGCTT 58.714 50.000 0.00 0.00 0.00 4.35
373 374 1.941377 TGGACTAAACCCTCGGCTTA 58.059 50.000 0.00 0.00 0.00 3.09
374 375 2.474112 TGGACTAAACCCTCGGCTTAT 58.526 47.619 0.00 0.00 0.00 1.73
375 376 3.645434 TGGACTAAACCCTCGGCTTATA 58.355 45.455 0.00 0.00 0.00 0.98
376 377 4.228824 TGGACTAAACCCTCGGCTTATAT 58.771 43.478 0.00 0.00 0.00 0.86
377 378 5.396485 TGGACTAAACCCTCGGCTTATATA 58.604 41.667 0.00 0.00 0.00 0.86
378 379 5.479375 TGGACTAAACCCTCGGCTTATATAG 59.521 44.000 0.00 0.00 0.00 1.31
379 380 5.105432 GGACTAAACCCTCGGCTTATATAGG 60.105 48.000 0.00 0.00 0.00 2.57
384 385 1.749634 CCTCGGCTTATATAGGGACCG 59.250 57.143 5.03 5.03 41.92 4.79
385 386 1.749634 CTCGGCTTATATAGGGACCGG 59.250 57.143 0.00 0.00 40.95 5.28
386 387 0.822164 CGGCTTATATAGGGACCGGG 59.178 60.000 6.32 0.00 37.04 5.73
387 388 1.201424 GGCTTATATAGGGACCGGGG 58.799 60.000 6.32 0.00 0.00 5.73
388 389 1.554118 GGCTTATATAGGGACCGGGGT 60.554 57.143 6.32 0.00 0.00 4.95
389 390 1.553704 GCTTATATAGGGACCGGGGTG 59.446 57.143 6.32 0.00 0.00 4.61
390 391 1.553704 CTTATATAGGGACCGGGGTGC 59.446 57.143 6.32 0.03 35.66 5.01
398 399 4.669773 ACCGGGGTGCCTAGGGTT 62.670 66.667 11.72 0.00 0.00 4.11
399 400 2.365901 CCGGGGTGCCTAGGGTTA 60.366 66.667 11.72 0.00 0.00 2.85
400 401 1.768888 CCGGGGTGCCTAGGGTTAT 60.769 63.158 11.72 0.00 0.00 1.89
401 402 0.472352 CCGGGGTGCCTAGGGTTATA 60.472 60.000 11.72 0.00 0.00 0.98
402 403 1.652947 CGGGGTGCCTAGGGTTATAT 58.347 55.000 11.72 0.00 0.00 0.86
403 404 1.278127 CGGGGTGCCTAGGGTTATATG 59.722 57.143 11.72 0.00 0.00 1.78
404 405 2.345560 GGGGTGCCTAGGGTTATATGT 58.654 52.381 11.72 0.00 0.00 2.29
405 406 3.523792 GGGGTGCCTAGGGTTATATGTA 58.476 50.000 11.72 0.00 0.00 2.29
406 407 3.518303 GGGGTGCCTAGGGTTATATGTAG 59.482 52.174 11.72 0.00 0.00 2.74
407 408 3.518303 GGGTGCCTAGGGTTATATGTAGG 59.482 52.174 11.72 0.00 35.97 3.18
413 414 6.388619 CCTAGGGTTATATGTAGGCCAATT 57.611 41.667 5.01 0.00 0.00 2.32
414 415 7.504926 CCTAGGGTTATATGTAGGCCAATTA 57.495 40.000 5.01 0.00 0.00 1.40
415 416 7.924541 CCTAGGGTTATATGTAGGCCAATTAA 58.075 38.462 5.01 0.00 0.00 1.40
416 417 8.387813 CCTAGGGTTATATGTAGGCCAATTAAA 58.612 37.037 5.01 0.00 0.00 1.52
417 418 9.975218 CTAGGGTTATATGTAGGCCAATTAAAT 57.025 33.333 5.01 0.00 0.00 1.40
419 420 9.749340 AGGGTTATATGTAGGCCAATTAAATAC 57.251 33.333 5.01 0.00 0.00 1.89
420 421 9.523168 GGGTTATATGTAGGCCAATTAAATACA 57.477 33.333 5.01 2.95 0.00 2.29
425 426 9.995594 ATATGTAGGCCAATTAAATACATGGAT 57.004 29.630 17.43 5.55 37.56 3.41
427 428 9.821240 ATGTAGGCCAATTAAATACATGGATAA 57.179 29.630 5.01 0.00 36.11 1.75
428 429 9.295825 TGTAGGCCAATTAAATACATGGATAAG 57.704 33.333 5.01 0.00 34.82 1.73
429 430 9.297037 GTAGGCCAATTAAATACATGGATAAGT 57.703 33.333 5.01 0.00 34.82 2.24
430 431 8.782137 AGGCCAATTAAATACATGGATAAGTT 57.218 30.769 5.01 0.00 34.82 2.66
431 432 9.212593 AGGCCAATTAAATACATGGATAAGTTT 57.787 29.630 5.01 0.00 34.82 2.66
432 433 9.260002 GGCCAATTAAATACATGGATAAGTTTG 57.740 33.333 0.00 0.00 34.82 2.93
433 434 8.764287 GCCAATTAAATACATGGATAAGTTTGC 58.236 33.333 0.00 0.00 34.82 3.68
434 435 9.260002 CCAATTAAATACATGGATAAGTTTGCC 57.740 33.333 0.00 0.00 34.82 4.52
435 436 8.967218 CAATTAAATACATGGATAAGTTTGCCG 58.033 33.333 0.00 0.00 0.00 5.69
436 437 7.867305 TTAAATACATGGATAAGTTTGCCGA 57.133 32.000 0.00 0.00 0.00 5.54
437 438 6.959639 AAATACATGGATAAGTTTGCCGAT 57.040 33.333 0.00 0.00 0.00 4.18
438 439 5.947228 ATACATGGATAAGTTTGCCGATG 57.053 39.130 0.00 0.00 0.00 3.84
439 440 3.884895 ACATGGATAAGTTTGCCGATGA 58.115 40.909 0.00 0.00 0.00 2.92
440 441 4.464008 ACATGGATAAGTTTGCCGATGAT 58.536 39.130 0.00 0.00 0.00 2.45
441 442 4.889409 ACATGGATAAGTTTGCCGATGATT 59.111 37.500 0.00 0.00 0.00 2.57
442 443 5.360714 ACATGGATAAGTTTGCCGATGATTT 59.639 36.000 0.00 0.00 0.00 2.17
443 444 5.247507 TGGATAAGTTTGCCGATGATTTG 57.752 39.130 0.00 0.00 0.00 2.32
444 445 4.946772 TGGATAAGTTTGCCGATGATTTGA 59.053 37.500 0.00 0.00 0.00 2.69
445 446 5.417266 TGGATAAGTTTGCCGATGATTTGAA 59.583 36.000 0.00 0.00 0.00 2.69
446 447 5.743872 GGATAAGTTTGCCGATGATTTGAAC 59.256 40.000 0.00 0.00 0.00 3.18
447 448 4.582701 AAGTTTGCCGATGATTTGAACA 57.417 36.364 0.00 0.00 0.00 3.18
448 449 4.789012 AGTTTGCCGATGATTTGAACAT 57.211 36.364 0.00 0.00 0.00 2.71
449 450 4.487948 AGTTTGCCGATGATTTGAACATG 58.512 39.130 0.00 0.00 0.00 3.21
450 451 4.022068 AGTTTGCCGATGATTTGAACATGT 60.022 37.500 0.00 0.00 0.00 3.21
451 452 3.490800 TGCCGATGATTTGAACATGTG 57.509 42.857 0.00 0.00 0.00 3.21
452 453 2.819019 TGCCGATGATTTGAACATGTGT 59.181 40.909 0.00 0.00 0.00 3.72
453 454 3.255395 TGCCGATGATTTGAACATGTGTT 59.745 39.130 0.00 0.00 41.64 3.32
454 455 3.609373 GCCGATGATTTGAACATGTGTTG 59.391 43.478 0.00 0.00 38.56 3.33
455 456 4.615682 GCCGATGATTTGAACATGTGTTGA 60.616 41.667 0.00 0.00 38.56 3.18
456 457 5.459768 CCGATGATTTGAACATGTGTTGAA 58.540 37.500 0.00 0.00 38.56 2.69
457 458 5.570206 CCGATGATTTGAACATGTGTTGAAG 59.430 40.000 0.00 0.00 38.56 3.02
458 459 6.144854 CGATGATTTGAACATGTGTTGAAGT 58.855 36.000 0.00 0.00 38.56 3.01
459 460 6.087159 CGATGATTTGAACATGTGTTGAAGTG 59.913 38.462 0.00 0.00 38.56 3.16
460 461 6.206395 TGATTTGAACATGTGTTGAAGTGT 57.794 33.333 0.00 0.00 38.56 3.55
461 462 6.035217 TGATTTGAACATGTGTTGAAGTGTG 58.965 36.000 0.00 0.00 38.56 3.82
462 463 5.635417 TTTGAACATGTGTTGAAGTGTGA 57.365 34.783 0.00 0.00 38.56 3.58
463 464 4.880886 TGAACATGTGTTGAAGTGTGAG 57.119 40.909 0.00 0.00 38.56 3.51
464 465 4.260985 TGAACATGTGTTGAAGTGTGAGT 58.739 39.130 0.00 0.00 38.56 3.41
465 466 4.332543 TGAACATGTGTTGAAGTGTGAGTC 59.667 41.667 0.00 0.00 38.56 3.36
466 467 3.872696 ACATGTGTTGAAGTGTGAGTCA 58.127 40.909 0.00 0.00 0.00 3.41
467 468 4.260985 ACATGTGTTGAAGTGTGAGTCAA 58.739 39.130 0.00 0.00 0.00 3.18
468 469 4.699735 ACATGTGTTGAAGTGTGAGTCAAA 59.300 37.500 0.00 0.00 35.60 2.69
469 470 4.944962 TGTGTTGAAGTGTGAGTCAAAG 57.055 40.909 0.00 0.00 35.60 2.77
470 471 4.323417 TGTGTTGAAGTGTGAGTCAAAGT 58.677 39.130 0.00 0.00 35.60 2.66
471 472 4.391830 TGTGTTGAAGTGTGAGTCAAAGTC 59.608 41.667 0.00 0.00 35.60 3.01
472 473 4.631813 GTGTTGAAGTGTGAGTCAAAGTCT 59.368 41.667 0.00 0.00 35.60 3.24
473 474 5.122396 GTGTTGAAGTGTGAGTCAAAGTCTT 59.878 40.000 0.00 0.00 35.60 3.01
474 475 5.122239 TGTTGAAGTGTGAGTCAAAGTCTTG 59.878 40.000 0.00 0.00 35.60 3.02
475 476 4.191544 TGAAGTGTGAGTCAAAGTCTTGG 58.808 43.478 0.00 0.00 33.01 3.61
476 477 3.199880 AGTGTGAGTCAAAGTCTTGGG 57.800 47.619 0.00 0.00 33.01 4.12
477 478 2.771943 AGTGTGAGTCAAAGTCTTGGGA 59.228 45.455 0.00 0.00 33.01 4.37
478 479 3.134458 GTGTGAGTCAAAGTCTTGGGAG 58.866 50.000 0.00 0.00 33.01 4.30
479 480 2.104792 TGTGAGTCAAAGTCTTGGGAGG 59.895 50.000 0.00 0.00 33.01 4.30
480 481 2.368875 GTGAGTCAAAGTCTTGGGAGGA 59.631 50.000 0.00 0.00 33.01 3.71
481 482 3.008485 GTGAGTCAAAGTCTTGGGAGGAT 59.992 47.826 0.00 0.00 33.01 3.24
482 483 3.652869 TGAGTCAAAGTCTTGGGAGGATT 59.347 43.478 0.00 0.00 33.01 3.01
483 484 4.104738 TGAGTCAAAGTCTTGGGAGGATTT 59.895 41.667 0.00 0.00 33.01 2.17
484 485 4.657013 AGTCAAAGTCTTGGGAGGATTTC 58.343 43.478 0.00 0.00 33.01 2.17
485 486 4.104738 AGTCAAAGTCTTGGGAGGATTTCA 59.895 41.667 0.00 0.00 33.01 2.69
486 487 5.012893 GTCAAAGTCTTGGGAGGATTTCAT 58.987 41.667 0.00 0.00 33.01 2.57
487 488 5.124617 GTCAAAGTCTTGGGAGGATTTCATC 59.875 44.000 0.00 0.00 33.01 2.92
488 489 5.014544 TCAAAGTCTTGGGAGGATTTCATCT 59.985 40.000 0.00 0.00 33.01 2.90
489 490 5.527026 AAGTCTTGGGAGGATTTCATCTT 57.473 39.130 0.00 0.00 0.00 2.40
490 491 4.853007 AGTCTTGGGAGGATTTCATCTTG 58.147 43.478 0.00 0.00 0.00 3.02
491 492 4.537688 AGTCTTGGGAGGATTTCATCTTGA 59.462 41.667 0.00 0.00 0.00 3.02
492 493 4.880696 GTCTTGGGAGGATTTCATCTTGAG 59.119 45.833 0.00 0.00 0.00 3.02
493 494 3.287867 TGGGAGGATTTCATCTTGAGC 57.712 47.619 0.00 0.00 0.00 4.26
494 495 2.577563 TGGGAGGATTTCATCTTGAGCA 59.422 45.455 0.00 0.00 0.00 4.26
495 496 2.948315 GGGAGGATTTCATCTTGAGCAC 59.052 50.000 0.00 0.00 0.00 4.40
496 497 2.611292 GGAGGATTTCATCTTGAGCACG 59.389 50.000 0.00 0.00 0.00 5.34
497 498 3.525537 GAGGATTTCATCTTGAGCACGA 58.474 45.455 0.00 0.00 0.00 4.35
498 499 3.265791 AGGATTTCATCTTGAGCACGAC 58.734 45.455 0.00 0.00 0.00 4.34
499 500 3.002791 GGATTTCATCTTGAGCACGACA 58.997 45.455 0.00 0.00 0.00 4.35
500 501 3.063180 GGATTTCATCTTGAGCACGACAG 59.937 47.826 0.00 0.00 0.00 3.51
501 502 2.084610 TTCATCTTGAGCACGACAGG 57.915 50.000 0.00 0.00 0.00 4.00
502 503 0.247460 TCATCTTGAGCACGACAGGG 59.753 55.000 0.00 0.00 0.00 4.45
503 504 0.036952 CATCTTGAGCACGACAGGGT 60.037 55.000 0.00 0.00 0.00 4.34
504 505 0.247736 ATCTTGAGCACGACAGGGTC 59.752 55.000 0.00 0.00 0.00 4.46
505 506 1.374758 CTTGAGCACGACAGGGTCC 60.375 63.158 0.00 0.00 31.96 4.46
506 507 2.099652 CTTGAGCACGACAGGGTCCA 62.100 60.000 0.00 0.00 31.96 4.02
507 508 1.480212 TTGAGCACGACAGGGTCCAT 61.480 55.000 0.00 0.00 31.96 3.41
508 509 1.448540 GAGCACGACAGGGTCCATG 60.449 63.158 0.92 0.92 0.00 3.66
509 510 1.888436 GAGCACGACAGGGTCCATGA 61.888 60.000 11.25 0.00 0.00 3.07
510 511 1.221840 GCACGACAGGGTCCATGAT 59.778 57.895 11.25 0.00 0.00 2.45
511 512 0.464036 GCACGACAGGGTCCATGATA 59.536 55.000 11.25 0.00 0.00 2.15
512 513 1.134521 GCACGACAGGGTCCATGATAA 60.135 52.381 11.25 0.00 0.00 1.75
513 514 2.679639 GCACGACAGGGTCCATGATAAA 60.680 50.000 11.25 0.00 0.00 1.40
514 515 2.936498 CACGACAGGGTCCATGATAAAC 59.064 50.000 11.25 0.00 0.00 2.01
515 516 2.569853 ACGACAGGGTCCATGATAAACA 59.430 45.455 11.25 0.00 0.00 2.83
516 517 3.199946 ACGACAGGGTCCATGATAAACAT 59.800 43.478 11.25 0.00 40.17 2.71
529 530 6.720112 ATGATAAACATGACCCATTCCTTG 57.280 37.500 0.00 0.00 37.87 3.61
530 531 5.825532 TGATAAACATGACCCATTCCTTGA 58.174 37.500 0.00 0.00 0.00 3.02
531 532 6.434302 TGATAAACATGACCCATTCCTTGAT 58.566 36.000 0.00 0.00 0.00 2.57
532 533 7.581814 TGATAAACATGACCCATTCCTTGATA 58.418 34.615 0.00 0.00 0.00 2.15
533 534 7.720957 TGATAAACATGACCCATTCCTTGATAG 59.279 37.037 0.00 0.00 0.00 2.08
534 535 5.456921 AACATGACCCATTCCTTGATAGT 57.543 39.130 0.00 0.00 0.00 2.12
535 536 5.041191 ACATGACCCATTCCTTGATAGTC 57.959 43.478 0.00 0.00 0.00 2.59
536 537 4.141390 ACATGACCCATTCCTTGATAGTCC 60.141 45.833 0.00 0.00 0.00 3.85
537 538 2.434336 TGACCCATTCCTTGATAGTCCG 59.566 50.000 0.00 0.00 0.00 4.79
538 539 1.768870 ACCCATTCCTTGATAGTCCGG 59.231 52.381 0.00 0.00 0.00 5.14
539 540 1.072331 CCCATTCCTTGATAGTCCGGG 59.928 57.143 0.00 0.00 0.00 5.73
540 541 1.072331 CCATTCCTTGATAGTCCGGGG 59.928 57.143 0.00 0.00 0.00 5.73
541 542 1.768870 CATTCCTTGATAGTCCGGGGT 59.231 52.381 0.00 0.00 0.00 4.95
542 543 1.492764 TTCCTTGATAGTCCGGGGTC 58.507 55.000 0.00 0.00 0.00 4.46
543 544 0.398098 TCCTTGATAGTCCGGGGTCC 60.398 60.000 0.00 0.00 0.00 4.46
544 545 0.398664 CCTTGATAGTCCGGGGTCCT 60.399 60.000 0.00 0.00 0.00 3.85
545 546 1.041437 CTTGATAGTCCGGGGTCCTC 58.959 60.000 0.00 0.00 0.00 3.71
546 547 0.754217 TTGATAGTCCGGGGTCCTCG 60.754 60.000 3.38 3.38 0.00 4.63
548 549 4.828296 TAGTCCGGGGTCCTCGGC 62.828 72.222 26.60 19.83 46.43 5.54
559 560 3.158648 CCTCGGCCCGACCCATTA 61.159 66.667 0.00 0.00 33.26 1.90
560 561 2.737881 CCTCGGCCCGACCCATTAA 61.738 63.158 0.00 0.00 33.26 1.40
561 562 1.450211 CTCGGCCCGACCCATTAAT 59.550 57.895 0.00 0.00 33.26 1.40
562 563 0.179029 CTCGGCCCGACCCATTAATT 60.179 55.000 0.00 0.00 33.26 1.40
563 564 0.464735 TCGGCCCGACCCATTAATTG 60.465 55.000 0.00 0.00 33.26 2.32
564 565 0.750182 CGGCCCGACCCATTAATTGT 60.750 55.000 0.00 0.00 33.26 2.71
565 566 0.744281 GGCCCGACCCATTAATTGTG 59.256 55.000 0.00 0.00 0.00 3.33
566 567 1.683629 GGCCCGACCCATTAATTGTGA 60.684 52.381 0.00 0.00 0.00 3.58
567 568 2.096248 GCCCGACCCATTAATTGTGAA 58.904 47.619 0.00 0.00 0.00 3.18
568 569 2.159296 GCCCGACCCATTAATTGTGAAC 60.159 50.000 0.00 0.00 0.00 3.18
569 570 3.085533 CCCGACCCATTAATTGTGAACA 58.914 45.455 0.00 0.00 0.00 3.18
570 571 3.128589 CCCGACCCATTAATTGTGAACAG 59.871 47.826 0.00 0.00 0.00 3.16
571 572 4.006989 CCGACCCATTAATTGTGAACAGA 58.993 43.478 0.00 0.00 0.00 3.41
572 573 4.640201 CCGACCCATTAATTGTGAACAGAT 59.360 41.667 0.00 0.00 0.00 2.90
573 574 5.449041 CCGACCCATTAATTGTGAACAGATG 60.449 44.000 0.00 0.00 0.00 2.90
574 575 5.353956 CGACCCATTAATTGTGAACAGATGA 59.646 40.000 0.00 0.00 0.00 2.92
575 576 6.038603 CGACCCATTAATTGTGAACAGATGAT 59.961 38.462 0.00 0.00 0.00 2.45
576 577 7.104043 ACCCATTAATTGTGAACAGATGATG 57.896 36.000 0.00 0.00 0.00 3.07
577 578 6.891361 ACCCATTAATTGTGAACAGATGATGA 59.109 34.615 0.00 0.00 0.00 2.92
578 579 7.562454 ACCCATTAATTGTGAACAGATGATGAT 59.438 33.333 0.00 0.00 0.00 2.45
579 580 8.418662 CCCATTAATTGTGAACAGATGATGATT 58.581 33.333 0.00 0.00 0.00 2.57
588 589 9.942850 TGTGAACAGATGATGATTAAGTTAAGA 57.057 29.630 1.21 0.00 0.00 2.10
616 617 9.547279 AAAAAGGGGTTAGATGATGATTAAGTT 57.453 29.630 0.00 0.00 0.00 2.66
619 620 9.853177 AAGGGGTTAGATGATGATTAAGTTAAG 57.147 33.333 1.21 0.00 0.00 1.85
620 621 9.225682 AGGGGTTAGATGATGATTAAGTTAAGA 57.774 33.333 1.21 0.00 0.00 2.10
621 622 9.847224 GGGGTTAGATGATGATTAAGTTAAGAA 57.153 33.333 1.21 0.00 0.00 2.52
648 649 6.699575 AAGGTGAATTTATGTACATCCAGC 57.300 37.500 12.68 12.45 0.00 4.85
649 650 6.006275 AGGTGAATTTATGTACATCCAGCT 57.994 37.500 12.68 14.25 0.00 4.24
650 651 6.426587 AGGTGAATTTATGTACATCCAGCTT 58.573 36.000 12.68 0.44 0.00 3.74
651 652 7.573710 AGGTGAATTTATGTACATCCAGCTTA 58.426 34.615 12.68 0.00 0.00 3.09
652 653 7.499232 AGGTGAATTTATGTACATCCAGCTTAC 59.501 37.037 12.68 5.20 0.00 2.34
653 654 7.282224 GGTGAATTTATGTACATCCAGCTTACA 59.718 37.037 12.68 0.00 0.00 2.41
654 655 8.673711 GTGAATTTATGTACATCCAGCTTACAA 58.326 33.333 12.68 0.00 29.78 2.41
655 656 9.237187 TGAATTTATGTACATCCAGCTTACAAA 57.763 29.630 12.68 4.44 29.78 2.83
659 660 8.574251 TTATGTACATCCAGCTTACAAATTGT 57.426 30.769 12.68 3.43 29.78 2.71
660 661 6.252967 TGTACATCCAGCTTACAAATTGTG 57.747 37.500 9.15 0.00 0.00 3.33
661 662 6.000840 TGTACATCCAGCTTACAAATTGTGA 58.999 36.000 9.15 0.00 0.00 3.58
662 663 6.488344 TGTACATCCAGCTTACAAATTGTGAA 59.512 34.615 9.15 0.00 0.00 3.18
663 664 5.772521 ACATCCAGCTTACAAATTGTGAAC 58.227 37.500 9.15 0.00 0.00 3.18
664 665 5.301551 ACATCCAGCTTACAAATTGTGAACA 59.698 36.000 9.15 0.00 0.00 3.18
665 666 5.437289 TCCAGCTTACAAATTGTGAACAG 57.563 39.130 9.15 1.01 0.00 3.16
666 667 5.129634 TCCAGCTTACAAATTGTGAACAGA 58.870 37.500 9.15 0.00 0.00 3.41
667 668 5.769662 TCCAGCTTACAAATTGTGAACAGAT 59.230 36.000 9.15 0.00 0.00 2.90
668 669 5.860182 CCAGCTTACAAATTGTGAACAGATG 59.140 40.000 9.15 8.01 0.00 2.90
669 670 6.294120 CCAGCTTACAAATTGTGAACAGATGA 60.294 38.462 9.15 0.00 0.00 2.92
670 671 7.140705 CAGCTTACAAATTGTGAACAGATGAA 58.859 34.615 9.15 0.00 0.00 2.57
671 672 7.811236 CAGCTTACAAATTGTGAACAGATGAAT 59.189 33.333 9.15 0.00 0.00 2.57
672 673 7.811236 AGCTTACAAATTGTGAACAGATGAATG 59.189 33.333 9.15 0.00 0.00 2.67
673 674 7.062605 GCTTACAAATTGTGAACAGATGAATGG 59.937 37.037 9.15 0.00 0.00 3.16
674 675 6.653526 ACAAATTGTGAACAGATGAATGGA 57.346 33.333 0.00 0.00 0.00 3.41
675 676 7.235935 ACAAATTGTGAACAGATGAATGGAT 57.764 32.000 0.00 0.00 0.00 3.41
676 677 8.352137 ACAAATTGTGAACAGATGAATGGATA 57.648 30.769 0.00 0.00 0.00 2.59
677 678 8.246180 ACAAATTGTGAACAGATGAATGGATAC 58.754 33.333 0.00 0.00 0.00 2.24
678 679 8.464404 CAAATTGTGAACAGATGAATGGATACT 58.536 33.333 0.00 0.00 37.61 2.12
679 680 9.685276 AAATTGTGAACAGATGAATGGATACTA 57.315 29.630 0.00 0.00 37.61 1.82
680 681 8.899427 ATTGTGAACAGATGAATGGATACTAG 57.101 34.615 0.00 0.00 37.61 2.57
681 682 7.660030 TGTGAACAGATGAATGGATACTAGA 57.340 36.000 0.00 0.00 37.61 2.43
682 683 8.078060 TGTGAACAGATGAATGGATACTAGAA 57.922 34.615 0.00 0.00 37.61 2.10
683 684 8.708378 TGTGAACAGATGAATGGATACTAGAAT 58.292 33.333 0.00 0.00 37.61 2.40
684 685 9.553064 GTGAACAGATGAATGGATACTAGAATT 57.447 33.333 0.00 0.00 37.61 2.17
685 686 9.551734 TGAACAGATGAATGGATACTAGAATTG 57.448 33.333 0.00 0.00 37.61 2.32
686 687 9.553064 GAACAGATGAATGGATACTAGAATTGT 57.447 33.333 0.00 0.00 37.61 2.71
717 718 4.481930 TGAAATGATTCACGTGTGGTTC 57.518 40.909 16.51 11.65 40.59 3.62
718 719 3.252215 TGAAATGATTCACGTGTGGTTCC 59.748 43.478 16.51 1.24 40.59 3.62
719 720 2.859165 ATGATTCACGTGTGGTTCCT 57.141 45.000 16.51 0.00 0.00 3.36
720 721 2.631160 TGATTCACGTGTGGTTCCTT 57.369 45.000 16.51 0.00 0.00 3.36
721 722 2.925724 TGATTCACGTGTGGTTCCTTT 58.074 42.857 16.51 0.00 0.00 3.11
722 723 2.616376 TGATTCACGTGTGGTTCCTTTG 59.384 45.455 16.51 0.00 0.00 2.77
723 724 2.116827 TTCACGTGTGGTTCCTTTGT 57.883 45.000 16.51 0.00 0.00 2.83
724 725 1.658994 TCACGTGTGGTTCCTTTGTC 58.341 50.000 16.51 0.00 0.00 3.18
725 726 0.303493 CACGTGTGGTTCCTTTGTCG 59.697 55.000 7.58 0.00 0.00 4.35
726 727 0.812412 ACGTGTGGTTCCTTTGTCGG 60.812 55.000 0.00 0.00 0.00 4.79
727 728 0.531090 CGTGTGGTTCCTTTGTCGGA 60.531 55.000 0.00 0.00 0.00 4.55
728 729 0.942252 GTGTGGTTCCTTTGTCGGAC 59.058 55.000 0.00 0.00 31.44 4.79
729 730 0.531090 TGTGGTTCCTTTGTCGGACG 60.531 55.000 3.34 0.00 31.44 4.79
730 731 1.070105 TGGTTCCTTTGTCGGACGG 59.930 57.895 3.34 0.00 31.44 4.79
731 732 2.322830 GGTTCCTTTGTCGGACGGC 61.323 63.158 3.34 0.00 31.44 5.68
732 733 2.356553 TTCCTTTGTCGGACGGCG 60.357 61.111 4.80 4.80 31.44 6.46
735 736 3.342627 CTTTGTCGGACGGCGCAA 61.343 61.111 10.83 0.00 0.00 4.85
736 737 3.295228 CTTTGTCGGACGGCGCAAG 62.295 63.158 10.83 4.90 43.44 4.01
748 749 2.949106 CGCAAGCAGTTGAGGTGG 59.051 61.111 0.00 0.00 35.46 4.61
749 750 2.620112 CGCAAGCAGTTGAGGTGGG 61.620 63.158 0.00 0.00 35.46 4.61
750 751 1.529244 GCAAGCAGTTGAGGTGGGT 60.529 57.895 0.00 0.00 35.46 4.51
751 752 0.250727 GCAAGCAGTTGAGGTGGGTA 60.251 55.000 0.00 0.00 35.46 3.69
752 753 1.817740 GCAAGCAGTTGAGGTGGGTAA 60.818 52.381 0.00 0.00 35.46 2.85
753 754 2.795329 CAAGCAGTTGAGGTGGGTAAT 58.205 47.619 0.00 0.00 35.46 1.89
754 755 3.872240 GCAAGCAGTTGAGGTGGGTAATA 60.872 47.826 0.00 0.00 35.46 0.98
755 756 4.331968 CAAGCAGTTGAGGTGGGTAATAA 58.668 43.478 0.00 0.00 35.46 1.40
756 757 4.650972 AGCAGTTGAGGTGGGTAATAAA 57.349 40.909 0.00 0.00 0.00 1.40
757 758 4.993028 AGCAGTTGAGGTGGGTAATAAAA 58.007 39.130 0.00 0.00 0.00 1.52
758 759 4.765339 AGCAGTTGAGGTGGGTAATAAAAC 59.235 41.667 0.00 0.00 0.00 2.43
759 760 4.379082 GCAGTTGAGGTGGGTAATAAAACG 60.379 45.833 0.00 0.00 0.00 3.60
760 761 4.998672 CAGTTGAGGTGGGTAATAAAACGA 59.001 41.667 0.00 0.00 0.00 3.85
761 762 5.121768 CAGTTGAGGTGGGTAATAAAACGAG 59.878 44.000 0.00 0.00 0.00 4.18
762 763 4.210724 TGAGGTGGGTAATAAAACGAGG 57.789 45.455 0.00 0.00 0.00 4.63
763 764 3.839490 TGAGGTGGGTAATAAAACGAGGA 59.161 43.478 0.00 0.00 0.00 3.71
764 765 4.186926 GAGGTGGGTAATAAAACGAGGAC 58.813 47.826 0.00 0.00 0.00 3.85
765 766 2.931969 GGTGGGTAATAAAACGAGGACG 59.068 50.000 0.00 0.00 45.75 4.79
766 767 3.368323 GGTGGGTAATAAAACGAGGACGA 60.368 47.826 0.00 0.00 42.66 4.20
767 768 3.614176 GTGGGTAATAAAACGAGGACGAC 59.386 47.826 0.00 0.00 42.66 4.34
768 769 3.257873 TGGGTAATAAAACGAGGACGACA 59.742 43.478 0.00 0.00 42.66 4.35
769 770 3.861689 GGGTAATAAAACGAGGACGACAG 59.138 47.826 0.00 0.00 42.66 3.51
770 771 3.305361 GGTAATAAAACGAGGACGACAGC 59.695 47.826 0.00 0.00 42.66 4.40
771 772 2.005971 ATAAAACGAGGACGACAGCC 57.994 50.000 0.00 0.00 42.66 4.85
772 773 0.037975 TAAAACGAGGACGACAGCCC 60.038 55.000 0.00 0.00 42.66 5.19
773 774 2.035237 AAAACGAGGACGACAGCCCA 62.035 55.000 0.00 0.00 42.66 5.36
774 775 2.035237 AAACGAGGACGACAGCCCAA 62.035 55.000 0.00 0.00 42.66 4.12
775 776 2.125912 CGAGGACGACAGCCCAAG 60.126 66.667 0.00 0.00 42.66 3.61
776 777 2.435059 GAGGACGACAGCCCAAGC 60.435 66.667 0.00 0.00 40.32 4.01
777 778 3.959991 GAGGACGACAGCCCAAGCC 62.960 68.421 0.00 0.00 41.25 4.35
801 802 4.729918 CAGGCAGGCTGGTGGGAC 62.730 72.222 17.64 0.00 0.00 4.46
825 826 4.360405 GTCGGCCACCCCCATGTT 62.360 66.667 2.24 0.00 0.00 2.71
826 827 4.041762 TCGGCCACCCCCATGTTC 62.042 66.667 2.24 0.00 0.00 3.18
829 830 4.360405 GCCACCCCCATGTTCGGT 62.360 66.667 0.00 0.00 0.00 4.69
830 831 2.438795 CCACCCCCATGTTCGGTT 59.561 61.111 0.00 0.00 0.00 4.44
831 832 1.976474 CCACCCCCATGTTCGGTTG 60.976 63.158 0.00 0.00 0.00 3.77
832 833 2.282887 ACCCCCATGTTCGGTTGC 60.283 61.111 0.00 0.00 0.00 4.17
833 834 3.068064 CCCCCATGTTCGGTTGCC 61.068 66.667 0.00 0.00 0.00 4.52
834 835 2.282816 CCCCATGTTCGGTTGCCA 60.283 61.111 0.00 0.00 0.00 4.92
835 836 2.342650 CCCCATGTTCGGTTGCCAG 61.343 63.158 0.00 0.00 0.00 4.85
836 837 1.603455 CCCATGTTCGGTTGCCAGT 60.603 57.895 0.00 0.00 0.00 4.00
837 838 1.178534 CCCATGTTCGGTTGCCAGTT 61.179 55.000 0.00 0.00 0.00 3.16
838 839 0.039256 CCATGTTCGGTTGCCAGTTG 60.039 55.000 0.00 0.00 0.00 3.16
839 840 0.664166 CATGTTCGGTTGCCAGTTGC 60.664 55.000 0.00 0.00 41.77 4.17
840 841 1.805428 ATGTTCGGTTGCCAGTTGCC 61.805 55.000 0.00 0.00 40.16 4.52
841 842 2.124109 TTCGGTTGCCAGTTGCCA 60.124 55.556 0.00 0.00 40.16 4.92
842 843 2.485795 TTCGGTTGCCAGTTGCCAC 61.486 57.895 0.00 0.00 40.16 5.01
845 846 2.730094 GTTGCCAGTTGCCACCTG 59.270 61.111 0.00 0.00 40.16 4.00
846 847 3.225798 TTGCCAGTTGCCACCTGC 61.226 61.111 0.00 0.00 40.16 4.85
847 848 3.736996 TTGCCAGTTGCCACCTGCT 62.737 57.895 1.78 0.00 42.00 4.24
848 849 2.914097 GCCAGTTGCCACCTGCTT 60.914 61.111 0.00 0.00 42.00 3.91
849 850 2.501602 GCCAGTTGCCACCTGCTTT 61.502 57.895 0.00 0.00 42.00 3.51
850 851 1.364901 CCAGTTGCCACCTGCTTTG 59.635 57.895 0.00 0.00 42.00 2.77
851 852 1.300388 CAGTTGCCACCTGCTTTGC 60.300 57.895 0.00 0.00 42.00 3.68
852 853 1.456331 AGTTGCCACCTGCTTTGCT 60.456 52.632 0.00 0.00 42.00 3.91
853 854 0.178992 AGTTGCCACCTGCTTTGCTA 60.179 50.000 0.00 0.00 42.00 3.49
854 855 0.890683 GTTGCCACCTGCTTTGCTAT 59.109 50.000 0.00 0.00 42.00 2.97
855 856 0.889994 TTGCCACCTGCTTTGCTATG 59.110 50.000 0.00 0.00 42.00 2.23
856 857 1.140375 GCCACCTGCTTTGCTATGC 59.860 57.895 0.00 0.00 36.87 3.14
857 858 1.318158 GCCACCTGCTTTGCTATGCT 61.318 55.000 7.48 0.00 36.87 3.79
858 859 2.018644 GCCACCTGCTTTGCTATGCTA 61.019 52.381 7.48 0.00 36.87 3.49
859 860 1.672881 CCACCTGCTTTGCTATGCTAC 59.327 52.381 7.48 0.00 0.00 3.58
860 861 1.328680 CACCTGCTTTGCTATGCTACG 59.671 52.381 7.48 0.00 0.00 3.51
861 862 0.305922 CCTGCTTTGCTATGCTACGC 59.694 55.000 7.48 0.00 0.00 4.42
862 863 1.293924 CTGCTTTGCTATGCTACGCT 58.706 50.000 7.48 0.00 31.20 5.07
863 864 2.473816 CTGCTTTGCTATGCTACGCTA 58.526 47.619 7.48 0.00 31.20 4.26
864 865 2.201732 TGCTTTGCTATGCTACGCTAC 58.798 47.619 7.48 0.00 31.20 3.58
865 866 2.159099 TGCTTTGCTATGCTACGCTACT 60.159 45.455 7.48 0.00 31.20 2.57
866 867 2.473235 GCTTTGCTATGCTACGCTACTC 59.527 50.000 0.00 0.00 0.00 2.59
867 868 2.795175 TTGCTATGCTACGCTACTCC 57.205 50.000 0.00 0.00 0.00 3.85
868 869 1.982660 TGCTATGCTACGCTACTCCT 58.017 50.000 0.00 0.00 0.00 3.69
869 870 1.880675 TGCTATGCTACGCTACTCCTC 59.119 52.381 0.00 0.00 0.00 3.71
870 871 2.156098 GCTATGCTACGCTACTCCTCT 58.844 52.381 0.00 0.00 0.00 3.69
871 872 2.160813 GCTATGCTACGCTACTCCTCTC 59.839 54.545 0.00 0.00 0.00 3.20
872 873 1.231221 ATGCTACGCTACTCCTCTCG 58.769 55.000 0.00 0.00 0.00 4.04
873 874 0.814410 TGCTACGCTACTCCTCTCGG 60.814 60.000 0.00 0.00 0.00 4.63
874 875 1.943293 CTACGCTACTCCTCTCGGC 59.057 63.158 0.00 0.00 0.00 5.54
875 876 1.508808 CTACGCTACTCCTCTCGGCC 61.509 65.000 0.00 0.00 0.00 6.13
876 877 2.955022 TACGCTACTCCTCTCGGCCC 62.955 65.000 0.00 0.00 0.00 5.80
877 878 3.597728 GCTACTCCTCTCGGCCCG 61.598 72.222 0.00 0.00 0.00 6.13
878 879 2.907917 CTACTCCTCTCGGCCCGG 60.908 72.222 1.90 0.00 0.00 5.73
896 897 4.435970 CCCGGCCCAACCCTAACC 62.436 72.222 0.00 0.00 33.26 2.85
897 898 4.435970 CCGGCCCAACCCTAACCC 62.436 72.222 0.00 0.00 33.26 4.11
898 899 4.789123 CGGCCCAACCCTAACCCG 62.789 72.222 0.00 0.00 33.26 5.28
899 900 4.435970 GGCCCAACCCTAACCCGG 62.436 72.222 0.00 0.00 0.00 5.73
901 902 3.653078 CCCAACCCTAACCCGGCA 61.653 66.667 0.00 0.00 0.00 5.69
902 903 2.045340 CCAACCCTAACCCGGCAG 60.045 66.667 0.00 0.00 0.00 4.85
903 904 2.045340 CAACCCTAACCCGGCAGG 60.045 66.667 0.00 1.37 43.78 4.85
904 905 4.043100 AACCCTAACCCGGCAGGC 62.043 66.667 0.00 0.00 40.58 4.85
906 907 4.796495 CCCTAACCCGGCAGGCAC 62.796 72.222 0.00 0.00 40.58 5.01
907 908 4.796495 CCTAACCCGGCAGGCACC 62.796 72.222 0.00 0.00 40.58 5.01
973 974 2.975799 GCGCACCAACGGAAGGAA 60.976 61.111 0.30 0.00 0.00 3.36
974 975 2.966309 GCGCACCAACGGAAGGAAG 61.966 63.158 0.30 0.00 0.00 3.46
975 976 2.325082 CGCACCAACGGAAGGAAGG 61.325 63.158 0.00 0.00 0.00 3.46
976 977 1.072505 GCACCAACGGAAGGAAGGA 59.927 57.895 0.00 0.00 0.00 3.36
977 978 0.536460 GCACCAACGGAAGGAAGGAA 60.536 55.000 0.00 0.00 0.00 3.36
978 979 1.523758 CACCAACGGAAGGAAGGAAG 58.476 55.000 0.00 0.00 0.00 3.46
979 980 0.400594 ACCAACGGAAGGAAGGAAGG 59.599 55.000 0.00 0.00 0.00 3.46
980 981 0.322546 CCAACGGAAGGAAGGAAGGG 60.323 60.000 0.00 0.00 0.00 3.95
981 982 0.690762 CAACGGAAGGAAGGAAGGGA 59.309 55.000 0.00 0.00 0.00 4.20
983 984 1.222113 CGGAAGGAAGGAAGGGAGC 59.778 63.158 0.00 0.00 0.00 4.70
986 987 2.878089 GAAGGAAGGAAGGGAGCGGC 62.878 65.000 0.00 0.00 0.00 6.53
987 988 4.840005 GGAAGGAAGGGAGCGGCG 62.840 72.222 0.51 0.51 0.00 6.46
1058 1062 4.500389 ATGTATCCAATCTCCTCCTCCT 57.500 45.455 0.00 0.00 0.00 3.69
1063 1067 1.715785 CAATCTCCTCCTCCTCCTCC 58.284 60.000 0.00 0.00 0.00 4.30
1064 1068 1.220236 CAATCTCCTCCTCCTCCTCCT 59.780 57.143 0.00 0.00 0.00 3.69
1067 1071 0.185901 CTCCTCCTCCTCCTCCTCTG 59.814 65.000 0.00 0.00 0.00 3.35
1068 1072 1.457455 CCTCCTCCTCCTCCTCTGC 60.457 68.421 0.00 0.00 0.00 4.26
1069 1073 1.620259 CTCCTCCTCCTCCTCTGCT 59.380 63.158 0.00 0.00 0.00 4.24
1070 1074 0.032217 CTCCTCCTCCTCCTCTGCTT 60.032 60.000 0.00 0.00 0.00 3.91
1071 1075 0.032615 TCCTCCTCCTCCTCTGCTTC 60.033 60.000 0.00 0.00 0.00 3.86
1072 1076 1.048160 CCTCCTCCTCCTCTGCTTCC 61.048 65.000 0.00 0.00 0.00 3.46
1073 1077 0.032217 CTCCTCCTCCTCTGCTTCCT 60.032 60.000 0.00 0.00 0.00 3.36
1074 1078 0.032615 TCCTCCTCCTCTGCTTCCTC 60.033 60.000 0.00 0.00 0.00 3.71
1075 1079 0.032217 CCTCCTCCTCTGCTTCCTCT 60.032 60.000 0.00 0.00 0.00 3.69
1076 1080 1.402787 CTCCTCCTCTGCTTCCTCTC 58.597 60.000 0.00 0.00 0.00 3.20
1077 1081 1.006813 TCCTCCTCTGCTTCCTCTCT 58.993 55.000 0.00 0.00 0.00 3.10
1078 1082 1.064017 TCCTCCTCTGCTTCCTCTCTC 60.064 57.143 0.00 0.00 0.00 3.20
1079 1083 1.063717 CCTCCTCTGCTTCCTCTCTCT 60.064 57.143 0.00 0.00 0.00 3.10
1080 1084 2.301346 CTCCTCTGCTTCCTCTCTCTC 58.699 57.143 0.00 0.00 0.00 3.20
1084 1088 3.209410 CTCTGCTTCCTCTCTCTCTCTC 58.791 54.545 0.00 0.00 0.00 3.20
1095 1099 5.363868 CCTCTCTCTCTCTCTCTCTAGTTCA 59.636 48.000 0.00 0.00 0.00 3.18
1099 1103 8.588472 TCTCTCTCTCTCTCTCTAGTTCATATG 58.412 40.741 0.00 0.00 0.00 1.78
1164 1168 4.224818 TCAATTTTGGGGGATTGGATTGTC 59.775 41.667 0.00 0.00 34.74 3.18
1165 1169 2.246091 TTTGGGGGATTGGATTGTCC 57.754 50.000 0.00 0.00 36.96 4.02
1168 1172 0.926293 GGGGGATTGGATTGTCCTGA 59.074 55.000 0.00 0.00 37.46 3.86
1169 1173 1.500736 GGGGGATTGGATTGTCCTGAT 59.499 52.381 0.00 0.00 37.46 2.90
1179 1203 3.628257 GGATTGTCCTGATTGGGGATTGT 60.628 47.826 0.00 0.00 35.15 2.71
1200 1224 1.749634 AGGCTGGACGTGTACATCTAC 59.250 52.381 0.00 0.00 0.00 2.59
1296 1320 4.737601 GGTACGCACGCATGTTTC 57.262 55.556 0.00 0.00 0.00 2.78
1298 1322 1.352114 GGTACGCACGCATGTTTCTA 58.648 50.000 0.00 0.00 0.00 2.10
1299 1323 1.931172 GGTACGCACGCATGTTTCTAT 59.069 47.619 0.00 0.00 0.00 1.98
1301 1325 2.010145 ACGCACGCATGTTTCTATCT 57.990 45.000 0.00 0.00 0.00 1.98
1302 1326 2.346803 ACGCACGCATGTTTCTATCTT 58.653 42.857 0.00 0.00 0.00 2.40
1303 1327 2.094258 ACGCACGCATGTTTCTATCTTG 59.906 45.455 0.00 0.00 0.00 3.02
1320 1344 1.429299 CTTGTTCCCCTTCCCCTTTCT 59.571 52.381 0.00 0.00 0.00 2.52
1323 1347 1.004862 GTTCCCCTTCCCCTTTCTGAG 59.995 57.143 0.00 0.00 0.00 3.35
1332 1356 2.614001 CCTTTCTGAGGGAGGGAGG 58.386 63.158 0.00 0.00 42.26 4.30
1333 1357 0.985490 CCTTTCTGAGGGAGGGAGGG 60.985 65.000 0.00 0.00 42.26 4.30
1334 1358 0.043334 CTTTCTGAGGGAGGGAGGGA 59.957 60.000 0.00 0.00 0.00 4.20
1335 1359 0.043334 TTTCTGAGGGAGGGAGGGAG 59.957 60.000 0.00 0.00 0.00 4.30
1336 1360 1.891296 TTCTGAGGGAGGGAGGGAGG 61.891 65.000 0.00 0.00 0.00 4.30
1337 1361 3.368501 TGAGGGAGGGAGGGAGGG 61.369 72.222 0.00 0.00 0.00 4.30
1338 1362 3.036959 GAGGGAGGGAGGGAGGGA 61.037 72.222 0.00 0.00 0.00 4.20
1339 1363 3.039526 AGGGAGGGAGGGAGGGAG 61.040 72.222 0.00 0.00 0.00 4.30
1340 1364 3.036959 GGGAGGGAGGGAGGGAGA 61.037 72.222 0.00 0.00 0.00 3.71
1341 1365 2.612251 GGAGGGAGGGAGGGAGAG 59.388 72.222 0.00 0.00 0.00 3.20
1342 1366 2.015726 GGAGGGAGGGAGGGAGAGA 61.016 68.421 0.00 0.00 0.00 3.10
1343 1367 1.595058 GGAGGGAGGGAGGGAGAGAA 61.595 65.000 0.00 0.00 0.00 2.87
1366 1390 7.422465 AAGATGCATCTTCTTCTTCTCTAGT 57.578 36.000 31.78 8.85 43.27 2.57
1367 1391 6.808829 AGATGCATCTTCTTCTTCTCTAGTG 58.191 40.000 23.75 0.00 31.97 2.74
1368 1392 6.606796 AGATGCATCTTCTTCTTCTCTAGTGA 59.393 38.462 23.75 0.00 31.97 3.41
1370 1394 5.105554 TGCATCTTCTTCTTCTCTAGTGACC 60.106 44.000 0.00 0.00 0.00 4.02
1371 1395 5.681179 GCATCTTCTTCTTCTCTAGTGACCC 60.681 48.000 0.00 0.00 0.00 4.46
1373 1397 3.827817 TCTTCTTCTCTAGTGACCCCA 57.172 47.619 0.00 0.00 0.00 4.96
1374 1398 3.702792 TCTTCTTCTCTAGTGACCCCAG 58.297 50.000 0.00 0.00 0.00 4.45
1375 1399 3.076182 TCTTCTTCTCTAGTGACCCCAGT 59.924 47.826 0.00 0.00 0.00 4.00
1376 1400 4.291513 TCTTCTTCTCTAGTGACCCCAGTA 59.708 45.833 0.00 0.00 0.00 2.74
1377 1401 4.237976 TCTTCTCTAGTGACCCCAGTAG 57.762 50.000 0.00 0.00 44.12 2.57
1378 1402 3.592427 TCTTCTCTAGTGACCCCAGTAGT 59.408 47.826 0.00 0.00 43.53 2.73
1379 1403 4.786994 TCTTCTCTAGTGACCCCAGTAGTA 59.213 45.833 0.00 0.00 43.53 1.82
1381 1405 6.618610 TCTTCTCTAGTGACCCCAGTAGTATA 59.381 42.308 0.00 0.00 43.53 1.47
1382 1406 6.436738 TCTCTAGTGACCCCAGTAGTATAG 57.563 45.833 0.00 0.00 43.53 1.31
1385 1409 5.848369 TCTAGTGACCCCAGTAGTATAGCTA 59.152 44.000 0.00 0.00 43.53 3.32
1386 1410 4.988029 AGTGACCCCAGTAGTATAGCTAG 58.012 47.826 0.00 0.00 0.00 3.42
1440 1556 2.043526 AGATGCTCAAACCAATCCCCTT 59.956 45.455 0.00 0.00 0.00 3.95
1442 1558 1.146774 TGCTCAAACCAATCCCCTTCA 59.853 47.619 0.00 0.00 0.00 3.02
1471 1592 5.350365 GGGAAAGGAAAACAGACACAAAAAC 59.650 40.000 0.00 0.00 0.00 2.43
1475 1596 4.929211 AGGAAAACAGACACAAAAACAAGC 59.071 37.500 0.00 0.00 0.00 4.01
1480 1601 3.258123 ACAGACACAAAAACAAGCAAGGT 59.742 39.130 0.00 0.00 0.00 3.50
1492 1613 9.705290 AAAAACAAGCAAGGTAACCATTTATAG 57.295 29.630 0.00 0.00 37.17 1.31
1493 1614 8.644374 AAACAAGCAAGGTAACCATTTATAGA 57.356 30.769 0.00 0.00 37.17 1.98
1495 1616 8.225603 ACAAGCAAGGTAACCATTTATAGATG 57.774 34.615 0.00 0.00 37.17 2.90
1496 1617 7.834181 ACAAGCAAGGTAACCATTTATAGATGT 59.166 33.333 2.84 0.00 37.17 3.06
1497 1618 7.807977 AGCAAGGTAACCATTTATAGATGTG 57.192 36.000 2.84 0.00 37.17 3.21
1498 1619 6.263168 AGCAAGGTAACCATTTATAGATGTGC 59.737 38.462 2.84 4.19 37.17 4.57
1499 1620 6.039270 GCAAGGTAACCATTTATAGATGTGCA 59.961 38.462 2.84 0.00 37.17 4.57
1500 1621 7.255590 GCAAGGTAACCATTTATAGATGTGCAT 60.256 37.037 2.84 0.00 37.17 3.96
1501 1622 7.986085 AGGTAACCATTTATAGATGTGCATC 57.014 36.000 4.12 4.12 35.97 3.91
1502 1623 7.749666 AGGTAACCATTTATAGATGTGCATCT 58.250 34.615 17.43 17.43 44.46 2.90
1503 1624 7.880195 AGGTAACCATTTATAGATGTGCATCTC 59.120 37.037 16.89 0.43 42.32 2.75
1504 1625 7.119846 GGTAACCATTTATAGATGTGCATCTCC 59.880 40.741 16.89 5.44 44.37 3.71
1505 1626 5.564550 ACCATTTATAGATGTGCATCTCCC 58.435 41.667 16.89 0.00 44.37 4.30
1506 1627 5.311649 ACCATTTATAGATGTGCATCTCCCT 59.688 40.000 16.89 7.32 44.37 4.20
1507 1628 5.879223 CCATTTATAGATGTGCATCTCCCTC 59.121 44.000 16.89 0.00 44.37 4.30
1508 1629 6.296317 CCATTTATAGATGTGCATCTCCCTCT 60.296 42.308 16.89 0.00 44.37 3.69
1510 1631 2.475339 AGATGTGCATCTCCCTCTCT 57.525 50.000 8.74 0.00 44.37 3.10
1511 1632 2.040939 AGATGTGCATCTCCCTCTCTG 58.959 52.381 8.74 0.00 44.37 3.35
1513 1634 1.145819 GTGCATCTCCCTCTCTGCC 59.854 63.158 0.00 0.00 33.70 4.85
1514 1635 1.002662 TGCATCTCCCTCTCTGCCT 59.997 57.895 0.00 0.00 33.70 4.75
1517 1638 0.464870 CATCTCCCTCTCTGCCTGTG 59.535 60.000 0.00 0.00 0.00 3.66
1518 1639 0.042431 ATCTCCCTCTCTGCCTGTGT 59.958 55.000 0.00 0.00 0.00 3.72
1520 1641 1.152247 TCCCTCTCTGCCTGTGTGT 60.152 57.895 0.00 0.00 0.00 3.72
1521 1642 0.764369 TCCCTCTCTGCCTGTGTGTT 60.764 55.000 0.00 0.00 0.00 3.32
1523 1644 1.477558 CCCTCTCTGCCTGTGTGTTTT 60.478 52.381 0.00 0.00 0.00 2.43
1524 1645 1.876156 CCTCTCTGCCTGTGTGTTTTC 59.124 52.381 0.00 0.00 0.00 2.29
1525 1646 2.486191 CCTCTCTGCCTGTGTGTTTTCT 60.486 50.000 0.00 0.00 0.00 2.52
1526 1647 3.209410 CTCTCTGCCTGTGTGTTTTCTT 58.791 45.455 0.00 0.00 0.00 2.52
1527 1648 3.620488 TCTCTGCCTGTGTGTTTTCTTT 58.380 40.909 0.00 0.00 0.00 2.52
1536 1657 1.760029 TGTGTTTTCTTTCCCCCAAGC 59.240 47.619 0.00 0.00 0.00 4.01
1544 1665 2.366153 TTTCCCCCAAGCCACTCACC 62.366 60.000 0.00 0.00 0.00 4.02
1551 1672 0.381801 CAAGCCACTCACCACAACAC 59.618 55.000 0.00 0.00 0.00 3.32
1553 1674 0.034574 AGCCACTCACCACAACACAA 60.035 50.000 0.00 0.00 0.00 3.33
1554 1675 0.100503 GCCACTCACCACAACACAAC 59.899 55.000 0.00 0.00 0.00 3.32
1555 1676 1.458398 CCACTCACCACAACACAACA 58.542 50.000 0.00 0.00 0.00 3.33
1556 1677 1.401552 CCACTCACCACAACACAACAG 59.598 52.381 0.00 0.00 0.00 3.16
1557 1678 2.355197 CACTCACCACAACACAACAGA 58.645 47.619 0.00 0.00 0.00 3.41
1558 1679 2.945008 CACTCACCACAACACAACAGAT 59.055 45.455 0.00 0.00 0.00 2.90
1559 1680 4.126437 CACTCACCACAACACAACAGATA 58.874 43.478 0.00 0.00 0.00 1.98
1560 1681 4.756642 CACTCACCACAACACAACAGATAT 59.243 41.667 0.00 0.00 0.00 1.63
1561 1682 5.931724 CACTCACCACAACACAACAGATATA 59.068 40.000 0.00 0.00 0.00 0.86
1562 1683 5.932303 ACTCACCACAACACAACAGATATAC 59.068 40.000 0.00 0.00 0.00 1.47
1565 1686 7.847096 TCACCACAACACAACAGATATACTAT 58.153 34.615 0.00 0.00 0.00 2.12
1568 1689 7.764443 ACCACAACACAACAGATATACTATGTC 59.236 37.037 0.00 0.00 0.00 3.06
1572 1693 8.768019 CAACACAACAGATATACTATGTCCATG 58.232 37.037 0.00 0.00 0.00 3.66
1584 1705 8.738645 ATACTATGTCCATGTTTTCTTTCCTC 57.261 34.615 0.00 0.00 0.00 3.71
1585 1706 6.784031 ACTATGTCCATGTTTTCTTTCCTCT 58.216 36.000 0.00 0.00 0.00 3.69
1590 1711 4.141274 TCCATGTTTTCTTTCCTCTCACCA 60.141 41.667 0.00 0.00 0.00 4.17
1595 1716 1.801242 TCTTTCCTCTCACCACACCA 58.199 50.000 0.00 0.00 0.00 4.17
1596 1717 1.416401 TCTTTCCTCTCACCACACCAC 59.584 52.381 0.00 0.00 0.00 4.16
1597 1718 0.472471 TTTCCTCTCACCACACCACC 59.528 55.000 0.00 0.00 0.00 4.61
1598 1719 1.415672 TTCCTCTCACCACACCACCC 61.416 60.000 0.00 0.00 0.00 4.61
1599 1720 2.750350 CTCTCACCACACCACCCC 59.250 66.667 0.00 0.00 0.00 4.95
1600 1721 2.040359 TCTCACCACACCACCCCA 60.040 61.111 0.00 0.00 0.00 4.96
1601 1722 2.116983 CTCTCACCACACCACCCCAG 62.117 65.000 0.00 0.00 0.00 4.45
1602 1723 3.174987 TCACCACACCACCCCAGG 61.175 66.667 0.00 0.00 0.00 4.45
1603 1724 4.974721 CACCACACCACCCCAGGC 62.975 72.222 0.00 0.00 0.00 4.85
1605 1726 4.666253 CCACACCACCCCAGGCAG 62.666 72.222 0.00 0.00 0.00 4.85
1606 1727 4.666253 CACACCACCCCAGGCAGG 62.666 72.222 0.00 0.00 37.03 4.85
1615 1736 4.290622 CCAGGCAGGGCAGGTGTT 62.291 66.667 0.00 0.00 0.00 3.32
1616 1737 2.203538 CAGGCAGGGCAGGTGTTT 60.204 61.111 0.00 0.00 0.00 2.83
1617 1738 1.833934 CAGGCAGGGCAGGTGTTTT 60.834 57.895 0.00 0.00 0.00 2.43
1618 1739 1.833934 AGGCAGGGCAGGTGTTTTG 60.834 57.895 0.00 0.00 0.00 2.44
1619 1740 2.736531 GCAGGGCAGGTGTTTTGG 59.263 61.111 0.00 0.00 0.00 3.28
1620 1741 2.133641 GCAGGGCAGGTGTTTTGGT 61.134 57.895 0.00 0.00 0.00 3.67
1621 1742 1.685355 GCAGGGCAGGTGTTTTGGTT 61.685 55.000 0.00 0.00 0.00 3.67
1622 1743 0.104671 CAGGGCAGGTGTTTTGGTTG 59.895 55.000 0.00 0.00 0.00 3.77
1623 1744 1.048160 AGGGCAGGTGTTTTGGTTGG 61.048 55.000 0.00 0.00 0.00 3.77
1624 1745 1.334384 GGGCAGGTGTTTTGGTTGGT 61.334 55.000 0.00 0.00 0.00 3.67
1625 1746 0.179086 GGCAGGTGTTTTGGTTGGTG 60.179 55.000 0.00 0.00 0.00 4.17
1626 1747 0.534873 GCAGGTGTTTTGGTTGGTGT 59.465 50.000 0.00 0.00 0.00 4.16
1627 1748 1.738700 GCAGGTGTTTTGGTTGGTGTG 60.739 52.381 0.00 0.00 0.00 3.82
1628 1749 1.821753 CAGGTGTTTTGGTTGGTGTGA 59.178 47.619 0.00 0.00 0.00 3.58
1629 1750 2.232452 CAGGTGTTTTGGTTGGTGTGAA 59.768 45.455 0.00 0.00 0.00 3.18
1630 1751 3.103742 AGGTGTTTTGGTTGGTGTGAAT 58.896 40.909 0.00 0.00 0.00 2.57
1631 1752 3.517500 AGGTGTTTTGGTTGGTGTGAATT 59.482 39.130 0.00 0.00 0.00 2.17
1632 1753 4.019771 AGGTGTTTTGGTTGGTGTGAATTT 60.020 37.500 0.00 0.00 0.00 1.82
1633 1754 4.697828 GGTGTTTTGGTTGGTGTGAATTTT 59.302 37.500 0.00 0.00 0.00 1.82
1634 1755 5.391416 GGTGTTTTGGTTGGTGTGAATTTTG 60.391 40.000 0.00 0.00 0.00 2.44
1635 1756 4.697352 TGTTTTGGTTGGTGTGAATTTTGG 59.303 37.500 0.00 0.00 0.00 3.28
1636 1757 3.550437 TTGGTTGGTGTGAATTTTGGG 57.450 42.857 0.00 0.00 0.00 4.12
1637 1758 2.472029 TGGTTGGTGTGAATTTTGGGT 58.528 42.857 0.00 0.00 0.00 4.51
1638 1759 2.840651 TGGTTGGTGTGAATTTTGGGTT 59.159 40.909 0.00 0.00 0.00 4.11
1639 1760 3.202097 GGTTGGTGTGAATTTTGGGTTG 58.798 45.455 0.00 0.00 0.00 3.77
1640 1761 3.202097 GTTGGTGTGAATTTTGGGTTGG 58.798 45.455 0.00 0.00 0.00 3.77
1641 1762 1.765314 TGGTGTGAATTTTGGGTTGGG 59.235 47.619 0.00 0.00 0.00 4.12
1642 1763 1.765904 GGTGTGAATTTTGGGTTGGGT 59.234 47.619 0.00 0.00 0.00 4.51
1643 1764 2.484594 GGTGTGAATTTTGGGTTGGGTG 60.485 50.000 0.00 0.00 0.00 4.61
1644 1765 1.765314 TGTGAATTTTGGGTTGGGTGG 59.235 47.619 0.00 0.00 0.00 4.61
1645 1766 0.761802 TGAATTTTGGGTTGGGTGGC 59.238 50.000 0.00 0.00 0.00 5.01
1646 1767 0.036164 GAATTTTGGGTTGGGTGGCC 59.964 55.000 0.00 0.00 0.00 5.36
1653 1774 1.151908 GGTTGGGTGGCCTGTACAA 59.848 57.895 3.32 1.12 0.00 2.41
1694 1818 8.384718 AGGAGGAATATGTACCAGTACTACTAG 58.615 40.741 9.24 0.00 37.00 2.57
1716 1840 9.171877 ACTAGTACTAACTCATGTGTTACCTAC 57.828 37.037 14.71 15.12 37.15 3.18
1743 1871 2.205022 TGGCTAATGCTTGTCTGCTT 57.795 45.000 0.00 0.00 39.59 3.91
1757 1885 1.912371 CTGCTTTCGCTTCCGTTCCC 61.912 60.000 0.00 0.00 36.97 3.97
1923 2051 3.890147 GACGTATGTCATAACTCCCTCCT 59.110 47.826 10.30 0.00 44.82 3.69
1924 2052 3.890147 ACGTATGTCATAACTCCCTCCTC 59.110 47.826 0.00 0.00 0.00 3.71
1925 2053 3.256136 CGTATGTCATAACTCCCTCCTCC 59.744 52.174 0.00 0.00 0.00 4.30
1948 2076 5.393461 CCATGCCCAACTTCTTTCTACATTC 60.393 44.000 0.00 0.00 0.00 2.67
1954 2082 6.072452 CCCAACTTCTTTCTACATTCCTTCAC 60.072 42.308 0.00 0.00 0.00 3.18
2010 2138 7.052248 GCCCTGCTTTTAACTAGGATTTACTA 58.948 38.462 0.00 0.00 31.91 1.82
2012 2140 9.628500 CCCTGCTTTTAACTAGGATTTACTATT 57.372 33.333 0.00 0.00 31.91 1.73
2048 2176 0.531974 CACACCTGTACCTGCACGTT 60.532 55.000 0.00 0.00 0.00 3.99
2071 2200 6.620877 TGATGTTACTAGGTCAAACAGGAT 57.379 37.500 0.00 0.00 36.62 3.24
2197 2333 0.978907 TCTTCAGCTGAGCATCCACA 59.021 50.000 17.43 0.00 0.00 4.17
2227 2363 0.168128 CCCGTTCCATTTTCGCTGAC 59.832 55.000 0.00 0.00 0.00 3.51
2257 2393 2.027100 ACTTACTAGCTGGGAAGCAACC 60.027 50.000 21.22 0.00 37.25 3.77
2260 2396 1.555533 ACTAGCTGGGAAGCAACCTAC 59.444 52.381 0.85 0.00 37.25 3.18
2278 2414 7.819900 GCAACCTACCATTCTACCTTCTATATG 59.180 40.741 0.00 0.00 0.00 1.78
2281 2417 7.397761 ACCTACCATTCTACCTTCTATATGCTC 59.602 40.741 0.00 0.00 0.00 4.26
2332 2468 2.202566 GCTTATCCTTACTGCCGTGTC 58.797 52.381 0.00 0.00 0.00 3.67
2360 2496 2.505407 TGCTACTATGGCCAAGTCACAT 59.495 45.455 10.96 0.00 0.00 3.21
2382 2519 5.835113 TTGACCTCAAAGTGGAAAAAGAG 57.165 39.130 0.00 0.00 32.11 2.85
2402 2539 4.643387 ACAGAGCGCCCCCAACAC 62.643 66.667 2.29 0.00 0.00 3.32
2411 2551 1.512230 CCCCCAACACGATGCATTG 59.488 57.895 12.66 12.66 0.00 2.82
2433 2573 5.000591 TGACTATTTCAAAGTGGAATGCGA 58.999 37.500 0.00 0.00 0.00 5.10
2465 2609 3.630312 TCTGGCAAAGTAAAACTGACCAC 59.370 43.478 0.00 0.00 0.00 4.16
2517 2670 1.474320 GGCCGTAACATGGATACTGCA 60.474 52.381 20.58 0.00 35.84 4.41
2518 2671 2.494059 GCCGTAACATGGATACTGCAT 58.506 47.619 16.78 0.00 34.73 3.96
2532 2685 6.593770 TGGATACTGCATGTTGTAACTTACTG 59.406 38.462 0.00 0.00 37.61 2.74
2533 2687 4.749245 ACTGCATGTTGTAACTTACTGC 57.251 40.909 0.00 2.94 0.00 4.40
2534 2688 3.502211 ACTGCATGTTGTAACTTACTGCC 59.498 43.478 7.90 0.00 0.00 4.85
2541 2695 4.023279 TGTTGTAACTTACTGCCAATGCTG 60.023 41.667 0.71 0.00 41.75 4.41
2592 2749 7.274447 TGTGAATGTGATATCTGCATTCTGTA 58.726 34.615 30.50 21.87 45.02 2.74
2607 2764 9.888878 CTGCATTCTGTATATCAAGTTTAATGG 57.111 33.333 0.00 0.00 0.00 3.16
2676 2839 2.642139 ATGGAATTCTTTGTGCTGCG 57.358 45.000 5.23 0.00 0.00 5.18
2686 2849 1.807139 TTGTGCTGCGCTAGATGAAA 58.193 45.000 14.92 0.00 0.00 2.69
2797 2960 4.920340 GGTGCTATGAACTCTGATGTATCG 59.080 45.833 0.00 0.00 0.00 2.92
2803 2966 3.181486 TGAACTCTGATGTATCGGCTGTC 60.181 47.826 0.00 0.00 33.18 3.51
2854 3017 5.222870 AGGAATCACAATCCTATGGACTCT 58.777 41.667 0.00 0.00 45.51 3.24
2918 3081 2.740981 CTCAAGTCAGCAGCTAACCAAG 59.259 50.000 0.00 0.00 0.00 3.61
2932 3095 2.767644 ACCAAGCTGGGTAGGTTTTT 57.232 45.000 12.48 0.00 43.37 1.94
2977 3142 2.851195 AGCGTTGGTGAGTTTTCTGAT 58.149 42.857 0.00 0.00 0.00 2.90
2993 3158 8.360390 AGTTTTCTGATTAATCCTTTTGTCCAC 58.640 33.333 12.90 0.00 0.00 4.02
3016 3181 1.601759 GCAACTTCAGGGCAGCTCA 60.602 57.895 0.00 0.00 0.00 4.26
3022 3187 0.250467 TTCAGGGCAGCTCAGTCAAC 60.250 55.000 0.00 0.00 0.00 3.18
3083 3248 4.396166 AGCAAGTTGTAATGCATACTGTCC 59.604 41.667 0.00 0.00 44.95 4.02
3087 3252 5.423015 AGTTGTAATGCATACTGTCCTCTG 58.577 41.667 0.00 0.00 35.42 3.35
3102 3267 7.777095 ACTGTCCTCTGTAACTCATTTCTATC 58.223 38.462 0.00 0.00 0.00 2.08
3112 3277 6.727824 AACTCATTTCTATCCACAGTTTCG 57.272 37.500 0.00 0.00 0.00 3.46
3122 3287 2.253452 CAGTTTCGCTGCACCTGC 59.747 61.111 0.00 0.00 38.52 4.85
3129 3294 3.292936 GCTGCACCTGCTTGCTGT 61.293 61.111 11.81 0.00 43.41 4.40
3133 3298 0.752743 TGCACCTGCTTGCTGTTTCT 60.753 50.000 7.00 0.00 43.41 2.52
3180 3348 6.729690 ATTTTCAAGGACATCAAAGGTGAA 57.270 33.333 0.00 0.00 37.30 3.18
3188 3356 4.265073 GACATCAAAGGTGAAGGTGCTAT 58.735 43.478 0.00 0.00 37.30 2.97
3237 3405 0.786581 CTGCATTATACGGAGCAGCG 59.213 55.000 0.00 0.00 46.51 5.18
3280 3448 0.905357 AGCCGCTTCTGGTGAGTAAT 59.095 50.000 0.00 0.00 0.00 1.89
3281 3449 2.108168 AGCCGCTTCTGGTGAGTAATA 58.892 47.619 0.00 0.00 0.00 0.98
3322 3490 1.085091 CTGCTGCTCATTGTGTCTCC 58.915 55.000 0.00 0.00 0.00 3.71
3340 3509 6.428159 GTGTCTCCTGATGTAGAAAACACATT 59.572 38.462 0.00 0.00 42.09 2.71
3371 3540 3.885297 GGAAGACCCATTATGTGTCCATG 59.115 47.826 4.28 0.00 31.64 3.66
3383 3552 2.039787 TCCATGCCGGGTGTCCTA 59.960 61.111 2.18 0.00 34.36 2.94
3399 3568 5.393962 GTGTCCTAGTGAAAATTGCATCAC 58.606 41.667 9.67 9.67 44.92 3.06
3407 3576 5.215160 GTGAAAATTGCATCACGAGTTCTT 58.785 37.500 2.60 0.00 36.89 2.52
3416 3585 5.288232 TGCATCACGAGTTCTTTTGTTTTTG 59.712 36.000 0.00 0.00 0.00 2.44
3422 3591 4.209080 CGAGTTCTTTTGTTTTTGCCCATC 59.791 41.667 0.00 0.00 0.00 3.51
3429 3598 2.243810 TGTTTTTGCCCATCAGTACCC 58.756 47.619 0.00 0.00 0.00 3.69
3452 3621 0.179073 CGGCTTGCTGTGGCTAGTAT 60.179 55.000 0.00 0.00 41.90 2.12
3454 3623 2.483013 CGGCTTGCTGTGGCTAGTATTA 60.483 50.000 0.00 0.00 41.90 0.98
3455 3624 3.744660 GGCTTGCTGTGGCTAGTATTAT 58.255 45.455 0.00 0.00 41.90 1.28
3456 3625 3.748568 GGCTTGCTGTGGCTAGTATTATC 59.251 47.826 0.00 0.00 41.90 1.75
3497 3669 7.061441 GTGTTTGTTGATTTAGATGTGAGCATG 59.939 37.037 0.00 0.00 35.07 4.06
3500 3672 5.183522 TGTTGATTTAGATGTGAGCATGCAA 59.816 36.000 21.98 4.48 35.07 4.08
3507 3679 4.330250 AGATGTGAGCATGCAACTAGTTT 58.670 39.130 21.98 0.00 35.07 2.66
3545 3717 5.729454 GCACATTAAACTCACGACAAACACT 60.729 40.000 0.00 0.00 0.00 3.55
3559 3731 8.471457 CACGACAAACACTCTGAAATTAAATTG 58.529 33.333 0.00 0.00 0.00 2.32
3652 3826 3.776731 TCCATCTTCCTCCACTTAGGA 57.223 47.619 0.00 0.00 46.75 2.94
3695 3869 2.281761 CACTGAAAGGCTGGCCGT 60.282 61.111 5.93 0.00 41.95 5.68
3708 3882 1.798813 CTGGCCGTTAACAGTGAGTTC 59.201 52.381 6.39 0.00 41.64 3.01
3724 3898 5.105554 AGTGAGTTCGCTGACATCTCTTTAT 60.106 40.000 0.00 0.00 33.63 1.40
3725 3899 6.095580 AGTGAGTTCGCTGACATCTCTTTATA 59.904 38.462 0.00 0.00 33.63 0.98
3727 3901 5.593010 AGTTCGCTGACATCTCTTTATACC 58.407 41.667 0.00 0.00 0.00 2.73
3728 3902 4.585955 TCGCTGACATCTCTTTATACCC 57.414 45.455 0.00 0.00 0.00 3.69
3729 3903 4.215908 TCGCTGACATCTCTTTATACCCT 58.784 43.478 0.00 0.00 0.00 4.34
3732 3906 5.235186 CGCTGACATCTCTTTATACCCTTTG 59.765 44.000 0.00 0.00 0.00 2.77
3755 3929 9.705290 TTTGTTTACTTCTCTTTTTGAAAGCTT 57.295 25.926 0.00 0.00 0.00 3.74
3765 3939 9.520204 TCTCTTTTTGAAAGCTTATCTGTTTTG 57.480 29.630 0.00 0.00 0.00 2.44
3766 3940 9.305925 CTCTTTTTGAAAGCTTATCTGTTTTGT 57.694 29.630 0.00 0.00 0.00 2.83
3768 3942 9.693157 CTTTTTGAAAGCTTATCTGTTTTGTTG 57.307 29.630 0.00 0.00 0.00 3.33
3769 3943 8.770438 TTTTGAAAGCTTATCTGTTTTGTTGT 57.230 26.923 0.00 0.00 0.00 3.32
3773 3947 6.588348 AAGCTTATCTGTTTTGTTGTTTGC 57.412 33.333 0.00 0.00 0.00 3.68
3774 3948 5.906073 AGCTTATCTGTTTTGTTGTTTGCT 58.094 33.333 0.00 0.00 0.00 3.91
3775 3949 7.038154 AGCTTATCTGTTTTGTTGTTTGCTA 57.962 32.000 0.00 0.00 0.00 3.49
3776 3950 7.488322 AGCTTATCTGTTTTGTTGTTTGCTAA 58.512 30.769 0.00 0.00 0.00 3.09
3808 3982 2.586258 ATCGATCAACTCCGGTCAAG 57.414 50.000 0.00 0.00 0.00 3.02
3815 3989 1.804748 CAACTCCGGTCAAGTTTAGGC 59.195 52.381 0.00 0.00 34.79 3.93
3857 4031 7.153985 TGACATCTCCAAACCAATTTCAAATC 58.846 34.615 0.00 0.00 0.00 2.17
3876 4050 6.209192 TCAAATCTTATCACCACAACAGCAAT 59.791 34.615 0.00 0.00 0.00 3.56
3893 4067 2.876091 CAATTGATGGCTCAAGCACAG 58.124 47.619 0.00 0.00 44.32 3.66
3962 4136 1.089920 CAAAGGTTCGGCCAGATGAG 58.910 55.000 2.24 0.00 40.61 2.90
3988 4162 7.649057 CACGAGTATATGATGAAGGTCAGTAA 58.351 38.462 0.00 0.00 0.00 2.24
3989 4163 7.591795 CACGAGTATATGATGAAGGTCAGTAAC 59.408 40.741 0.00 0.00 0.00 2.50
3990 4164 7.502895 ACGAGTATATGATGAAGGTCAGTAACT 59.497 37.037 0.00 0.00 0.00 2.24
3991 4165 8.018520 CGAGTATATGATGAAGGTCAGTAACTC 58.981 40.741 0.00 0.00 0.00 3.01
3993 4167 8.634444 AGTATATGATGAAGGTCAGTAACTCAC 58.366 37.037 0.00 0.00 0.00 3.51
3995 4169 8.768501 ATATGATGAAGGTCAGTAACTCACTA 57.231 34.615 0.00 0.00 34.98 2.74
3996 4170 7.667575 ATGATGAAGGTCAGTAACTCACTAT 57.332 36.000 0.00 0.00 34.98 2.12
3998 4172 8.589701 TGATGAAGGTCAGTAACTCACTATTA 57.410 34.615 0.00 0.00 34.98 0.98
3999 4173 9.201989 TGATGAAGGTCAGTAACTCACTATTAT 57.798 33.333 0.00 0.00 34.98 1.28
4000 4174 9.469807 GATGAAGGTCAGTAACTCACTATTATG 57.530 37.037 0.00 0.00 34.98 1.90
4002 4176 6.163135 AGGTCAGTAACTCACTATTATGGC 57.837 41.667 0.00 0.00 34.98 4.40
4003 4177 5.661312 AGGTCAGTAACTCACTATTATGGCA 59.339 40.000 0.00 0.00 34.98 4.92
4004 4178 5.753921 GGTCAGTAACTCACTATTATGGCAC 59.246 44.000 0.00 0.00 34.98 5.01
4005 4179 5.753921 GTCAGTAACTCACTATTATGGCACC 59.246 44.000 0.00 0.00 34.98 5.01
4006 4180 5.661312 TCAGTAACTCACTATTATGGCACCT 59.339 40.000 0.00 0.00 34.98 4.00
4007 4181 6.156256 TCAGTAACTCACTATTATGGCACCTT 59.844 38.462 0.00 0.00 34.98 3.50
4008 4182 7.343574 TCAGTAACTCACTATTATGGCACCTTA 59.656 37.037 0.00 0.00 34.98 2.69
4085 4477 1.755395 GATGGCCCAGATGCAGCAA 60.755 57.895 4.07 0.00 0.00 3.91
4094 4486 2.517875 ATGCAGCAATCCTCGGGC 60.518 61.111 0.00 0.00 0.00 6.13
4148 4543 2.643272 CACCAGCAACAGCAGCAG 59.357 61.111 0.00 0.00 0.00 4.24
4175 4573 0.101759 AACAGCAACAGCAACAGCAG 59.898 50.000 0.00 0.00 0.00 4.24
4193 4591 1.227031 GCAGCAGCAGCAACAACAA 60.227 52.632 4.63 0.00 45.49 2.83
4196 4594 0.531657 AGCAGCAGCAACAACAACAA 59.468 45.000 3.17 0.00 45.49 2.83
4202 4600 2.335752 CAGCAACAACAACAACAGCAA 58.664 42.857 0.00 0.00 0.00 3.91
4203 4601 2.092524 CAGCAACAACAACAACAGCAAC 59.907 45.455 0.00 0.00 0.00 4.17
4204 4602 2.064762 GCAACAACAACAACAGCAACA 58.935 42.857 0.00 0.00 0.00 3.33
4205 4603 2.092524 GCAACAACAACAACAGCAACAG 59.907 45.455 0.00 0.00 0.00 3.16
4206 4604 1.994916 ACAACAACAACAGCAACAGC 58.005 45.000 0.00 0.00 0.00 4.40
4207 4605 1.271934 ACAACAACAACAGCAACAGCA 59.728 42.857 0.00 0.00 0.00 4.41
4208 4606 1.921887 CAACAACAACAGCAACAGCAG 59.078 47.619 0.00 0.00 0.00 4.24
4209 4607 0.179129 ACAACAACAGCAACAGCAGC 60.179 50.000 0.00 0.00 0.00 5.25
4210 4608 0.179132 CAACAACAGCAACAGCAGCA 60.179 50.000 0.00 0.00 0.00 4.41
4211 4609 0.101759 AACAACAGCAACAGCAGCAG 59.898 50.000 0.00 0.00 0.00 4.24
4212 4610 1.660575 CAACAGCAACAGCAGCAGC 60.661 57.895 0.00 0.00 42.56 5.25
4213 4611 2.122797 AACAGCAACAGCAGCAGCA 61.123 52.632 3.17 0.00 45.49 4.41
4214 4612 1.669049 AACAGCAACAGCAGCAGCAA 61.669 50.000 3.17 0.00 45.49 3.91
4215 4613 1.660575 CAGCAACAGCAGCAGCAAC 60.661 57.895 3.17 0.00 45.49 4.17
4216 4614 2.122797 AGCAACAGCAGCAGCAACA 61.123 52.632 3.17 0.00 45.49 3.33
4217 4615 1.227031 GCAACAGCAGCAGCAACAA 60.227 52.632 3.17 0.00 45.49 2.83
4223 4621 0.101759 AGCAGCAGCAACAACAACAG 59.898 50.000 3.17 0.00 45.49 3.16
4226 4624 0.179129 AGCAGCAACAACAACAGCAC 60.179 50.000 0.00 0.00 0.00 4.40
4229 4627 0.894141 AGCAACAACAACAGCACCAA 59.106 45.000 0.00 0.00 0.00 3.67
4235 4633 0.173255 AACAACAGCACCAACAGCAC 59.827 50.000 0.00 0.00 0.00 4.40
4256 4654 3.738246 CAGCAGCAGCAGCAGGTG 61.738 66.667 12.92 12.39 46.58 4.00
4261 4659 4.415150 GCAGCAGCAGGTGGCCTA 62.415 66.667 10.46 0.00 46.50 3.93
4320 4721 2.550978 ACATGTGATACCTAAGCGTGC 58.449 47.619 0.00 0.00 0.00 5.34
4374 4775 3.042481 AAGCCAACTTCTTCTGGGC 57.958 52.632 0.00 0.00 44.92 5.36
4411 4812 0.323087 ACAGGAAATACCGTTGGGCC 60.323 55.000 0.00 0.00 44.74 5.80
4541 4942 3.349927 CAGTGGATTTGCTTCATCCTCA 58.650 45.455 9.81 0.00 40.99 3.86
4567 4968 8.758633 AATCAGATGGTACTATTATTACGTGC 57.241 34.615 0.00 0.00 0.00 5.34
4578 4979 8.107399 ACTATTATTACGTGCATACTGCTCTA 57.893 34.615 0.00 0.00 45.31 2.43
4704 5105 5.404466 TTTTGTCAAATGATGATGGGGAC 57.596 39.130 0.00 0.00 40.97 4.46
4743 5144 1.892329 GCATTGAAGAAAGGGCCCTCA 60.892 52.381 28.84 16.57 0.00 3.86
4872 5274 5.527582 TCTTTCTTTGAGTGAGGTTGCTAAC 59.472 40.000 0.00 0.00 0.00 2.34
5037 5444 2.177394 TGTGCCAGAGCGTTCAAATA 57.823 45.000 1.01 0.00 44.31 1.40
5238 5648 6.183360 GGCACCTGCATCTTATTCTGTTTATT 60.183 38.462 0.00 0.00 44.36 1.40
5549 5979 3.804873 GCAGCCGAGGTATTTTCTTCTAG 59.195 47.826 0.00 0.00 0.00 2.43
5550 5980 4.680975 GCAGCCGAGGTATTTTCTTCTAGT 60.681 45.833 0.00 0.00 0.00 2.57
5664 6099 8.539770 TTGACACTGAAATTTAAACTTTTGCA 57.460 26.923 0.00 0.00 0.00 4.08
5806 6444 3.052869 AGGGGAACACCTTTGTCTCTTTT 60.053 43.478 0.00 0.00 37.69 2.27
5807 6445 3.704566 GGGGAACACCTTTGTCTCTTTTT 59.295 43.478 0.00 0.00 40.03 1.94
5808 6446 4.202121 GGGGAACACCTTTGTCTCTTTTTC 60.202 45.833 0.00 0.00 40.03 2.29
5809 6447 4.401202 GGGAACACCTTTGTCTCTTTTTCA 59.599 41.667 0.00 0.00 33.55 2.69
5810 6448 5.450550 GGGAACACCTTTGTCTCTTTTTCAG 60.451 44.000 0.00 0.00 33.55 3.02
5811 6449 5.125578 GGAACACCTTTGTCTCTTTTTCAGT 59.874 40.000 0.00 0.00 33.55 3.41
5812 6450 6.317893 GGAACACCTTTGTCTCTTTTTCAGTA 59.682 38.462 0.00 0.00 33.55 2.74
5813 6451 7.148137 GGAACACCTTTGTCTCTTTTTCAGTAA 60.148 37.037 0.00 0.00 33.55 2.24
5814 6452 7.321745 ACACCTTTGTCTCTTTTTCAGTAAG 57.678 36.000 0.00 0.00 0.00 2.34
5815 6453 6.183360 ACACCTTTGTCTCTTTTTCAGTAAGC 60.183 38.462 0.00 0.00 0.00 3.09
5816 6454 5.007724 ACCTTTGTCTCTTTTTCAGTAAGCG 59.992 40.000 0.00 0.00 0.00 4.68
5817 6455 4.468095 TTGTCTCTTTTTCAGTAAGCGC 57.532 40.909 0.00 0.00 0.00 5.92
5818 6456 2.806244 TGTCTCTTTTTCAGTAAGCGCC 59.194 45.455 2.29 0.00 0.00 6.53
5819 6457 2.806244 GTCTCTTTTTCAGTAAGCGCCA 59.194 45.455 2.29 0.00 0.00 5.69
5820 6458 3.250040 GTCTCTTTTTCAGTAAGCGCCAA 59.750 43.478 2.29 0.00 0.00 4.52
5821 6459 3.498397 TCTCTTTTTCAGTAAGCGCCAAG 59.502 43.478 2.29 0.00 0.00 3.61
5871 6529 8.687824 ATATCTTAAATGCAAAAACCTCAACG 57.312 30.769 0.00 0.00 0.00 4.10
6794 7486 4.395854 TGTAGATGTTTTGCAGCCACATAG 59.604 41.667 7.30 0.00 33.15 2.23
6936 7637 6.757897 AACACGGTGAACATGATTGATATT 57.242 33.333 16.29 0.00 0.00 1.28
6995 7696 1.541147 CAAGAATTGCACGGTGGTCAT 59.459 47.619 10.60 0.00 40.39 3.06
7000 7701 0.250684 TTGCACGGTGGTCATGATGT 60.251 50.000 10.60 0.00 0.00 3.06
7005 7706 2.813754 CACGGTGGTCATGATGTTTCTT 59.186 45.455 0.00 0.00 0.00 2.52
7006 7707 4.000325 CACGGTGGTCATGATGTTTCTTA 59.000 43.478 0.00 0.00 0.00 2.10
7050 7763 4.825085 GGAGGTAGTTGTTCACCATTGAAA 59.175 41.667 0.00 0.00 43.52 2.69
7114 7827 4.323477 TGCTGGGACGAAACGGGG 62.323 66.667 0.00 0.00 0.00 5.73
7317 8030 8.758715 GCTGCAAATTCTGAATAATAATGTTCC 58.241 33.333 2.85 0.00 0.00 3.62
7318 8031 9.252962 CTGCAAATTCTGAATAATAATGTTCCC 57.747 33.333 2.85 0.00 0.00 3.97
7335 8048 1.621317 TCCCGTGCAACATAACAGAGA 59.379 47.619 0.00 0.00 35.74 3.10
7369 8082 4.716794 TGGACAGTTGGGTAACGTTTATT 58.283 39.130 5.91 0.00 41.71 1.40
7374 8087 9.112725 GGACAGTTGGGTAACGTTTATTTATAT 57.887 33.333 5.91 0.00 41.71 0.86
7441 8154 1.669211 GGAGCGTATCGGATAACCAGC 60.669 57.143 0.00 4.01 35.59 4.85
7553 8266 1.339151 GGTGAAGCTGTGGAAGTAGGG 60.339 57.143 0.00 0.00 0.00 3.53
7554 8267 1.623811 GTGAAGCTGTGGAAGTAGGGA 59.376 52.381 0.00 0.00 0.00 4.20
7555 8268 1.902508 TGAAGCTGTGGAAGTAGGGAG 59.097 52.381 0.00 0.00 0.00 4.30
7556 8269 2.180276 GAAGCTGTGGAAGTAGGGAGA 58.820 52.381 0.00 0.00 0.00 3.71
7557 8270 1.859302 AGCTGTGGAAGTAGGGAGAG 58.141 55.000 0.00 0.00 0.00 3.20
7558 8271 1.359474 AGCTGTGGAAGTAGGGAGAGA 59.641 52.381 0.00 0.00 0.00 3.10
7560 8273 2.621929 GCTGTGGAAGTAGGGAGAGAGA 60.622 54.545 0.00 0.00 0.00 3.10
7586 8309 3.462483 TGTAAAGACGAAGCTTGTGGA 57.538 42.857 2.10 0.00 0.00 4.02
7640 8367 3.338818 GCAAATACATGCATGCTACGT 57.661 42.857 26.53 14.93 45.70 3.57
7642 8369 4.457810 GCAAATACATGCATGCTACGTAG 58.542 43.478 26.53 18.47 45.70 3.51
7645 8372 6.292649 GCAAATACATGCATGCTACGTAGTAA 60.293 38.462 26.53 12.76 43.96 2.24
7646 8373 6.764877 AATACATGCATGCTACGTAGTAAC 57.235 37.500 26.53 15.44 45.13 2.50
7647 8374 4.386867 ACATGCATGCTACGTAGTAACT 57.613 40.909 26.53 2.68 45.13 2.24
7648 8375 5.509716 ACATGCATGCTACGTAGTAACTA 57.490 39.130 26.53 9.92 45.13 2.24
7649 8376 5.279384 ACATGCATGCTACGTAGTAACTAC 58.721 41.667 26.53 10.63 45.13 2.73
7650 8377 5.067413 ACATGCATGCTACGTAGTAACTACT 59.933 40.000 26.53 1.17 45.13 2.57
7651 8378 6.261603 ACATGCATGCTACGTAGTAACTACTA 59.738 38.462 26.53 0.10 45.13 1.82
7652 8379 6.296365 TGCATGCTACGTAGTAACTACTAG 57.704 41.667 22.98 6.48 45.13 2.57
7653 8380 5.819379 TGCATGCTACGTAGTAACTACTAGT 59.181 40.000 22.98 0.00 45.13 2.57
7654 8381 6.986231 TGCATGCTACGTAGTAACTACTAGTA 59.014 38.462 22.98 1.89 45.13 1.82
7655 8382 7.170489 TGCATGCTACGTAGTAACTACTAGTAG 59.830 40.741 25.30 25.30 45.13 2.57
7658 8385 7.707774 GCTACGTAGTAACTACTAGTAGCTT 57.292 40.000 26.54 20.78 46.34 3.74
7659 8386 8.137210 GCTACGTAGTAACTACTAGTAGCTTT 57.863 38.462 26.54 17.58 46.34 3.51
7660 8387 8.608317 GCTACGTAGTAACTACTAGTAGCTTTT 58.392 37.037 26.54 16.96 46.34 2.27
7661 8388 9.913451 CTACGTAGTAACTACTAGTAGCTTTTG 57.087 37.037 26.54 14.30 45.13 2.44
7662 8389 8.553459 ACGTAGTAACTACTAGTAGCTTTTGA 57.447 34.615 26.54 8.09 41.94 2.69
7663 8390 8.447053 ACGTAGTAACTACTAGTAGCTTTTGAC 58.553 37.037 26.54 16.85 41.94 3.18
7664 8391 7.907563 CGTAGTAACTACTAGTAGCTTTTGACC 59.092 40.741 26.54 9.55 39.29 4.02
7665 8392 8.955388 GTAGTAACTACTAGTAGCTTTTGACCT 58.045 37.037 26.54 14.23 39.29 3.85
7666 8393 8.419922 AGTAACTACTAGTAGCTTTTGACCTT 57.580 34.615 26.54 13.85 36.66 3.50
7667 8394 8.868103 AGTAACTACTAGTAGCTTTTGACCTTT 58.132 33.333 26.54 13.23 36.66 3.11
7668 8395 7.964604 AACTACTAGTAGCTTTTGACCTTTG 57.035 36.000 26.54 2.59 36.66 2.77
7669 8396 7.063934 ACTACTAGTAGCTTTTGACCTTTGT 57.936 36.000 26.54 3.19 36.66 2.83
7670 8397 7.506971 ACTACTAGTAGCTTTTGACCTTTGTT 58.493 34.615 26.54 1.76 36.66 2.83
7671 8398 7.991460 ACTACTAGTAGCTTTTGACCTTTGTTT 59.009 33.333 26.54 1.40 36.66 2.83
7672 8399 9.485206 CTACTAGTAGCTTTTGACCTTTGTTTA 57.515 33.333 16.77 0.00 0.00 2.01
7673 8400 8.151141 ACTAGTAGCTTTTGACCTTTGTTTAC 57.849 34.615 0.00 0.00 0.00 2.01
7674 8401 6.387041 AGTAGCTTTTGACCTTTGTTTACC 57.613 37.500 0.00 0.00 0.00 2.85
7679 8406 5.872617 GCTTTTGACCTTTGTTTACCTTTGT 59.127 36.000 0.00 0.00 0.00 2.83
7697 8424 1.152419 TCCGTCTGTTGTGGAGGGA 60.152 57.895 0.00 0.00 42.90 4.20
7698 8425 1.185618 TCCGTCTGTTGTGGAGGGAG 61.186 60.000 0.00 0.00 41.10 4.30
7701 8428 0.836400 GTCTGTTGTGGAGGGAGGGA 60.836 60.000 0.00 0.00 0.00 4.20
7702 8429 0.119155 TCTGTTGTGGAGGGAGGGAT 59.881 55.000 0.00 0.00 0.00 3.85
7703 8430 0.254178 CTGTTGTGGAGGGAGGGATG 59.746 60.000 0.00 0.00 0.00 3.51
7704 8431 0.475632 TGTTGTGGAGGGAGGGATGT 60.476 55.000 0.00 0.00 0.00 3.06
7705 8432 1.203376 TGTTGTGGAGGGAGGGATGTA 60.203 52.381 0.00 0.00 0.00 2.29
7706 8433 1.209747 GTTGTGGAGGGAGGGATGTAC 59.790 57.143 0.00 0.00 0.00 2.90
7707 8434 0.326238 TGTGGAGGGAGGGATGTACC 60.326 60.000 0.00 0.00 38.08 3.34
7708 8435 0.031010 GTGGAGGGAGGGATGTACCT 60.031 60.000 0.00 0.00 45.57 3.08
7709 8436 1.219724 GTGGAGGGAGGGATGTACCTA 59.780 57.143 0.00 0.00 42.10 3.08
7712 8439 2.491271 GGAGGGAGGGATGTACCTAGTC 60.491 59.091 0.00 0.00 42.10 2.59
7714 8441 3.656751 GAGGGAGGGATGTACCTAGTCTA 59.343 52.174 0.00 0.00 42.10 2.59
7715 8442 3.398629 AGGGAGGGATGTACCTAGTCTAC 59.601 52.174 0.00 0.00 42.10 2.59
7716 8443 3.398629 GGGAGGGATGTACCTAGTCTACT 59.601 52.174 0.00 0.00 42.10 2.57
7717 8444 4.140971 GGGAGGGATGTACCTAGTCTACTT 60.141 50.000 0.00 0.00 42.10 2.24
7718 8445 5.074239 GGGAGGGATGTACCTAGTCTACTTA 59.926 48.000 0.00 0.00 42.10 2.24
7719 8446 6.240527 GGGAGGGATGTACCTAGTCTACTTAT 60.241 46.154 0.00 0.00 42.10 1.73
7720 8447 6.660094 GGAGGGATGTACCTAGTCTACTTATG 59.340 46.154 0.00 0.00 42.10 1.90
7721 8448 7.164233 AGGGATGTACCTAGTCTACTTATGT 57.836 40.000 0.00 0.00 39.65 2.29
7722 8449 7.593653 AGGGATGTACCTAGTCTACTTATGTT 58.406 38.462 0.00 0.00 39.65 2.71
7723 8450 8.730948 AGGGATGTACCTAGTCTACTTATGTTA 58.269 37.037 0.00 0.00 39.65 2.41
7724 8451 8.791675 GGGATGTACCTAGTCTACTTATGTTAC 58.208 40.741 0.00 0.00 38.98 2.50
7725 8452 8.791675 GGATGTACCTAGTCTACTTATGTTACC 58.208 40.741 0.00 0.00 35.41 2.85
7726 8453 9.571816 GATGTACCTAGTCTACTTATGTTACCT 57.428 37.037 0.00 0.00 0.00 3.08
7727 8454 8.970859 TGTACCTAGTCTACTTATGTTACCTC 57.029 38.462 0.00 0.00 0.00 3.85
7728 8455 8.776119 TGTACCTAGTCTACTTATGTTACCTCT 58.224 37.037 0.00 0.00 0.00 3.69
7734 8461 8.522542 AGTCTACTTATGTTACCTCTTACCTG 57.477 38.462 0.00 0.00 0.00 4.00
7741 8468 6.831664 ATGTTACCTCTTACCTGGATGAAT 57.168 37.500 0.00 0.00 0.00 2.57
7743 8470 5.104527 TGTTACCTCTTACCTGGATGAATGG 60.105 44.000 0.00 0.00 0.00 3.16
7749 8476 6.466904 CCTCTTACCTGGATGAATGGATGAAT 60.467 42.308 0.00 0.00 0.00 2.57
7750 8477 6.301486 TCTTACCTGGATGAATGGATGAATG 58.699 40.000 0.00 0.00 0.00 2.67
7753 8480 4.891756 ACCTGGATGAATGGATGAATGAAC 59.108 41.667 0.00 0.00 0.00 3.18
7754 8481 4.280174 CCTGGATGAATGGATGAATGAACC 59.720 45.833 0.00 0.00 0.00 3.62
7781 8508 5.514279 CAAGTTTGCAGGTGAGTAAGAAAG 58.486 41.667 0.00 0.00 0.00 2.62
7782 8509 4.137543 AGTTTGCAGGTGAGTAAGAAAGG 58.862 43.478 0.00 0.00 0.00 3.11
7783 8510 4.134563 GTTTGCAGGTGAGTAAGAAAGGA 58.865 43.478 0.00 0.00 0.00 3.36
7784 8511 3.685139 TGCAGGTGAGTAAGAAAGGAG 57.315 47.619 0.00 0.00 0.00 3.69
7785 8512 3.239449 TGCAGGTGAGTAAGAAAGGAGA 58.761 45.455 0.00 0.00 0.00 3.71
7788 8515 4.381505 GCAGGTGAGTAAGAAAGGAGAGAG 60.382 50.000 0.00 0.00 0.00 3.20
7789 8516 5.013547 CAGGTGAGTAAGAAAGGAGAGAGA 58.986 45.833 0.00 0.00 0.00 3.10
7790 8517 5.125417 CAGGTGAGTAAGAAAGGAGAGAGAG 59.875 48.000 0.00 0.00 0.00 3.20
7791 8518 5.014755 AGGTGAGTAAGAAAGGAGAGAGAGA 59.985 44.000 0.00 0.00 0.00 3.10
7792 8519 5.357032 GGTGAGTAAGAAAGGAGAGAGAGAG 59.643 48.000 0.00 0.00 0.00 3.20
7793 8520 6.177610 GTGAGTAAGAAAGGAGAGAGAGAGA 58.822 44.000 0.00 0.00 0.00 3.10
7794 8521 6.316390 GTGAGTAAGAAAGGAGAGAGAGAGAG 59.684 46.154 0.00 0.00 0.00 3.20
7795 8522 6.214615 TGAGTAAGAAAGGAGAGAGAGAGAGA 59.785 42.308 0.00 0.00 0.00 3.10
7796 8523 6.653989 AGTAAGAAAGGAGAGAGAGAGAGAG 58.346 44.000 0.00 0.00 0.00 3.20
7797 8524 5.779241 AAGAAAGGAGAGAGAGAGAGAGA 57.221 43.478 0.00 0.00 0.00 3.10
7798 8525 5.365021 AGAAAGGAGAGAGAGAGAGAGAG 57.635 47.826 0.00 0.00 0.00 3.20
7799 8526 5.032846 AGAAAGGAGAGAGAGAGAGAGAGA 58.967 45.833 0.00 0.00 0.00 3.10
7800 8527 5.130145 AGAAAGGAGAGAGAGAGAGAGAGAG 59.870 48.000 0.00 0.00 0.00 3.20
7801 8528 4.271807 AGGAGAGAGAGAGAGAGAGAGA 57.728 50.000 0.00 0.00 0.00 3.10
7802 8529 4.222336 AGGAGAGAGAGAGAGAGAGAGAG 58.778 52.174 0.00 0.00 0.00 3.20
7803 8530 4.078922 AGGAGAGAGAGAGAGAGAGAGAGA 60.079 50.000 0.00 0.00 0.00 3.10
7804 8531 4.651503 GGAGAGAGAGAGAGAGAGAGAGAA 59.348 50.000 0.00 0.00 0.00 2.87
7805 8532 5.129485 GGAGAGAGAGAGAGAGAGAGAGAAA 59.871 48.000 0.00 0.00 0.00 2.52
7806 8533 6.232581 AGAGAGAGAGAGAGAGAGAGAAAG 57.767 45.833 0.00 0.00 0.00 2.62
7807 8534 5.130145 AGAGAGAGAGAGAGAGAGAGAAAGG 59.870 48.000 0.00 0.00 0.00 3.11
7808 8535 4.164988 AGAGAGAGAGAGAGAGAGAAAGGG 59.835 50.000 0.00 0.00 0.00 3.95
7809 8536 3.852578 AGAGAGAGAGAGAGAGAAAGGGT 59.147 47.826 0.00 0.00 0.00 4.34
7810 8537 3.947834 GAGAGAGAGAGAGAGAAAGGGTG 59.052 52.174 0.00 0.00 0.00 4.61
7811 8538 3.023832 GAGAGAGAGAGAGAAAGGGTGG 58.976 54.545 0.00 0.00 0.00 4.61
7832 8559 8.369424 GGGTGGGTTATTTTGTGTAATTAAACT 58.631 33.333 7.31 0.00 0.00 2.66
7837 8564 7.411049 GGTTATTTTGTGTAATTAAACTGCGGC 60.411 37.037 7.31 0.00 0.00 6.53
7838 8565 2.884663 TGTGTAATTAAACTGCGGCG 57.115 45.000 0.51 0.51 0.00 6.46
7839 8566 1.135916 TGTGTAATTAAACTGCGGCGC 60.136 47.619 27.44 27.44 0.00 6.53
7840 8567 0.095589 TGTAATTAAACTGCGGCGCG 59.904 50.000 28.09 22.98 0.00 6.86
7841 8568 0.587985 GTAATTAAACTGCGGCGCGG 60.588 55.000 36.75 36.75 41.29 6.46
7842 8569 2.312398 TAATTAAACTGCGGCGCGGC 62.312 55.000 38.07 30.55 38.71 6.53
7864 8591 5.164031 GGCGCGTTGTCGATCAATATTAATA 60.164 40.000 8.43 0.00 38.38 0.98
7868 8595 9.946418 CGCGTTGTCGATCAATATTAATATTAA 57.054 29.630 18.16 10.27 38.38 1.40
7891 8618 0.321034 TAGTGCAAGGAGCTGTGCTG 60.321 55.000 13.19 0.00 45.94 4.41
7905 8632 8.802267 AGGAGCTGTGCTGTTTAATTAATTTTA 58.198 29.630 5.91 0.00 39.88 1.52
7947 8677 6.713903 AGAGAATTGTTGAAAGAGAATGCAGA 59.286 34.615 0.00 0.00 0.00 4.26
7949 8679 7.893658 AGAATTGTTGAAAGAGAATGCAGAAT 58.106 30.769 0.00 0.00 0.00 2.40
8044 8877 3.964909 TCGACGACGATGATGATGATTT 58.035 40.909 5.75 0.00 43.81 2.17
8105 8944 4.779733 GCTCCTCGGAGGGGGTGA 62.780 72.222 24.95 4.14 42.19 4.02
8107 8946 2.038975 TCCTCGGAGGGGGTGAAG 59.961 66.667 23.39 0.00 35.59 3.02
8352 9191 3.104766 CCAGCAGCAATACCAGCG 58.895 61.111 0.00 0.00 37.01 5.18
8356 9195 0.107508 AGCAGCAATACCAGCGACAT 60.108 50.000 0.00 0.00 37.01 3.06
8382 9221 1.817099 GTCATGCTCCTCCCGCAAG 60.817 63.158 0.00 0.00 41.26 4.01
8414 9253 2.423031 CGCATTCGTCGTCGTCGTT 61.423 57.895 11.41 0.00 38.33 3.85
8460 9312 3.709348 TAGCTCCGTCCGCCTGCTA 62.709 63.158 0.00 0.00 35.47 3.49
8461 9313 4.577246 GCTCCGTCCGCCTGCTAG 62.577 72.222 0.00 0.00 0.00 3.42
8462 9314 4.577246 CTCCGTCCGCCTGCTAGC 62.577 72.222 8.10 8.10 0.00 3.42
8464 9316 4.880537 CCGTCCGCCTGCTAGCTG 62.881 72.222 17.23 15.65 0.00 4.24
8466 9318 4.154347 GTCCGCCTGCTAGCTGCT 62.154 66.667 21.86 7.57 43.37 4.24
8513 9365 4.320935 CCTTGTCTTGTTTATTTGGGGACG 60.321 45.833 0.00 0.00 0.00 4.79
8539 9391 4.041321 TGATGGAGAGGATGGATTCATGAC 59.959 45.833 0.00 0.00 32.98 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.963856 AGACACGGTGCGATCCAGTA 60.964 55.000 8.30 0.00 0.00 2.74
2 3 0.248661 CTAGACACGGTGCGATCCAG 60.249 60.000 8.30 0.00 0.00 3.86
7 8 2.034432 TGTTTAACTAGACACGGTGCGA 59.966 45.455 8.30 0.00 0.00 5.10
8 9 2.396601 TGTTTAACTAGACACGGTGCG 58.603 47.619 8.30 0.00 0.00 5.34
11 12 8.255206 TCATCATAATGTTTAACTAGACACGGT 58.745 33.333 0.00 0.00 34.32 4.83
12 13 8.540492 GTCATCATAATGTTTAACTAGACACGG 58.460 37.037 0.00 0.00 34.32 4.94
13 14 8.540492 GGTCATCATAATGTTTAACTAGACACG 58.460 37.037 0.00 0.00 34.32 4.49
14 15 9.601217 AGGTCATCATAATGTTTAACTAGACAC 57.399 33.333 0.00 0.00 34.32 3.67
17 18 9.613428 CCAAGGTCATCATAATGTTTAACTAGA 57.387 33.333 0.00 0.00 34.32 2.43
18 19 9.396022 ACCAAGGTCATCATAATGTTTAACTAG 57.604 33.333 0.00 0.00 34.32 2.57
19 20 9.173021 CACCAAGGTCATCATAATGTTTAACTA 57.827 33.333 0.00 0.00 34.32 2.24
20 21 7.888021 TCACCAAGGTCATCATAATGTTTAACT 59.112 33.333 0.00 0.00 34.32 2.24
21 22 8.050778 TCACCAAGGTCATCATAATGTTTAAC 57.949 34.615 0.00 0.00 34.32 2.01
22 23 8.642935 TTCACCAAGGTCATCATAATGTTTAA 57.357 30.769 0.00 0.00 34.32 1.52
23 24 8.821686 ATTCACCAAGGTCATCATAATGTTTA 57.178 30.769 0.00 0.00 34.32 2.01
24 25 7.147846 GGATTCACCAAGGTCATCATAATGTTT 60.148 37.037 9.20 0.00 38.79 2.83
25 26 6.322201 GGATTCACCAAGGTCATCATAATGTT 59.678 38.462 9.20 0.00 38.79 2.71
26 27 5.829924 GGATTCACCAAGGTCATCATAATGT 59.170 40.000 9.20 0.00 38.79 2.71
27 28 5.242393 GGGATTCACCAAGGTCATCATAATG 59.758 44.000 9.20 0.00 41.20 1.90
28 29 5.103558 TGGGATTCACCAAGGTCATCATAAT 60.104 40.000 9.20 0.00 41.20 1.28
29 30 4.229353 TGGGATTCACCAAGGTCATCATAA 59.771 41.667 9.20 0.00 41.20 1.90
30 31 3.785325 TGGGATTCACCAAGGTCATCATA 59.215 43.478 9.20 0.00 41.20 2.15
31 32 2.582172 TGGGATTCACCAAGGTCATCAT 59.418 45.455 9.20 0.00 41.20 2.45
32 33 1.991813 TGGGATTCACCAAGGTCATCA 59.008 47.619 9.20 0.00 41.20 3.07
33 34 2.290896 TGTGGGATTCACCAAGGTCATC 60.291 50.000 0.00 0.00 45.48 2.92
34 35 1.710244 TGTGGGATTCACCAAGGTCAT 59.290 47.619 0.00 0.00 45.48 3.06
35 36 1.144691 TGTGGGATTCACCAAGGTCA 58.855 50.000 0.00 0.00 45.48 4.02
36 37 1.886542 GTTGTGGGATTCACCAAGGTC 59.113 52.381 0.00 0.00 45.48 3.85
37 38 1.480498 GGTTGTGGGATTCACCAAGGT 60.480 52.381 0.00 0.00 45.48 3.50
38 39 1.256812 GGTTGTGGGATTCACCAAGG 58.743 55.000 0.00 0.00 45.48 3.61
39 40 1.993956 TGGTTGTGGGATTCACCAAG 58.006 50.000 0.00 0.00 45.48 3.61
40 41 2.461300 TTGGTTGTGGGATTCACCAA 57.539 45.000 0.00 0.00 45.48 3.67
41 42 2.246469 CATTGGTTGTGGGATTCACCA 58.754 47.619 0.00 0.00 45.48 4.17
42 43 2.247358 ACATTGGTTGTGGGATTCACC 58.753 47.619 0.00 0.00 45.48 4.02
43 44 5.650543 GATAACATTGGTTGTGGGATTCAC 58.349 41.667 0.00 0.00 46.23 3.18
44 45 4.397730 CGATAACATTGGTTGTGGGATTCA 59.602 41.667 0.00 0.00 38.99 2.57
45 46 4.398044 ACGATAACATTGGTTGTGGGATTC 59.602 41.667 0.00 0.00 38.99 2.52
46 47 4.340617 ACGATAACATTGGTTGTGGGATT 58.659 39.130 0.00 0.00 38.99 3.01
47 48 3.945285 GACGATAACATTGGTTGTGGGAT 59.055 43.478 0.00 0.00 38.99 3.85
48 49 3.008594 AGACGATAACATTGGTTGTGGGA 59.991 43.478 0.00 0.00 38.99 4.37
49 50 3.343617 AGACGATAACATTGGTTGTGGG 58.656 45.455 0.00 0.00 38.99 4.61
50 51 5.236478 GGATAGACGATAACATTGGTTGTGG 59.764 44.000 0.00 0.00 38.99 4.17
51 52 5.051039 CGGATAGACGATAACATTGGTTGTG 60.051 44.000 0.00 0.00 35.59 3.33
52 53 5.047847 CGGATAGACGATAACATTGGTTGT 58.952 41.667 0.00 0.00 36.56 3.32
53 54 4.447724 CCGGATAGACGATAACATTGGTTG 59.552 45.833 0.00 0.00 35.71 3.77
54 55 4.342951 TCCGGATAGACGATAACATTGGTT 59.657 41.667 0.00 0.00 37.22 3.67
55 56 3.893200 TCCGGATAGACGATAACATTGGT 59.107 43.478 0.00 0.00 35.47 3.67
56 57 4.217767 TCTCCGGATAGACGATAACATTGG 59.782 45.833 3.57 0.00 35.47 3.16
57 58 5.372547 TCTCCGGATAGACGATAACATTG 57.627 43.478 3.57 0.00 35.47 2.82
58 59 7.628794 GCTTATCTCCGGATAGACGATAACATT 60.629 40.741 15.49 0.00 36.03 2.71
59 60 6.183360 GCTTATCTCCGGATAGACGATAACAT 60.183 42.308 15.49 0.00 36.03 2.71
60 61 5.123502 GCTTATCTCCGGATAGACGATAACA 59.876 44.000 15.49 1.99 36.03 2.41
61 62 5.448904 GGCTTATCTCCGGATAGACGATAAC 60.449 48.000 15.49 12.84 36.03 1.89
62 63 4.639310 GGCTTATCTCCGGATAGACGATAA 59.361 45.833 17.45 17.45 36.03 1.75
63 64 4.197750 GGCTTATCTCCGGATAGACGATA 58.802 47.826 3.57 5.35 36.03 2.92
64 65 3.018149 GGCTTATCTCCGGATAGACGAT 58.982 50.000 3.57 6.48 36.03 3.73
65 66 2.434428 GGCTTATCTCCGGATAGACGA 58.566 52.381 3.57 0.00 36.03 4.20
66 67 1.130749 CGGCTTATCTCCGGATAGACG 59.869 57.143 3.57 10.75 42.99 4.18
67 68 2.923605 CGGCTTATCTCCGGATAGAC 57.076 55.000 3.57 1.34 42.99 2.59
75 76 1.499049 CGGCTTAACGGCTTATCTCC 58.501 55.000 0.00 0.00 35.72 3.71
85 86 1.301874 TGGTCAACCCGGCTTAACG 60.302 57.895 0.00 0.00 35.15 3.18
86 87 0.535553 TGTGGTCAACCCGGCTTAAC 60.536 55.000 0.00 0.00 35.15 2.01
87 88 0.402504 ATGTGGTCAACCCGGCTTAA 59.597 50.000 0.00 0.00 35.15 1.85
88 89 1.208535 CTATGTGGTCAACCCGGCTTA 59.791 52.381 0.00 0.00 35.15 3.09
89 90 0.035439 CTATGTGGTCAACCCGGCTT 60.035 55.000 0.00 0.00 35.15 4.35
90 91 1.198759 ACTATGTGGTCAACCCGGCT 61.199 55.000 0.00 0.00 35.15 5.52
91 92 0.322187 AACTATGTGGTCAACCCGGC 60.322 55.000 0.00 0.00 35.15 6.13
92 93 1.448985 CAACTATGTGGTCAACCCGG 58.551 55.000 0.00 0.00 35.15 5.73
93 94 1.002659 TCCAACTATGTGGTCAACCCG 59.997 52.381 0.00 0.00 39.88 5.28
94 95 2.433436 GTCCAACTATGTGGTCAACCC 58.567 52.381 0.00 0.00 39.88 4.11
95 96 2.039879 AGGTCCAACTATGTGGTCAACC 59.960 50.000 0.00 0.00 39.88 3.77
96 97 3.074412 CAGGTCCAACTATGTGGTCAAC 58.926 50.000 0.00 0.00 39.88 3.18
97 98 2.552155 GCAGGTCCAACTATGTGGTCAA 60.552 50.000 0.00 0.00 39.88 3.18
98 99 1.003118 GCAGGTCCAACTATGTGGTCA 59.997 52.381 0.00 0.00 39.88 4.02
99 100 1.003118 TGCAGGTCCAACTATGTGGTC 59.997 52.381 0.00 0.00 39.88 4.02
100 101 1.064003 TGCAGGTCCAACTATGTGGT 58.936 50.000 0.00 0.00 39.88 4.16
101 102 2.019249 CATGCAGGTCCAACTATGTGG 58.981 52.381 0.00 0.00 40.33 4.17
102 103 2.019249 CCATGCAGGTCCAACTATGTG 58.981 52.381 0.00 0.00 0.00 3.21
103 104 1.064463 CCCATGCAGGTCCAACTATGT 60.064 52.381 0.00 0.00 34.66 2.29
104 105 1.683943 CCCATGCAGGTCCAACTATG 58.316 55.000 0.00 0.00 34.66 2.23
105 106 0.106519 GCCCATGCAGGTCCAACTAT 60.107 55.000 0.00 0.00 37.47 2.12
106 107 1.207488 AGCCCATGCAGGTCCAACTA 61.207 55.000 0.00 0.00 41.13 2.24
107 108 1.207488 TAGCCCATGCAGGTCCAACT 61.207 55.000 0.00 0.00 41.13 3.16
108 109 1.032114 GTAGCCCATGCAGGTCCAAC 61.032 60.000 0.00 0.00 41.13 3.77
109 110 1.302949 GTAGCCCATGCAGGTCCAA 59.697 57.895 0.00 0.00 41.13 3.53
110 111 2.679342 GGTAGCCCATGCAGGTCCA 61.679 63.158 0.00 0.00 41.13 4.02
111 112 2.193248 GGTAGCCCATGCAGGTCC 59.807 66.667 0.00 0.00 41.13 4.46
112 113 0.106519 ATTGGTAGCCCATGCAGGTC 60.107 55.000 0.00 0.00 41.49 3.85
113 114 0.396139 CATTGGTAGCCCATGCAGGT 60.396 55.000 0.00 0.00 41.49 4.00
114 115 0.106569 TCATTGGTAGCCCATGCAGG 60.107 55.000 0.00 0.00 41.49 4.85
115 116 1.027357 GTCATTGGTAGCCCATGCAG 58.973 55.000 0.00 0.00 41.49 4.41
116 117 0.747644 CGTCATTGGTAGCCCATGCA 60.748 55.000 0.00 0.00 41.49 3.96
117 118 1.447317 CCGTCATTGGTAGCCCATGC 61.447 60.000 0.00 0.00 41.49 4.06
118 119 0.819259 CCCGTCATTGGTAGCCCATG 60.819 60.000 0.00 0.00 41.49 3.66
119 120 1.531748 CCCGTCATTGGTAGCCCAT 59.468 57.895 0.00 0.00 41.49 4.00
120 121 2.675242 CCCCGTCATTGGTAGCCCA 61.675 63.158 0.00 0.00 39.65 5.36
121 122 2.192175 CCCCGTCATTGGTAGCCC 59.808 66.667 0.00 0.00 0.00 5.19
122 123 1.692173 TAGCCCCGTCATTGGTAGCC 61.692 60.000 0.00 0.00 0.00 3.93
123 124 0.179468 TTAGCCCCGTCATTGGTAGC 59.821 55.000 0.00 0.00 0.00 3.58
124 125 2.702592 TTTAGCCCCGTCATTGGTAG 57.297 50.000 0.00 0.00 0.00 3.18
125 126 2.158726 GGATTTAGCCCCGTCATTGGTA 60.159 50.000 0.00 0.00 0.00 3.25
126 127 1.409661 GGATTTAGCCCCGTCATTGGT 60.410 52.381 0.00 0.00 0.00 3.67
127 128 1.318576 GGATTTAGCCCCGTCATTGG 58.681 55.000 0.00 0.00 0.00 3.16
128 129 0.944386 CGGATTTAGCCCCGTCATTG 59.056 55.000 0.00 0.00 40.78 2.82
129 130 0.834612 TCGGATTTAGCCCCGTCATT 59.165 50.000 0.00 0.00 45.48 2.57
130 131 0.106149 GTCGGATTTAGCCCCGTCAT 59.894 55.000 0.00 0.00 45.48 3.06
131 132 1.259142 TGTCGGATTTAGCCCCGTCA 61.259 55.000 0.00 0.00 45.48 4.35
132 133 0.108041 TTGTCGGATTTAGCCCCGTC 60.108 55.000 0.00 0.00 45.48 4.79
133 134 0.544697 ATTGTCGGATTTAGCCCCGT 59.455 50.000 0.00 0.00 45.48 5.28
134 135 2.536761 TATTGTCGGATTTAGCCCCG 57.463 50.000 0.00 0.00 46.57 5.73
135 136 4.254492 GAGATATTGTCGGATTTAGCCCC 58.746 47.826 0.00 0.00 0.00 5.80
136 137 3.927142 CGAGATATTGTCGGATTTAGCCC 59.073 47.826 1.44 0.00 33.66 5.19
146 147 4.011023 ACCCTCTATCCGAGATATTGTCG 58.989 47.826 2.26 2.26 42.62 4.35
147 148 4.399934 GGACCCTCTATCCGAGATATTGTC 59.600 50.000 0.00 0.00 42.62 3.18
148 149 4.345854 GGACCCTCTATCCGAGATATTGT 58.654 47.826 0.00 0.00 42.62 2.71
149 150 3.702045 GGGACCCTCTATCCGAGATATTG 59.298 52.174 2.09 0.00 42.62 1.90
150 151 3.336997 TGGGACCCTCTATCCGAGATATT 59.663 47.826 13.00 0.00 42.62 1.28
151 152 2.927007 TGGGACCCTCTATCCGAGATAT 59.073 50.000 13.00 0.00 42.62 1.63
152 153 2.355309 TGGGACCCTCTATCCGAGATA 58.645 52.381 13.00 0.00 42.62 1.98
153 154 1.158904 TGGGACCCTCTATCCGAGAT 58.841 55.000 13.00 0.00 42.62 2.75
154 155 0.931468 TTGGGACCCTCTATCCGAGA 59.069 55.000 13.00 0.00 42.62 4.04
155 156 1.333177 CTTGGGACCCTCTATCCGAG 58.667 60.000 13.00 0.00 37.08 4.63
156 157 0.759436 GCTTGGGACCCTCTATCCGA 60.759 60.000 13.00 0.00 37.08 4.55
157 158 0.760945 AGCTTGGGACCCTCTATCCG 60.761 60.000 13.00 0.00 37.08 4.18
158 159 0.761802 CAGCTTGGGACCCTCTATCC 59.238 60.000 13.00 0.00 35.28 2.59
159 160 0.761802 CCAGCTTGGGACCCTCTATC 59.238 60.000 13.00 0.00 32.67 2.08
160 161 0.044855 ACCAGCTTGGGACCCTCTAT 59.955 55.000 13.00 0.00 43.37 1.98
161 162 0.909610 CACCAGCTTGGGACCCTCTA 60.910 60.000 13.00 0.00 43.37 2.43
162 163 2.208349 ACCAGCTTGGGACCCTCT 59.792 61.111 13.00 3.34 43.37 3.69
163 164 1.566298 ATCACCAGCTTGGGACCCTC 61.566 60.000 13.00 0.79 43.37 4.30
164 165 1.542375 ATCACCAGCTTGGGACCCT 60.542 57.895 13.00 0.00 43.37 4.34
165 166 1.077429 GATCACCAGCTTGGGACCC 60.077 63.158 2.45 2.45 43.37 4.46
166 167 0.329596 AAGATCACCAGCTTGGGACC 59.670 55.000 0.00 0.00 43.37 4.46
167 168 1.457346 CAAGATCACCAGCTTGGGAC 58.543 55.000 0.00 0.00 43.37 4.46
168 169 3.963733 CAAGATCACCAGCTTGGGA 57.036 52.632 0.00 0.00 43.37 4.37
171 172 2.286872 CTAGCCAAGATCACCAGCTTG 58.713 52.381 5.11 0.00 40.81 4.01
172 173 1.211457 CCTAGCCAAGATCACCAGCTT 59.789 52.381 5.11 0.00 35.03 3.74
173 174 0.835941 CCTAGCCAAGATCACCAGCT 59.164 55.000 0.00 0.00 37.58 4.24
174 175 0.833287 TCCTAGCCAAGATCACCAGC 59.167 55.000 0.00 0.00 0.00 4.85
175 176 3.634397 TTTCCTAGCCAAGATCACCAG 57.366 47.619 0.00 0.00 0.00 4.00
176 177 5.708736 TTATTTCCTAGCCAAGATCACCA 57.291 39.130 0.00 0.00 0.00 4.17
177 178 6.881602 CCTATTATTTCCTAGCCAAGATCACC 59.118 42.308 0.00 0.00 0.00 4.02
178 179 7.680730 TCCTATTATTTCCTAGCCAAGATCAC 58.319 38.462 0.00 0.00 0.00 3.06
179 180 7.872061 TCCTATTATTTCCTAGCCAAGATCA 57.128 36.000 0.00 0.00 0.00 2.92
180 181 8.543774 TCATCCTATTATTTCCTAGCCAAGATC 58.456 37.037 0.00 0.00 0.00 2.75
181 182 8.454859 TCATCCTATTATTTCCTAGCCAAGAT 57.545 34.615 0.00 0.00 0.00 2.40
182 183 7.872061 TCATCCTATTATTTCCTAGCCAAGA 57.128 36.000 0.00 0.00 0.00 3.02
183 184 7.939039 TGTTCATCCTATTATTTCCTAGCCAAG 59.061 37.037 0.00 0.00 0.00 3.61
184 185 7.719633 GTGTTCATCCTATTATTTCCTAGCCAA 59.280 37.037 0.00 0.00 0.00 4.52
185 186 7.224297 GTGTTCATCCTATTATTTCCTAGCCA 58.776 38.462 0.00 0.00 0.00 4.75
186 187 6.369065 CGTGTTCATCCTATTATTTCCTAGCC 59.631 42.308 0.00 0.00 0.00 3.93
187 188 7.152645 TCGTGTTCATCCTATTATTTCCTAGC 58.847 38.462 0.00 0.00 0.00 3.42
188 189 8.577296 TCTCGTGTTCATCCTATTATTTCCTAG 58.423 37.037 0.00 0.00 0.00 3.02
189 190 8.358148 GTCTCGTGTTCATCCTATTATTTCCTA 58.642 37.037 0.00 0.00 0.00 2.94
190 191 7.147724 TGTCTCGTGTTCATCCTATTATTTCCT 60.148 37.037 0.00 0.00 0.00 3.36
191 192 6.984474 TGTCTCGTGTTCATCCTATTATTTCC 59.016 38.462 0.00 0.00 0.00 3.13
192 193 7.491372 TGTGTCTCGTGTTCATCCTATTATTTC 59.509 37.037 0.00 0.00 0.00 2.17
193 194 7.327975 TGTGTCTCGTGTTCATCCTATTATTT 58.672 34.615 0.00 0.00 0.00 1.40
194 195 6.873997 TGTGTCTCGTGTTCATCCTATTATT 58.126 36.000 0.00 0.00 0.00 1.40
195 196 6.096987 ACTGTGTCTCGTGTTCATCCTATTAT 59.903 38.462 0.00 0.00 0.00 1.28
196 197 5.417894 ACTGTGTCTCGTGTTCATCCTATTA 59.582 40.000 0.00 0.00 0.00 0.98
197 198 4.220821 ACTGTGTCTCGTGTTCATCCTATT 59.779 41.667 0.00 0.00 0.00 1.73
198 199 3.764434 ACTGTGTCTCGTGTTCATCCTAT 59.236 43.478 0.00 0.00 0.00 2.57
199 200 3.154710 ACTGTGTCTCGTGTTCATCCTA 58.845 45.455 0.00 0.00 0.00 2.94
200 201 1.964223 ACTGTGTCTCGTGTTCATCCT 59.036 47.619 0.00 0.00 0.00 3.24
201 202 2.440539 ACTGTGTCTCGTGTTCATCC 57.559 50.000 0.00 0.00 0.00 3.51
202 203 6.034683 GGTAAATACTGTGTCTCGTGTTCATC 59.965 42.308 0.00 0.00 0.00 2.92
203 204 5.867716 GGTAAATACTGTGTCTCGTGTTCAT 59.132 40.000 0.00 0.00 0.00 2.57
204 205 5.010314 AGGTAAATACTGTGTCTCGTGTTCA 59.990 40.000 0.00 0.00 0.00 3.18
205 206 5.467705 AGGTAAATACTGTGTCTCGTGTTC 58.532 41.667 0.00 0.00 0.00 3.18
206 207 5.464030 AGGTAAATACTGTGTCTCGTGTT 57.536 39.130 0.00 0.00 0.00 3.32
207 208 5.125097 CCTAGGTAAATACTGTGTCTCGTGT 59.875 44.000 0.00 0.00 0.00 4.49
208 209 5.125097 ACCTAGGTAAATACTGTGTCTCGTG 59.875 44.000 14.41 0.00 0.00 4.35
209 210 5.259632 ACCTAGGTAAATACTGTGTCTCGT 58.740 41.667 14.41 0.00 0.00 4.18
210 211 5.831702 ACCTAGGTAAATACTGTGTCTCG 57.168 43.478 14.41 0.00 0.00 4.04
211 212 7.093858 ACTGAACCTAGGTAAATACTGTGTCTC 60.094 40.741 16.67 4.61 0.00 3.36
212 213 6.724905 ACTGAACCTAGGTAAATACTGTGTCT 59.275 38.462 16.67 0.00 0.00 3.41
213 214 6.932947 ACTGAACCTAGGTAAATACTGTGTC 58.067 40.000 16.67 5.38 0.00 3.67
214 215 6.070938 GGACTGAACCTAGGTAAATACTGTGT 60.071 42.308 16.67 4.35 0.00 3.72
215 216 6.154706 AGGACTGAACCTAGGTAAATACTGTG 59.845 42.308 16.67 1.18 38.65 3.66
216 217 6.262207 AGGACTGAACCTAGGTAAATACTGT 58.738 40.000 16.67 13.43 38.65 3.55
217 218 6.608002 AGAGGACTGAACCTAGGTAAATACTG 59.392 42.308 16.67 10.65 40.73 2.74
218 219 6.743788 AGAGGACTGAACCTAGGTAAATACT 58.256 40.000 16.67 7.34 40.73 2.12
219 220 6.238703 CGAGAGGACTGAACCTAGGTAAATAC 60.239 46.154 16.67 7.28 40.73 1.89
220 221 5.826737 CGAGAGGACTGAACCTAGGTAAATA 59.173 44.000 16.67 0.94 40.73 1.40
221 222 4.645588 CGAGAGGACTGAACCTAGGTAAAT 59.354 45.833 16.67 0.00 40.73 1.40
222 223 4.015084 CGAGAGGACTGAACCTAGGTAAA 58.985 47.826 16.67 5.51 40.73 2.01
223 224 3.265221 TCGAGAGGACTGAACCTAGGTAA 59.735 47.826 16.67 5.91 40.73 2.85
224 225 2.842496 TCGAGAGGACTGAACCTAGGTA 59.158 50.000 16.67 0.00 40.73 3.08
225 226 1.634459 TCGAGAGGACTGAACCTAGGT 59.366 52.381 9.21 9.21 40.73 3.08
226 227 2.421751 TCGAGAGGACTGAACCTAGG 57.578 55.000 7.41 7.41 40.73 3.02
227 228 3.611970 TCTTCGAGAGGACTGAACCTAG 58.388 50.000 0.00 0.00 40.73 3.02
228 229 3.611970 CTCTTCGAGAGGACTGAACCTA 58.388 50.000 0.00 0.00 40.73 3.08
229 230 2.442413 CTCTTCGAGAGGACTGAACCT 58.558 52.381 0.00 0.00 43.64 3.50
230 231 2.931512 CTCTTCGAGAGGACTGAACC 57.068 55.000 4.52 0.00 38.67 3.62
239 240 2.952116 AGGGGATTACCTCTTCGAGAG 58.048 52.381 5.27 5.27 46.28 3.20
240 241 3.830121 GTAGGGGATTACCTCTTCGAGA 58.170 50.000 0.00 0.00 46.28 4.04
244 245 2.627221 GGACGTAGGGGATTACCTCTTC 59.373 54.545 0.00 0.00 46.28 2.87
245 246 2.246849 AGGACGTAGGGGATTACCTCTT 59.753 50.000 0.00 0.00 46.28 2.85
247 248 1.962100 CAGGACGTAGGGGATTACCTC 59.038 57.143 0.00 0.00 42.09 3.85
248 249 2.033208 GCAGGACGTAGGGGATTACCT 61.033 57.143 0.00 0.00 44.75 3.08
249 250 0.391966 GCAGGACGTAGGGGATTACC 59.608 60.000 0.00 0.00 39.11 2.85
250 251 1.411041 AGCAGGACGTAGGGGATTAC 58.589 55.000 0.00 0.00 0.00 1.89
251 252 2.170012 AAGCAGGACGTAGGGGATTA 57.830 50.000 0.00 0.00 0.00 1.75
252 253 1.286248 AAAGCAGGACGTAGGGGATT 58.714 50.000 0.00 0.00 0.00 3.01
253 254 1.065418 CAAAAGCAGGACGTAGGGGAT 60.065 52.381 0.00 0.00 0.00 3.85
254 255 0.323629 CAAAAGCAGGACGTAGGGGA 59.676 55.000 0.00 0.00 0.00 4.81
255 256 1.305930 GCAAAAGCAGGACGTAGGGG 61.306 60.000 0.00 0.00 0.00 4.79
256 257 0.321653 AGCAAAAGCAGGACGTAGGG 60.322 55.000 0.00 0.00 0.00 3.53
257 258 1.523758 AAGCAAAAGCAGGACGTAGG 58.476 50.000 0.00 0.00 0.00 3.18
258 259 4.946784 ATAAAGCAAAAGCAGGACGTAG 57.053 40.909 0.00 0.00 0.00 3.51
259 260 4.757657 TCAATAAAGCAAAAGCAGGACGTA 59.242 37.500 0.00 0.00 0.00 3.57
260 261 3.568007 TCAATAAAGCAAAAGCAGGACGT 59.432 39.130 0.00 0.00 0.00 4.34
261 262 4.159377 TCAATAAAGCAAAAGCAGGACG 57.841 40.909 0.00 0.00 0.00 4.79
262 263 5.928264 ACAATCAATAAAGCAAAAGCAGGAC 59.072 36.000 0.00 0.00 0.00 3.85
263 264 5.927689 CACAATCAATAAAGCAAAAGCAGGA 59.072 36.000 0.00 0.00 0.00 3.86
264 265 5.927689 TCACAATCAATAAAGCAAAAGCAGG 59.072 36.000 0.00 0.00 0.00 4.85
265 266 7.329962 TCATCACAATCAATAAAGCAAAAGCAG 59.670 33.333 0.00 0.00 0.00 4.24
266 267 7.153315 TCATCACAATCAATAAAGCAAAAGCA 58.847 30.769 0.00 0.00 0.00 3.91
267 268 7.585286 TCATCACAATCAATAAAGCAAAAGC 57.415 32.000 0.00 0.00 0.00 3.51
268 269 9.199982 ACTTCATCACAATCAATAAAGCAAAAG 57.800 29.630 0.00 0.00 0.00 2.27
270 271 9.624697 GTACTTCATCACAATCAATAAAGCAAA 57.375 29.630 0.00 0.00 0.00 3.68
271 272 8.791675 TGTACTTCATCACAATCAATAAAGCAA 58.208 29.630 0.00 0.00 0.00 3.91
272 273 8.334263 TGTACTTCATCACAATCAATAAAGCA 57.666 30.769 0.00 0.00 0.00 3.91
273 274 9.624697 TTTGTACTTCATCACAATCAATAAAGC 57.375 29.630 0.00 0.00 34.78 3.51
278 279 9.283768 TGTACTTTGTACTTCATCACAATCAAT 57.716 29.630 8.94 0.00 34.78 2.57
279 280 8.669946 TGTACTTTGTACTTCATCACAATCAA 57.330 30.769 8.94 0.00 34.78 2.57
280 281 8.720562 CATGTACTTTGTACTTCATCACAATCA 58.279 33.333 8.94 0.00 34.78 2.57
281 282 8.721478 ACATGTACTTTGTACTTCATCACAATC 58.279 33.333 0.00 0.00 34.78 2.67
282 283 8.621532 ACATGTACTTTGTACTTCATCACAAT 57.378 30.769 0.00 0.00 34.78 2.71
283 284 8.341903 CAACATGTACTTTGTACTTCATCACAA 58.658 33.333 0.00 0.00 32.98 3.33
284 285 7.713073 TCAACATGTACTTTGTACTTCATCACA 59.287 33.333 0.00 0.00 0.00 3.58
285 286 8.083462 TCAACATGTACTTTGTACTTCATCAC 57.917 34.615 0.00 0.00 0.00 3.06
286 287 8.846943 ATCAACATGTACTTTGTACTTCATCA 57.153 30.769 0.00 0.00 0.00 3.07
287 288 9.155975 AGATCAACATGTACTTTGTACTTCATC 57.844 33.333 0.00 0.00 0.00 2.92
289 290 9.419297 GTAGATCAACATGTACTTTGTACTTCA 57.581 33.333 0.00 0.00 0.00 3.02
290 291 8.584600 CGTAGATCAACATGTACTTTGTACTTC 58.415 37.037 0.00 0.00 28.39 3.01
291 292 8.086522 ACGTAGATCAACATGTACTTTGTACTT 58.913 33.333 0.00 0.89 28.39 2.24
292 293 7.600065 ACGTAGATCAACATGTACTTTGTACT 58.400 34.615 0.00 1.18 28.39 2.73
293 294 7.253223 CGACGTAGATCAACATGTACTTTGTAC 60.253 40.741 0.00 1.33 28.39 2.90
294 295 6.744082 CGACGTAGATCAACATGTACTTTGTA 59.256 38.462 0.00 0.00 28.39 2.41
295 296 5.571741 CGACGTAGATCAACATGTACTTTGT 59.428 40.000 0.00 0.00 28.39 2.83
296 297 5.798434 TCGACGTAGATCAACATGTACTTTG 59.202 40.000 0.00 0.00 28.39 2.77
297 298 5.946298 TCGACGTAGATCAACATGTACTTT 58.054 37.500 0.00 0.00 28.39 2.66
298 299 5.353400 TCTCGACGTAGATCAACATGTACTT 59.647 40.000 0.00 0.00 28.39 2.24
299 300 4.874396 TCTCGACGTAGATCAACATGTACT 59.126 41.667 0.00 0.00 28.39 2.73
300 301 5.152923 TCTCGACGTAGATCAACATGTAC 57.847 43.478 0.00 0.00 0.00 2.90
302 303 4.902443 ATCTCGACGTAGATCAACATGT 57.098 40.909 0.00 0.00 30.09 3.21
309 310 2.976509 TCGTACGATCTCGACGTAGATC 59.023 50.000 15.28 15.51 45.64 2.75
310 311 3.005341 TCGTACGATCTCGACGTAGAT 57.995 47.619 15.28 0.00 44.70 1.98
311 312 2.475200 TCGTACGATCTCGACGTAGA 57.525 50.000 15.28 0.00 44.70 2.59
312 313 3.060674 ACATTCGTACGATCTCGACGTAG 60.061 47.826 20.27 0.00 44.70 3.51
313 314 2.860136 ACATTCGTACGATCTCGACGTA 59.140 45.455 20.27 0.22 43.62 3.57
314 315 1.662629 ACATTCGTACGATCTCGACGT 59.337 47.619 20.27 0.00 45.75 4.34
315 316 2.027695 CACATTCGTACGATCTCGACG 58.972 52.381 20.27 11.39 43.02 5.12
316 317 3.027710 GACACATTCGTACGATCTCGAC 58.972 50.000 20.27 6.52 43.02 4.20
317 318 2.934553 AGACACATTCGTACGATCTCGA 59.065 45.455 20.27 3.58 43.02 4.04
318 319 3.320733 AGACACATTCGTACGATCTCG 57.679 47.619 20.27 10.89 46.33 4.04
319 320 4.968788 GGTTAGACACATTCGTACGATCTC 59.031 45.833 20.27 9.08 0.00 2.75
320 321 4.639310 AGGTTAGACACATTCGTACGATCT 59.361 41.667 20.27 19.53 0.00 2.75
321 322 4.918037 AGGTTAGACACATTCGTACGATC 58.082 43.478 20.27 13.11 0.00 3.69
322 323 4.639310 AGAGGTTAGACACATTCGTACGAT 59.361 41.667 20.27 2.90 0.00 3.73
323 324 4.005650 AGAGGTTAGACACATTCGTACGA 58.994 43.478 15.28 15.28 0.00 3.43
324 325 4.094590 AGAGAGGTTAGACACATTCGTACG 59.905 45.833 9.53 9.53 0.00 3.67
325 326 5.564048 AGAGAGGTTAGACACATTCGTAC 57.436 43.478 0.00 0.00 0.00 3.67
326 327 5.587844 GGTAGAGAGGTTAGACACATTCGTA 59.412 44.000 0.00 0.00 0.00 3.43
327 328 4.398673 GGTAGAGAGGTTAGACACATTCGT 59.601 45.833 0.00 0.00 0.00 3.85
328 329 4.202030 GGGTAGAGAGGTTAGACACATTCG 60.202 50.000 0.00 0.00 0.00 3.34
329 330 4.957327 AGGGTAGAGAGGTTAGACACATTC 59.043 45.833 0.00 0.00 0.00 2.67
330 331 4.949121 AGGGTAGAGAGGTTAGACACATT 58.051 43.478 0.00 0.00 0.00 2.71
331 332 4.611564 AGGGTAGAGAGGTTAGACACAT 57.388 45.455 0.00 0.00 0.00 3.21
332 333 5.446860 CATAGGGTAGAGAGGTTAGACACA 58.553 45.833 0.00 0.00 0.00 3.72
333 334 4.828387 CCATAGGGTAGAGAGGTTAGACAC 59.172 50.000 0.00 0.00 0.00 3.67
334 335 4.730392 TCCATAGGGTAGAGAGGTTAGACA 59.270 45.833 0.00 0.00 34.93 3.41
335 336 5.072055 GTCCATAGGGTAGAGAGGTTAGAC 58.928 50.000 0.00 0.00 34.93 2.59
336 337 4.982956 AGTCCATAGGGTAGAGAGGTTAGA 59.017 45.833 0.00 0.00 34.93 2.10
337 338 5.327737 AGTCCATAGGGTAGAGAGGTTAG 57.672 47.826 0.00 0.00 34.93 2.34
338 339 6.853669 TTAGTCCATAGGGTAGAGAGGTTA 57.146 41.667 0.00 0.00 34.93 2.85
339 340 5.745988 TTAGTCCATAGGGTAGAGAGGTT 57.254 43.478 0.00 0.00 34.93 3.50
340 341 5.456779 GTTTAGTCCATAGGGTAGAGAGGT 58.543 45.833 0.00 0.00 34.93 3.85
341 342 4.833938 GGTTTAGTCCATAGGGTAGAGAGG 59.166 50.000 0.00 0.00 34.93 3.69
342 343 4.833938 GGGTTTAGTCCATAGGGTAGAGAG 59.166 50.000 0.00 0.00 34.93 3.20
343 344 4.485021 AGGGTTTAGTCCATAGGGTAGAGA 59.515 45.833 0.00 0.00 34.93 3.10
344 345 4.817286 AGGGTTTAGTCCATAGGGTAGAG 58.183 47.826 0.00 0.00 34.93 2.43
345 346 4.690818 CGAGGGTTTAGTCCATAGGGTAGA 60.691 50.000 0.00 0.00 34.93 2.59
346 347 3.573110 CGAGGGTTTAGTCCATAGGGTAG 59.427 52.174 0.00 0.00 34.93 3.18
347 348 3.569491 CGAGGGTTTAGTCCATAGGGTA 58.431 50.000 0.00 0.00 34.93 3.69
348 349 2.395619 CGAGGGTTTAGTCCATAGGGT 58.604 52.381 0.00 0.00 34.93 4.34
349 350 1.692519 CCGAGGGTTTAGTCCATAGGG 59.307 57.143 0.00 0.00 32.04 3.53
350 351 1.070289 GCCGAGGGTTTAGTCCATAGG 59.930 57.143 0.00 0.00 37.17 2.57
351 352 2.040178 AGCCGAGGGTTTAGTCCATAG 58.960 52.381 0.00 0.00 0.00 2.23
352 353 2.170012 AGCCGAGGGTTTAGTCCATA 57.830 50.000 0.00 0.00 0.00 2.74
353 354 1.286248 AAGCCGAGGGTTTAGTCCAT 58.714 50.000 0.02 0.00 31.14 3.41
354 355 1.941377 TAAGCCGAGGGTTTAGTCCA 58.059 50.000 12.04 0.00 37.08 4.02
355 356 4.886496 ATATAAGCCGAGGGTTTAGTCC 57.114 45.455 12.04 0.00 32.29 3.85
356 357 5.105432 CCCTATATAAGCCGAGGGTTTAGTC 60.105 48.000 12.04 0.00 43.32 2.59
357 358 4.776308 CCCTATATAAGCCGAGGGTTTAGT 59.224 45.833 12.04 2.36 43.32 2.24
358 359 5.340439 CCCTATATAAGCCGAGGGTTTAG 57.660 47.826 12.04 7.86 43.32 1.85
364 365 1.749634 CGGTCCCTATATAAGCCGAGG 59.250 57.143 0.00 0.00 41.45 4.63
365 366 1.749634 CCGGTCCCTATATAAGCCGAG 59.250 57.143 12.55 3.53 41.45 4.63
366 367 1.617804 CCCGGTCCCTATATAAGCCGA 60.618 57.143 0.00 0.00 41.45 5.54
367 368 0.822164 CCCGGTCCCTATATAAGCCG 59.178 60.000 0.00 0.00 38.99 5.52
368 369 1.201424 CCCCGGTCCCTATATAAGCC 58.799 60.000 0.00 0.00 0.00 4.35
369 370 1.553704 CACCCCGGTCCCTATATAAGC 59.446 57.143 0.00 0.00 0.00 3.09
370 371 1.553704 GCACCCCGGTCCCTATATAAG 59.446 57.143 0.00 0.00 0.00 1.73
371 372 1.648116 GCACCCCGGTCCCTATATAA 58.352 55.000 0.00 0.00 0.00 0.98
372 373 0.252375 GGCACCCCGGTCCCTATATA 60.252 60.000 0.00 0.00 0.00 0.86
373 374 1.538135 GGCACCCCGGTCCCTATAT 60.538 63.158 0.00 0.00 0.00 0.86
374 375 1.370651 TAGGCACCCCGGTCCCTATA 61.371 60.000 0.00 0.00 37.49 1.31
375 376 2.674672 CTAGGCACCCCGGTCCCTAT 62.675 65.000 3.96 0.00 37.84 2.57
376 377 3.357952 TAGGCACCCCGGTCCCTA 61.358 66.667 0.00 0.00 37.49 3.53
377 378 4.798682 CTAGGCACCCCGGTCCCT 62.799 72.222 1.05 1.05 39.96 4.20
381 382 2.556608 ATAACCCTAGGCACCCCGGT 62.557 60.000 2.05 0.00 35.76 5.28
382 383 0.472352 TATAACCCTAGGCACCCCGG 60.472 60.000 2.05 0.00 35.76 5.73
383 384 1.278127 CATATAACCCTAGGCACCCCG 59.722 57.143 2.05 0.00 35.76 5.73
384 385 2.345560 ACATATAACCCTAGGCACCCC 58.654 52.381 2.05 0.00 0.00 4.95
385 386 3.518303 CCTACATATAACCCTAGGCACCC 59.482 52.174 2.05 0.00 0.00 4.61
386 387 4.820894 CCTACATATAACCCTAGGCACC 57.179 50.000 2.05 0.00 0.00 5.01
390 391 6.388619 AATTGGCCTACATATAACCCTAGG 57.611 41.667 3.32 0.06 0.00 3.02
391 392 9.975218 ATTTAATTGGCCTACATATAACCCTAG 57.025 33.333 3.32 0.00 0.00 3.02
393 394 9.749340 GTATTTAATTGGCCTACATATAACCCT 57.251 33.333 3.32 0.00 0.00 4.34
394 395 9.523168 TGTATTTAATTGGCCTACATATAACCC 57.477 33.333 3.32 0.00 0.00 4.11
399 400 9.995594 ATCCATGTATTTAATTGGCCTACATAT 57.004 29.630 3.32 0.00 32.70 1.78
401 402 9.821240 TTATCCATGTATTTAATTGGCCTACAT 57.179 29.630 3.32 4.94 34.28 2.29
402 403 9.295825 CTTATCCATGTATTTAATTGGCCTACA 57.704 33.333 3.32 2.32 0.00 2.74
403 404 9.297037 ACTTATCCATGTATTTAATTGGCCTAC 57.703 33.333 3.32 0.00 0.00 3.18
404 405 9.875708 AACTTATCCATGTATTTAATTGGCCTA 57.124 29.630 3.32 0.00 0.00 3.93
405 406 8.782137 AACTTATCCATGTATTTAATTGGCCT 57.218 30.769 3.32 0.00 0.00 5.19
406 407 9.260002 CAAACTTATCCATGTATTTAATTGGCC 57.740 33.333 0.00 0.00 0.00 5.36
407 408 8.764287 GCAAACTTATCCATGTATTTAATTGGC 58.236 33.333 0.00 0.00 0.00 4.52
408 409 9.260002 GGCAAACTTATCCATGTATTTAATTGG 57.740 33.333 0.00 0.00 0.00 3.16
409 410 8.967218 CGGCAAACTTATCCATGTATTTAATTG 58.033 33.333 0.00 0.00 0.00 2.32
410 411 8.908903 TCGGCAAACTTATCCATGTATTTAATT 58.091 29.630 0.00 0.00 0.00 1.40
411 412 8.458573 TCGGCAAACTTATCCATGTATTTAAT 57.541 30.769 0.00 0.00 0.00 1.40
412 413 7.867305 TCGGCAAACTTATCCATGTATTTAA 57.133 32.000 0.00 0.00 0.00 1.52
413 414 7.717436 TCATCGGCAAACTTATCCATGTATTTA 59.283 33.333 0.00 0.00 0.00 1.40
414 415 6.545666 TCATCGGCAAACTTATCCATGTATTT 59.454 34.615 0.00 0.00 0.00 1.40
415 416 6.061441 TCATCGGCAAACTTATCCATGTATT 58.939 36.000 0.00 0.00 0.00 1.89
416 417 5.620206 TCATCGGCAAACTTATCCATGTAT 58.380 37.500 0.00 0.00 0.00 2.29
417 418 5.029807 TCATCGGCAAACTTATCCATGTA 57.970 39.130 0.00 0.00 0.00 2.29
418 419 3.884895 TCATCGGCAAACTTATCCATGT 58.115 40.909 0.00 0.00 0.00 3.21
419 420 5.443185 AATCATCGGCAAACTTATCCATG 57.557 39.130 0.00 0.00 0.00 3.66
420 421 5.593909 TCAAATCATCGGCAAACTTATCCAT 59.406 36.000 0.00 0.00 0.00 3.41
421 422 4.946772 TCAAATCATCGGCAAACTTATCCA 59.053 37.500 0.00 0.00 0.00 3.41
422 423 5.499139 TCAAATCATCGGCAAACTTATCC 57.501 39.130 0.00 0.00 0.00 2.59
423 424 6.321717 TGTTCAAATCATCGGCAAACTTATC 58.678 36.000 0.00 0.00 0.00 1.75
424 425 6.266168 TGTTCAAATCATCGGCAAACTTAT 57.734 33.333 0.00 0.00 0.00 1.73
425 426 5.697473 TGTTCAAATCATCGGCAAACTTA 57.303 34.783 0.00 0.00 0.00 2.24
426 427 4.582701 TGTTCAAATCATCGGCAAACTT 57.417 36.364 0.00 0.00 0.00 2.66
427 428 4.022068 ACATGTTCAAATCATCGGCAAACT 60.022 37.500 0.00 0.00 0.00 2.66
428 429 4.090354 CACATGTTCAAATCATCGGCAAAC 59.910 41.667 0.00 0.00 0.00 2.93
429 430 4.236147 CACATGTTCAAATCATCGGCAAA 58.764 39.130 0.00 0.00 0.00 3.68
430 431 3.255395 ACACATGTTCAAATCATCGGCAA 59.745 39.130 0.00 0.00 0.00 4.52
431 432 2.819019 ACACATGTTCAAATCATCGGCA 59.181 40.909 0.00 0.00 0.00 5.69
432 433 3.492421 ACACATGTTCAAATCATCGGC 57.508 42.857 0.00 0.00 0.00 5.54
433 434 5.045668 TCAACACATGTTCAAATCATCGG 57.954 39.130 0.00 0.00 35.83 4.18
434 435 6.087159 CACTTCAACACATGTTCAAATCATCG 59.913 38.462 0.00 0.00 35.83 3.84
435 436 6.919662 ACACTTCAACACATGTTCAAATCATC 59.080 34.615 0.00 0.00 35.83 2.92
436 437 6.698329 CACACTTCAACACATGTTCAAATCAT 59.302 34.615 0.00 0.00 35.83 2.45
437 438 6.035217 CACACTTCAACACATGTTCAAATCA 58.965 36.000 0.00 0.00 35.83 2.57
438 439 6.264832 TCACACTTCAACACATGTTCAAATC 58.735 36.000 0.00 0.00 35.83 2.17
439 440 6.127647 ACTCACACTTCAACACATGTTCAAAT 60.128 34.615 0.00 0.00 35.83 2.32
440 441 5.182950 ACTCACACTTCAACACATGTTCAAA 59.817 36.000 0.00 0.00 35.83 2.69
441 442 4.699735 ACTCACACTTCAACACATGTTCAA 59.300 37.500 0.00 0.00 35.83 2.69
442 443 4.260985 ACTCACACTTCAACACATGTTCA 58.739 39.130 0.00 0.00 35.83 3.18
443 444 4.332543 TGACTCACACTTCAACACATGTTC 59.667 41.667 0.00 0.00 35.83 3.18
444 445 4.260985 TGACTCACACTTCAACACATGTT 58.739 39.130 0.00 0.00 39.12 2.71
445 446 3.872696 TGACTCACACTTCAACACATGT 58.127 40.909 0.00 0.00 0.00 3.21
446 447 4.880886 TTGACTCACACTTCAACACATG 57.119 40.909 0.00 0.00 0.00 3.21
447 448 4.943705 ACTTTGACTCACACTTCAACACAT 59.056 37.500 0.00 0.00 31.42 3.21
448 449 4.323417 ACTTTGACTCACACTTCAACACA 58.677 39.130 0.00 0.00 31.42 3.72
449 450 4.631813 AGACTTTGACTCACACTTCAACAC 59.368 41.667 0.00 0.00 31.42 3.32
450 451 4.832248 AGACTTTGACTCACACTTCAACA 58.168 39.130 0.00 0.00 31.42 3.33
451 452 5.447818 CCAAGACTTTGACTCACACTTCAAC 60.448 44.000 0.00 0.00 36.36 3.18
452 453 4.635765 CCAAGACTTTGACTCACACTTCAA 59.364 41.667 0.00 0.00 36.36 2.69
453 454 4.191544 CCAAGACTTTGACTCACACTTCA 58.808 43.478 0.00 0.00 36.36 3.02
454 455 3.561725 CCCAAGACTTTGACTCACACTTC 59.438 47.826 0.00 0.00 36.36 3.01
455 456 3.199946 TCCCAAGACTTTGACTCACACTT 59.800 43.478 0.00 0.00 36.36 3.16
456 457 2.771943 TCCCAAGACTTTGACTCACACT 59.228 45.455 0.00 0.00 36.36 3.55
457 458 3.134458 CTCCCAAGACTTTGACTCACAC 58.866 50.000 0.00 0.00 36.36 3.82
458 459 2.104792 CCTCCCAAGACTTTGACTCACA 59.895 50.000 0.00 0.00 36.36 3.58
459 460 2.368875 TCCTCCCAAGACTTTGACTCAC 59.631 50.000 0.00 0.00 36.36 3.51
460 461 2.689658 TCCTCCCAAGACTTTGACTCA 58.310 47.619 0.00 0.00 36.36 3.41
461 462 3.990959 ATCCTCCCAAGACTTTGACTC 57.009 47.619 0.00 0.00 36.36 3.36
462 463 4.104738 TGAAATCCTCCCAAGACTTTGACT 59.895 41.667 0.00 0.00 36.36 3.41
463 464 4.398319 TGAAATCCTCCCAAGACTTTGAC 58.602 43.478 0.00 0.00 36.36 3.18
464 465 4.722526 TGAAATCCTCCCAAGACTTTGA 57.277 40.909 0.00 0.00 36.36 2.69
465 466 5.573337 GATGAAATCCTCCCAAGACTTTG 57.427 43.478 0.00 0.00 37.38 2.77
479 480 3.063180 CCTGTCGTGCTCAAGATGAAATC 59.937 47.826 0.00 0.00 46.04 2.17
480 481 3.005554 CCTGTCGTGCTCAAGATGAAAT 58.994 45.455 0.00 0.00 0.00 2.17
481 482 2.416747 CCTGTCGTGCTCAAGATGAAA 58.583 47.619 0.00 0.00 0.00 2.69
482 483 1.338105 CCCTGTCGTGCTCAAGATGAA 60.338 52.381 0.00 0.00 0.00 2.57
483 484 0.247460 CCCTGTCGTGCTCAAGATGA 59.753 55.000 0.00 0.00 0.00 2.92
484 485 0.036952 ACCCTGTCGTGCTCAAGATG 60.037 55.000 0.00 0.00 0.00 2.90
485 486 0.247736 GACCCTGTCGTGCTCAAGAT 59.752 55.000 0.00 0.00 0.00 2.40
486 487 1.666011 GACCCTGTCGTGCTCAAGA 59.334 57.895 0.00 0.00 0.00 3.02
487 488 1.374758 GGACCCTGTCGTGCTCAAG 60.375 63.158 0.00 0.00 32.65 3.02
488 489 1.480212 ATGGACCCTGTCGTGCTCAA 61.480 55.000 0.00 0.00 32.65 3.02
489 490 1.913262 ATGGACCCTGTCGTGCTCA 60.913 57.895 0.00 0.00 32.65 4.26
490 491 1.448540 CATGGACCCTGTCGTGCTC 60.449 63.158 0.00 0.00 32.65 4.26
491 492 1.267574 ATCATGGACCCTGTCGTGCT 61.268 55.000 0.00 0.00 32.65 4.40
492 493 0.464036 TATCATGGACCCTGTCGTGC 59.536 55.000 0.00 0.00 32.65 5.34
493 494 2.936498 GTTTATCATGGACCCTGTCGTG 59.064 50.000 0.00 0.00 32.65 4.35
494 495 2.569853 TGTTTATCATGGACCCTGTCGT 59.430 45.455 0.00 0.00 32.65 4.34
495 496 3.260475 TGTTTATCATGGACCCTGTCG 57.740 47.619 0.00 0.00 32.65 4.35
506 507 6.434302 TCAAGGAATGGGTCATGTTTATCAT 58.566 36.000 0.00 0.00 37.22 2.45
507 508 5.825532 TCAAGGAATGGGTCATGTTTATCA 58.174 37.500 0.00 0.00 0.00 2.15
508 509 6.966534 ATCAAGGAATGGGTCATGTTTATC 57.033 37.500 0.00 0.00 0.00 1.75
509 510 7.586349 ACTATCAAGGAATGGGTCATGTTTAT 58.414 34.615 0.00 0.00 0.00 1.40
510 511 6.969043 ACTATCAAGGAATGGGTCATGTTTA 58.031 36.000 0.00 0.00 0.00 2.01
511 512 5.831103 ACTATCAAGGAATGGGTCATGTTT 58.169 37.500 0.00 0.00 0.00 2.83
512 513 5.440610 GACTATCAAGGAATGGGTCATGTT 58.559 41.667 0.00 0.00 0.00 2.71
513 514 4.141390 GGACTATCAAGGAATGGGTCATGT 60.141 45.833 0.00 0.00 0.00 3.21
514 515 4.392940 GGACTATCAAGGAATGGGTCATG 58.607 47.826 0.00 0.00 0.00 3.07
515 516 3.071602 CGGACTATCAAGGAATGGGTCAT 59.928 47.826 0.00 0.00 0.00 3.06
516 517 2.434336 CGGACTATCAAGGAATGGGTCA 59.566 50.000 0.00 0.00 0.00 4.02
517 518 2.224305 CCGGACTATCAAGGAATGGGTC 60.224 54.545 0.00 0.00 0.00 4.46
518 519 1.768870 CCGGACTATCAAGGAATGGGT 59.231 52.381 0.00 0.00 0.00 4.51
519 520 1.072331 CCCGGACTATCAAGGAATGGG 59.928 57.143 0.73 0.00 0.00 4.00
520 521 1.072331 CCCCGGACTATCAAGGAATGG 59.928 57.143 0.73 0.00 0.00 3.16
521 522 1.768870 ACCCCGGACTATCAAGGAATG 59.231 52.381 0.73 0.00 0.00 2.67
522 523 2.047830 GACCCCGGACTATCAAGGAAT 58.952 52.381 0.73 0.00 0.00 3.01
523 524 1.492764 GACCCCGGACTATCAAGGAA 58.507 55.000 0.73 0.00 0.00 3.36
524 525 0.398098 GGACCCCGGACTATCAAGGA 60.398 60.000 0.73 0.00 0.00 3.36
525 526 0.398664 AGGACCCCGGACTATCAAGG 60.399 60.000 0.73 0.00 0.00 3.61
526 527 1.041437 GAGGACCCCGGACTATCAAG 58.959 60.000 0.73 0.00 0.00 3.02
527 528 0.754217 CGAGGACCCCGGACTATCAA 60.754 60.000 0.73 0.00 0.00 2.57
528 529 1.152819 CGAGGACCCCGGACTATCA 60.153 63.158 0.73 0.00 0.00 2.15
529 530 3.760917 CGAGGACCCCGGACTATC 58.239 66.667 0.73 0.00 0.00 2.08
541 542 3.682644 TAATGGGTCGGGCCGAGGA 62.683 63.158 31.98 16.57 36.23 3.71
542 543 2.052047 ATTAATGGGTCGGGCCGAGG 62.052 60.000 31.98 0.00 36.23 4.63
543 544 0.179029 AATTAATGGGTCGGGCCGAG 60.179 55.000 31.98 0.00 36.23 4.63
544 545 0.464735 CAATTAATGGGTCGGGCCGA 60.465 55.000 27.46 27.46 38.44 5.54
545 546 0.750182 ACAATTAATGGGTCGGGCCG 60.750 55.000 22.51 22.51 38.44 6.13
546 547 0.744281 CACAATTAATGGGTCGGGCC 59.256 55.000 0.00 0.00 0.00 5.80
547 548 1.757682 TCACAATTAATGGGTCGGGC 58.242 50.000 0.00 0.00 32.72 6.13
548 549 3.085533 TGTTCACAATTAATGGGTCGGG 58.914 45.455 0.00 0.00 32.72 5.14
549 550 4.006989 TCTGTTCACAATTAATGGGTCGG 58.993 43.478 0.00 0.00 32.72 4.79
550 551 5.353956 TCATCTGTTCACAATTAATGGGTCG 59.646 40.000 0.00 0.00 32.72 4.79
551 552 6.757897 TCATCTGTTCACAATTAATGGGTC 57.242 37.500 0.00 0.00 32.72 4.46
552 553 6.891361 TCATCATCTGTTCACAATTAATGGGT 59.109 34.615 0.00 0.00 32.72 4.51
553 554 7.337480 TCATCATCTGTTCACAATTAATGGG 57.663 36.000 0.00 0.00 0.00 4.00
562 563 9.942850 TCTTAACTTAATCATCATCTGTTCACA 57.057 29.630 0.00 0.00 0.00 3.58
590 591 9.547279 AACTTAATCATCATCTAACCCCTTTTT 57.453 29.630 0.00 0.00 0.00 1.94
593 594 9.853177 CTTAACTTAATCATCATCTAACCCCTT 57.147 33.333 0.00 0.00 0.00 3.95
594 595 9.225682 TCTTAACTTAATCATCATCTAACCCCT 57.774 33.333 0.00 0.00 0.00 4.79
595 596 9.847224 TTCTTAACTTAATCATCATCTAACCCC 57.153 33.333 0.00 0.00 0.00 4.95
622 623 8.034804 GCTGGATGTACATAAATTCACCTTTTT 58.965 33.333 8.71 0.00 0.00 1.94
623 624 7.397192 AGCTGGATGTACATAAATTCACCTTTT 59.603 33.333 8.71 0.00 0.00 2.27
624 625 6.891908 AGCTGGATGTACATAAATTCACCTTT 59.108 34.615 8.71 0.00 0.00 3.11
625 626 6.426587 AGCTGGATGTACATAAATTCACCTT 58.573 36.000 8.71 0.00 0.00 3.50
626 627 6.006275 AGCTGGATGTACATAAATTCACCT 57.994 37.500 8.71 0.00 0.00 4.00
627 628 6.699575 AAGCTGGATGTACATAAATTCACC 57.300 37.500 8.71 4.45 0.00 4.02
628 629 8.208718 TGTAAGCTGGATGTACATAAATTCAC 57.791 34.615 8.71 3.03 0.00 3.18
629 630 8.800370 TTGTAAGCTGGATGTACATAAATTCA 57.200 30.769 8.71 2.28 0.00 2.57
633 634 9.019656 ACAATTTGTAAGCTGGATGTACATAAA 57.980 29.630 8.71 2.84 0.00 1.40
634 635 8.458052 CACAATTTGTAAGCTGGATGTACATAA 58.542 33.333 8.71 0.00 0.00 1.90
635 636 7.826744 TCACAATTTGTAAGCTGGATGTACATA 59.173 33.333 8.71 0.00 0.00 2.29
636 637 6.658816 TCACAATTTGTAAGCTGGATGTACAT 59.341 34.615 8.43 8.43 0.00 2.29
637 638 6.000840 TCACAATTTGTAAGCTGGATGTACA 58.999 36.000 0.00 0.00 0.00 2.90
638 639 6.494893 TCACAATTTGTAAGCTGGATGTAC 57.505 37.500 0.86 0.00 0.00 2.90
639 640 6.488344 TGTTCACAATTTGTAAGCTGGATGTA 59.512 34.615 0.86 0.00 0.00 2.29
640 641 5.301551 TGTTCACAATTTGTAAGCTGGATGT 59.698 36.000 0.86 0.00 0.00 3.06
641 642 5.771469 TGTTCACAATTTGTAAGCTGGATG 58.229 37.500 0.86 0.00 0.00 3.51
642 643 5.769662 TCTGTTCACAATTTGTAAGCTGGAT 59.230 36.000 0.86 0.00 0.00 3.41
643 644 5.129634 TCTGTTCACAATTTGTAAGCTGGA 58.870 37.500 0.86 0.00 0.00 3.86
644 645 5.437289 TCTGTTCACAATTTGTAAGCTGG 57.563 39.130 0.86 0.00 0.00 4.85
645 646 6.671190 TCATCTGTTCACAATTTGTAAGCTG 58.329 36.000 0.86 0.00 0.00 4.24
646 647 6.882610 TCATCTGTTCACAATTTGTAAGCT 57.117 33.333 0.86 0.00 0.00 3.74
647 648 7.062605 CCATTCATCTGTTCACAATTTGTAAGC 59.937 37.037 0.86 0.00 0.00 3.09
648 649 8.298854 TCCATTCATCTGTTCACAATTTGTAAG 58.701 33.333 0.86 0.00 0.00 2.34
649 650 8.175925 TCCATTCATCTGTTCACAATTTGTAA 57.824 30.769 0.86 0.00 0.00 2.41
650 651 7.757941 TCCATTCATCTGTTCACAATTTGTA 57.242 32.000 0.86 0.00 0.00 2.41
651 652 6.653526 TCCATTCATCTGTTCACAATTTGT 57.346 33.333 0.00 0.00 0.00 2.83
652 653 8.464404 AGTATCCATTCATCTGTTCACAATTTG 58.536 33.333 0.00 0.00 0.00 2.32
653 654 8.585471 AGTATCCATTCATCTGTTCACAATTT 57.415 30.769 0.00 0.00 0.00 1.82
654 655 9.334947 CTAGTATCCATTCATCTGTTCACAATT 57.665 33.333 0.00 0.00 0.00 2.32
655 656 8.708378 TCTAGTATCCATTCATCTGTTCACAAT 58.292 33.333 0.00 0.00 0.00 2.71
656 657 8.078060 TCTAGTATCCATTCATCTGTTCACAA 57.922 34.615 0.00 0.00 0.00 3.33
657 658 7.660030 TCTAGTATCCATTCATCTGTTCACA 57.340 36.000 0.00 0.00 0.00 3.58
658 659 9.553064 AATTCTAGTATCCATTCATCTGTTCAC 57.447 33.333 0.00 0.00 0.00 3.18
659 660 9.551734 CAATTCTAGTATCCATTCATCTGTTCA 57.448 33.333 0.00 0.00 0.00 3.18
660 661 9.553064 ACAATTCTAGTATCCATTCATCTGTTC 57.447 33.333 0.00 0.00 0.00 3.18
683 684 9.505995 CGTGAATCATTTCATTTCATCATACAA 57.494 29.630 0.00 0.00 43.49 2.41
684 685 8.676401 ACGTGAATCATTTCATTTCATCATACA 58.324 29.630 0.00 0.00 43.49 2.29
685 686 8.950961 CACGTGAATCATTTCATTTCATCATAC 58.049 33.333 10.90 0.00 43.49 2.39
686 687 8.676401 ACACGTGAATCATTTCATTTCATCATA 58.324 29.630 25.01 0.00 43.49 2.15
687 688 7.486870 CACACGTGAATCATTTCATTTCATCAT 59.513 33.333 25.01 0.00 43.49 2.45
688 689 6.802834 CACACGTGAATCATTTCATTTCATCA 59.197 34.615 25.01 0.00 43.49 3.07
689 690 6.252015 CCACACGTGAATCATTTCATTTCATC 59.748 38.462 25.01 0.00 43.49 2.92
690 691 6.094719 CCACACGTGAATCATTTCATTTCAT 58.905 36.000 25.01 0.00 43.49 2.57
691 692 5.009510 ACCACACGTGAATCATTTCATTTCA 59.990 36.000 25.01 0.00 43.49 2.69
692 693 5.460646 ACCACACGTGAATCATTTCATTTC 58.539 37.500 25.01 0.00 43.49 2.17
693 694 5.452078 ACCACACGTGAATCATTTCATTT 57.548 34.783 25.01 0.00 43.49 2.32
694 695 5.452078 AACCACACGTGAATCATTTCATT 57.548 34.783 25.01 0.00 43.49 2.57
695 696 4.082787 GGAACCACACGTGAATCATTTCAT 60.083 41.667 25.01 0.00 43.49 2.57
696 697 3.252215 GGAACCACACGTGAATCATTTCA 59.748 43.478 25.01 0.00 39.54 2.69
697 698 3.502211 AGGAACCACACGTGAATCATTTC 59.498 43.478 25.01 14.05 0.00 2.17
698 699 3.486383 AGGAACCACACGTGAATCATTT 58.514 40.909 25.01 5.95 0.00 2.32
699 700 3.140325 AGGAACCACACGTGAATCATT 57.860 42.857 25.01 8.69 0.00 2.57
700 701 2.859165 AGGAACCACACGTGAATCAT 57.141 45.000 25.01 9.10 0.00 2.45
701 702 2.616376 CAAAGGAACCACACGTGAATCA 59.384 45.455 25.01 0.00 0.00 2.57
702 703 2.616842 ACAAAGGAACCACACGTGAATC 59.383 45.455 25.01 13.50 0.00 2.52
703 704 2.616842 GACAAAGGAACCACACGTGAAT 59.383 45.455 25.01 3.61 0.00 2.57
704 705 2.011222 GACAAAGGAACCACACGTGAA 58.989 47.619 25.01 0.00 0.00 3.18
705 706 1.658994 GACAAAGGAACCACACGTGA 58.341 50.000 25.01 0.00 0.00 4.35
706 707 0.303493 CGACAAAGGAACCACACGTG 59.697 55.000 15.48 15.48 0.00 4.49
707 708 0.812412 CCGACAAAGGAACCACACGT 60.812 55.000 0.00 0.00 0.00 4.49
708 709 0.531090 TCCGACAAAGGAACCACACG 60.531 55.000 0.00 0.00 37.36 4.49
709 710 0.942252 GTCCGACAAAGGAACCACAC 59.058 55.000 0.00 0.00 42.77 3.82
710 711 0.531090 CGTCCGACAAAGGAACCACA 60.531 55.000 0.00 0.00 42.77 4.17
711 712 1.226030 CCGTCCGACAAAGGAACCAC 61.226 60.000 0.00 0.00 42.77 4.16
712 713 1.070105 CCGTCCGACAAAGGAACCA 59.930 57.895 0.00 0.00 42.77 3.67
713 714 2.322830 GCCGTCCGACAAAGGAACC 61.323 63.158 0.00 0.00 42.77 3.62
714 715 2.664436 CGCCGTCCGACAAAGGAAC 61.664 63.158 0.00 0.00 42.77 3.62
715 716 2.356553 CGCCGTCCGACAAAGGAA 60.357 61.111 0.00 0.00 42.77 3.36
718 719 3.295228 CTTGCGCCGTCCGACAAAG 62.295 63.158 4.18 0.00 40.02 2.77
719 720 3.342627 CTTGCGCCGTCCGACAAA 61.343 61.111 4.18 0.00 40.02 2.83
725 726 4.389576 CAACTGCTTGCGCCGTCC 62.390 66.667 4.18 0.00 32.08 4.79
726 727 3.300667 CTCAACTGCTTGCGCCGTC 62.301 63.158 4.18 0.00 32.08 4.79
727 728 3.349006 CTCAACTGCTTGCGCCGT 61.349 61.111 4.18 0.00 34.92 5.68
728 729 4.093952 CCTCAACTGCTTGCGCCG 62.094 66.667 4.18 0.00 34.43 6.46
729 730 2.980233 ACCTCAACTGCTTGCGCC 60.980 61.111 4.18 0.00 34.43 6.53
730 731 2.253452 CACCTCAACTGCTTGCGC 59.747 61.111 0.00 0.00 0.00 6.09
731 732 2.620112 CCCACCTCAACTGCTTGCG 61.620 63.158 0.00 0.00 0.00 4.85
732 733 0.250727 TACCCACCTCAACTGCTTGC 60.251 55.000 0.00 0.00 0.00 4.01
733 734 2.270352 TTACCCACCTCAACTGCTTG 57.730 50.000 0.00 0.00 0.00 4.01
734 735 4.650972 TTATTACCCACCTCAACTGCTT 57.349 40.909 0.00 0.00 0.00 3.91
735 736 4.650972 TTTATTACCCACCTCAACTGCT 57.349 40.909 0.00 0.00 0.00 4.24
736 737 4.379082 CGTTTTATTACCCACCTCAACTGC 60.379 45.833 0.00 0.00 0.00 4.40
737 738 4.998672 TCGTTTTATTACCCACCTCAACTG 59.001 41.667 0.00 0.00 0.00 3.16
738 739 5.231702 TCGTTTTATTACCCACCTCAACT 57.768 39.130 0.00 0.00 0.00 3.16
739 740 4.393990 CCTCGTTTTATTACCCACCTCAAC 59.606 45.833 0.00 0.00 0.00 3.18
740 741 4.286549 TCCTCGTTTTATTACCCACCTCAA 59.713 41.667 0.00 0.00 0.00 3.02
741 742 3.839490 TCCTCGTTTTATTACCCACCTCA 59.161 43.478 0.00 0.00 0.00 3.86
742 743 4.186926 GTCCTCGTTTTATTACCCACCTC 58.813 47.826 0.00 0.00 0.00 3.85
743 744 3.368739 CGTCCTCGTTTTATTACCCACCT 60.369 47.826 0.00 0.00 0.00 4.00
744 745 2.931969 CGTCCTCGTTTTATTACCCACC 59.068 50.000 0.00 0.00 0.00 4.61
745 746 3.614176 GTCGTCCTCGTTTTATTACCCAC 59.386 47.826 0.00 0.00 38.33 4.61
746 747 3.257873 TGTCGTCCTCGTTTTATTACCCA 59.742 43.478 0.00 0.00 38.33 4.51
747 748 3.848726 TGTCGTCCTCGTTTTATTACCC 58.151 45.455 0.00 0.00 38.33 3.69
748 749 3.305361 GCTGTCGTCCTCGTTTTATTACC 59.695 47.826 0.00 0.00 38.33 2.85
749 750 3.305361 GGCTGTCGTCCTCGTTTTATTAC 59.695 47.826 0.00 0.00 38.33 1.89
750 751 3.514645 GGCTGTCGTCCTCGTTTTATTA 58.485 45.455 0.00 0.00 38.33 0.98
751 752 2.344025 GGCTGTCGTCCTCGTTTTATT 58.656 47.619 0.00 0.00 38.33 1.40
752 753 1.405121 GGGCTGTCGTCCTCGTTTTAT 60.405 52.381 0.00 0.00 38.33 1.40
753 754 0.037975 GGGCTGTCGTCCTCGTTTTA 60.038 55.000 0.00 0.00 38.33 1.52
754 755 1.301479 GGGCTGTCGTCCTCGTTTT 60.301 57.895 0.00 0.00 38.33 2.43
755 756 2.035237 TTGGGCTGTCGTCCTCGTTT 62.035 55.000 0.00 0.00 35.36 3.60
756 757 2.436087 CTTGGGCTGTCGTCCTCGTT 62.436 60.000 0.00 0.00 35.36 3.85
757 758 2.915659 TTGGGCTGTCGTCCTCGT 60.916 61.111 0.00 0.00 35.36 4.18
758 759 2.125912 CTTGGGCTGTCGTCCTCG 60.126 66.667 0.00 0.00 35.36 4.63
759 760 2.435059 GCTTGGGCTGTCGTCCTC 60.435 66.667 0.00 0.00 35.36 3.71
760 761 4.021925 GGCTTGGGCTGTCGTCCT 62.022 66.667 0.00 0.00 35.36 3.85
784 785 4.729918 GTCCCACCAGCCTGCCTG 62.730 72.222 0.00 0.00 41.41 4.85
808 809 4.360405 AACATGGGGGTGGCCGAC 62.360 66.667 0.00 0.00 0.00 4.79
809 810 4.041762 GAACATGGGGGTGGCCGA 62.042 66.667 0.00 0.00 0.00 5.54
812 813 3.879180 AACCGAACATGGGGGTGGC 62.879 63.158 5.50 0.00 33.47 5.01
813 814 1.976474 CAACCGAACATGGGGGTGG 60.976 63.158 9.26 1.76 37.37 4.61
814 815 2.635443 GCAACCGAACATGGGGGTG 61.635 63.158 12.03 12.03 44.05 4.61
815 816 2.282887 GCAACCGAACATGGGGGT 60.283 61.111 0.00 0.00 34.99 4.95
816 817 3.068064 GGCAACCGAACATGGGGG 61.068 66.667 0.00 0.00 0.00 5.40
817 818 2.282816 TGGCAACCGAACATGGGG 60.283 61.111 0.00 0.00 0.00 4.96
818 819 1.178534 AACTGGCAACCGAACATGGG 61.179 55.000 0.00 0.00 0.00 4.00
819 820 0.039256 CAACTGGCAACCGAACATGG 60.039 55.000 0.00 0.00 0.00 3.66
820 821 0.664166 GCAACTGGCAACCGAACATG 60.664 55.000 0.00 0.00 43.97 3.21
821 822 1.659794 GCAACTGGCAACCGAACAT 59.340 52.632 0.00 0.00 43.97 2.71
822 823 3.115556 GCAACTGGCAACCGAACA 58.884 55.556 0.00 0.00 43.97 3.18
838 839 1.140375 GCATAGCAAAGCAGGTGGC 59.860 57.895 0.00 0.00 45.30 5.01
839 840 1.672881 GTAGCATAGCAAAGCAGGTGG 59.327 52.381 0.00 0.00 0.00 4.61
840 841 1.328680 CGTAGCATAGCAAAGCAGGTG 59.671 52.381 0.00 0.00 0.00 4.00
841 842 1.656652 CGTAGCATAGCAAAGCAGGT 58.343 50.000 0.00 0.00 0.00 4.00
879 880 4.435970 GGTTAGGGTTGGGCCGGG 62.436 72.222 2.18 0.00 38.44 5.73
880 881 4.435970 GGGTTAGGGTTGGGCCGG 62.436 72.222 0.00 0.00 38.44 6.13
881 882 4.789123 CGGGTTAGGGTTGGGCCG 62.789 72.222 0.00 0.00 38.44 6.13
882 883 4.435970 CCGGGTTAGGGTTGGGCC 62.436 72.222 0.00 0.00 0.00 5.80
884 885 3.638592 CTGCCGGGTTAGGGTTGGG 62.639 68.421 2.18 0.00 0.00 4.12
885 886 2.045340 CTGCCGGGTTAGGGTTGG 60.045 66.667 2.18 0.00 0.00 3.77
886 887 2.045340 CCTGCCGGGTTAGGGTTG 60.045 66.667 2.18 0.00 0.00 3.77
887 888 4.043100 GCCTGCCGGGTTAGGGTT 62.043 66.667 17.46 0.00 37.43 4.11
889 890 4.796495 GTGCCTGCCGGGTTAGGG 62.796 72.222 17.46 6.90 37.43 3.53
890 891 4.796495 GGTGCCTGCCGGGTTAGG 62.796 72.222 2.18 13.22 37.43 2.69
911 912 3.898509 CTCTCCCTCTGCGAGCCG 61.899 72.222 0.00 0.00 0.00 5.52
912 913 2.441164 TCTCTCCCTCTGCGAGCC 60.441 66.667 0.00 0.00 0.00 4.70
913 914 1.034838 TTCTCTCTCCCTCTGCGAGC 61.035 60.000 0.00 0.00 0.00 5.03
914 915 1.405105 CTTTCTCTCTCCCTCTGCGAG 59.595 57.143 0.00 0.00 0.00 5.03
915 916 1.004862 TCTTTCTCTCTCCCTCTGCGA 59.995 52.381 0.00 0.00 0.00 5.10
916 917 1.405105 CTCTTTCTCTCTCCCTCTGCG 59.595 57.143 0.00 0.00 0.00 5.18
917 918 1.756538 CCTCTTTCTCTCTCCCTCTGC 59.243 57.143 0.00 0.00 0.00 4.26
918 919 2.387757 CCCTCTTTCTCTCTCCCTCTG 58.612 57.143 0.00 0.00 0.00 3.35
923 924 1.681486 CGCCCCCTCTTTCTCTCTCC 61.681 65.000 0.00 0.00 0.00 3.71
960 961 0.400594 CCTTCCTTCCTTCCGTTGGT 59.599 55.000 0.00 0.00 0.00 3.67
961 962 0.322546 CCCTTCCTTCCTTCCGTTGG 60.323 60.000 0.00 0.00 0.00 3.77
963 964 0.984995 CTCCCTTCCTTCCTTCCGTT 59.015 55.000 0.00 0.00 0.00 4.44
964 965 1.554583 GCTCCCTTCCTTCCTTCCGT 61.555 60.000 0.00 0.00 0.00 4.69
967 968 1.222113 CCGCTCCCTTCCTTCCTTC 59.778 63.158 0.00 0.00 0.00 3.46
968 969 2.972819 GCCGCTCCCTTCCTTCCTT 61.973 63.158 0.00 0.00 0.00 3.36
970 971 4.840005 CGCCGCTCCCTTCCTTCC 62.840 72.222 0.00 0.00 0.00 3.46
992 993 4.100084 TCTGTGCCATGGCTCCGG 62.100 66.667 35.53 28.23 42.51 5.14
993 994 2.513204 CTCTGTGCCATGGCTCCG 60.513 66.667 35.53 27.48 42.51 4.63
994 995 2.124403 CCTCTGTGCCATGGCTCC 60.124 66.667 35.53 25.60 42.51 4.70
995 996 1.153208 CTCCTCTGTGCCATGGCTC 60.153 63.158 35.53 31.63 42.51 4.70
1058 1062 1.006813 AGAGAGGAAGCAGAGGAGGA 58.993 55.000 0.00 0.00 0.00 3.71
1063 1067 3.118112 AGAGAGAGAGAGAGGAAGCAGAG 60.118 52.174 0.00 0.00 0.00 3.35
1064 1068 2.846206 AGAGAGAGAGAGAGGAAGCAGA 59.154 50.000 0.00 0.00 0.00 4.26
1067 1071 3.135530 AGAGAGAGAGAGAGAGAGGAAGC 59.864 52.174 0.00 0.00 0.00 3.86
1068 1072 5.600484 ACTAGAGAGAGAGAGAGAGAGGAAG 59.400 48.000 0.00 0.00 0.00 3.46
1069 1073 5.529289 ACTAGAGAGAGAGAGAGAGAGGAA 58.471 45.833 0.00 0.00 0.00 3.36
1070 1074 5.144159 ACTAGAGAGAGAGAGAGAGAGGA 57.856 47.826 0.00 0.00 0.00 3.71
1071 1075 5.363868 TGAACTAGAGAGAGAGAGAGAGAGG 59.636 48.000 0.00 0.00 0.00 3.69
1072 1076 6.471233 TGAACTAGAGAGAGAGAGAGAGAG 57.529 45.833 0.00 0.00 0.00 3.20
1073 1077 8.588472 CATATGAACTAGAGAGAGAGAGAGAGA 58.412 40.741 0.00 0.00 0.00 3.10
1074 1078 7.821359 CCATATGAACTAGAGAGAGAGAGAGAG 59.179 44.444 3.65 0.00 0.00 3.20
1075 1079 7.512402 TCCATATGAACTAGAGAGAGAGAGAGA 59.488 40.741 3.65 0.00 0.00 3.10
1076 1080 7.679783 TCCATATGAACTAGAGAGAGAGAGAG 58.320 42.308 3.65 0.00 0.00 3.20
1077 1081 7.625498 TCCATATGAACTAGAGAGAGAGAGA 57.375 40.000 3.65 0.00 0.00 3.10
1078 1082 8.868522 ATTCCATATGAACTAGAGAGAGAGAG 57.131 38.462 3.65 0.00 35.31 3.20
1079 1083 7.606073 CGATTCCATATGAACTAGAGAGAGAGA 59.394 40.741 3.65 0.00 35.31 3.10
1080 1084 7.606073 TCGATTCCATATGAACTAGAGAGAGAG 59.394 40.741 3.65 0.00 35.31 3.20
1084 1088 7.696035 CGATTCGATTCCATATGAACTAGAGAG 59.304 40.741 3.65 0.00 35.31 3.20
1095 1099 7.545615 TCGATTTGATTCGATTCGATTCCATAT 59.454 33.333 21.63 14.31 42.81 1.78
1099 1103 5.576337 TCGATTTGATTCGATTCGATTCC 57.424 39.130 21.63 10.66 42.81 3.01
1128 1132 6.014669 CCCCCAAAATTGAATTGAACTCAGTA 60.015 38.462 0.00 0.00 0.00 2.74
1130 1134 5.011943 TCCCCCAAAATTGAATTGAACTCAG 59.988 40.000 0.00 0.00 0.00 3.35
1164 1168 1.496429 AGCCTACAATCCCCAATCAGG 59.504 52.381 0.00 0.00 37.03 3.86
1165 1169 2.579873 CAGCCTACAATCCCCAATCAG 58.420 52.381 0.00 0.00 0.00 2.90
1168 1172 1.215423 GTCCAGCCTACAATCCCCAAT 59.785 52.381 0.00 0.00 0.00 3.16
1169 1173 0.623723 GTCCAGCCTACAATCCCCAA 59.376 55.000 0.00 0.00 0.00 4.12
1179 1203 2.139323 AGATGTACACGTCCAGCCTA 57.861 50.000 0.00 0.00 32.40 3.93
1200 1224 1.075542 TGCGCTTCACCAAGTAATCG 58.924 50.000 9.73 0.00 31.45 3.34
1285 1309 4.437390 GGGAACAAGATAGAAACATGCGTG 60.437 45.833 3.82 3.82 0.00 5.34
1286 1310 3.689649 GGGAACAAGATAGAAACATGCGT 59.310 43.478 0.00 0.00 0.00 5.24
1287 1311 3.065371 GGGGAACAAGATAGAAACATGCG 59.935 47.826 0.00 0.00 0.00 4.73
1288 1312 4.273318 AGGGGAACAAGATAGAAACATGC 58.727 43.478 0.00 0.00 0.00 4.06
1289 1313 5.358160 GGAAGGGGAACAAGATAGAAACATG 59.642 44.000 0.00 0.00 0.00 3.21
1291 1315 4.263771 GGGAAGGGGAACAAGATAGAAACA 60.264 45.833 0.00 0.00 0.00 2.83
1292 1316 4.270834 GGGAAGGGGAACAAGATAGAAAC 58.729 47.826 0.00 0.00 0.00 2.78
1295 1319 2.047296 AGGGGAAGGGGAACAAGATAGA 59.953 50.000 0.00 0.00 0.00 1.98
1296 1320 2.493091 AGGGGAAGGGGAACAAGATAG 58.507 52.381 0.00 0.00 0.00 2.08
1298 1322 1.773541 AAGGGGAAGGGGAACAAGAT 58.226 50.000 0.00 0.00 0.00 2.40
1299 1323 1.427753 GAAAGGGGAAGGGGAACAAGA 59.572 52.381 0.00 0.00 0.00 3.02
1301 1325 1.146982 CAGAAAGGGGAAGGGGAACAA 59.853 52.381 0.00 0.00 0.00 2.83
1302 1326 0.777446 CAGAAAGGGGAAGGGGAACA 59.223 55.000 0.00 0.00 0.00 3.18
1303 1327 1.004862 CTCAGAAAGGGGAAGGGGAAC 59.995 57.143 0.00 0.00 0.00 3.62
1320 1344 3.368501 CCCTCCCTCCCTCCCTCA 61.369 72.222 0.00 0.00 0.00 3.86
1323 1347 3.036959 TCTCCCTCCCTCCCTCCC 61.037 72.222 0.00 0.00 0.00 4.30
1329 1353 1.047801 GCATCTTCTCTCCCTCCCTC 58.952 60.000 0.00 0.00 0.00 4.30
1330 1354 0.341258 TGCATCTTCTCTCCCTCCCT 59.659 55.000 0.00 0.00 0.00 4.20
1331 1355 1.347378 GATGCATCTTCTCTCCCTCCC 59.653 57.143 19.70 0.00 0.00 4.30
1332 1356 2.328319 AGATGCATCTTCTCTCCCTCC 58.672 52.381 23.75 0.00 31.97 4.30
1343 1367 6.606796 TCACTAGAGAAGAAGAAGATGCATCT 59.393 38.462 23.75 23.75 39.22 2.90
1362 1386 4.988029 AGCTATACTACTGGGGTCACTAG 58.012 47.826 0.00 0.00 0.00 2.57
1363 1387 5.514484 GCTAGCTATACTACTGGGGTCACTA 60.514 48.000 7.70 0.00 0.00 2.74
1364 1388 3.975479 AGCTATACTACTGGGGTCACT 57.025 47.619 0.00 0.00 0.00 3.41
1365 1389 3.506844 GCTAGCTATACTACTGGGGTCAC 59.493 52.174 7.70 0.00 0.00 3.67
1366 1390 3.398292 AGCTAGCTATACTACTGGGGTCA 59.602 47.826 17.69 0.00 0.00 4.02
1367 1391 4.036941 AGCTAGCTATACTACTGGGGTC 57.963 50.000 17.69 0.00 0.00 4.46
1368 1392 5.595814 TTAGCTAGCTATACTACTGGGGT 57.404 43.478 24.69 0.00 0.00 4.95
1406 1522 9.981460 TGGTTTGAGCATCTATCTATCTATCTA 57.019 33.333 0.00 0.00 34.92 1.98
1407 1523 8.891985 TGGTTTGAGCATCTATCTATCTATCT 57.108 34.615 0.00 0.00 34.92 1.98
1410 1526 8.535335 GGATTGGTTTGAGCATCTATCTATCTA 58.465 37.037 0.00 0.00 34.92 1.98
1411 1527 7.393216 GGATTGGTTTGAGCATCTATCTATCT 58.607 38.462 0.00 0.00 34.92 1.98
1412 1528 6.597280 GGGATTGGTTTGAGCATCTATCTATC 59.403 42.308 0.00 0.00 34.92 2.08
1426 1542 3.615224 CCAATGAAGGGGATTGGTTTG 57.385 47.619 0.00 0.00 43.40 2.93
1440 1556 3.116939 TCTGTTTTCCTTTCCCCCAATGA 60.117 43.478 0.00 0.00 0.00 2.57
1442 1558 3.239449 GTCTGTTTTCCTTTCCCCCAAT 58.761 45.455 0.00 0.00 0.00 3.16
1446 1562 2.661718 TGTGTCTGTTTTCCTTTCCCC 58.338 47.619 0.00 0.00 0.00 4.81
1450 1567 6.073276 GCTTGTTTTTGTGTCTGTTTTCCTTT 60.073 34.615 0.00 0.00 0.00 3.11
1471 1592 8.131100 CACATCTATAAATGGTTACCTTGCTTG 58.869 37.037 2.07 0.00 0.00 4.01
1475 1596 7.566760 TGCACATCTATAAATGGTTACCTTG 57.433 36.000 2.07 0.00 0.00 3.61
1492 1613 1.540797 GCAGAGAGGGAGATGCACATC 60.541 57.143 2.28 2.28 38.54 3.06
1493 1614 0.469070 GCAGAGAGGGAGATGCACAT 59.531 55.000 0.00 0.00 38.54 3.21
1495 1616 1.145819 GGCAGAGAGGGAGATGCAC 59.854 63.158 0.00 0.00 40.46 4.57
1496 1617 1.002662 AGGCAGAGAGGGAGATGCA 59.997 57.895 0.00 0.00 40.46 3.96
1497 1618 1.336632 ACAGGCAGAGAGGGAGATGC 61.337 60.000 0.00 0.00 37.95 3.91
1498 1619 0.464870 CACAGGCAGAGAGGGAGATG 59.535 60.000 0.00 0.00 0.00 2.90
1499 1620 0.042431 ACACAGGCAGAGAGGGAGAT 59.958 55.000 0.00 0.00 0.00 2.75
1500 1621 0.902048 CACACAGGCAGAGAGGGAGA 60.902 60.000 0.00 0.00 0.00 3.71
1501 1622 1.190833 ACACACAGGCAGAGAGGGAG 61.191 60.000 0.00 0.00 0.00 4.30
1502 1623 0.764369 AACACACAGGCAGAGAGGGA 60.764 55.000 0.00 0.00 0.00 4.20
1503 1624 0.109342 AAACACACAGGCAGAGAGGG 59.891 55.000 0.00 0.00 0.00 4.30
1504 1625 1.876156 GAAAACACACAGGCAGAGAGG 59.124 52.381 0.00 0.00 0.00 3.69
1505 1626 2.843701 AGAAAACACACAGGCAGAGAG 58.156 47.619 0.00 0.00 0.00 3.20
1506 1627 3.281727 AAGAAAACACACAGGCAGAGA 57.718 42.857 0.00 0.00 0.00 3.10
1507 1628 3.243201 GGAAAGAAAACACACAGGCAGAG 60.243 47.826 0.00 0.00 0.00 3.35
1508 1629 2.687935 GGAAAGAAAACACACAGGCAGA 59.312 45.455 0.00 0.00 0.00 4.26
1510 1631 1.754226 GGGAAAGAAAACACACAGGCA 59.246 47.619 0.00 0.00 0.00 4.75
1511 1632 1.068588 GGGGAAAGAAAACACACAGGC 59.931 52.381 0.00 0.00 0.00 4.85
1513 1634 2.383855 TGGGGGAAAGAAAACACACAG 58.616 47.619 0.00 0.00 0.00 3.66
1514 1635 2.534042 TGGGGGAAAGAAAACACACA 57.466 45.000 0.00 0.00 0.00 3.72
1517 1638 1.070134 GGCTTGGGGGAAAGAAAACAC 59.930 52.381 0.00 0.00 0.00 3.32
1518 1639 1.343478 TGGCTTGGGGGAAAGAAAACA 60.343 47.619 0.00 0.00 0.00 2.83
1520 1641 1.062505 AGTGGCTTGGGGGAAAGAAAA 60.063 47.619 0.00 0.00 0.00 2.29
1521 1642 0.560688 AGTGGCTTGGGGGAAAGAAA 59.439 50.000 0.00 0.00 0.00 2.52
1523 1644 1.065410 TGAGTGGCTTGGGGGAAAGA 61.065 55.000 0.00 0.00 0.00 2.52
1524 1645 0.895559 GTGAGTGGCTTGGGGGAAAG 60.896 60.000 0.00 0.00 0.00 2.62
1525 1646 1.152830 GTGAGTGGCTTGGGGGAAA 59.847 57.895 0.00 0.00 0.00 3.13
1526 1647 2.840753 GGTGAGTGGCTTGGGGGAA 61.841 63.158 0.00 0.00 0.00 3.97
1527 1648 3.256960 GGTGAGTGGCTTGGGGGA 61.257 66.667 0.00 0.00 0.00 4.81
1536 1657 1.401552 CTGTTGTGTTGTGGTGAGTGG 59.598 52.381 0.00 0.00 0.00 4.00
1544 1665 7.763985 TGGACATAGTATATCTGTTGTGTTGTG 59.236 37.037 0.00 0.00 0.00 3.33
1558 1679 9.832445 GAGGAAAGAAAACATGGACATAGTATA 57.168 33.333 0.00 0.00 0.00 1.47
1559 1680 8.552296 AGAGGAAAGAAAACATGGACATAGTAT 58.448 33.333 0.00 0.00 0.00 2.12
1560 1681 7.918076 AGAGGAAAGAAAACATGGACATAGTA 58.082 34.615 0.00 0.00 0.00 1.82
1561 1682 6.784031 AGAGGAAAGAAAACATGGACATAGT 58.216 36.000 0.00 0.00 0.00 2.12
1562 1683 6.881065 TGAGAGGAAAGAAAACATGGACATAG 59.119 38.462 0.00 0.00 0.00 2.23
1565 1686 4.821805 GTGAGAGGAAAGAAAACATGGACA 59.178 41.667 0.00 0.00 0.00 4.02
1568 1689 4.022849 GTGGTGAGAGGAAAGAAAACATGG 60.023 45.833 0.00 0.00 0.00 3.66
1572 1693 3.315470 GGTGTGGTGAGAGGAAAGAAAAC 59.685 47.826 0.00 0.00 0.00 2.43
1584 1705 2.431683 CTGGGGTGGTGTGGTGAG 59.568 66.667 0.00 0.00 0.00 3.51
1585 1706 3.174987 CCTGGGGTGGTGTGGTGA 61.175 66.667 0.00 0.00 0.00 4.02
1598 1719 3.815407 AAACACCTGCCCTGCCTGG 62.815 63.158 0.00 0.00 0.00 4.45
1599 1720 1.833934 AAAACACCTGCCCTGCCTG 60.834 57.895 0.00 0.00 0.00 4.85
1600 1721 1.833934 CAAAACACCTGCCCTGCCT 60.834 57.895 0.00 0.00 0.00 4.75
1601 1722 2.736531 CAAAACACCTGCCCTGCC 59.263 61.111 0.00 0.00 0.00 4.85
1602 1723 1.685355 AACCAAAACACCTGCCCTGC 61.685 55.000 0.00 0.00 0.00 4.85
1603 1724 0.104671 CAACCAAAACACCTGCCCTG 59.895 55.000 0.00 0.00 0.00 4.45
1604 1725 1.048160 CCAACCAAAACACCTGCCCT 61.048 55.000 0.00 0.00 0.00 5.19
1605 1726 1.334384 ACCAACCAAAACACCTGCCC 61.334 55.000 0.00 0.00 0.00 5.36
1606 1727 0.179086 CACCAACCAAAACACCTGCC 60.179 55.000 0.00 0.00 0.00 4.85
1607 1728 0.534873 ACACCAACCAAAACACCTGC 59.465 50.000 0.00 0.00 0.00 4.85
1608 1729 1.821753 TCACACCAACCAAAACACCTG 59.178 47.619 0.00 0.00 0.00 4.00
1610 1731 3.535280 ATTCACACCAACCAAAACACC 57.465 42.857 0.00 0.00 0.00 4.16
1611 1732 5.391416 CCAAAATTCACACCAACCAAAACAC 60.391 40.000 0.00 0.00 0.00 3.32
1612 1733 4.697352 CCAAAATTCACACCAACCAAAACA 59.303 37.500 0.00 0.00 0.00 2.83
1613 1734 4.095632 CCCAAAATTCACACCAACCAAAAC 59.904 41.667 0.00 0.00 0.00 2.43
1614 1735 4.263506 ACCCAAAATTCACACCAACCAAAA 60.264 37.500 0.00 0.00 0.00 2.44
1615 1736 3.264450 ACCCAAAATTCACACCAACCAAA 59.736 39.130 0.00 0.00 0.00 3.28
1616 1737 2.840651 ACCCAAAATTCACACCAACCAA 59.159 40.909 0.00 0.00 0.00 3.67
1617 1738 2.472029 ACCCAAAATTCACACCAACCA 58.528 42.857 0.00 0.00 0.00 3.67
1618 1739 3.202097 CAACCCAAAATTCACACCAACC 58.798 45.455 0.00 0.00 0.00 3.77
1619 1740 3.202097 CCAACCCAAAATTCACACCAAC 58.798 45.455 0.00 0.00 0.00 3.77
1620 1741 2.171448 CCCAACCCAAAATTCACACCAA 59.829 45.455 0.00 0.00 0.00 3.67
1621 1742 1.765314 CCCAACCCAAAATTCACACCA 59.235 47.619 0.00 0.00 0.00 4.17
1622 1743 1.765904 ACCCAACCCAAAATTCACACC 59.234 47.619 0.00 0.00 0.00 4.16
1623 1744 2.484594 CCACCCAACCCAAAATTCACAC 60.485 50.000 0.00 0.00 0.00 3.82
1624 1745 1.765314 CCACCCAACCCAAAATTCACA 59.235 47.619 0.00 0.00 0.00 3.58
1625 1746 1.542328 GCCACCCAACCCAAAATTCAC 60.542 52.381 0.00 0.00 0.00 3.18
1626 1747 0.761802 GCCACCCAACCCAAAATTCA 59.238 50.000 0.00 0.00 0.00 2.57
1627 1748 0.036164 GGCCACCCAACCCAAAATTC 59.964 55.000 0.00 0.00 0.00 2.17
1628 1749 0.401250 AGGCCACCCAACCCAAAATT 60.401 50.000 5.01 0.00 0.00 1.82
1629 1750 1.126948 CAGGCCACCCAACCCAAAAT 61.127 55.000 5.01 0.00 0.00 1.82
1630 1751 1.764054 CAGGCCACCCAACCCAAAA 60.764 57.895 5.01 0.00 0.00 2.44
1631 1752 1.656092 TACAGGCCACCCAACCCAAA 61.656 55.000 5.01 0.00 0.00 3.28
1632 1753 2.085562 TACAGGCCACCCAACCCAA 61.086 57.895 5.01 0.00 0.00 4.12
1633 1754 2.450699 TACAGGCCACCCAACCCA 60.451 61.111 5.01 0.00 0.00 4.51
1634 1755 2.035155 GTACAGGCCACCCAACCC 59.965 66.667 5.01 0.00 0.00 4.11
1635 1756 1.151908 TTGTACAGGCCACCCAACC 59.848 57.895 5.01 0.00 0.00 3.77
1636 1757 1.176619 GGTTGTACAGGCCACCCAAC 61.177 60.000 5.01 11.97 35.75 3.77
1637 1758 1.151908 GGTTGTACAGGCCACCCAA 59.848 57.895 5.01 0.00 0.00 4.12
1638 1759 2.063015 CTGGTTGTACAGGCCACCCA 62.063 60.000 14.78 0.00 34.84 4.51
1639 1760 1.303317 CTGGTTGTACAGGCCACCC 60.303 63.158 14.78 0.00 34.84 4.61
1640 1761 1.971695 GCTGGTTGTACAGGCCACC 60.972 63.158 14.78 11.34 38.90 4.61
1641 1762 0.609131 ATGCTGGTTGTACAGGCCAC 60.609 55.000 14.78 12.53 38.90 5.01
1642 1763 0.112218 AATGCTGGTTGTACAGGCCA 59.888 50.000 16.94 16.94 38.90 5.36
1643 1764 1.743394 GTAATGCTGGTTGTACAGGCC 59.257 52.381 10.55 10.55 38.90 5.19
1644 1765 2.432444 TGTAATGCTGGTTGTACAGGC 58.568 47.619 0.00 0.71 38.90 4.85
1645 1766 3.190535 GGTTGTAATGCTGGTTGTACAGG 59.809 47.826 0.00 0.00 38.90 4.00
1646 1767 3.818210 TGGTTGTAATGCTGGTTGTACAG 59.182 43.478 0.00 0.00 41.41 2.74
1653 1774 1.004745 CCTCCTGGTTGTAATGCTGGT 59.995 52.381 0.00 0.00 0.00 4.00
1716 1840 6.860023 GCAGACAAGCATTAGCCATTAATAAG 59.140 38.462 0.00 0.00 43.56 1.73
1743 1871 1.004200 GGAAGGGAACGGAAGCGAA 60.004 57.895 0.00 0.00 0.00 4.70
1923 2051 2.978156 AGAAAGAAGTTGGGCATGGA 57.022 45.000 0.00 0.00 0.00 3.41
1924 2052 3.420893 TGTAGAAAGAAGTTGGGCATGG 58.579 45.455 0.00 0.00 0.00 3.66
1925 2053 5.393461 GGAATGTAGAAAGAAGTTGGGCATG 60.393 44.000 0.00 0.00 0.00 4.06
1967 2095 6.099557 AGCAGGGCAAGGCATAATAATAAAAA 59.900 34.615 0.00 0.00 0.00 1.94
1968 2096 5.602145 AGCAGGGCAAGGCATAATAATAAAA 59.398 36.000 0.00 0.00 0.00 1.52
1969 2097 5.147032 AGCAGGGCAAGGCATAATAATAAA 58.853 37.500 0.00 0.00 0.00 1.40
1985 2113 5.886474 AGTAAATCCTAGTTAAAAGCAGGGC 59.114 40.000 0.00 0.00 0.00 5.19
2010 2138 4.889409 GTGTGGTGTGGGATGATATGAAAT 59.111 41.667 0.00 0.00 0.00 2.17
2012 2140 3.371487 GGTGTGGTGTGGGATGATATGAA 60.371 47.826 0.00 0.00 0.00 2.57
2013 2141 2.172505 GGTGTGGTGTGGGATGATATGA 59.827 50.000 0.00 0.00 0.00 2.15
2014 2142 2.173356 AGGTGTGGTGTGGGATGATATG 59.827 50.000 0.00 0.00 0.00 1.78
2048 2176 6.013725 ACATCCTGTTTGACCTAGTAACATCA 60.014 38.462 0.00 0.00 31.96 3.07
2071 2200 7.973388 GCCAAGAATAAACATTGTTATAGCACA 59.027 33.333 1.76 0.00 0.00 4.57
2074 2203 7.649306 CAGGCCAAGAATAAACATTGTTATAGC 59.351 37.037 5.01 0.00 0.00 2.97
2084 2213 2.030363 CGTTGCAGGCCAAGAATAAACA 60.030 45.455 5.01 0.00 33.21 2.83
2197 2333 7.863877 GCGAAAATGGAACGGGTAATTATAAAT 59.136 33.333 0.00 0.00 0.00 1.40
2221 2357 7.324856 CAGCTAGTAAGTAATAGAATGTCAGCG 59.675 40.741 0.00 0.00 0.00 5.18
2227 2363 7.600752 GCTTCCCAGCTAGTAAGTAATAGAATG 59.399 40.741 0.00 0.00 43.51 2.67
2257 2393 7.617723 AGGAGCATATAGAAGGTAGAATGGTAG 59.382 40.741 0.00 0.00 0.00 3.18
2260 2396 6.667414 AGAGGAGCATATAGAAGGTAGAATGG 59.333 42.308 0.00 0.00 0.00 3.16
2278 2414 5.265989 ACAGCCTAGGTATAATAGAGGAGC 58.734 45.833 11.31 0.00 0.00 4.70
2281 2417 9.122779 GTACATACAGCCTAGGTATAATAGAGG 57.877 40.741 11.31 0.00 30.58 3.69
2311 2447 1.134491 ACACGGCAGTAAGGATAAGCC 60.134 52.381 0.00 0.00 41.86 4.35
2332 2468 1.276138 TGGCCATAGTAGCATCGGATG 59.724 52.381 13.63 13.63 0.00 3.51
2360 2496 5.505780 TCTCTTTTTCCACTTTGAGGTCAA 58.494 37.500 0.00 0.00 0.00 3.18
2382 2519 2.282180 TTGGGGGCGCTCTGTTTC 60.282 61.111 7.48 0.00 0.00 2.78
2402 2539 5.740569 CCACTTTGAAATAGTCAATGCATCG 59.259 40.000 0.00 0.00 45.71 3.84
2411 2551 5.106712 TGTCGCATTCCACTTTGAAATAGTC 60.107 40.000 0.00 0.00 0.00 2.59
2431 2571 3.065786 ACTTTGCCAGATTATGCATGTCG 59.934 43.478 10.16 4.51 37.33 4.35
2433 2573 6.528537 TTTACTTTGCCAGATTATGCATGT 57.471 33.333 10.16 0.00 37.33 3.21
2465 2609 2.294512 TCAGTGCACTAGTCACACTCAG 59.705 50.000 21.20 13.04 42.59 3.35
2517 2670 4.766891 AGCATTGGCAGTAAGTTACAACAT 59.233 37.500 15.28 0.00 44.61 2.71
2518 2671 4.023279 CAGCATTGGCAGTAAGTTACAACA 60.023 41.667 15.28 7.81 44.61 3.33
2519 2672 4.475944 CAGCATTGGCAGTAAGTTACAAC 58.524 43.478 15.28 6.32 44.61 3.32
2520 2673 3.057596 GCAGCATTGGCAGTAAGTTACAA 60.058 43.478 15.28 1.31 44.61 2.41
2532 2685 2.159327 AAAAAGACAGCAGCATTGGC 57.841 45.000 0.00 0.00 41.61 4.52
2607 2764 3.425359 GCAGCACATGTGACTTGACATAC 60.425 47.826 29.80 7.32 34.69 2.39
2609 2766 1.538512 GCAGCACATGTGACTTGACAT 59.461 47.619 29.80 1.29 37.01 3.06
2610 2767 0.946528 GCAGCACATGTGACTTGACA 59.053 50.000 29.80 0.00 0.00 3.58
2611 2768 1.196354 GAGCAGCACATGTGACTTGAC 59.804 52.381 29.80 16.96 0.00 3.18
2612 2769 1.202675 TGAGCAGCACATGTGACTTGA 60.203 47.619 29.80 10.38 0.00 3.02
2655 2818 4.095410 CGCAGCACAAAGAATTCCATAA 57.905 40.909 0.65 0.00 0.00 1.90
2656 2819 3.763097 CGCAGCACAAAGAATTCCATA 57.237 42.857 0.65 0.00 0.00 2.74
2672 2835 2.547211 CCCTTGATTTCATCTAGCGCAG 59.453 50.000 11.47 5.22 31.98 5.18
2676 2839 4.336713 GGTGTTCCCTTGATTTCATCTAGC 59.663 45.833 0.00 0.00 31.98 3.42
2686 2849 3.054802 GTCTCATCTGGTGTTCCCTTGAT 60.055 47.826 0.00 0.00 0.00 2.57
2803 2966 3.582998 TCCATCAATTTAGAGGCCAGG 57.417 47.619 5.01 0.00 0.00 4.45
2854 3017 1.078637 GAGCTGCTGTGATGCCTCA 60.079 57.895 7.01 0.00 0.00 3.86
2918 3081 4.219725 TGAATTGCTAAAAACCTACCCAGC 59.780 41.667 0.00 0.00 0.00 4.85
2932 3095 3.084536 TGGTGCTGGAATGAATTGCTA 57.915 42.857 0.00 0.00 0.00 3.49
2964 3127 9.399403 GACAAAAGGATTAATCAGAAAACTCAC 57.601 33.333 17.07 0.00 0.00 3.51
2968 3131 8.360390 AGTGGACAAAAGGATTAATCAGAAAAC 58.640 33.333 17.07 0.00 0.00 2.43
2969 3132 8.477419 AGTGGACAAAAGGATTAATCAGAAAA 57.523 30.769 17.07 0.00 0.00 2.29
2970 3133 7.723616 TGAGTGGACAAAAGGATTAATCAGAAA 59.276 33.333 17.07 0.00 0.00 2.52
2977 3142 4.079253 GCCTGAGTGGACAAAAGGATTAA 58.921 43.478 0.00 0.00 38.35 1.40
2993 3158 0.959372 CTGCCCTGAAGTTGCCTGAG 60.959 60.000 0.00 0.00 0.00 3.35
3016 3181 3.244764 CAGAGCTGCCATGTTGACT 57.755 52.632 0.00 0.00 0.00 3.41
3083 3248 7.551585 ACTGTGGATAGAAATGAGTTACAGAG 58.448 38.462 0.00 0.00 37.16 3.35
3087 3252 7.674240 GCGAAACTGTGGATAGAAATGAGTTAC 60.674 40.741 0.00 0.00 0.00 2.50
3121 3286 9.670719 GAATATTAGGATTAAGAAACAGCAAGC 57.329 33.333 0.00 0.00 0.00 4.01
3148 3316 7.439157 TGATGTCCTTGAAAATAGTTGAGTG 57.561 36.000 0.00 0.00 0.00 3.51
3180 3348 6.449698 CATTGTTCTTTGTTGAATAGCACCT 58.550 36.000 0.00 0.00 0.00 4.00
3188 3356 5.592282 TCTGTAGGCATTGTTCTTTGTTGAA 59.408 36.000 0.00 0.00 0.00 2.69
3237 3405 5.786264 ATCCAGATTTTGATTGGAGCATC 57.214 39.130 0.00 0.00 43.71 3.91
3243 3411 4.794003 GCGGCTAATCCAGATTTTGATTGG 60.794 45.833 0.00 0.00 33.46 3.16
3280 3448 9.274206 GCAGTACGTATATCATCTCAGGATATA 57.726 37.037 0.00 0.00 38.53 0.86
3281 3449 7.996066 AGCAGTACGTATATCATCTCAGGATAT 59.004 37.037 0.00 0.00 40.22 1.63
3299 3467 1.391485 GACACAATGAGCAGCAGTACG 59.609 52.381 0.00 0.00 0.00 3.67
3322 3490 8.310406 TCAGTACAATGTGTTTTCTACATCAG 57.690 34.615 0.00 0.00 39.39 2.90
3371 3540 0.035739 TTTTCACTAGGACACCCGGC 59.964 55.000 0.00 0.00 37.58 6.13
3383 3552 4.516698 AGAACTCGTGATGCAATTTTCACT 59.483 37.500 14.46 0.00 40.05 3.41
3399 3568 3.516615 TGGGCAAAAACAAAAGAACTCG 58.483 40.909 0.00 0.00 0.00 4.18
3407 3576 3.070302 GGGTACTGATGGGCAAAAACAAA 59.930 43.478 0.00 0.00 0.00 2.83
3416 3585 3.080647 CGAAAGGGTACTGATGGGC 57.919 57.895 0.00 0.00 0.00 5.36
3429 3598 0.955428 TAGCCACAGCAAGCCGAAAG 60.955 55.000 0.00 0.00 43.56 2.62
3455 3624 9.500785 TCAACAAACACTCAAGTATGAATATGA 57.499 29.630 0.00 0.00 34.49 2.15
3468 3640 7.520453 GCTCACATCTAAATCAACAAACACTCA 60.520 37.037 0.00 0.00 0.00 3.41
3500 3672 3.004734 GCAATGGACACAAGCAAACTAGT 59.995 43.478 0.00 0.00 33.49 2.57
3507 3679 2.804549 TGTGCAATGGACACAAGCA 58.195 47.368 2.74 0.00 44.68 3.91
3512 3684 4.917415 GTGAGTTTAATGTGCAATGGACAC 59.083 41.667 10.33 0.00 38.55 3.67
3513 3685 4.320129 CGTGAGTTTAATGTGCAATGGACA 60.320 41.667 10.55 10.55 0.00 4.02
3514 3686 4.083537 TCGTGAGTTTAATGTGCAATGGAC 60.084 41.667 0.00 0.00 0.00 4.02
3515 3687 4.068599 TCGTGAGTTTAATGTGCAATGGA 58.931 39.130 0.00 0.00 0.00 3.41
3516 3688 4.158384 GTCGTGAGTTTAATGTGCAATGG 58.842 43.478 0.00 0.00 0.00 3.16
3517 3689 4.782156 TGTCGTGAGTTTAATGTGCAATG 58.218 39.130 0.00 0.00 0.00 2.82
3518 3690 5.431420 TTGTCGTGAGTTTAATGTGCAAT 57.569 34.783 0.00 0.00 0.00 3.56
3559 3731 8.398665 GTCATATGGTTTTACAAATCTCAGTCC 58.601 37.037 2.13 0.00 0.00 3.85
3594 3766 9.158233 CCTTCGACCATTTACTGAAACTATTTA 57.842 33.333 0.00 0.00 0.00 1.40
3600 3772 4.514066 ACACCTTCGACCATTTACTGAAAC 59.486 41.667 0.00 0.00 0.00 2.78
3614 3786 4.079980 TGGATCAGAAAAACACCTTCGA 57.920 40.909 0.00 0.00 0.00 3.71
3652 3826 3.195825 CACTCCCGACTCCTTGATTTAGT 59.804 47.826 0.00 0.00 0.00 2.24
3695 3869 3.446310 TGTCAGCGAACTCACTGTTAA 57.554 42.857 0.00 0.00 39.30 2.01
3708 3882 4.592485 AGGGTATAAAGAGATGTCAGCG 57.408 45.455 0.00 0.00 0.00 5.18
3724 3898 8.810990 TCAAAAAGAGAAGTAAACAAAGGGTA 57.189 30.769 0.00 0.00 0.00 3.69
3725 3899 7.712204 TCAAAAAGAGAAGTAAACAAAGGGT 57.288 32.000 0.00 0.00 0.00 4.34
3727 3901 8.595533 GCTTTCAAAAAGAGAAGTAAACAAAGG 58.404 33.333 3.68 0.00 0.00 3.11
3728 3902 9.358872 AGCTTTCAAAAAGAGAAGTAAACAAAG 57.641 29.630 3.68 0.00 0.00 2.77
3729 3903 9.705290 AAGCTTTCAAAAAGAGAAGTAAACAAA 57.295 25.926 0.00 0.00 0.00 2.83
3740 3914 9.305925 ACAAAACAGATAAGCTTTCAAAAAGAG 57.694 29.630 3.20 0.00 0.00 2.85
3745 3919 8.770438 AACAACAAAACAGATAAGCTTTCAAA 57.230 26.923 3.20 0.00 0.00 2.69
3755 3929 8.254508 ACCTTTTAGCAAACAACAAAACAGATA 58.745 29.630 0.00 0.00 0.00 1.98
3765 3939 3.243737 CCTGGGACCTTTTAGCAAACAAC 60.244 47.826 0.00 0.00 0.00 3.32
3766 3940 2.962421 CCTGGGACCTTTTAGCAAACAA 59.038 45.455 0.00 0.00 0.00 2.83
3768 3942 2.594131 ACCTGGGACCTTTTAGCAAAC 58.406 47.619 0.00 0.00 0.00 2.93
3769 3943 4.595986 GATACCTGGGACCTTTTAGCAAA 58.404 43.478 0.00 0.00 0.00 3.68
3773 3947 4.344102 TGATCGATACCTGGGACCTTTTAG 59.656 45.833 0.00 0.00 0.00 1.85
3774 3948 4.291792 TGATCGATACCTGGGACCTTTTA 58.708 43.478 0.00 0.00 0.00 1.52
3775 3949 3.112263 TGATCGATACCTGGGACCTTTT 58.888 45.455 0.00 0.00 0.00 2.27
3776 3950 2.759355 TGATCGATACCTGGGACCTTT 58.241 47.619 0.00 0.00 0.00 3.11
3808 3982 0.166814 CTGCTTCTGTGCGCCTAAAC 59.833 55.000 4.18 0.00 35.36 2.01
3815 3989 1.136141 GTCATCAACTGCTTCTGTGCG 60.136 52.381 0.00 0.00 35.36 5.34
3857 4031 5.375417 TCAATTGCTGTTGTGGTGATAAG 57.625 39.130 0.00 0.00 0.00 1.73
3876 4050 1.202794 TGTCTGTGCTTGAGCCATCAA 60.203 47.619 0.00 0.00 43.20 2.57
3893 4067 3.854666 TCTAGCAAGCTCATTCTGTGTC 58.145 45.455 0.00 0.00 0.00 3.67
3962 4136 4.871513 TGACCTTCATCATATACTCGTGC 58.128 43.478 0.00 0.00 0.00 5.34
4052 4444 4.263905 TGGGCCATCTTCAACTAACAGATT 60.264 41.667 0.00 0.00 0.00 2.40
4094 4486 0.670162 GCAATTCCATCATCCGGTGG 59.330 55.000 0.00 0.89 36.82 4.61
4148 4543 1.134226 GCTGTTGCTGTTGATGTTGC 58.866 50.000 0.00 0.00 36.03 4.17
4175 4573 1.227031 TTGTTGTTGCTGCTGCTGC 60.227 52.632 22.51 22.51 40.48 5.25
4193 4591 1.731700 CTGCTGCTGTTGCTGTTGT 59.268 52.632 0.00 0.00 39.81 3.32
4196 4594 2.122797 TTGCTGCTGCTGTTGCTGT 61.123 52.632 17.00 0.00 39.81 4.40
4202 4600 0.179129 GTTGTTGTTGCTGCTGCTGT 60.179 50.000 17.00 0.00 40.48 4.40
4203 4601 0.179132 TGTTGTTGTTGCTGCTGCTG 60.179 50.000 17.00 0.77 40.48 4.41
4204 4602 0.101759 CTGTTGTTGTTGCTGCTGCT 59.898 50.000 17.00 0.00 40.48 4.24
4205 4603 1.485032 GCTGTTGTTGTTGCTGCTGC 61.485 55.000 8.89 8.89 40.20 5.25
4206 4604 0.179132 TGCTGTTGTTGTTGCTGCTG 60.179 50.000 0.00 0.00 0.00 4.41
4207 4605 0.179129 GTGCTGTTGTTGTTGCTGCT 60.179 50.000 0.00 0.00 0.00 4.24
4208 4606 1.147557 GGTGCTGTTGTTGTTGCTGC 61.148 55.000 0.00 0.00 0.00 5.25
4209 4607 0.173029 TGGTGCTGTTGTTGTTGCTG 59.827 50.000 0.00 0.00 0.00 4.41
4210 4608 0.894141 TTGGTGCTGTTGTTGTTGCT 59.106 45.000 0.00 0.00 0.00 3.91
4211 4609 0.998669 GTTGGTGCTGTTGTTGTTGC 59.001 50.000 0.00 0.00 0.00 4.17
4212 4610 2.261345 CTGTTGGTGCTGTTGTTGTTG 58.739 47.619 0.00 0.00 0.00 3.33
4213 4611 1.404047 GCTGTTGGTGCTGTTGTTGTT 60.404 47.619 0.00 0.00 0.00 2.83
4214 4612 0.173255 GCTGTTGGTGCTGTTGTTGT 59.827 50.000 0.00 0.00 0.00 3.32
4215 4613 0.173029 TGCTGTTGGTGCTGTTGTTG 59.827 50.000 0.00 0.00 0.00 3.33
4216 4614 0.173255 GTGCTGTTGGTGCTGTTGTT 59.827 50.000 0.00 0.00 0.00 2.83
4217 4615 1.666209 GGTGCTGTTGGTGCTGTTGT 61.666 55.000 0.00 0.00 0.00 3.32
4223 4621 1.066257 CTGTTGGTGCTGTTGGTGC 59.934 57.895 0.00 0.00 0.00 5.01
4226 4624 1.361271 CTGCTGTTGGTGCTGTTGG 59.639 57.895 0.00 0.00 0.00 3.77
4229 4627 2.124193 TGCTGCTGTTGGTGCTGT 60.124 55.556 0.00 0.00 0.00 4.40
4235 4633 3.268965 CTGCTGCTGCTGCTGTTGG 62.269 63.158 27.67 11.91 39.81 3.77
4288 4689 7.652524 AGGTATCACATGTATGGAGCTATAG 57.347 40.000 0.00 0.00 0.00 1.31
4302 4703 1.202651 GGGCACGCTTAGGTATCACAT 60.203 52.381 0.00 0.00 0.00 3.21
4374 4775 1.411246 TGTGCCGGTACTATTAGCTGG 59.589 52.381 23.67 0.00 0.00 4.85
4411 4812 1.352083 TGGAGTTGAGGGTGGAGAAG 58.648 55.000 0.00 0.00 0.00 2.85
4501 4902 2.745884 TTCCATCCGCGCCACAAG 60.746 61.111 0.00 0.00 0.00 3.16
4520 4921 3.349927 TGAGGATGAAGCAAATCCACTG 58.650 45.455 13.05 0.00 45.24 3.66
4541 4942 9.204570 GCACGTAATAATAGTACCATCTGATTT 57.795 33.333 0.00 0.00 0.00 2.17
4567 4968 9.121517 CAAAAATTGAAACAGTAGAGCAGTATG 57.878 33.333 0.00 0.00 40.87 2.39
4578 4979 6.463360 ACTGACAACCAAAAATTGAAACAGT 58.537 32.000 0.00 0.00 36.17 3.55
4653 5054 9.720667 GAATCGACATTATCATCAAAATCAACA 57.279 29.630 0.00 0.00 0.00 3.33
4665 5066 9.905171 TTTGACAAAAATGAATCGACATTATCA 57.095 25.926 0.00 2.68 39.19 2.15
4671 5072 8.081025 TCATCATTTGACAAAAATGAATCGACA 58.919 29.630 19.31 3.82 46.06 4.35
4704 5105 1.399572 CAGCGAATATGTCTCGACCG 58.600 55.000 0.00 0.00 38.61 4.79
4789 5191 0.183492 TCAGGGCTGAAGTTTGCAGT 59.817 50.000 0.00 0.00 36.53 4.40
4872 5274 0.457509 TGTTGTTGCTTGCACGGTTG 60.458 50.000 0.00 0.00 0.00 3.77
5238 5648 3.395607 AGGGTAATATTGCATCTCCAGCA 59.604 43.478 5.87 0.00 40.85 4.41
5369 5799 6.130569 AGGAAGACCTACAGTACCATAGAAG 58.869 44.000 3.14 0.00 45.83 2.85
5664 6099 4.217118 GTGATCTCTTGCCACAATCAAAGT 59.783 41.667 0.00 0.00 0.00 2.66
5814 6452 0.444260 GAGTTACAGAAGCTTGGCGC 59.556 55.000 2.10 0.00 39.57 6.53
5815 6453 1.079503 GGAGTTACAGAAGCTTGGCG 58.920 55.000 2.10 0.00 0.00 5.69
5816 6454 2.185004 TGGAGTTACAGAAGCTTGGC 57.815 50.000 2.10 0.00 0.00 4.52
5817 6455 3.012518 CCATGGAGTTACAGAAGCTTGG 58.987 50.000 5.56 0.00 0.00 3.61
5818 6456 3.942829 TCCATGGAGTTACAGAAGCTTG 58.057 45.455 11.44 0.00 0.00 4.01
5819 6457 4.202461 TGTTCCATGGAGTTACAGAAGCTT 60.202 41.667 15.53 0.00 0.00 3.74
5820 6458 3.327757 TGTTCCATGGAGTTACAGAAGCT 59.672 43.478 15.53 0.00 0.00 3.74
5821 6459 3.437049 GTGTTCCATGGAGTTACAGAAGC 59.563 47.826 16.43 3.44 0.00 3.86
5822 6460 4.899502 AGTGTTCCATGGAGTTACAGAAG 58.100 43.478 16.43 0.00 0.00 2.85
5823 6461 4.974645 AGTGTTCCATGGAGTTACAGAA 57.025 40.909 16.43 0.00 0.00 3.02
5824 6462 4.974645 AAGTGTTCCATGGAGTTACAGA 57.025 40.909 16.43 0.00 0.00 3.41
5825 6463 8.424918 AGATATAAGTGTTCCATGGAGTTACAG 58.575 37.037 16.43 0.00 0.00 2.74
5864 6522 7.863375 CAGTAAGTCTTAGATATTCCGTTGAGG 59.137 40.741 0.00 0.00 42.97 3.86
5871 6529 8.709272 AGGTACCAGTAAGTCTTAGATATTCC 57.291 38.462 15.94 0.00 0.00 3.01
5917 6575 2.351738 GCAAGTACCCACATGCTTTGAC 60.352 50.000 0.00 0.00 44.14 3.18
6354 7012 5.323900 CGTCCAATCAACAATCATGTGTAC 58.676 41.667 0.00 0.00 40.46 2.90
6432 7090 6.884295 TGGTTTCCTACAATTAGATCAACCAG 59.116 38.462 0.00 0.00 35.55 4.00
6611 7294 1.272704 GGGAGGAATGCCCAAGAAAGT 60.273 52.381 0.00 0.00 45.31 2.66
6612 7295 1.478631 GGGAGGAATGCCCAAGAAAG 58.521 55.000 0.00 0.00 45.31 2.62
6821 7522 5.917462 TCACCTGTATCCATTCATGTACAG 58.083 41.667 0.33 10.48 42.16 2.74
6936 7637 1.404748 TGTAAACTCGTGTCCGTGTCA 59.595 47.619 0.00 0.00 39.65 3.58
6995 7696 5.449862 GCACAAACACCTGTAAGAAACATCA 60.450 40.000 0.00 0.00 37.50 3.07
7000 7701 4.673061 CGTTGCACAAACACCTGTAAGAAA 60.673 41.667 0.00 0.00 38.84 2.52
7005 7706 1.398739 CACGTTGCACAAACACCTGTA 59.601 47.619 0.00 0.00 38.84 2.74
7006 7707 0.170116 CACGTTGCACAAACACCTGT 59.830 50.000 0.00 0.00 38.84 4.00
7063 7776 4.113354 CCTCGCTAGTGTGAACCTAAATC 58.887 47.826 6.92 0.00 31.75 2.17
7114 7827 2.027751 GCCGACGCCAGATACTCC 59.972 66.667 0.00 0.00 0.00 3.85
7141 7854 2.022129 CGACCACACCTTCACGCTC 61.022 63.158 0.00 0.00 0.00 5.03
7274 7987 2.868839 GCAGCAACCATGTCAATGCTTT 60.869 45.455 8.50 0.00 46.36 3.51
7317 8030 2.412870 TGTCTCTGTTATGTTGCACGG 58.587 47.619 0.00 0.00 0.00 4.94
7318 8031 4.466567 TTTGTCTCTGTTATGTTGCACG 57.533 40.909 0.00 0.00 0.00 5.34
7335 8048 4.343814 CCCAACTGTCCAGGTTTAATTTGT 59.656 41.667 0.00 0.00 0.00 2.83
7374 8087 5.816777 CACATCACATCACACCACATGTATA 59.183 40.000 0.00 0.00 40.64 1.47
7376 8089 4.002316 CACATCACATCACACCACATGTA 58.998 43.478 0.00 0.00 40.64 2.29
7377 8090 2.815503 CACATCACATCACACCACATGT 59.184 45.455 0.00 0.00 44.81 3.21
7378 8091 3.075884 TCACATCACATCACACCACATG 58.924 45.455 0.00 0.00 0.00 3.21
7379 8092 3.421919 TCACATCACATCACACCACAT 57.578 42.857 0.00 0.00 0.00 3.21
7380 8093 2.926778 TCACATCACATCACACCACA 57.073 45.000 0.00 0.00 0.00 4.17
7381 8094 3.337358 TCATCACATCACATCACACCAC 58.663 45.455 0.00 0.00 0.00 4.16
7382 8095 3.699411 TCATCACATCACATCACACCA 57.301 42.857 0.00 0.00 0.00 4.17
7383 8096 3.242969 GCATCATCACATCACATCACACC 60.243 47.826 0.00 0.00 0.00 4.16
7384 8097 3.375922 TGCATCATCACATCACATCACAC 59.624 43.478 0.00 0.00 0.00 3.82
7392 8105 1.207811 ACCGTCTGCATCATCACATCA 59.792 47.619 0.00 0.00 0.00 3.07
7428 8141 0.249322 CGTTCCGCTGGTTATCCGAT 60.249 55.000 0.00 0.00 36.30 4.18
7429 8142 1.140161 CGTTCCGCTGGTTATCCGA 59.860 57.895 0.00 0.00 36.30 4.55
7553 8266 5.710984 TCGTCTTTACAACCAATCTCTCTC 58.289 41.667 0.00 0.00 0.00 3.20
7554 8267 5.723672 TCGTCTTTACAACCAATCTCTCT 57.276 39.130 0.00 0.00 0.00 3.10
7555 8268 5.163943 GCTTCGTCTTTACAACCAATCTCTC 60.164 44.000 0.00 0.00 0.00 3.20
7556 8269 4.691216 GCTTCGTCTTTACAACCAATCTCT 59.309 41.667 0.00 0.00 0.00 3.10
7557 8270 4.691216 AGCTTCGTCTTTACAACCAATCTC 59.309 41.667 0.00 0.00 0.00 2.75
7558 8271 4.642429 AGCTTCGTCTTTACAACCAATCT 58.358 39.130 0.00 0.00 0.00 2.40
7560 8273 4.578928 ACAAGCTTCGTCTTTACAACCAAT 59.421 37.500 0.00 0.00 0.00 3.16
7586 8309 2.238395 GCTTCACTTCCAATCTCTCCCT 59.762 50.000 0.00 0.00 0.00 4.20
7638 8365 7.907563 GGTCAAAAGCTACTAGTAGTTACTACG 59.092 40.741 26.76 12.55 41.37 3.51
7639 8366 8.955388 AGGTCAAAAGCTACTAGTAGTTACTAC 58.045 37.037 26.76 14.13 37.73 2.73
7640 8367 9.525826 AAGGTCAAAAGCTACTAGTAGTTACTA 57.474 33.333 26.76 9.53 33.64 1.82
7642 8369 8.923683 CAAAGGTCAAAAGCTACTAGTAGTTAC 58.076 37.037 26.76 17.01 35.65 2.50
7645 8372 7.063934 ACAAAGGTCAAAAGCTACTAGTAGT 57.936 36.000 26.76 13.66 35.65 2.73
7646 8373 7.964604 AACAAAGGTCAAAAGCTACTAGTAG 57.035 36.000 23.25 23.25 36.29 2.57
7647 8374 9.264719 GTAAACAAAGGTCAAAAGCTACTAGTA 57.735 33.333 1.89 1.89 31.54 1.82
7648 8375 7.228108 GGTAAACAAAGGTCAAAAGCTACTAGT 59.772 37.037 0.00 0.00 31.54 2.57
7649 8376 7.444487 AGGTAAACAAAGGTCAAAAGCTACTAG 59.556 37.037 0.00 0.00 31.54 2.57
7650 8377 7.284820 AGGTAAACAAAGGTCAAAAGCTACTA 58.715 34.615 0.00 0.00 31.54 1.82
7651 8378 6.127101 AGGTAAACAAAGGTCAAAAGCTACT 58.873 36.000 0.00 0.00 31.54 2.57
7652 8379 6.387041 AGGTAAACAAAGGTCAAAAGCTAC 57.613 37.500 0.00 0.00 31.54 3.58
7653 8380 7.093684 ACAAAGGTAAACAAAGGTCAAAAGCTA 60.094 33.333 0.00 0.00 31.54 3.32
7654 8381 5.932619 AAGGTAAACAAAGGTCAAAAGCT 57.067 34.783 0.00 0.00 33.74 3.74
7655 8382 5.872617 ACAAAGGTAAACAAAGGTCAAAAGC 59.127 36.000 0.00 0.00 0.00 3.51
7656 8383 6.533723 GGACAAAGGTAAACAAAGGTCAAAAG 59.466 38.462 0.00 0.00 0.00 2.27
7657 8384 6.399743 GGACAAAGGTAAACAAAGGTCAAAA 58.600 36.000 0.00 0.00 0.00 2.44
7658 8385 5.393243 CGGACAAAGGTAAACAAAGGTCAAA 60.393 40.000 0.00 0.00 0.00 2.69
7659 8386 4.096682 CGGACAAAGGTAAACAAAGGTCAA 59.903 41.667 0.00 0.00 0.00 3.18
7660 8387 3.628487 CGGACAAAGGTAAACAAAGGTCA 59.372 43.478 0.00 0.00 0.00 4.02
7661 8388 3.628942 ACGGACAAAGGTAAACAAAGGTC 59.371 43.478 0.00 0.00 0.00 3.85
7662 8389 3.623703 ACGGACAAAGGTAAACAAAGGT 58.376 40.909 0.00 0.00 0.00 3.50
7663 8390 3.881089 AGACGGACAAAGGTAAACAAAGG 59.119 43.478 0.00 0.00 0.00 3.11
7664 8391 4.334481 ACAGACGGACAAAGGTAAACAAAG 59.666 41.667 0.00 0.00 0.00 2.77
7665 8392 4.263435 ACAGACGGACAAAGGTAAACAAA 58.737 39.130 0.00 0.00 0.00 2.83
7666 8393 3.876341 ACAGACGGACAAAGGTAAACAA 58.124 40.909 0.00 0.00 0.00 2.83
7667 8394 3.547054 ACAGACGGACAAAGGTAAACA 57.453 42.857 0.00 0.00 0.00 2.83
7668 8395 3.624410 ACAACAGACGGACAAAGGTAAAC 59.376 43.478 0.00 0.00 0.00 2.01
7669 8396 3.623960 CACAACAGACGGACAAAGGTAAA 59.376 43.478 0.00 0.00 0.00 2.01
7670 8397 3.199677 CACAACAGACGGACAAAGGTAA 58.800 45.455 0.00 0.00 0.00 2.85
7671 8398 2.484065 CCACAACAGACGGACAAAGGTA 60.484 50.000 0.00 0.00 0.00 3.08
7672 8399 1.663695 CACAACAGACGGACAAAGGT 58.336 50.000 0.00 0.00 0.00 3.50
7673 8400 0.944386 CCACAACAGACGGACAAAGG 59.056 55.000 0.00 0.00 0.00 3.11
7674 8401 1.867233 CTCCACAACAGACGGACAAAG 59.133 52.381 0.00 0.00 0.00 2.77
7679 8406 1.152419 TCCCTCCACAACAGACGGA 60.152 57.895 0.00 0.00 0.00 4.69
7697 8424 7.164233 ACATAAGTAGACTAGGTACATCCCT 57.836 40.000 0.00 0.00 38.70 4.20
7698 8425 7.836479 AACATAAGTAGACTAGGTACATCCC 57.164 40.000 0.00 0.00 36.75 3.85
7701 8428 9.571816 GAGGTAACATAAGTAGACTAGGTACAT 57.428 37.037 0.00 0.00 41.41 2.29
7702 8429 8.776119 AGAGGTAACATAAGTAGACTAGGTACA 58.224 37.037 0.00 0.00 41.41 2.90
7703 8430 9.625747 AAGAGGTAACATAAGTAGACTAGGTAC 57.374 37.037 0.00 0.00 41.41 3.34
7705 8432 9.625747 GTAAGAGGTAACATAAGTAGACTAGGT 57.374 37.037 0.00 0.00 41.41 3.08
7706 8433 9.065798 GGTAAGAGGTAACATAAGTAGACTAGG 57.934 40.741 0.00 0.00 41.41 3.02
7707 8434 9.850198 AGGTAAGAGGTAACATAAGTAGACTAG 57.150 37.037 0.00 0.00 41.41 2.57
7708 8435 9.624373 CAGGTAAGAGGTAACATAAGTAGACTA 57.376 37.037 0.00 0.00 41.41 2.59
7709 8436 7.560626 CCAGGTAAGAGGTAACATAAGTAGACT 59.439 40.741 0.00 0.00 41.41 3.24
7712 8439 7.893124 TCCAGGTAAGAGGTAACATAAGTAG 57.107 40.000 0.00 0.00 41.41 2.57
7714 8441 6.901300 TCATCCAGGTAAGAGGTAACATAAGT 59.099 38.462 0.00 0.00 41.41 2.24
7715 8442 7.361457 TCATCCAGGTAAGAGGTAACATAAG 57.639 40.000 0.00 0.00 41.41 1.73
7716 8443 7.743116 TTCATCCAGGTAAGAGGTAACATAA 57.257 36.000 0.00 0.00 41.41 1.90
7717 8444 7.202093 CCATTCATCCAGGTAAGAGGTAACATA 60.202 40.741 0.00 0.00 41.41 2.29
7718 8445 6.409695 CCATTCATCCAGGTAAGAGGTAACAT 60.410 42.308 0.00 0.00 41.41 2.71
7719 8446 5.104527 CCATTCATCCAGGTAAGAGGTAACA 60.105 44.000 0.00 0.00 41.41 2.41
7720 8447 5.130477 TCCATTCATCCAGGTAAGAGGTAAC 59.870 44.000 0.00 0.00 0.00 2.50
7721 8448 5.285401 TCCATTCATCCAGGTAAGAGGTAA 58.715 41.667 0.00 0.00 0.00 2.85
7722 8449 4.890988 TCCATTCATCCAGGTAAGAGGTA 58.109 43.478 0.00 0.00 0.00 3.08
7723 8450 3.736094 TCCATTCATCCAGGTAAGAGGT 58.264 45.455 0.00 0.00 0.00 3.85
7724 8451 4.349048 TCATCCATTCATCCAGGTAAGAGG 59.651 45.833 0.00 0.00 0.00 3.69
7725 8452 5.557576 TCATCCATTCATCCAGGTAAGAG 57.442 43.478 0.00 0.00 0.00 2.85
7726 8453 5.974156 TTCATCCATTCATCCAGGTAAGA 57.026 39.130 0.00 0.00 0.00 2.10
7727 8454 6.301486 TCATTCATCCATTCATCCAGGTAAG 58.699 40.000 0.00 0.00 0.00 2.34
7728 8455 6.264771 TCATTCATCCATTCATCCAGGTAA 57.735 37.500 0.00 0.00 0.00 2.85
7734 8461 5.738208 GCTTGGTTCATTCATCCATTCATCC 60.738 44.000 0.00 0.00 0.00 3.51
7741 8468 3.499338 ACTTGCTTGGTTCATTCATCCA 58.501 40.909 0.00 0.00 0.00 3.41
7743 8470 5.834239 CAAACTTGCTTGGTTCATTCATC 57.166 39.130 0.00 0.00 0.00 2.92
7769 8496 6.177610 TCTCTCTCTCTCCTTTCTTACTCAC 58.822 44.000 0.00 0.00 0.00 3.51
7773 8500 6.650120 TCTCTCTCTCTCTCTCCTTTCTTAC 58.350 44.000 0.00 0.00 0.00 2.34
7775 8502 5.488919 TCTCTCTCTCTCTCTCTCCTTTCTT 59.511 44.000 0.00 0.00 0.00 2.52
7779 8506 4.624913 TCTCTCTCTCTCTCTCTCTCCTT 58.375 47.826 0.00 0.00 0.00 3.36
7781 8508 4.219115 TCTCTCTCTCTCTCTCTCTCTCC 58.781 52.174 0.00 0.00 0.00 3.71
7782 8509 5.860941 TTCTCTCTCTCTCTCTCTCTCTC 57.139 47.826 0.00 0.00 0.00 3.20
7783 8510 5.130145 CCTTTCTCTCTCTCTCTCTCTCTCT 59.870 48.000 0.00 0.00 0.00 3.10
7784 8511 5.363939 CCTTTCTCTCTCTCTCTCTCTCTC 58.636 50.000 0.00 0.00 0.00 3.20
7785 8512 4.164988 CCCTTTCTCTCTCTCTCTCTCTCT 59.835 50.000 0.00 0.00 0.00 3.10
7788 8515 3.947834 CACCCTTTCTCTCTCTCTCTCTC 59.052 52.174 0.00 0.00 0.00 3.20
7789 8516 3.309121 CCACCCTTTCTCTCTCTCTCTCT 60.309 52.174 0.00 0.00 0.00 3.10
7790 8517 3.023832 CCACCCTTTCTCTCTCTCTCTC 58.976 54.545 0.00 0.00 0.00 3.20
7791 8518 2.292192 CCCACCCTTTCTCTCTCTCTCT 60.292 54.545 0.00 0.00 0.00 3.10
7792 8519 2.107366 CCCACCCTTTCTCTCTCTCTC 58.893 57.143 0.00 0.00 0.00 3.20
7793 8520 1.435168 ACCCACCCTTTCTCTCTCTCT 59.565 52.381 0.00 0.00 0.00 3.10
7794 8521 1.945580 ACCCACCCTTTCTCTCTCTC 58.054 55.000 0.00 0.00 0.00 3.20
7795 8522 2.424684 AACCCACCCTTTCTCTCTCT 57.575 50.000 0.00 0.00 0.00 3.10
7796 8523 4.846168 AATAACCCACCCTTTCTCTCTC 57.154 45.455 0.00 0.00 0.00 3.20
7797 8524 5.162980 ACAAAATAACCCACCCTTTCTCTCT 60.163 40.000 0.00 0.00 0.00 3.10
7798 8525 5.048013 CACAAAATAACCCACCCTTTCTCTC 60.048 44.000 0.00 0.00 0.00 3.20
7799 8526 4.832823 CACAAAATAACCCACCCTTTCTCT 59.167 41.667 0.00 0.00 0.00 3.10
7800 8527 4.587262 ACACAAAATAACCCACCCTTTCTC 59.413 41.667 0.00 0.00 0.00 2.87
7801 8528 4.552674 ACACAAAATAACCCACCCTTTCT 58.447 39.130 0.00 0.00 0.00 2.52
7802 8529 4.948341 ACACAAAATAACCCACCCTTTC 57.052 40.909 0.00 0.00 0.00 2.62
7803 8530 7.381789 AATTACACAAAATAACCCACCCTTT 57.618 32.000 0.00 0.00 0.00 3.11
7804 8531 8.493787 TTAATTACACAAAATAACCCACCCTT 57.506 30.769 0.00 0.00 0.00 3.95
7805 8532 8.369424 GTTTAATTACACAAAATAACCCACCCT 58.631 33.333 0.00 0.00 0.00 4.34
7806 8533 8.369424 AGTTTAATTACACAAAATAACCCACCC 58.631 33.333 4.66 0.00 0.00 4.61
7807 8534 9.198837 CAGTTTAATTACACAAAATAACCCACC 57.801 33.333 4.66 0.00 0.00 4.61
7808 8535 8.705134 GCAGTTTAATTACACAAAATAACCCAC 58.295 33.333 4.66 0.00 0.00 4.61
7809 8536 7.595502 CGCAGTTTAATTACACAAAATAACCCA 59.404 33.333 4.66 0.00 0.00 4.51
7810 8537 7.062488 CCGCAGTTTAATTACACAAAATAACCC 59.938 37.037 4.66 0.00 0.00 4.11
7811 8538 7.411049 GCCGCAGTTTAATTACACAAAATAACC 60.411 37.037 4.66 0.00 0.00 2.85
7839 8566 1.476235 TATTGATCGACAACGCGCCG 61.476 55.000 5.73 5.11 41.52 6.46
7840 8567 0.859232 ATATTGATCGACAACGCGCC 59.141 50.000 5.73 0.00 41.52 6.53
7841 8568 2.645628 AATATTGATCGACAACGCGC 57.354 45.000 5.73 0.00 41.52 6.86
7842 8569 9.946418 TTAATATTAATATTGATCGACAACGCG 57.054 29.630 24.75 3.53 41.52 6.01
7864 8591 6.624423 CACAGCTCCTTGCACTAAAATTAAT 58.376 36.000 0.00 0.00 45.94 1.40
7868 8595 2.229784 GCACAGCTCCTTGCACTAAAAT 59.770 45.455 6.61 0.00 45.94 1.82
7869 8596 1.608590 GCACAGCTCCTTGCACTAAAA 59.391 47.619 6.61 0.00 45.94 1.52
7870 8597 1.202806 AGCACAGCTCCTTGCACTAAA 60.203 47.619 12.74 0.00 45.94 1.85
7877 8604 4.510038 AATTAAACAGCACAGCTCCTTG 57.490 40.909 0.00 0.00 36.40 3.61
7880 8607 7.889589 AAAATTAATTAAACAGCACAGCTCC 57.110 32.000 1.21 0.00 36.40 4.70
7905 8632 5.768980 TTCTCTCCTCCAATGAGTCAAAT 57.231 39.130 0.00 0.00 36.86 2.32
7909 8636 5.096443 ACAATTCTCTCCTCCAATGAGTC 57.904 43.478 0.00 0.00 36.86 3.36
7911 8638 5.494724 TCAACAATTCTCTCCTCCAATGAG 58.505 41.667 0.00 0.00 38.42 2.90
7912 8639 5.503634 TCAACAATTCTCTCCTCCAATGA 57.496 39.130 0.00 0.00 0.00 2.57
7913 8640 6.432162 TCTTTCAACAATTCTCTCCTCCAATG 59.568 38.462 0.00 0.00 0.00 2.82
7914 8641 6.546484 TCTTTCAACAATTCTCTCCTCCAAT 58.454 36.000 0.00 0.00 0.00 3.16
7919 8649 6.150809 GCATTCTCTTTCAACAATTCTCTCCT 59.849 38.462 0.00 0.00 0.00 3.69
7920 8650 6.072286 TGCATTCTCTTTCAACAATTCTCTCC 60.072 38.462 0.00 0.00 0.00 3.71
8044 8877 2.741985 CGTCACCGGCAGCATCAA 60.742 61.111 0.00 0.00 0.00 2.57
8102 8941 2.035442 GCTGCCGGACCTTCTTCAC 61.035 63.158 5.05 0.00 0.00 3.18
8339 9178 0.578683 CGATGTCGCTGGTATTGCTG 59.421 55.000 0.00 0.00 0.00 4.41
8352 9191 3.630148 CATGACGGCCGCGATGTC 61.630 66.667 28.58 15.96 0.00