Multiple sequence alignment - TraesCS5B01G568000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G568000 chr5B 100.000 5636 0 0 1 5636 711390643 711396278 0.000000e+00 10408.0
1 TraesCS5B01G568000 chr5B 80.660 848 148 10 1957 2801 697828402 697827568 1.320000e-180 643.0
2 TraesCS5B01G568000 chr5B 91.589 428 30 5 5213 5636 538365809 538365384 2.260000e-163 586.0
3 TraesCS5B01G568000 chr5B 74.431 1099 241 27 2147 3231 479392909 479391837 2.410000e-118 436.0
4 TraesCS5B01G568000 chr5B 73.031 1257 288 34 2183 3418 479502848 479501622 4.090000e-106 396.0
5 TraesCS5B01G568000 chr5B 87.018 285 37 0 4924 5208 530653397 530653681 7.040000e-84 322.0
6 TraesCS5B01G568000 chr5B 87.970 133 15 1 4 135 20824608 20824476 7.560000e-34 156.0
7 TraesCS5B01G568000 chr1B 93.056 432 28 2 5206 5636 133405593 133406023 1.030000e-176 630.0
8 TraesCS5B01G568000 chr3B 92.757 428 27 4 5211 5636 475493606 475493181 2.890000e-172 616.0
9 TraesCS5B01G568000 chr3B 91.628 430 31 4 5209 5636 475480565 475480139 1.750000e-164 590.0
10 TraesCS5B01G568000 chr3B 86.316 285 38 1 4924 5208 543465207 543465490 5.480000e-80 309.0
11 TraesCS5B01G568000 chr3B 86.170 282 36 3 4928 5208 92662750 92663029 9.180000e-78 302.0
12 TraesCS5B01G568000 chr3B 71.032 1260 270 64 3168 4372 815478775 815479994 3.420000e-52 217.0
13 TraesCS5B01G568000 chr6B 91.860 430 31 4 5209 5636 350235200 350235627 1.050000e-166 597.0
14 TraesCS5B01G568000 chr6B 91.204 432 34 4 5206 5636 228282351 228282779 8.140000e-163 584.0
15 TraesCS5B01G568000 chr7B 91.455 433 30 6 5209 5636 261443599 261444029 6.290000e-164 588.0
16 TraesCS5B01G568000 chr7B 92.000 275 18 4 1 273 517610330 517610058 3.190000e-102 383.0
17 TraesCS5B01G568000 chr7B 85.765 281 39 1 4928 5208 80091566 80091287 4.270000e-76 296.0
18 TraesCS5B01G568000 chr7B 84.932 73 11 0 1223 1295 685208134 685208206 2.180000e-09 75.0
19 TraesCS5B01G568000 chr2D 91.204 432 34 4 5206 5636 520452790 520453218 8.140000e-163 584.0
20 TraesCS5B01G568000 chr2D 75.349 430 99 7 2815 3239 650748167 650748594 3.440000e-47 200.0
21 TraesCS5B01G568000 chr2D 80.408 245 42 5 1031 1272 650717685 650717926 1.250000e-41 182.0
22 TraesCS5B01G568000 chr4B 91.224 433 31 6 5208 5636 142362036 142361607 2.930000e-162 582.0
23 TraesCS5B01G568000 chr5A 73.828 1280 286 32 2159 3418 504854550 504853300 3.980000e-126 462.0
24 TraesCS5B01G568000 chr5A 74.335 1091 234 30 2159 3232 504783009 504781948 6.750000e-114 422.0
25 TraesCS5B01G568000 chr5D 74.390 1066 229 25 2183 3232 399161721 399160684 3.140000e-112 416.0
26 TraesCS5B01G568000 chr4A 90.182 275 20 6 1 271 710289910 710290181 8.980000e-93 351.0
27 TraesCS5B01G568000 chr4A 81.818 308 47 6 2159 2465 615370938 615370639 3.370000e-62 250.0
28 TraesCS5B01G568000 chr4A 87.283 173 18 3 1 170 597856852 597856681 1.600000e-45 195.0
29 TraesCS5B01G568000 chr4A 73.571 280 65 8 3711 3987 730352067 730351794 1.290000e-16 99.0
30 TraesCS5B01G568000 chr7A 90.182 275 18 7 1 270 22866164 22866434 3.230000e-92 350.0
31 TraesCS5B01G568000 chr7A 91.667 72 6 0 4855 4926 94371757 94371686 3.590000e-17 100.0
32 TraesCS5B01G568000 chr7A 78.261 115 25 0 1158 1272 700055427 700055541 2.180000e-09 75.0
33 TraesCS5B01G568000 chr3D 87.368 285 35 1 4924 5208 29528946 29528663 5.450000e-85 326.0
34 TraesCS5B01G568000 chr3D 83.230 161 16 4 2 159 11330980 11331132 2.740000e-28 137.0
35 TraesCS5B01G568000 chr3D 88.095 84 7 2 4832 4912 11264754 11264837 4.650000e-16 97.1
36 TraesCS5B01G568000 chr2A 72.670 1116 256 43 2147 3239 772371814 772372903 5.450000e-85 326.0
37 TraesCS5B01G568000 chr2A 80.597 268 48 3 1031 1296 772370834 772371099 2.660000e-48 204.0
38 TraesCS5B01G568000 chr2A 78.541 233 48 2 2146 2377 779990936 779990705 9.780000e-33 152.0
39 TraesCS5B01G568000 chr2A 84.091 132 18 3 1 130 528753009 528753139 2.130000e-24 124.0
40 TraesCS5B01G568000 chr2A 87.671 73 9 0 1224 1296 779991716 779991644 1.010000e-12 86.1
41 TraesCS5B01G568000 chr1D 87.226 274 33 2 4935 5208 53877031 53876760 1.520000e-80 311.0
42 TraesCS5B01G568000 chr2B 86.268 284 37 2 4925 5208 49080642 49080361 1.970000e-79 307.0
43 TraesCS5B01G568000 chr2B 75.778 450 103 4 2780 3225 787953065 787953512 7.350000e-54 222.0
44 TraesCS5B01G568000 chrUn 86.111 288 34 5 4924 5209 97466177 97466460 7.090000e-79 305.0
45 TraesCS5B01G568000 chr7D 85.965 285 39 1 4924 5208 80797945 80797662 2.550000e-78 303.0
46 TraesCS5B01G568000 chr6D 84.746 295 43 2 4915 5208 91239899 91240192 1.540000e-75 294.0
47 TraesCS5B01G568000 chr6D 87.363 182 18 4 1 179 395343784 395343963 2.660000e-48 204.0
48 TraesCS5B01G568000 chr6D 86.264 182 20 4 1 179 395336783 395336962 5.760000e-45 193.0
49 TraesCS5B01G568000 chr6D 86.264 182 20 4 1 179 395340474 395340653 5.760000e-45 193.0
50 TraesCS5B01G568000 chr6D 86.264 182 20 4 1 179 395345624 395345803 5.760000e-45 193.0
51 TraesCS5B01G568000 chr6D 85.714 182 21 4 1 179 395334934 395335113 2.680000e-43 187.0
52 TraesCS5B01G568000 chr6D 85.635 181 21 4 2 179 395347469 395347647 9.640000e-43 185.0
53 TraesCS5B01G568000 chr6D 84.409 186 20 6 1 179 395338620 395338803 2.090000e-39 174.0
54 TraesCS5B01G568000 chr6D 84.066 182 17 6 1 179 395357909 395358081 1.260000e-36 165.0
55 TraesCS5B01G568000 chr3A 70.810 1247 276 59 3168 4372 737799982 737801182 7.400000e-49 206.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G568000 chr5B 711390643 711396278 5635 False 10408 10408 100.0000 1 5636 1 chr5B.!!$F2 5635
1 TraesCS5B01G568000 chr5B 697827568 697828402 834 True 643 643 80.6600 1957 2801 1 chr5B.!!$R5 844
2 TraesCS5B01G568000 chr5B 479391837 479392909 1072 True 436 436 74.4310 2147 3231 1 chr5B.!!$R2 1084
3 TraesCS5B01G568000 chr5B 479501622 479502848 1226 True 396 396 73.0310 2183 3418 1 chr5B.!!$R3 1235
4 TraesCS5B01G568000 chr3B 815478775 815479994 1219 False 217 217 71.0320 3168 4372 1 chr3B.!!$F3 1204
5 TraesCS5B01G568000 chr5A 504853300 504854550 1250 True 462 462 73.8280 2159 3418 1 chr5A.!!$R2 1259
6 TraesCS5B01G568000 chr5A 504781948 504783009 1061 True 422 422 74.3350 2159 3232 1 chr5A.!!$R1 1073
7 TraesCS5B01G568000 chr5D 399160684 399161721 1037 True 416 416 74.3900 2183 3232 1 chr5D.!!$R1 1049
8 TraesCS5B01G568000 chr2A 772370834 772372903 2069 False 265 326 76.6335 1031 3239 2 chr2A.!!$F2 2208
9 TraesCS5B01G568000 chr3A 737799982 737801182 1200 False 206 206 70.8100 3168 4372 1 chr3A.!!$F1 1204


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
202 203 0.033781 TTTTCTTGGGCTGCATGTGC 59.966 50.0 0.5 0.0 42.50 4.57 F
872 873 0.038251 CGCAGTCACACCTCTAGCAA 60.038 55.0 0.0 0.0 0.00 3.91 F
1830 1980 0.036164 TGCCTGTTGTTAGTCGCCAT 59.964 50.0 0.0 0.0 0.00 4.40 F
2864 3040 0.107459 CTAGGCAGGAGACCCAAAGC 60.107 60.0 0.0 0.0 33.88 3.51 F
3251 3433 0.106967 GGCTGGAGATGGGAAGAACC 60.107 60.0 0.0 0.0 38.08 3.62 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1811 1961 0.036164 ATGGCGACTAACAACAGGCA 59.964 50.0 0.00 0.0 41.46 4.75 R
1962 2112 0.252696 TGGGCATACCAGTCTCCTGT 60.253 55.0 0.00 0.0 46.80 4.00 R
2910 3086 0.042581 TCCACCACAGAGCTCCCATA 59.957 55.0 10.93 0.0 0.00 2.74 R
4101 4333 0.033796 CAGGTCCATGTTGGCTCCAT 60.034 55.0 0.00 0.0 37.47 3.41 R
5124 5359 0.031585 CGGGTGAAAGAGTGACGACA 59.968 55.0 0.00 0.0 0.00 4.35 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 3.899835 CGCGACGAATCTTTTATGTCA 57.100 42.857 0.00 0.00 0.00 3.58
21 22 4.239505 CGCGACGAATCTTTTATGTCAA 57.760 40.909 0.00 0.00 0.00 3.18
22 23 4.634000 CGCGACGAATCTTTTATGTCAAA 58.366 39.130 0.00 0.00 0.00 2.69
23 24 5.076765 CGCGACGAATCTTTTATGTCAAAA 58.923 37.500 0.00 0.00 0.00 2.44
24 25 5.001267 CGCGACGAATCTTTTATGTCAAAAC 59.999 40.000 0.00 0.00 0.00 2.43
25 26 5.849081 GCGACGAATCTTTTATGTCAAAACA 59.151 36.000 0.00 0.00 40.38 2.83
26 27 6.031417 GCGACGAATCTTTTATGTCAAAACAG 59.969 38.462 0.00 0.00 39.20 3.16
27 28 7.069569 CGACGAATCTTTTATGTCAAAACAGT 58.930 34.615 0.00 0.00 39.20 3.55
28 29 7.586300 CGACGAATCTTTTATGTCAAAACAGTT 59.414 33.333 0.00 0.00 39.20 3.16
29 30 9.233232 GACGAATCTTTTATGTCAAAACAGTTT 57.767 29.630 0.00 0.00 39.20 2.66
30 31 9.581099 ACGAATCTTTTATGTCAAAACAGTTTT 57.419 25.926 5.37 5.37 39.20 2.43
41 42 7.517321 TGTCAAAACAGTTTTTCAATTGAAGC 58.483 30.769 19.64 14.07 32.27 3.86
42 43 7.172190 TGTCAAAACAGTTTTTCAATTGAAGCA 59.828 29.630 19.64 9.16 32.27 3.91
43 44 8.014517 GTCAAAACAGTTTTTCAATTGAAGCAA 58.985 29.630 19.64 14.12 32.27 3.91
44 45 8.014517 TCAAAACAGTTTTTCAATTGAAGCAAC 58.985 29.630 24.56 24.56 32.27 4.17
45 46 5.701029 ACAGTTTTTCAATTGAAGCAACG 57.299 34.783 25.05 22.51 35.70 4.10
46 47 4.566360 ACAGTTTTTCAATTGAAGCAACGG 59.434 37.500 26.23 26.23 35.70 4.44
47 48 4.566360 CAGTTTTTCAATTGAAGCAACGGT 59.434 37.500 25.05 14.81 35.70 4.83
48 49 5.063312 CAGTTTTTCAATTGAAGCAACGGTT 59.937 36.000 25.05 14.35 35.70 4.44
49 50 5.641636 AGTTTTTCAATTGAAGCAACGGTTT 59.358 32.000 25.05 14.12 35.70 3.27
50 51 5.462034 TTTTCAATTGAAGCAACGGTTTG 57.538 34.783 19.64 0.00 35.21 2.93
51 52 4.377839 TTCAATTGAAGCAACGGTTTGA 57.622 36.364 16.91 0.00 34.24 2.69
52 53 3.963665 TCAATTGAAGCAACGGTTTGAG 58.036 40.909 5.45 0.00 34.24 3.02
53 54 2.422276 ATTGAAGCAACGGTTTGAGC 57.578 45.000 0.00 0.00 34.24 4.26
54 55 1.388547 TTGAAGCAACGGTTTGAGCT 58.611 45.000 0.00 0.00 39.37 4.09
55 56 2.248280 TGAAGCAACGGTTTGAGCTA 57.752 45.000 4.83 0.00 36.07 3.32
56 57 2.778299 TGAAGCAACGGTTTGAGCTAT 58.222 42.857 4.83 0.00 36.07 2.97
57 58 3.932822 TGAAGCAACGGTTTGAGCTATA 58.067 40.909 4.83 0.00 36.07 1.31
58 59 4.320023 TGAAGCAACGGTTTGAGCTATAA 58.680 39.130 4.83 0.00 36.07 0.98
59 60 4.757657 TGAAGCAACGGTTTGAGCTATAAA 59.242 37.500 4.83 0.00 36.07 1.40
60 61 5.239744 TGAAGCAACGGTTTGAGCTATAAAA 59.760 36.000 4.83 0.00 36.07 1.52
61 62 5.897377 AGCAACGGTTTGAGCTATAAAAT 57.103 34.783 2.70 0.00 35.19 1.82
62 63 5.640732 AGCAACGGTTTGAGCTATAAAATG 58.359 37.500 2.70 0.00 35.19 2.32
63 64 5.183140 AGCAACGGTTTGAGCTATAAAATGT 59.817 36.000 2.70 0.00 35.19 2.71
64 65 5.861787 GCAACGGTTTGAGCTATAAAATGTT 59.138 36.000 0.00 0.00 34.24 2.71
65 66 6.364976 GCAACGGTTTGAGCTATAAAATGTTT 59.635 34.615 0.00 0.00 34.24 2.83
66 67 7.095816 GCAACGGTTTGAGCTATAAAATGTTTT 60.096 33.333 0.00 0.00 34.24 2.43
67 68 7.867445 ACGGTTTGAGCTATAAAATGTTTTG 57.133 32.000 1.16 0.00 0.00 2.44
68 69 7.653647 ACGGTTTGAGCTATAAAATGTTTTGA 58.346 30.769 1.16 0.00 0.00 2.69
69 70 8.138712 ACGGTTTGAGCTATAAAATGTTTTGAA 58.861 29.630 1.16 0.00 0.00 2.69
70 71 9.139174 CGGTTTGAGCTATAAAATGTTTTGAAT 57.861 29.630 1.16 0.00 0.00 2.57
103 104 5.831702 ATTGGAATCTTTCTGACATCAGC 57.168 39.130 3.88 0.00 43.46 4.26
104 105 4.290711 TGGAATCTTTCTGACATCAGCA 57.709 40.909 3.88 0.00 43.46 4.41
105 106 4.851843 TGGAATCTTTCTGACATCAGCAT 58.148 39.130 3.88 0.00 43.46 3.79
106 107 5.258841 TGGAATCTTTCTGACATCAGCATT 58.741 37.500 3.88 0.60 43.46 3.56
107 108 5.713389 TGGAATCTTTCTGACATCAGCATTT 59.287 36.000 3.88 0.00 43.46 2.32
108 109 6.209986 TGGAATCTTTCTGACATCAGCATTTT 59.790 34.615 3.88 0.00 43.46 1.82
109 110 7.095270 GGAATCTTTCTGACATCAGCATTTTT 58.905 34.615 3.88 0.00 43.46 1.94
110 111 7.063074 GGAATCTTTCTGACATCAGCATTTTTG 59.937 37.037 3.88 0.00 43.46 2.44
111 112 6.395426 TCTTTCTGACATCAGCATTTTTGT 57.605 33.333 3.88 0.00 43.46 2.83
112 113 6.441274 TCTTTCTGACATCAGCATTTTTGTC 58.559 36.000 3.88 0.00 43.46 3.18
113 114 6.263842 TCTTTCTGACATCAGCATTTTTGTCT 59.736 34.615 3.88 0.00 43.46 3.41
114 115 5.618056 TCTGACATCAGCATTTTTGTCTC 57.382 39.130 3.88 0.00 43.46 3.36
115 116 5.065235 TCTGACATCAGCATTTTTGTCTCA 58.935 37.500 3.88 0.00 43.46 3.27
116 117 5.049198 TCTGACATCAGCATTTTTGTCTCAC 60.049 40.000 3.88 0.00 43.46 3.51
117 118 4.579753 TGACATCAGCATTTTTGTCTCACA 59.420 37.500 0.00 0.00 39.33 3.58
118 119 5.242171 TGACATCAGCATTTTTGTCTCACAT 59.758 36.000 0.00 0.00 39.33 3.21
119 120 5.466819 ACATCAGCATTTTTGTCTCACATG 58.533 37.500 0.00 0.00 0.00 3.21
120 121 3.904571 TCAGCATTTTTGTCTCACATGC 58.095 40.909 0.00 0.00 32.28 4.06
121 122 3.318557 TCAGCATTTTTGTCTCACATGCA 59.681 39.130 5.32 0.00 33.99 3.96
122 123 4.021807 TCAGCATTTTTGTCTCACATGCAT 60.022 37.500 0.00 0.00 33.99 3.96
123 124 4.091365 CAGCATTTTTGTCTCACATGCATG 59.909 41.667 25.09 25.09 33.99 4.06
124 125 3.181524 GCATTTTTGTCTCACATGCATGC 60.182 43.478 26.53 11.82 32.38 4.06
125 126 3.729862 TTTTTGTCTCACATGCATGCA 57.270 38.095 26.53 25.04 0.00 3.96
126 127 3.945981 TTTTGTCTCACATGCATGCAT 57.054 38.095 27.46 27.46 37.08 3.96
165 166 8.980481 TCAATTTTAAGCTAATTAGGAGAGGG 57.020 34.615 14.28 0.00 0.00 4.30
166 167 7.998964 TCAATTTTAAGCTAATTAGGAGAGGGG 59.001 37.037 14.28 0.00 0.00 4.79
167 168 7.707467 ATTTTAAGCTAATTAGGAGAGGGGA 57.293 36.000 14.28 0.00 0.00 4.81
168 169 6.749036 TTTAAGCTAATTAGGAGAGGGGAG 57.251 41.667 14.28 0.00 0.00 4.30
169 170 4.288324 AAGCTAATTAGGAGAGGGGAGT 57.712 45.455 14.28 0.00 0.00 3.85
170 171 4.288324 AGCTAATTAGGAGAGGGGAGTT 57.712 45.455 14.28 0.00 0.00 3.01
171 172 4.228010 AGCTAATTAGGAGAGGGGAGTTC 58.772 47.826 14.28 0.00 0.00 3.01
172 173 3.967987 GCTAATTAGGAGAGGGGAGTTCA 59.032 47.826 14.28 0.00 0.00 3.18
173 174 4.409247 GCTAATTAGGAGAGGGGAGTTCAA 59.591 45.833 14.28 0.00 0.00 2.69
174 175 5.454045 GCTAATTAGGAGAGGGGAGTTCAAG 60.454 48.000 14.28 0.00 0.00 3.02
175 176 1.867363 TAGGAGAGGGGAGTTCAAGC 58.133 55.000 0.00 0.00 0.00 4.01
176 177 1.219393 GGAGAGGGGAGTTCAAGCG 59.781 63.158 0.00 0.00 0.00 4.68
177 178 1.219393 GAGAGGGGAGTTCAAGCGG 59.781 63.158 0.00 0.00 0.00 5.52
178 179 2.245438 GAGAGGGGAGTTCAAGCGGG 62.245 65.000 0.00 0.00 0.00 6.13
179 180 3.330720 AGGGGAGTTCAAGCGGGG 61.331 66.667 0.00 0.00 0.00 5.73
180 181 3.327404 GGGGAGTTCAAGCGGGGA 61.327 66.667 0.00 0.00 0.00 4.81
181 182 2.754375 GGGAGTTCAAGCGGGGAA 59.246 61.111 0.00 0.00 0.00 3.97
182 183 1.074248 GGGAGTTCAAGCGGGGAAA 59.926 57.895 0.00 0.00 0.00 3.13
183 184 0.323451 GGGAGTTCAAGCGGGGAAAT 60.323 55.000 0.00 0.00 0.00 2.17
184 185 1.545841 GGAGTTCAAGCGGGGAAATT 58.454 50.000 0.00 0.00 0.00 1.82
185 186 1.893137 GGAGTTCAAGCGGGGAAATTT 59.107 47.619 0.00 0.00 0.00 1.82
186 187 2.299013 GGAGTTCAAGCGGGGAAATTTT 59.701 45.455 0.00 0.00 0.00 1.82
187 188 3.575630 GAGTTCAAGCGGGGAAATTTTC 58.424 45.455 0.24 0.24 0.00 2.29
188 189 3.230976 AGTTCAAGCGGGGAAATTTTCT 58.769 40.909 8.93 0.00 0.00 2.52
189 190 3.641436 AGTTCAAGCGGGGAAATTTTCTT 59.359 39.130 8.93 0.00 0.00 2.52
190 191 3.658757 TCAAGCGGGGAAATTTTCTTG 57.341 42.857 8.93 5.63 34.04 3.02
191 192 2.298729 TCAAGCGGGGAAATTTTCTTGG 59.701 45.455 8.93 0.54 33.68 3.61
192 193 1.266178 AGCGGGGAAATTTTCTTGGG 58.734 50.000 8.93 0.00 0.00 4.12
193 194 0.391130 GCGGGGAAATTTTCTTGGGC 60.391 55.000 8.93 4.67 0.00 5.36
194 195 1.266178 CGGGGAAATTTTCTTGGGCT 58.734 50.000 8.93 0.00 0.00 5.19
195 196 1.066929 CGGGGAAATTTTCTTGGGCTG 60.067 52.381 8.93 0.00 0.00 4.85
196 197 1.339055 GGGGAAATTTTCTTGGGCTGC 60.339 52.381 8.93 0.00 0.00 5.25
197 198 1.347378 GGGAAATTTTCTTGGGCTGCA 59.653 47.619 8.93 0.00 0.00 4.41
198 199 2.026915 GGGAAATTTTCTTGGGCTGCAT 60.027 45.455 8.93 0.00 0.00 3.96
199 200 3.004862 GGAAATTTTCTTGGGCTGCATG 58.995 45.455 8.93 0.00 0.00 4.06
200 201 3.557686 GGAAATTTTCTTGGGCTGCATGT 60.558 43.478 8.93 0.00 0.00 3.21
201 202 2.754946 ATTTTCTTGGGCTGCATGTG 57.245 45.000 0.50 0.00 0.00 3.21
202 203 0.033781 TTTTCTTGGGCTGCATGTGC 59.966 50.000 0.50 0.00 42.50 4.57
203 204 2.144833 TTTCTTGGGCTGCATGTGCG 62.145 55.000 0.50 0.00 45.83 5.34
204 205 3.367743 CTTGGGCTGCATGTGCGT 61.368 61.111 0.50 0.00 45.83 5.24
205 206 2.033294 TTGGGCTGCATGTGCGTA 59.967 55.556 0.50 0.00 45.83 4.42
206 207 1.378382 TTGGGCTGCATGTGCGTAT 60.378 52.632 0.50 0.00 45.83 3.06
207 208 1.655885 TTGGGCTGCATGTGCGTATG 61.656 55.000 0.50 0.00 45.83 2.39
215 216 1.801618 CATGTGCGTATGCTTCGTTG 58.198 50.000 8.69 0.94 43.34 4.10
216 217 0.096976 ATGTGCGTATGCTTCGTTGC 59.903 50.000 8.69 0.00 43.34 4.17
217 218 1.577616 GTGCGTATGCTTCGTTGCG 60.578 57.895 8.69 0.00 43.34 4.85
218 219 2.024868 TGCGTATGCTTCGTTGCGT 61.025 52.632 8.69 3.12 43.34 5.24
219 220 0.733223 TGCGTATGCTTCGTTGCGTA 60.733 50.000 8.69 1.46 43.34 4.42
220 221 0.575390 GCGTATGCTTCGTTGCGTAT 59.425 50.000 0.00 0.00 36.89 3.06
221 222 1.395573 GCGTATGCTTCGTTGCGTATC 60.396 52.381 0.00 1.62 36.89 2.24
222 223 1.137260 CGTATGCTTCGTTGCGTATCG 60.137 52.381 0.00 0.00 36.89 2.92
223 224 1.850441 GTATGCTTCGTTGCGTATCGT 59.150 47.619 3.94 0.00 36.89 3.73
224 225 1.355971 ATGCTTCGTTGCGTATCGTT 58.644 45.000 3.94 0.00 35.36 3.85
225 226 1.141645 TGCTTCGTTGCGTATCGTTT 58.858 45.000 3.94 0.00 35.36 3.60
226 227 1.136474 TGCTTCGTTGCGTATCGTTTG 60.136 47.619 3.94 0.00 35.36 2.93
227 228 1.785518 GCTTCGTTGCGTATCGTTTGG 60.786 52.381 3.94 0.00 0.00 3.28
228 229 1.722464 CTTCGTTGCGTATCGTTTGGA 59.278 47.619 3.94 0.00 0.00 3.53
229 230 1.999048 TCGTTGCGTATCGTTTGGAT 58.001 45.000 3.94 0.00 39.25 3.41
230 231 1.921887 TCGTTGCGTATCGTTTGGATC 59.078 47.619 3.94 0.00 36.55 3.36
231 232 1.924524 CGTTGCGTATCGTTTGGATCT 59.075 47.619 0.00 0.00 36.55 2.75
232 233 2.285026 CGTTGCGTATCGTTTGGATCTG 60.285 50.000 0.00 0.00 36.55 2.90
233 234 2.665649 TGCGTATCGTTTGGATCTGT 57.334 45.000 0.00 0.00 36.55 3.41
234 235 2.967362 TGCGTATCGTTTGGATCTGTT 58.033 42.857 0.00 0.00 36.55 3.16
235 236 4.112716 TGCGTATCGTTTGGATCTGTTA 57.887 40.909 0.00 0.00 36.55 2.41
236 237 3.861113 TGCGTATCGTTTGGATCTGTTAC 59.139 43.478 0.00 0.00 36.55 2.50
237 238 4.110482 GCGTATCGTTTGGATCTGTTACT 58.890 43.478 0.00 0.00 36.55 2.24
238 239 5.163632 TGCGTATCGTTTGGATCTGTTACTA 60.164 40.000 0.00 0.00 36.55 1.82
239 240 5.745294 GCGTATCGTTTGGATCTGTTACTAA 59.255 40.000 0.00 0.00 36.55 2.24
240 241 6.420008 GCGTATCGTTTGGATCTGTTACTAAT 59.580 38.462 0.00 0.00 36.55 1.73
241 242 7.567048 GCGTATCGTTTGGATCTGTTACTAATG 60.567 40.741 0.00 0.00 36.55 1.90
242 243 7.646526 CGTATCGTTTGGATCTGTTACTAATGA 59.353 37.037 0.00 0.00 36.55 2.57
243 244 8.969267 GTATCGTTTGGATCTGTTACTAATGAG 58.031 37.037 0.00 0.00 36.55 2.90
244 245 5.810587 TCGTTTGGATCTGTTACTAATGAGC 59.189 40.000 0.00 0.00 0.00 4.26
245 246 5.276395 CGTTTGGATCTGTTACTAATGAGCG 60.276 44.000 0.00 0.00 0.00 5.03
246 247 4.322080 TGGATCTGTTACTAATGAGCGG 57.678 45.455 0.00 0.00 0.00 5.52
247 248 3.704566 TGGATCTGTTACTAATGAGCGGT 59.295 43.478 0.00 0.00 0.00 5.68
248 249 4.202121 TGGATCTGTTACTAATGAGCGGTC 60.202 45.833 7.89 7.89 0.00 4.79
249 250 4.202121 GGATCTGTTACTAATGAGCGGTCA 60.202 45.833 21.02 21.02 37.02 4.02
250 251 4.371855 TCTGTTACTAATGAGCGGTCAG 57.628 45.455 23.06 11.84 35.66 3.51
251 252 3.762288 TCTGTTACTAATGAGCGGTCAGT 59.238 43.478 23.06 22.44 35.66 3.41
252 253 4.219944 TCTGTTACTAATGAGCGGTCAGTT 59.780 41.667 23.30 17.59 35.66 3.16
253 254 4.242475 TGTTACTAATGAGCGGTCAGTTG 58.758 43.478 23.30 22.18 35.66 3.16
254 255 2.386661 ACTAATGAGCGGTCAGTTGG 57.613 50.000 23.30 18.65 35.66 3.77
255 256 1.899814 ACTAATGAGCGGTCAGTTGGA 59.100 47.619 23.30 4.30 35.66 3.53
256 257 2.301870 ACTAATGAGCGGTCAGTTGGAA 59.698 45.455 23.30 3.92 35.66 3.53
257 258 1.813513 AATGAGCGGTCAGTTGGAAG 58.186 50.000 23.06 0.00 35.66 3.46
258 259 0.687354 ATGAGCGGTCAGTTGGAAGT 59.313 50.000 23.06 0.00 35.66 3.01
259 260 0.468226 TGAGCGGTCAGTTGGAAGTT 59.532 50.000 14.39 0.00 0.00 2.66
260 261 1.689813 TGAGCGGTCAGTTGGAAGTTA 59.310 47.619 14.39 0.00 0.00 2.24
261 262 2.288825 TGAGCGGTCAGTTGGAAGTTAG 60.289 50.000 14.39 0.00 0.00 2.34
262 263 1.692519 AGCGGTCAGTTGGAAGTTAGT 59.307 47.619 0.00 0.00 0.00 2.24
263 264 2.067013 GCGGTCAGTTGGAAGTTAGTC 58.933 52.381 0.00 0.00 0.00 2.59
264 265 2.288886 GCGGTCAGTTGGAAGTTAGTCT 60.289 50.000 0.00 0.00 0.00 3.24
265 266 3.318017 CGGTCAGTTGGAAGTTAGTCTG 58.682 50.000 0.00 0.00 0.00 3.51
266 267 3.067833 GGTCAGTTGGAAGTTAGTCTGC 58.932 50.000 0.00 0.00 0.00 4.26
267 268 3.244249 GGTCAGTTGGAAGTTAGTCTGCT 60.244 47.826 0.00 0.00 0.00 4.24
268 269 3.991121 GTCAGTTGGAAGTTAGTCTGCTC 59.009 47.826 0.00 0.00 0.00 4.26
269 270 3.006967 TCAGTTGGAAGTTAGTCTGCTCC 59.993 47.826 0.00 0.00 0.00 4.70
270 271 2.972713 AGTTGGAAGTTAGTCTGCTCCA 59.027 45.455 0.00 0.00 32.92 3.86
271 272 3.391296 AGTTGGAAGTTAGTCTGCTCCAA 59.609 43.478 0.00 0.00 39.40 3.53
272 273 4.042187 AGTTGGAAGTTAGTCTGCTCCAAT 59.958 41.667 5.23 0.00 41.90 3.16
273 274 4.640771 TGGAAGTTAGTCTGCTCCAATT 57.359 40.909 0.00 0.00 32.13 2.32
274 275 4.985538 TGGAAGTTAGTCTGCTCCAATTT 58.014 39.130 0.00 0.00 32.13 1.82
275 276 5.385198 TGGAAGTTAGTCTGCTCCAATTTT 58.615 37.500 0.00 0.00 32.13 1.82
276 277 5.833131 TGGAAGTTAGTCTGCTCCAATTTTT 59.167 36.000 0.00 0.00 32.13 1.94
299 300 7.920160 TTTTATACCCCACTAACGGTTTTAG 57.080 36.000 0.00 0.00 33.36 1.85
300 301 2.865119 ACCCCACTAACGGTTTTAGG 57.135 50.000 0.00 0.00 0.00 2.69
301 302 1.352017 ACCCCACTAACGGTTTTAGGG 59.648 52.381 13.95 13.95 39.33 3.53
302 303 1.456296 CCCACTAACGGTTTTAGGGC 58.544 55.000 0.00 0.00 0.00 5.19
303 304 1.003928 CCCACTAACGGTTTTAGGGCT 59.996 52.381 0.00 0.00 0.00 5.19
304 305 2.553685 CCCACTAACGGTTTTAGGGCTT 60.554 50.000 0.00 0.00 0.00 4.35
305 306 2.745821 CCACTAACGGTTTTAGGGCTTC 59.254 50.000 0.00 0.00 0.00 3.86
306 307 3.558533 CCACTAACGGTTTTAGGGCTTCT 60.559 47.826 0.00 0.00 0.00 2.85
307 308 3.435671 CACTAACGGTTTTAGGGCTTCTG 59.564 47.826 0.00 0.00 0.00 3.02
308 309 1.244816 AACGGTTTTAGGGCTTCTGC 58.755 50.000 0.00 0.00 38.76 4.26
309 310 0.400594 ACGGTTTTAGGGCTTCTGCT 59.599 50.000 0.00 0.00 39.59 4.24
310 311 1.626825 ACGGTTTTAGGGCTTCTGCTA 59.373 47.619 0.00 0.00 39.59 3.49
311 312 2.280628 CGGTTTTAGGGCTTCTGCTAG 58.719 52.381 0.00 0.00 39.59 3.42
312 313 2.354805 CGGTTTTAGGGCTTCTGCTAGT 60.355 50.000 0.00 0.00 39.59 2.57
313 314 3.687125 GGTTTTAGGGCTTCTGCTAGTT 58.313 45.455 0.00 0.00 39.59 2.24
314 315 3.690139 GGTTTTAGGGCTTCTGCTAGTTC 59.310 47.826 0.00 0.00 39.59 3.01
315 316 3.629142 TTTAGGGCTTCTGCTAGTTCC 57.371 47.619 0.00 0.00 39.59 3.62
316 317 1.112113 TAGGGCTTCTGCTAGTTCCG 58.888 55.000 0.00 0.00 39.59 4.30
317 318 1.153349 GGGCTTCTGCTAGTTCCGG 60.153 63.158 0.00 0.00 39.59 5.14
318 319 1.815840 GGCTTCTGCTAGTTCCGGC 60.816 63.158 0.00 0.00 39.59 6.13
319 320 1.219393 GCTTCTGCTAGTTCCGGCT 59.781 57.895 0.00 0.00 36.03 5.52
320 321 0.391793 GCTTCTGCTAGTTCCGGCTT 60.392 55.000 0.00 0.00 36.03 4.35
321 322 1.134788 GCTTCTGCTAGTTCCGGCTTA 60.135 52.381 0.00 0.00 36.03 3.09
322 323 2.815478 CTTCTGCTAGTTCCGGCTTAG 58.185 52.381 0.00 0.00 0.00 2.18
323 324 2.139323 TCTGCTAGTTCCGGCTTAGA 57.861 50.000 0.00 0.00 0.00 2.10
324 325 2.025155 TCTGCTAGTTCCGGCTTAGAG 58.975 52.381 0.00 0.00 0.00 2.43
325 326 1.067821 CTGCTAGTTCCGGCTTAGAGG 59.932 57.143 0.00 0.00 0.00 3.69
326 327 1.341679 TGCTAGTTCCGGCTTAGAGGA 60.342 52.381 0.00 0.00 34.19 3.71
327 328 1.338655 GCTAGTTCCGGCTTAGAGGAG 59.661 57.143 0.00 0.00 37.88 3.69
328 329 1.957877 CTAGTTCCGGCTTAGAGGAGG 59.042 57.143 0.00 0.00 37.88 4.30
329 330 0.335361 AGTTCCGGCTTAGAGGAGGA 59.665 55.000 0.00 0.00 37.88 3.71
330 331 1.192428 GTTCCGGCTTAGAGGAGGAA 58.808 55.000 0.00 0.00 37.88 3.36
331 332 1.553704 GTTCCGGCTTAGAGGAGGAAA 59.446 52.381 0.00 0.00 41.90 3.13
332 333 1.192428 TCCGGCTTAGAGGAGGAAAC 58.808 55.000 0.00 0.00 31.95 2.78
333 334 0.178301 CCGGCTTAGAGGAGGAAACC 59.822 60.000 0.00 0.00 0.00 3.27
334 335 0.178301 CGGCTTAGAGGAGGAAACCC 59.822 60.000 0.00 0.00 0.00 4.11
335 336 1.585895 GGCTTAGAGGAGGAAACCCT 58.414 55.000 0.00 0.00 36.57 4.34
336 337 1.210722 GGCTTAGAGGAGGAAACCCTG 59.789 57.143 0.00 0.00 33.25 4.45
337 338 2.188817 GCTTAGAGGAGGAAACCCTGA 58.811 52.381 0.00 0.00 33.25 3.86
338 339 2.572104 GCTTAGAGGAGGAAACCCTGAA 59.428 50.000 0.00 0.00 33.25 3.02
339 340 3.009143 GCTTAGAGGAGGAAACCCTGAAA 59.991 47.826 0.00 0.00 33.25 2.69
340 341 4.324641 GCTTAGAGGAGGAAACCCTGAAAT 60.325 45.833 0.00 0.00 33.25 2.17
341 342 5.808050 GCTTAGAGGAGGAAACCCTGAAATT 60.808 44.000 0.00 0.00 33.25 1.82
342 343 4.749048 AGAGGAGGAAACCCTGAAATTT 57.251 40.909 0.00 0.00 33.25 1.82
343 344 5.860648 AGAGGAGGAAACCCTGAAATTTA 57.139 39.130 0.00 0.00 33.25 1.40
344 345 5.571285 AGAGGAGGAAACCCTGAAATTTAC 58.429 41.667 0.00 0.00 33.25 2.01
345 346 5.313506 AGAGGAGGAAACCCTGAAATTTACT 59.686 40.000 0.00 0.00 33.25 2.24
346 347 5.571285 AGGAGGAAACCCTGAAATTTACTC 58.429 41.667 1.06 1.06 42.71 2.59
347 348 5.899120 GAGGAAACCCTGAAATTTACTCC 57.101 43.478 0.00 0.00 39.10 3.85
348 349 5.571285 GAGGAAACCCTGAAATTTACTCCT 58.429 41.667 0.00 0.00 39.10 3.69
349 350 5.571285 AGGAAACCCTGAAATTTACTCCTC 58.429 41.667 0.00 0.00 31.48 3.71
350 351 5.313506 AGGAAACCCTGAAATTTACTCCTCT 59.686 40.000 0.00 0.00 31.48 3.69
351 352 6.504279 AGGAAACCCTGAAATTTACTCCTCTA 59.496 38.462 0.00 0.00 31.48 2.43
352 353 6.824196 GGAAACCCTGAAATTTACTCCTCTAG 59.176 42.308 0.00 0.00 0.00 2.43
353 354 7.311109 GGAAACCCTGAAATTTACTCCTCTAGA 60.311 40.741 0.00 0.00 0.00 2.43
354 355 6.547930 ACCCTGAAATTTACTCCTCTAGAC 57.452 41.667 0.00 0.00 0.00 2.59
355 356 5.127356 ACCCTGAAATTTACTCCTCTAGACG 59.873 44.000 0.00 0.00 0.00 4.18
356 357 5.452077 CCCTGAAATTTACTCCTCTAGACGG 60.452 48.000 0.00 0.00 0.00 4.79
357 358 5.127356 CCTGAAATTTACTCCTCTAGACGGT 59.873 44.000 7.76 1.78 0.00 4.83
358 359 6.351117 CCTGAAATTTACTCCTCTAGACGGTT 60.351 42.308 7.76 1.41 0.00 4.44
359 360 7.147949 CCTGAAATTTACTCCTCTAGACGGTTA 60.148 40.741 7.76 0.70 0.00 2.85
360 361 7.542025 TGAAATTTACTCCTCTAGACGGTTAC 58.458 38.462 7.76 0.00 0.00 2.50
361 362 7.177216 TGAAATTTACTCCTCTAGACGGTTACA 59.823 37.037 7.76 0.00 0.00 2.41
362 363 6.696441 ATTTACTCCTCTAGACGGTTACAG 57.304 41.667 7.76 2.33 0.00 2.74
363 364 3.002038 ACTCCTCTAGACGGTTACAGG 57.998 52.381 7.76 0.00 0.00 4.00
364 365 2.299521 CTCCTCTAGACGGTTACAGGG 58.700 57.143 7.76 0.00 0.00 4.45
365 366 1.064166 TCCTCTAGACGGTTACAGGGG 60.064 57.143 7.76 0.00 0.00 4.79
366 367 1.064166 CCTCTAGACGGTTACAGGGGA 60.064 57.143 0.00 0.00 29.34 4.81
367 368 2.424523 CCTCTAGACGGTTACAGGGGAT 60.425 54.545 0.00 0.00 29.34 3.85
368 369 2.885894 CTCTAGACGGTTACAGGGGATC 59.114 54.545 0.00 0.00 0.00 3.36
369 370 1.607628 CTAGACGGTTACAGGGGATCG 59.392 57.143 0.00 0.00 0.00 3.69
370 371 1.041447 AGACGGTTACAGGGGATCGG 61.041 60.000 0.00 0.00 0.00 4.18
371 372 1.305549 ACGGTTACAGGGGATCGGT 60.306 57.895 0.00 0.00 0.00 4.69
372 373 0.906282 ACGGTTACAGGGGATCGGTT 60.906 55.000 0.00 0.00 0.00 4.44
373 374 1.113788 CGGTTACAGGGGATCGGTTA 58.886 55.000 0.00 0.00 0.00 2.85
374 375 1.068127 CGGTTACAGGGGATCGGTTAG 59.932 57.143 0.00 0.00 0.00 2.34
375 376 2.391678 GGTTACAGGGGATCGGTTAGA 58.608 52.381 0.00 0.00 0.00 2.10
376 377 2.364647 GGTTACAGGGGATCGGTTAGAG 59.635 54.545 0.00 0.00 0.00 2.43
377 378 3.029570 GTTACAGGGGATCGGTTAGAGT 58.970 50.000 0.00 0.00 0.00 3.24
378 379 2.249309 ACAGGGGATCGGTTAGAGTT 57.751 50.000 0.00 0.00 0.00 3.01
379 380 1.831736 ACAGGGGATCGGTTAGAGTTG 59.168 52.381 0.00 0.00 0.00 3.16
380 381 2.108168 CAGGGGATCGGTTAGAGTTGA 58.892 52.381 0.00 0.00 0.00 3.18
381 382 2.700897 CAGGGGATCGGTTAGAGTTGAT 59.299 50.000 0.00 0.00 0.00 2.57
382 383 2.966516 AGGGGATCGGTTAGAGTTGATC 59.033 50.000 0.00 0.00 37.18 2.92
383 384 2.966516 GGGGATCGGTTAGAGTTGATCT 59.033 50.000 0.00 0.00 42.47 2.75
384 385 4.140994 AGGGGATCGGTTAGAGTTGATCTA 60.141 45.833 0.00 0.00 39.64 1.98
385 386 4.587684 GGGGATCGGTTAGAGTTGATCTAA 59.412 45.833 0.00 0.00 46.16 2.10
394 395 6.534475 TTAGAGTTGATCTAAGCCGGTAAA 57.466 37.500 1.90 0.00 44.01 2.01
395 396 5.615925 AGAGTTGATCTAAGCCGGTAAAT 57.384 39.130 1.90 0.00 36.10 1.40
396 397 5.360591 AGAGTTGATCTAAGCCGGTAAATG 58.639 41.667 1.90 0.00 36.10 2.32
397 398 5.128827 AGAGTTGATCTAAGCCGGTAAATGA 59.871 40.000 1.90 0.00 36.10 2.57
398 399 5.741011 AGTTGATCTAAGCCGGTAAATGAA 58.259 37.500 1.90 0.00 0.00 2.57
399 400 5.585047 AGTTGATCTAAGCCGGTAAATGAAC 59.415 40.000 1.90 1.30 0.00 3.18
400 401 4.116961 TGATCTAAGCCGGTAAATGAACG 58.883 43.478 1.90 0.00 0.00 3.95
401 402 3.872511 TCTAAGCCGGTAAATGAACGA 57.127 42.857 1.90 0.00 0.00 3.85
402 403 4.191033 TCTAAGCCGGTAAATGAACGAA 57.809 40.909 1.90 0.00 0.00 3.85
403 404 4.761975 TCTAAGCCGGTAAATGAACGAAT 58.238 39.130 1.90 0.00 0.00 3.34
404 405 5.180271 TCTAAGCCGGTAAATGAACGAATT 58.820 37.500 1.90 0.00 0.00 2.17
405 406 4.776795 AAGCCGGTAAATGAACGAATTT 57.223 36.364 1.90 0.00 34.24 1.82
406 407 4.351131 AGCCGGTAAATGAACGAATTTC 57.649 40.909 1.90 0.00 32.16 2.17
415 416 3.852471 TGAACGAATTTCAGTGTGACG 57.148 42.857 0.00 0.00 39.45 4.35
416 417 3.449632 TGAACGAATTTCAGTGTGACGA 58.550 40.909 0.00 0.00 39.45 4.20
417 418 4.055360 TGAACGAATTTCAGTGTGACGAT 58.945 39.130 0.00 0.00 39.45 3.73
418 419 4.084589 TGAACGAATTTCAGTGTGACGATG 60.085 41.667 0.00 0.00 39.45 3.84
419 420 2.736721 ACGAATTTCAGTGTGACGATGG 59.263 45.455 0.00 0.00 0.00 3.51
420 421 2.094258 CGAATTTCAGTGTGACGATGGG 59.906 50.000 0.00 0.00 0.00 4.00
421 422 2.859165 ATTTCAGTGTGACGATGGGT 57.141 45.000 0.00 0.00 0.00 4.51
422 423 3.973206 ATTTCAGTGTGACGATGGGTA 57.027 42.857 0.00 0.00 0.00 3.69
423 424 3.973206 TTTCAGTGTGACGATGGGTAT 57.027 42.857 0.00 0.00 0.00 2.73
424 425 3.973206 TTCAGTGTGACGATGGGTATT 57.027 42.857 0.00 0.00 0.00 1.89
425 426 5.408880 TTTCAGTGTGACGATGGGTATTA 57.591 39.130 0.00 0.00 0.00 0.98
426 427 5.408880 TTCAGTGTGACGATGGGTATTAA 57.591 39.130 0.00 0.00 0.00 1.40
427 428 4.751060 TCAGTGTGACGATGGGTATTAAC 58.249 43.478 0.00 0.00 0.00 2.01
428 429 4.464951 TCAGTGTGACGATGGGTATTAACT 59.535 41.667 0.00 0.00 0.00 2.24
429 430 4.804139 CAGTGTGACGATGGGTATTAACTC 59.196 45.833 0.00 0.00 0.00 3.01
430 431 4.464951 AGTGTGACGATGGGTATTAACTCA 59.535 41.667 0.00 0.00 41.40 3.41
431 432 4.565564 GTGTGACGATGGGTATTAACTCAC 59.434 45.833 0.00 0.00 39.47 3.51
432 433 4.221041 TGTGACGATGGGTATTAACTCACA 59.779 41.667 0.00 0.00 39.47 3.58
433 434 5.172934 GTGACGATGGGTATTAACTCACAA 58.827 41.667 0.00 0.00 39.47 3.33
434 435 5.640357 GTGACGATGGGTATTAACTCACAAA 59.360 40.000 0.00 0.00 39.47 2.83
435 436 6.315393 GTGACGATGGGTATTAACTCACAAAT 59.685 38.462 0.00 0.00 39.47 2.32
436 437 6.882140 TGACGATGGGTATTAACTCACAAATT 59.118 34.615 0.00 0.00 39.47 1.82
437 438 7.392113 TGACGATGGGTATTAACTCACAAATTT 59.608 33.333 0.00 0.00 39.47 1.82
438 439 7.535139 ACGATGGGTATTAACTCACAAATTTG 58.465 34.615 16.67 16.67 39.47 2.32
439 440 7.392113 ACGATGGGTATTAACTCACAAATTTGA 59.608 33.333 24.64 2.21 39.47 2.69
440 441 8.405531 CGATGGGTATTAACTCACAAATTTGAT 58.594 33.333 24.64 8.18 39.47 2.57
450 451 8.641498 AACTCACAAATTTGATAACATCTCCT 57.359 30.769 24.64 0.00 0.00 3.69
451 452 8.048534 ACTCACAAATTTGATAACATCTCCTG 57.951 34.615 24.64 7.79 0.00 3.86
452 453 7.667219 ACTCACAAATTTGATAACATCTCCTGT 59.333 33.333 24.64 0.00 40.84 4.00
453 454 8.044060 TCACAAATTTGATAACATCTCCTGTC 57.956 34.615 24.64 0.00 36.98 3.51
454 455 6.963242 CACAAATTTGATAACATCTCCTGTCG 59.037 38.462 24.64 0.00 36.98 4.35
455 456 6.094048 ACAAATTTGATAACATCTCCTGTCGG 59.906 38.462 24.64 0.00 36.98 4.79
456 457 4.819105 TTTGATAACATCTCCTGTCGGT 57.181 40.909 0.00 0.00 36.98 4.69
457 458 3.801114 TGATAACATCTCCTGTCGGTG 57.199 47.619 0.00 0.00 36.98 4.94
458 459 3.361786 TGATAACATCTCCTGTCGGTGA 58.638 45.455 0.00 0.00 36.98 4.02
459 460 3.381590 TGATAACATCTCCTGTCGGTGAG 59.618 47.826 0.00 0.00 36.98 3.51
460 461 1.924731 AACATCTCCTGTCGGTGAGA 58.075 50.000 0.00 0.00 41.55 3.27
461 462 2.151502 ACATCTCCTGTCGGTGAGAT 57.848 50.000 6.77 6.77 46.59 2.75
463 464 2.443958 ATCTCCTGTCGGTGAGATGA 57.556 50.000 10.28 0.00 44.54 2.92
464 465 1.464734 TCTCCTGTCGGTGAGATGAC 58.535 55.000 0.00 0.00 32.84 3.06
465 466 1.177401 CTCCTGTCGGTGAGATGACA 58.823 55.000 0.00 0.00 42.49 3.58
466 467 0.888619 TCCTGTCGGTGAGATGACAC 59.111 55.000 0.00 0.00 40.02 3.67
467 468 0.603065 CCTGTCGGTGAGATGACACA 59.397 55.000 0.00 0.00 40.02 3.72
468 469 1.403382 CCTGTCGGTGAGATGACACAG 60.403 57.143 0.00 0.00 40.02 3.66
469 470 1.541588 CTGTCGGTGAGATGACACAGA 59.458 52.381 0.00 0.00 40.02 3.41
470 471 1.541588 TGTCGGTGAGATGACACAGAG 59.458 52.381 0.00 0.00 43.09 3.35
471 472 1.542030 GTCGGTGAGATGACACAGAGT 59.458 52.381 0.00 0.00 43.09 3.24
472 473 2.029828 GTCGGTGAGATGACACAGAGTT 60.030 50.000 0.00 0.00 43.09 3.01
473 474 2.628178 TCGGTGAGATGACACAGAGTTT 59.372 45.455 0.00 0.00 39.26 2.66
474 475 2.989840 CGGTGAGATGACACAGAGTTTC 59.010 50.000 0.00 0.00 41.88 2.78
475 476 3.305676 CGGTGAGATGACACAGAGTTTCT 60.306 47.826 0.00 0.00 41.88 2.52
476 477 4.082733 CGGTGAGATGACACAGAGTTTCTA 60.083 45.833 0.00 0.00 41.88 2.10
477 478 5.164954 GGTGAGATGACACAGAGTTTCTAC 58.835 45.833 0.00 0.00 41.88 2.59
478 479 5.047660 GGTGAGATGACACAGAGTTTCTACT 60.048 44.000 0.00 0.00 41.88 2.57
479 480 6.451393 GTGAGATGACACAGAGTTTCTACTT 58.549 40.000 0.00 0.00 40.11 2.24
480 481 6.926272 GTGAGATGACACAGAGTTTCTACTTT 59.074 38.462 0.00 0.00 40.11 2.66
481 482 7.115663 GTGAGATGACACAGAGTTTCTACTTTC 59.884 40.741 0.00 0.00 40.11 2.62
482 483 7.014711 TGAGATGACACAGAGTTTCTACTTTCT 59.985 37.037 0.00 0.00 33.84 2.52
483 484 8.410673 AGATGACACAGAGTTTCTACTTTCTA 57.589 34.615 0.00 0.00 33.84 2.10
484 485 8.519526 AGATGACACAGAGTTTCTACTTTCTAG 58.480 37.037 0.00 0.00 33.84 2.43
485 486 7.584122 TGACACAGAGTTTCTACTTTCTAGT 57.416 36.000 0.00 0.00 38.44 2.57
486 487 8.008513 TGACACAGAGTTTCTACTTTCTAGTT 57.991 34.615 0.00 0.00 35.78 2.24
487 488 8.475639 TGACACAGAGTTTCTACTTTCTAGTTT 58.524 33.333 0.00 0.00 35.78 2.66
488 489 9.962783 GACACAGAGTTTCTACTTTCTAGTTTA 57.037 33.333 0.00 0.00 35.78 2.01
489 490 9.968870 ACACAGAGTTTCTACTTTCTAGTTTAG 57.031 33.333 0.00 0.00 35.78 1.85
490 491 9.968870 CACAGAGTTTCTACTTTCTAGTTTAGT 57.031 33.333 0.00 0.00 35.78 2.24
491 492 9.968870 ACAGAGTTTCTACTTTCTAGTTTAGTG 57.031 33.333 0.00 0.00 35.78 2.74
492 493 9.413048 CAGAGTTTCTACTTTCTAGTTTAGTGG 57.587 37.037 0.00 0.00 35.78 4.00
493 494 8.586744 AGAGTTTCTACTTTCTAGTTTAGTGGG 58.413 37.037 0.00 0.00 35.78 4.61
494 495 8.260099 AGTTTCTACTTTCTAGTTTAGTGGGT 57.740 34.615 0.00 0.00 35.78 4.51
495 496 9.372189 AGTTTCTACTTTCTAGTTTAGTGGGTA 57.628 33.333 0.00 0.00 35.78 3.69
496 497 9.636879 GTTTCTACTTTCTAGTTTAGTGGGTAG 57.363 37.037 0.00 0.00 35.78 3.18
497 498 8.946797 TTCTACTTTCTAGTTTAGTGGGTAGT 57.053 34.615 0.00 0.00 35.78 2.73
501 502 8.718158 ACTTTCTAGTTTAGTGGGTAGTAAGT 57.282 34.615 0.00 0.00 31.83 2.24
502 503 9.152327 ACTTTCTAGTTTAGTGGGTAGTAAGTT 57.848 33.333 0.00 0.00 32.39 2.66
503 504 9.993454 CTTTCTAGTTTAGTGGGTAGTAAGTTT 57.007 33.333 0.00 0.00 0.00 2.66
504 505 9.987272 TTTCTAGTTTAGTGGGTAGTAAGTTTC 57.013 33.333 0.00 0.00 0.00 2.78
505 506 8.127150 TCTAGTTTAGTGGGTAGTAAGTTTCC 57.873 38.462 0.00 0.00 0.00 3.13
506 507 7.952368 TCTAGTTTAGTGGGTAGTAAGTTTCCT 59.048 37.037 0.00 0.00 0.00 3.36
507 508 7.384524 AGTTTAGTGGGTAGTAAGTTTCCTT 57.615 36.000 0.00 0.00 34.56 3.36
508 509 7.809238 AGTTTAGTGGGTAGTAAGTTTCCTTT 58.191 34.615 0.00 0.00 31.89 3.11
509 510 7.718314 AGTTTAGTGGGTAGTAAGTTTCCTTTG 59.282 37.037 0.00 0.00 31.89 2.77
510 511 4.395625 AGTGGGTAGTAAGTTTCCTTTGC 58.604 43.478 0.00 0.00 31.89 3.68
511 512 3.187842 GTGGGTAGTAAGTTTCCTTTGCG 59.812 47.826 0.00 0.00 31.89 4.85
512 513 3.071312 TGGGTAGTAAGTTTCCTTTGCGA 59.929 43.478 0.00 0.00 31.89 5.10
513 514 3.683340 GGGTAGTAAGTTTCCTTTGCGAG 59.317 47.826 0.00 0.00 31.89 5.03
515 516 3.487120 AGTAAGTTTCCTTTGCGAGGT 57.513 42.857 5.91 0.00 46.39 3.85
516 517 3.816994 AGTAAGTTTCCTTTGCGAGGTT 58.183 40.909 5.91 0.00 46.39 3.50
517 518 3.813724 AGTAAGTTTCCTTTGCGAGGTTC 59.186 43.478 5.91 0.00 46.39 3.62
518 519 2.341846 AGTTTCCTTTGCGAGGTTCA 57.658 45.000 5.91 0.00 46.39 3.18
519 520 2.863809 AGTTTCCTTTGCGAGGTTCAT 58.136 42.857 5.91 0.00 46.39 2.57
520 521 3.222603 AGTTTCCTTTGCGAGGTTCATT 58.777 40.909 5.91 0.00 46.39 2.57
521 522 3.636764 AGTTTCCTTTGCGAGGTTCATTT 59.363 39.130 5.91 0.00 46.39 2.32
522 523 4.099419 AGTTTCCTTTGCGAGGTTCATTTT 59.901 37.500 5.91 0.00 46.39 1.82
523 524 4.664150 TTCCTTTGCGAGGTTCATTTTT 57.336 36.364 5.91 0.00 46.39 1.94
524 525 4.237349 TCCTTTGCGAGGTTCATTTTTC 57.763 40.909 5.91 0.00 46.39 2.29
525 526 3.888930 TCCTTTGCGAGGTTCATTTTTCT 59.111 39.130 5.91 0.00 46.39 2.52
526 527 4.023193 TCCTTTGCGAGGTTCATTTTTCTC 60.023 41.667 5.91 0.00 46.39 2.87
533 534 5.132437 GAGGTTCATTTTTCTCGATCGAC 57.868 43.478 15.15 0.34 0.00 4.20
534 535 3.612860 AGGTTCATTTTTCTCGATCGACG 59.387 43.478 15.15 10.75 44.09 5.12
535 536 3.334573 GTTCATTTTTCTCGATCGACGC 58.665 45.455 15.15 0.00 42.26 5.19
536 537 2.601804 TCATTTTTCTCGATCGACGCA 58.398 42.857 15.15 0.00 42.26 5.24
537 538 2.344441 TCATTTTTCTCGATCGACGCAC 59.656 45.455 15.15 0.00 42.26 5.34
538 539 2.060326 TTTTTCTCGATCGACGCACT 57.940 45.000 15.15 0.00 42.26 4.40
539 540 1.336877 TTTTCTCGATCGACGCACTG 58.663 50.000 15.15 3.35 42.26 3.66
540 541 0.456142 TTTCTCGATCGACGCACTGG 60.456 55.000 15.15 2.55 42.26 4.00
541 542 1.303091 TTCTCGATCGACGCACTGGA 61.303 55.000 15.15 5.23 42.26 3.86
542 543 1.095807 TCTCGATCGACGCACTGGAT 61.096 55.000 15.15 0.00 42.26 3.41
543 544 0.932123 CTCGATCGACGCACTGGATG 60.932 60.000 15.15 0.00 42.26 3.51
544 545 1.064134 CGATCGACGCACTGGATGA 59.936 57.895 10.26 0.00 34.51 2.92
545 546 0.525455 CGATCGACGCACTGGATGAA 60.525 55.000 10.26 0.00 34.51 2.57
546 547 1.640428 GATCGACGCACTGGATGAAA 58.360 50.000 0.00 0.00 0.00 2.69
547 548 1.590238 GATCGACGCACTGGATGAAAG 59.410 52.381 0.00 0.00 0.00 2.62
548 549 0.389817 TCGACGCACTGGATGAAAGG 60.390 55.000 0.00 0.00 0.00 3.11
549 550 1.361668 CGACGCACTGGATGAAAGGG 61.362 60.000 0.00 0.00 0.00 3.95
550 551 1.648467 GACGCACTGGATGAAAGGGC 61.648 60.000 0.00 0.00 40.84 5.19
551 552 1.377725 CGCACTGGATGAAAGGGCT 60.378 57.895 0.00 0.00 42.14 5.19
552 553 1.651240 CGCACTGGATGAAAGGGCTG 61.651 60.000 0.00 0.00 42.14 4.85
553 554 1.318158 GCACTGGATGAAAGGGCTGG 61.318 60.000 0.00 0.00 41.06 4.85
554 555 0.038744 CACTGGATGAAAGGGCTGGT 59.961 55.000 0.00 0.00 0.00 4.00
555 556 0.038744 ACTGGATGAAAGGGCTGGTG 59.961 55.000 0.00 0.00 0.00 4.17
556 557 0.329261 CTGGATGAAAGGGCTGGTGA 59.671 55.000 0.00 0.00 0.00 4.02
557 558 1.002069 TGGATGAAAGGGCTGGTGAT 58.998 50.000 0.00 0.00 0.00 3.06
558 559 1.341285 TGGATGAAAGGGCTGGTGATG 60.341 52.381 0.00 0.00 0.00 3.07
559 560 1.064463 GGATGAAAGGGCTGGTGATGA 60.064 52.381 0.00 0.00 0.00 2.92
560 561 2.019984 GATGAAAGGGCTGGTGATGAC 58.980 52.381 0.00 0.00 0.00 3.06
561 562 1.067295 TGAAAGGGCTGGTGATGACT 58.933 50.000 0.00 0.00 0.00 3.41
562 563 1.425066 TGAAAGGGCTGGTGATGACTT 59.575 47.619 0.00 0.00 0.00 3.01
563 564 1.815003 GAAAGGGCTGGTGATGACTTG 59.185 52.381 0.00 0.00 0.00 3.16
564 565 0.610232 AAGGGCTGGTGATGACTTGC 60.610 55.000 0.00 0.00 0.00 4.01
565 566 1.303561 GGGCTGGTGATGACTTGCA 60.304 57.895 3.27 0.00 0.00 4.08
566 567 1.310933 GGGCTGGTGATGACTTGCAG 61.311 60.000 0.00 0.00 0.00 4.41
567 568 1.310933 GGCTGGTGATGACTTGCAGG 61.311 60.000 0.00 0.00 0.00 4.85
568 569 1.930908 GCTGGTGATGACTTGCAGGC 61.931 60.000 0.00 0.00 0.00 4.85
569 570 1.303561 TGGTGATGACTTGCAGGCC 60.304 57.895 0.00 0.00 0.00 5.19
570 571 1.001641 GGTGATGACTTGCAGGCCT 60.002 57.895 0.00 0.00 0.00 5.19
571 572 0.610232 GGTGATGACTTGCAGGCCTT 60.610 55.000 0.00 0.00 0.00 4.35
572 573 0.807496 GTGATGACTTGCAGGCCTTC 59.193 55.000 0.00 0.00 0.00 3.46
573 574 0.401356 TGATGACTTGCAGGCCTTCA 59.599 50.000 0.00 0.00 0.00 3.02
574 575 0.807496 GATGACTTGCAGGCCTTCAC 59.193 55.000 3.92 0.00 0.00 3.18
575 576 0.957395 ATGACTTGCAGGCCTTCACG 60.957 55.000 3.92 5.87 0.00 4.35
576 577 2.970974 GACTTGCAGGCCTTCACGC 61.971 63.158 3.92 5.03 0.00 5.34
584 585 4.373116 GCCTTCACGCCCAGACGA 62.373 66.667 0.00 0.00 36.70 4.20
585 586 2.342279 CCTTCACGCCCAGACGAA 59.658 61.111 0.00 0.00 36.70 3.85
586 587 2.027625 CCTTCACGCCCAGACGAAC 61.028 63.158 0.00 0.00 36.70 3.95
587 588 1.006102 CTTCACGCCCAGACGAACT 60.006 57.895 0.00 0.00 36.70 3.01
588 589 1.284982 CTTCACGCCCAGACGAACTG 61.285 60.000 0.00 0.00 45.36 3.16
596 597 3.989104 CAGACGAACTGGACCAAGT 57.011 52.632 0.00 0.00 42.39 3.16
598 599 3.380479 CAGACGAACTGGACCAAGTAA 57.620 47.619 0.00 0.00 42.39 2.24
599 600 3.318017 CAGACGAACTGGACCAAGTAAG 58.682 50.000 0.00 0.00 42.39 2.34
600 601 3.005472 CAGACGAACTGGACCAAGTAAGA 59.995 47.826 0.00 0.00 42.39 2.10
601 602 3.005578 AGACGAACTGGACCAAGTAAGAC 59.994 47.826 0.00 0.00 0.00 3.01
602 603 2.288030 ACGAACTGGACCAAGTAAGACG 60.288 50.000 0.00 0.00 0.00 4.18
603 604 2.685100 GAACTGGACCAAGTAAGACGG 58.315 52.381 0.00 0.00 0.00 4.79
604 605 2.005370 ACTGGACCAAGTAAGACGGA 57.995 50.000 0.00 0.00 0.00 4.69
605 606 1.617357 ACTGGACCAAGTAAGACGGAC 59.383 52.381 0.00 0.00 0.00 4.79
606 607 1.616865 CTGGACCAAGTAAGACGGACA 59.383 52.381 0.00 0.00 0.00 4.02
607 608 2.036733 CTGGACCAAGTAAGACGGACAA 59.963 50.000 0.00 0.00 0.00 3.18
608 609 2.435069 TGGACCAAGTAAGACGGACAAA 59.565 45.455 0.00 0.00 0.00 2.83
609 610 3.071892 TGGACCAAGTAAGACGGACAAAT 59.928 43.478 0.00 0.00 0.00 2.32
610 611 4.070009 GGACCAAGTAAGACGGACAAATT 58.930 43.478 0.00 0.00 0.00 1.82
611 612 4.517832 GGACCAAGTAAGACGGACAAATTT 59.482 41.667 0.00 0.00 0.00 1.82
612 613 5.702209 GGACCAAGTAAGACGGACAAATTTA 59.298 40.000 0.00 0.00 0.00 1.40
613 614 6.205270 GGACCAAGTAAGACGGACAAATTTAA 59.795 38.462 0.00 0.00 0.00 1.52
614 615 7.255208 GGACCAAGTAAGACGGACAAATTTAAA 60.255 37.037 0.00 0.00 0.00 1.52
615 616 7.645402 ACCAAGTAAGACGGACAAATTTAAAG 58.355 34.615 0.00 0.00 0.00 1.85
616 617 7.081976 CCAAGTAAGACGGACAAATTTAAAGG 58.918 38.462 0.00 0.00 0.00 3.11
617 618 6.250344 AGTAAGACGGACAAATTTAAAGGC 57.750 37.500 0.00 0.00 0.00 4.35
618 619 6.002082 AGTAAGACGGACAAATTTAAAGGCT 58.998 36.000 0.00 0.00 0.00 4.58
619 620 4.766404 AGACGGACAAATTTAAAGGCTG 57.234 40.909 0.00 0.00 0.00 4.85
620 621 4.142038 AGACGGACAAATTTAAAGGCTGT 58.858 39.130 0.00 0.00 0.00 4.40
621 622 4.583073 AGACGGACAAATTTAAAGGCTGTT 59.417 37.500 0.00 0.00 0.00 3.16
622 623 4.616953 ACGGACAAATTTAAAGGCTGTTG 58.383 39.130 0.00 0.00 0.00 3.33
623 624 3.987220 CGGACAAATTTAAAGGCTGTTGG 59.013 43.478 0.00 0.00 0.00 3.77
624 625 4.261825 CGGACAAATTTAAAGGCTGTTGGA 60.262 41.667 0.00 0.00 0.00 3.53
625 626 5.606505 GGACAAATTTAAAGGCTGTTGGAA 58.393 37.500 0.00 0.00 0.00 3.53
626 627 6.052360 GGACAAATTTAAAGGCTGTTGGAAA 58.948 36.000 0.00 0.00 0.00 3.13
627 628 6.710295 GGACAAATTTAAAGGCTGTTGGAAAT 59.290 34.615 0.00 0.00 0.00 2.17
628 629 7.228507 GGACAAATTTAAAGGCTGTTGGAAATT 59.771 33.333 0.00 0.00 0.00 1.82
629 630 8.153479 ACAAATTTAAAGGCTGTTGGAAATTC 57.847 30.769 0.00 0.00 0.00 2.17
630 631 7.772757 ACAAATTTAAAGGCTGTTGGAAATTCA 59.227 29.630 0.00 0.00 0.00 2.57
631 632 7.728847 AATTTAAAGGCTGTTGGAAATTCAC 57.271 32.000 0.00 0.00 0.00 3.18
632 633 5.860941 TTAAAGGCTGTTGGAAATTCACA 57.139 34.783 0.00 0.00 0.00 3.58
633 634 3.733443 AAGGCTGTTGGAAATTCACAC 57.267 42.857 0.00 0.00 0.00 3.82
634 635 1.963515 AGGCTGTTGGAAATTCACACC 59.036 47.619 0.00 0.00 0.00 4.16
635 636 1.963515 GGCTGTTGGAAATTCACACCT 59.036 47.619 0.00 0.00 0.00 4.00
636 637 3.153919 GGCTGTTGGAAATTCACACCTA 58.846 45.455 0.00 0.00 0.00 3.08
637 638 3.763897 GGCTGTTGGAAATTCACACCTAT 59.236 43.478 0.00 0.00 0.00 2.57
638 639 4.142381 GGCTGTTGGAAATTCACACCTATC 60.142 45.833 0.00 0.00 0.00 2.08
639 640 4.702131 GCTGTTGGAAATTCACACCTATCT 59.298 41.667 0.00 0.00 0.00 1.98
640 641 5.163713 GCTGTTGGAAATTCACACCTATCTC 60.164 44.000 0.00 0.00 0.00 2.75
641 642 5.875224 TGTTGGAAATTCACACCTATCTCA 58.125 37.500 0.00 0.00 0.00 3.27
642 643 5.705441 TGTTGGAAATTCACACCTATCTCAC 59.295 40.000 0.00 0.00 0.00 3.51
643 644 4.843728 TGGAAATTCACACCTATCTCACC 58.156 43.478 0.00 0.00 0.00 4.02
644 645 4.536090 TGGAAATTCACACCTATCTCACCT 59.464 41.667 0.00 0.00 0.00 4.00
645 646 4.878397 GGAAATTCACACCTATCTCACCTG 59.122 45.833 0.00 0.00 0.00 4.00
646 647 5.491982 GAAATTCACACCTATCTCACCTGT 58.508 41.667 0.00 0.00 0.00 4.00
647 648 4.744795 ATTCACACCTATCTCACCTGTC 57.255 45.455 0.00 0.00 0.00 3.51
648 649 3.169512 TCACACCTATCTCACCTGTCA 57.830 47.619 0.00 0.00 0.00 3.58
649 650 3.506398 TCACACCTATCTCACCTGTCAA 58.494 45.455 0.00 0.00 0.00 3.18
650 651 4.096681 TCACACCTATCTCACCTGTCAAT 58.903 43.478 0.00 0.00 0.00 2.57
651 652 4.532126 TCACACCTATCTCACCTGTCAATT 59.468 41.667 0.00 0.00 0.00 2.32
652 653 4.872691 CACACCTATCTCACCTGTCAATTC 59.127 45.833 0.00 0.00 0.00 2.17
653 654 4.532126 ACACCTATCTCACCTGTCAATTCA 59.468 41.667 0.00 0.00 0.00 2.57
654 655 5.190528 ACACCTATCTCACCTGTCAATTCAT 59.809 40.000 0.00 0.00 0.00 2.57
655 656 5.526479 CACCTATCTCACCTGTCAATTCATG 59.474 44.000 0.00 0.00 0.00 3.07
656 657 4.514441 CCTATCTCACCTGTCAATTCATGC 59.486 45.833 0.00 0.00 0.00 4.06
657 658 3.421919 TCTCACCTGTCAATTCATGCA 57.578 42.857 0.00 0.00 0.00 3.96
658 659 3.959293 TCTCACCTGTCAATTCATGCAT 58.041 40.909 0.00 0.00 0.00 3.96
659 660 3.692593 TCTCACCTGTCAATTCATGCATG 59.307 43.478 21.07 21.07 0.00 4.06
660 661 2.756207 TCACCTGTCAATTCATGCATGG 59.244 45.455 25.97 10.42 0.00 3.66
661 662 2.494471 CACCTGTCAATTCATGCATGGT 59.506 45.455 25.97 12.77 0.00 3.55
662 663 3.695556 CACCTGTCAATTCATGCATGGTA 59.304 43.478 25.97 14.95 0.00 3.25
663 664 4.340097 CACCTGTCAATTCATGCATGGTAT 59.660 41.667 25.97 16.47 0.00 2.73
664 665 5.532032 CACCTGTCAATTCATGCATGGTATA 59.468 40.000 25.97 10.07 0.00 1.47
665 666 6.039605 CACCTGTCAATTCATGCATGGTATAA 59.960 38.462 25.97 13.46 0.00 0.98
666 667 6.779049 ACCTGTCAATTCATGCATGGTATAAT 59.221 34.615 25.97 15.11 0.00 1.28
667 668 7.944000 ACCTGTCAATTCATGCATGGTATAATA 59.056 33.333 25.97 2.13 0.00 0.98
668 669 8.795513 CCTGTCAATTCATGCATGGTATAATAA 58.204 33.333 25.97 11.64 0.00 1.40
676 677 9.972106 TTCATGCATGGTATAATAATATGTGGA 57.028 29.630 25.97 0.00 0.00 4.02
677 678 9.617523 TCATGCATGGTATAATAATATGTGGAG 57.382 33.333 25.97 0.00 0.00 3.86
678 679 8.843262 CATGCATGGTATAATAATATGTGGAGG 58.157 37.037 19.40 0.00 0.00 4.30
679 680 7.927788 TGCATGGTATAATAATATGTGGAGGT 58.072 34.615 0.00 0.00 0.00 3.85
680 681 7.828717 TGCATGGTATAATAATATGTGGAGGTG 59.171 37.037 0.00 0.00 0.00 4.00
681 682 8.046708 GCATGGTATAATAATATGTGGAGGTGA 58.953 37.037 0.00 0.00 0.00 4.02
682 683 9.605275 CATGGTATAATAATATGTGGAGGTGAG 57.395 37.037 0.00 0.00 0.00 3.51
683 684 8.736097 TGGTATAATAATATGTGGAGGTGAGT 57.264 34.615 0.00 0.00 0.00 3.41
684 685 8.593679 TGGTATAATAATATGTGGAGGTGAGTG 58.406 37.037 0.00 0.00 0.00 3.51
685 686 8.812972 GGTATAATAATATGTGGAGGTGAGTGA 58.187 37.037 0.00 0.00 0.00 3.41
688 689 4.494091 AATATGTGGAGGTGAGTGAAGG 57.506 45.455 0.00 0.00 0.00 3.46
689 690 2.030027 ATGTGGAGGTGAGTGAAGGA 57.970 50.000 0.00 0.00 0.00 3.36
690 691 1.801242 TGTGGAGGTGAGTGAAGGAA 58.199 50.000 0.00 0.00 0.00 3.36
691 692 1.694150 TGTGGAGGTGAGTGAAGGAAG 59.306 52.381 0.00 0.00 0.00 3.46
692 693 1.002544 GTGGAGGTGAGTGAAGGAAGG 59.997 57.143 0.00 0.00 0.00 3.46
693 694 1.353091 GGAGGTGAGTGAAGGAAGGT 58.647 55.000 0.00 0.00 0.00 3.50
694 695 1.700186 GGAGGTGAGTGAAGGAAGGTT 59.300 52.381 0.00 0.00 0.00 3.50
695 696 2.106684 GGAGGTGAGTGAAGGAAGGTTT 59.893 50.000 0.00 0.00 0.00 3.27
696 697 3.142174 GAGGTGAGTGAAGGAAGGTTTG 58.858 50.000 0.00 0.00 0.00 2.93
697 698 2.509964 AGGTGAGTGAAGGAAGGTTTGT 59.490 45.455 0.00 0.00 0.00 2.83
698 699 2.618709 GGTGAGTGAAGGAAGGTTTGTG 59.381 50.000 0.00 0.00 0.00 3.33
699 700 2.033424 GTGAGTGAAGGAAGGTTTGTGC 59.967 50.000 0.00 0.00 0.00 4.57
700 701 1.264288 GAGTGAAGGAAGGTTTGTGCG 59.736 52.381 0.00 0.00 0.00 5.34
701 702 0.310854 GTGAAGGAAGGTTTGTGCGG 59.689 55.000 0.00 0.00 0.00 5.69
702 703 0.181587 TGAAGGAAGGTTTGTGCGGA 59.818 50.000 0.00 0.00 0.00 5.54
703 704 1.314730 GAAGGAAGGTTTGTGCGGAA 58.685 50.000 0.00 0.00 0.00 4.30
704 705 1.886542 GAAGGAAGGTTTGTGCGGAAT 59.113 47.619 0.00 0.00 0.00 3.01
705 706 2.871096 AGGAAGGTTTGTGCGGAATA 57.129 45.000 0.00 0.00 0.00 1.75
706 707 3.149005 AGGAAGGTTTGTGCGGAATAA 57.851 42.857 0.00 0.00 0.00 1.40
707 708 3.697166 AGGAAGGTTTGTGCGGAATAAT 58.303 40.909 0.00 0.00 0.00 1.28
708 709 4.850680 AGGAAGGTTTGTGCGGAATAATA 58.149 39.130 0.00 0.00 0.00 0.98
709 710 4.638865 AGGAAGGTTTGTGCGGAATAATAC 59.361 41.667 0.00 0.00 0.00 1.89
710 711 4.638865 GGAAGGTTTGTGCGGAATAATACT 59.361 41.667 0.00 0.00 0.00 2.12
711 712 5.124936 GGAAGGTTTGTGCGGAATAATACTT 59.875 40.000 0.00 0.00 0.00 2.24
712 713 5.560966 AGGTTTGTGCGGAATAATACTTG 57.439 39.130 0.00 0.00 0.00 3.16
713 714 5.007682 AGGTTTGTGCGGAATAATACTTGT 58.992 37.500 0.00 0.00 0.00 3.16
714 715 5.092781 GGTTTGTGCGGAATAATACTTGTG 58.907 41.667 0.00 0.00 0.00 3.33
715 716 4.955925 TTGTGCGGAATAATACTTGTGG 57.044 40.909 0.00 0.00 0.00 4.17
716 717 3.945346 TGTGCGGAATAATACTTGTGGT 58.055 40.909 0.00 0.00 0.00 4.16
717 718 3.936453 TGTGCGGAATAATACTTGTGGTC 59.064 43.478 0.00 0.00 0.00 4.02
718 719 3.000925 GTGCGGAATAATACTTGTGGTCG 59.999 47.826 0.00 0.00 0.00 4.79
719 720 3.192466 GCGGAATAATACTTGTGGTCGT 58.808 45.455 0.00 0.00 0.00 4.34
720 721 3.244579 GCGGAATAATACTTGTGGTCGTC 59.755 47.826 0.00 0.00 0.00 4.20
721 722 3.800506 CGGAATAATACTTGTGGTCGTCC 59.199 47.826 0.00 0.00 0.00 4.79
722 723 3.800506 GGAATAATACTTGTGGTCGTCCG 59.199 47.826 0.00 0.00 36.30 4.79
723 724 4.427312 GAATAATACTTGTGGTCGTCCGT 58.573 43.478 0.00 0.00 36.30 4.69
724 725 2.358939 AATACTTGTGGTCGTCCGTC 57.641 50.000 0.00 0.00 36.30 4.79
725 726 0.169672 ATACTTGTGGTCGTCCGTCG 59.830 55.000 0.00 0.00 41.41 5.12
726 727 1.165907 TACTTGTGGTCGTCCGTCGT 61.166 55.000 0.00 0.00 40.80 4.34
727 728 1.728426 CTTGTGGTCGTCCGTCGTC 60.728 63.158 0.00 0.00 40.80 4.20
728 729 3.525844 TTGTGGTCGTCCGTCGTCG 62.526 63.158 0.00 0.00 40.80 5.12
729 730 4.017877 GTGGTCGTCCGTCGTCGT 62.018 66.667 0.71 0.00 40.80 4.34
730 731 3.716006 TGGTCGTCCGTCGTCGTC 61.716 66.667 0.71 2.55 40.80 4.20
731 732 3.418068 GGTCGTCCGTCGTCGTCT 61.418 66.667 0.71 0.00 40.80 4.18
732 733 2.095469 GTCGTCCGTCGTCGTCTC 59.905 66.667 0.71 0.00 40.80 3.36
733 734 3.114616 TCGTCCGTCGTCGTCTCC 61.115 66.667 0.71 0.00 40.80 3.71
734 735 3.417224 CGTCCGTCGTCGTCTCCA 61.417 66.667 0.71 0.00 35.01 3.86
735 736 2.747822 CGTCCGTCGTCGTCTCCAT 61.748 63.158 0.71 0.00 35.01 3.41
736 737 1.505353 GTCCGTCGTCGTCTCCATT 59.495 57.895 0.71 0.00 35.01 3.16
737 738 0.797249 GTCCGTCGTCGTCTCCATTG 60.797 60.000 0.71 0.00 35.01 2.82
738 739 0.956902 TCCGTCGTCGTCTCCATTGA 60.957 55.000 0.71 0.00 35.01 2.57
739 740 0.523546 CCGTCGTCGTCTCCATTGAG 60.524 60.000 0.71 0.00 40.17 3.02
740 741 0.168348 CGTCGTCGTCTCCATTGAGT 59.832 55.000 0.00 0.00 39.75 3.41
741 742 1.790838 CGTCGTCGTCTCCATTGAGTC 60.791 57.143 0.00 0.00 39.75 3.36
742 743 1.469308 GTCGTCGTCTCCATTGAGTCT 59.531 52.381 0.00 0.00 39.75 3.24
743 744 2.095161 GTCGTCGTCTCCATTGAGTCTT 60.095 50.000 0.00 0.00 39.75 3.01
744 745 2.095212 TCGTCGTCTCCATTGAGTCTTG 60.095 50.000 0.00 0.00 39.75 3.02
745 746 2.095212 CGTCGTCTCCATTGAGTCTTGA 60.095 50.000 0.00 0.00 39.75 3.02
746 747 3.506810 GTCGTCTCCATTGAGTCTTGAG 58.493 50.000 0.00 0.00 39.75 3.02
747 748 2.094494 TCGTCTCCATTGAGTCTTGAGC 60.094 50.000 0.00 0.00 39.75 4.26
748 749 2.353109 CGTCTCCATTGAGTCTTGAGCA 60.353 50.000 0.00 0.00 39.75 4.26
749 750 3.260740 GTCTCCATTGAGTCTTGAGCAG 58.739 50.000 0.00 0.00 39.75 4.24
750 751 3.056250 GTCTCCATTGAGTCTTGAGCAGA 60.056 47.826 0.00 0.00 39.75 4.26
751 752 3.773667 TCTCCATTGAGTCTTGAGCAGAT 59.226 43.478 0.00 0.00 39.75 2.90
752 753 4.958581 TCTCCATTGAGTCTTGAGCAGATA 59.041 41.667 0.00 0.00 39.75 1.98
753 754 5.423290 TCTCCATTGAGTCTTGAGCAGATAA 59.577 40.000 0.00 0.00 39.75 1.75
754 755 5.668471 TCCATTGAGTCTTGAGCAGATAAG 58.332 41.667 0.00 0.00 32.60 1.73
755 756 5.423290 TCCATTGAGTCTTGAGCAGATAAGA 59.577 40.000 0.00 0.00 32.60 2.10
760 761 4.624336 GTCTTGAGCAGATAAGACTCGA 57.376 45.455 9.24 0.00 45.75 4.04
761 762 4.597079 GTCTTGAGCAGATAAGACTCGAG 58.403 47.826 11.84 11.84 45.75 4.04
762 763 4.334203 GTCTTGAGCAGATAAGACTCGAGA 59.666 45.833 21.68 5.31 45.75 4.04
763 764 4.574421 TCTTGAGCAGATAAGACTCGAGAG 59.426 45.833 21.68 0.14 43.09 3.20
764 765 3.210227 TGAGCAGATAAGACTCGAGAGG 58.790 50.000 21.68 0.00 32.98 3.69
765 766 3.118223 TGAGCAGATAAGACTCGAGAGGA 60.118 47.826 21.68 1.22 32.98 3.71
766 767 4.072131 GAGCAGATAAGACTCGAGAGGAT 58.928 47.826 21.68 6.51 0.00 3.24
767 768 3.820467 AGCAGATAAGACTCGAGAGGATG 59.180 47.826 21.68 9.08 0.00 3.51
768 769 3.568007 GCAGATAAGACTCGAGAGGATGT 59.432 47.826 21.68 0.00 0.00 3.06
769 770 4.556501 GCAGATAAGACTCGAGAGGATGTG 60.557 50.000 21.68 14.94 0.00 3.21
770 771 3.568007 AGATAAGACTCGAGAGGATGTGC 59.432 47.826 21.68 1.29 0.00 4.57
771 772 1.550327 AAGACTCGAGAGGATGTGCA 58.450 50.000 21.68 0.00 0.00 4.57
772 773 0.814457 AGACTCGAGAGGATGTGCAC 59.186 55.000 21.68 10.75 0.00 4.57
773 774 0.179124 GACTCGAGAGGATGTGCACC 60.179 60.000 21.68 0.00 0.00 5.01
774 775 0.900182 ACTCGAGAGGATGTGCACCA 60.900 55.000 21.68 2.61 0.00 4.17
775 776 0.459237 CTCGAGAGGATGTGCACCAC 60.459 60.000 15.69 8.11 34.56 4.16
776 777 1.448540 CGAGAGGATGTGCACCACC 60.449 63.158 15.69 17.03 32.73 4.61
777 778 1.078143 GAGAGGATGTGCACCACCC 60.078 63.158 15.69 12.47 32.73 4.61
778 779 1.841302 GAGAGGATGTGCACCACCCA 61.841 60.000 15.69 0.00 32.73 4.51
779 780 1.210204 AGAGGATGTGCACCACCCAT 61.210 55.000 15.69 0.00 32.73 4.00
780 781 1.000521 AGGATGTGCACCACCCATG 60.001 57.895 15.69 0.00 32.73 3.66
781 782 1.304381 GGATGTGCACCACCCATGT 60.304 57.895 15.69 0.00 32.73 3.21
782 783 1.315257 GGATGTGCACCACCCATGTC 61.315 60.000 15.69 0.00 32.73 3.06
783 784 0.608856 GATGTGCACCACCCATGTCA 60.609 55.000 15.69 0.00 32.73 3.58
784 785 0.178967 ATGTGCACCACCCATGTCAA 60.179 50.000 15.69 0.00 32.73 3.18
785 786 0.178967 TGTGCACCACCCATGTCAAT 60.179 50.000 15.69 0.00 32.73 2.57
786 787 0.968405 GTGCACCACCCATGTCAATT 59.032 50.000 5.22 0.00 0.00 2.32
787 788 1.067635 GTGCACCACCCATGTCAATTC 60.068 52.381 5.22 0.00 0.00 2.17
788 789 1.255882 GCACCACCCATGTCAATTCA 58.744 50.000 0.00 0.00 0.00 2.57
789 790 1.826720 GCACCACCCATGTCAATTCAT 59.173 47.619 0.00 0.00 0.00 2.57
790 791 2.417651 GCACCACCCATGTCAATTCATG 60.418 50.000 1.08 1.08 43.14 3.07
791 792 2.827322 CACCACCCATGTCAATTCATGT 59.173 45.455 6.43 0.00 42.29 3.21
792 793 3.091545 ACCACCCATGTCAATTCATGTC 58.908 45.455 6.43 0.00 42.29 3.06
793 794 3.245371 ACCACCCATGTCAATTCATGTCT 60.245 43.478 6.43 0.00 42.29 3.41
794 795 4.018506 ACCACCCATGTCAATTCATGTCTA 60.019 41.667 6.43 0.00 42.29 2.59
795 796 4.577693 CCACCCATGTCAATTCATGTCTAG 59.422 45.833 6.43 0.00 42.29 2.43
796 797 5.188434 CACCCATGTCAATTCATGTCTAGT 58.812 41.667 6.43 0.00 42.29 2.57
797 798 5.295292 CACCCATGTCAATTCATGTCTAGTC 59.705 44.000 6.43 0.00 42.29 2.59
798 799 4.818546 CCCATGTCAATTCATGTCTAGTCC 59.181 45.833 6.43 0.00 42.29 3.85
799 800 5.430886 CCATGTCAATTCATGTCTAGTCCA 58.569 41.667 6.43 0.00 42.29 4.02
800 801 6.060136 CCATGTCAATTCATGTCTAGTCCAT 58.940 40.000 6.43 0.00 42.29 3.41
801 802 6.017357 CCATGTCAATTCATGTCTAGTCCATG 60.017 42.308 14.92 14.92 42.29 3.66
802 803 5.430886 TGTCAATTCATGTCTAGTCCATGG 58.569 41.667 4.97 4.97 40.07 3.66
803 804 5.189539 TGTCAATTCATGTCTAGTCCATGGA 59.810 40.000 11.44 11.44 40.07 3.41
804 805 6.126681 TGTCAATTCATGTCTAGTCCATGGAT 60.127 38.462 19.62 9.69 39.67 3.41
805 806 7.071071 TGTCAATTCATGTCTAGTCCATGGATA 59.929 37.037 19.62 10.33 37.51 2.59
806 807 8.099537 GTCAATTCATGTCTAGTCCATGGATAT 58.900 37.037 19.62 12.61 37.51 1.63
807 808 8.663167 TCAATTCATGTCTAGTCCATGGATATT 58.337 33.333 19.62 9.56 37.51 1.28
808 809 8.944029 CAATTCATGTCTAGTCCATGGATATTC 58.056 37.037 19.62 4.66 37.51 1.75
809 810 7.616528 TTCATGTCTAGTCCATGGATATTCA 57.383 36.000 19.62 13.82 40.07 2.57
810 811 6.997655 TCATGTCTAGTCCATGGATATTCAC 58.002 40.000 19.62 11.69 40.07 3.18
811 812 5.808366 TGTCTAGTCCATGGATATTCACC 57.192 43.478 19.62 2.57 0.00 4.02
812 813 4.280929 TGTCTAGTCCATGGATATTCACCG 59.719 45.833 19.62 1.40 0.00 4.94
813 814 4.281182 GTCTAGTCCATGGATATTCACCGT 59.719 45.833 19.62 0.00 0.00 4.83
814 815 5.475909 GTCTAGTCCATGGATATTCACCGTA 59.524 44.000 19.62 0.00 0.00 4.02
815 816 4.873746 AGTCCATGGATATTCACCGTAG 57.126 45.455 19.62 0.00 0.00 3.51
833 834 5.874892 CGTAGGATTTCTCTCTTTAAGCG 57.125 43.478 0.00 0.00 0.00 4.68
834 835 5.579718 CGTAGGATTTCTCTCTTTAAGCGA 58.420 41.667 0.00 0.00 0.00 4.93
835 836 6.034591 CGTAGGATTTCTCTCTTTAAGCGAA 58.965 40.000 0.00 0.00 0.00 4.70
836 837 6.530534 CGTAGGATTTCTCTCTTTAAGCGAAA 59.469 38.462 0.00 6.45 41.57 3.46
837 838 6.976636 AGGATTTCTCTCTTTAAGCGAAAG 57.023 37.500 7.59 7.59 40.88 2.62
847 848 5.209944 CTTTAAGCGAAAGAAGCTGGTAG 57.790 43.478 8.07 0.00 46.57 3.18
848 849 2.841442 AAGCGAAAGAAGCTGGTAGT 57.159 45.000 0.00 0.00 45.31 2.73
849 850 2.841442 AGCGAAAGAAGCTGGTAGTT 57.159 45.000 0.00 0.00 44.22 2.24
850 851 3.127425 AGCGAAAGAAGCTGGTAGTTT 57.873 42.857 0.00 0.00 44.22 2.66
851 852 3.067833 AGCGAAAGAAGCTGGTAGTTTC 58.932 45.455 0.00 0.00 44.22 2.78
852 853 2.806244 GCGAAAGAAGCTGGTAGTTTCA 59.194 45.455 7.90 0.00 37.82 2.69
853 854 3.364068 GCGAAAGAAGCTGGTAGTTTCAC 60.364 47.826 7.90 2.21 37.82 3.18
854 855 3.120991 CGAAAGAAGCTGGTAGTTTCACG 60.121 47.826 7.90 6.70 37.82 4.35
855 856 1.797025 AGAAGCTGGTAGTTTCACGC 58.203 50.000 7.90 0.00 37.82 5.34
856 857 1.070134 AGAAGCTGGTAGTTTCACGCA 59.930 47.619 7.90 0.00 37.82 5.24
857 858 1.461127 GAAGCTGGTAGTTTCACGCAG 59.539 52.381 0.00 0.00 35.79 5.18
859 860 0.790814 GCTGGTAGTTTCACGCAGTC 59.209 55.000 0.00 0.00 41.61 3.51
860 861 1.872237 GCTGGTAGTTTCACGCAGTCA 60.872 52.381 0.00 0.00 41.61 3.41
861 862 1.792949 CTGGTAGTTTCACGCAGTCAC 59.207 52.381 0.00 0.00 41.61 3.67
862 863 1.137282 TGGTAGTTTCACGCAGTCACA 59.863 47.619 0.00 0.00 41.61 3.58
863 864 1.525619 GGTAGTTTCACGCAGTCACAC 59.474 52.381 0.00 0.00 41.61 3.82
864 865 1.525619 GTAGTTTCACGCAGTCACACC 59.474 52.381 0.00 0.00 41.61 4.16
865 866 0.178068 AGTTTCACGCAGTCACACCT 59.822 50.000 0.00 0.00 41.61 4.00
866 867 0.582005 GTTTCACGCAGTCACACCTC 59.418 55.000 0.00 0.00 41.61 3.85
867 868 0.464036 TTTCACGCAGTCACACCTCT 59.536 50.000 0.00 0.00 41.61 3.69
868 869 1.324383 TTCACGCAGTCACACCTCTA 58.676 50.000 0.00 0.00 41.61 2.43
869 870 0.881796 TCACGCAGTCACACCTCTAG 59.118 55.000 0.00 0.00 41.61 2.43
870 871 0.734253 CACGCAGTCACACCTCTAGC 60.734 60.000 0.00 0.00 41.61 3.42
871 872 1.179174 ACGCAGTCACACCTCTAGCA 61.179 55.000 0.00 0.00 29.74 3.49
872 873 0.038251 CGCAGTCACACCTCTAGCAA 60.038 55.000 0.00 0.00 0.00 3.91
873 874 1.404717 CGCAGTCACACCTCTAGCAAT 60.405 52.381 0.00 0.00 0.00 3.56
874 875 2.275318 GCAGTCACACCTCTAGCAATC 58.725 52.381 0.00 0.00 0.00 2.67
875 876 2.354103 GCAGTCACACCTCTAGCAATCA 60.354 50.000 0.00 0.00 0.00 2.57
876 877 3.681034 GCAGTCACACCTCTAGCAATCAT 60.681 47.826 0.00 0.00 0.00 2.45
877 878 4.118410 CAGTCACACCTCTAGCAATCATC 58.882 47.826 0.00 0.00 0.00 2.92
878 879 3.119291 GTCACACCTCTAGCAATCATCG 58.881 50.000 0.00 0.00 0.00 3.84
879 880 2.101415 TCACACCTCTAGCAATCATCGG 59.899 50.000 0.00 0.00 0.00 4.18
880 881 1.202580 ACACCTCTAGCAATCATCGGC 60.203 52.381 0.00 0.00 0.00 5.54
881 882 1.069823 CACCTCTAGCAATCATCGGCT 59.930 52.381 0.00 0.00 43.94 5.52
882 883 1.342819 ACCTCTAGCAATCATCGGCTC 59.657 52.381 0.00 0.00 41.41 4.70
883 884 1.342496 CCTCTAGCAATCATCGGCTCA 59.658 52.381 0.00 0.00 41.41 4.26
884 885 2.402305 CTCTAGCAATCATCGGCTCAC 58.598 52.381 0.00 0.00 41.41 3.51
885 886 1.069204 TCTAGCAATCATCGGCTCACC 59.931 52.381 0.00 0.00 41.41 4.02
886 887 0.829990 TAGCAATCATCGGCTCACCA 59.170 50.000 0.00 0.00 41.41 4.17
887 888 0.182061 AGCAATCATCGGCTCACCAT 59.818 50.000 0.00 0.00 34.76 3.55
888 889 1.027357 GCAATCATCGGCTCACCATT 58.973 50.000 0.00 0.00 34.57 3.16
889 890 1.406539 GCAATCATCGGCTCACCATTT 59.593 47.619 0.00 0.00 34.57 2.32
890 891 2.797087 GCAATCATCGGCTCACCATTTG 60.797 50.000 0.00 0.00 34.57 2.32
891 892 2.424601 CAATCATCGGCTCACCATTTGT 59.575 45.455 0.00 0.00 34.57 2.83
892 893 1.452110 TCATCGGCTCACCATTTGTG 58.548 50.000 0.00 0.00 46.88 3.33
893 894 0.179156 CATCGGCTCACCATTTGTGC 60.179 55.000 0.00 0.00 45.03 4.57
894 895 0.322816 ATCGGCTCACCATTTGTGCT 60.323 50.000 0.00 0.00 45.03 4.40
895 896 1.210931 CGGCTCACCATTTGTGCTG 59.789 57.895 0.00 0.00 45.03 4.41
896 897 1.080298 GGCTCACCATTTGTGCTGC 60.080 57.895 0.00 0.00 45.03 5.25
897 898 1.530013 GGCTCACCATTTGTGCTGCT 61.530 55.000 0.00 0.00 45.03 4.24
898 899 1.167851 GCTCACCATTTGTGCTGCTA 58.832 50.000 0.00 0.00 45.03 3.49
899 900 1.131883 GCTCACCATTTGTGCTGCTAG 59.868 52.381 0.00 0.00 45.03 3.42
900 901 1.741706 CTCACCATTTGTGCTGCTAGG 59.258 52.381 0.00 0.00 45.03 3.02
901 902 1.350684 TCACCATTTGTGCTGCTAGGA 59.649 47.619 0.00 0.00 45.03 2.94
902 903 1.470098 CACCATTTGTGCTGCTAGGAC 59.530 52.381 0.00 1.80 38.34 3.85
903 904 0.729116 CCATTTGTGCTGCTAGGACG 59.271 55.000 0.00 0.00 39.63 4.79
904 905 0.097674 CATTTGTGCTGCTAGGACGC 59.902 55.000 0.00 0.00 39.63 5.19
905 906 0.321564 ATTTGTGCTGCTAGGACGCA 60.322 50.000 0.00 4.68 39.63 5.24
907 908 3.181967 GTGCTGCTAGGACGCACG 61.182 66.667 17.87 0.00 43.63 5.34
909 910 4.803426 GCTGCTAGGACGCACGCT 62.803 66.667 0.00 0.00 35.74 5.07
910 911 2.580867 CTGCTAGGACGCACGCTC 60.581 66.667 0.00 0.00 35.74 5.03
911 912 4.129737 TGCTAGGACGCACGCTCC 62.130 66.667 0.00 4.23 34.44 4.70
912 913 3.827898 GCTAGGACGCACGCTCCT 61.828 66.667 15.19 15.19 41.36 3.69
913 914 2.103143 CTAGGACGCACGCTCCTG 59.897 66.667 18.31 9.08 38.68 3.86
914 915 2.360726 TAGGACGCACGCTCCTGA 60.361 61.111 18.31 5.96 38.68 3.86
915 916 2.329678 CTAGGACGCACGCTCCTGAG 62.330 65.000 18.31 11.04 38.68 3.35
916 917 4.057428 GGACGCACGCTCCTGAGT 62.057 66.667 0.00 0.00 0.00 3.41
917 918 2.697761 GGACGCACGCTCCTGAGTA 61.698 63.158 0.00 0.00 0.00 2.59
918 919 1.433879 GACGCACGCTCCTGAGTAT 59.566 57.895 0.00 0.00 0.00 2.12
919 920 0.179134 GACGCACGCTCCTGAGTATT 60.179 55.000 0.00 0.00 0.00 1.89
920 921 1.065102 GACGCACGCTCCTGAGTATTA 59.935 52.381 0.00 0.00 0.00 0.98
921 922 1.681793 ACGCACGCTCCTGAGTATTAT 59.318 47.619 0.00 0.00 0.00 1.28
922 923 2.882761 ACGCACGCTCCTGAGTATTATA 59.117 45.455 0.00 0.00 0.00 0.98
923 924 3.058155 ACGCACGCTCCTGAGTATTATAG 60.058 47.826 0.00 0.00 0.00 1.31
924 925 3.188667 CGCACGCTCCTGAGTATTATAGA 59.811 47.826 0.00 0.00 0.00 1.98
925 926 4.142578 CGCACGCTCCTGAGTATTATAGAT 60.143 45.833 0.00 0.00 0.00 1.98
926 927 5.064834 CGCACGCTCCTGAGTATTATAGATA 59.935 44.000 0.00 0.00 0.00 1.98
927 928 6.491394 GCACGCTCCTGAGTATTATAGATAG 58.509 44.000 0.00 0.00 0.00 2.08
928 929 6.316640 GCACGCTCCTGAGTATTATAGATAGA 59.683 42.308 0.00 0.00 0.00 1.98
929 930 7.148222 GCACGCTCCTGAGTATTATAGATAGAA 60.148 40.741 0.00 0.00 0.00 2.10
930 931 8.178964 CACGCTCCTGAGTATTATAGATAGAAC 58.821 40.741 0.00 0.00 0.00 3.01
931 932 7.337436 ACGCTCCTGAGTATTATAGATAGAACC 59.663 40.741 0.00 0.00 0.00 3.62
932 933 7.337184 CGCTCCTGAGTATTATAGATAGAACCA 59.663 40.741 0.00 0.00 0.00 3.67
933 934 9.026121 GCTCCTGAGTATTATAGATAGAACCAA 57.974 37.037 0.00 0.00 0.00 3.67
940 941 9.765795 AGTATTATAGATAGAACCAACTGTTGC 57.234 33.333 14.94 1.97 37.29 4.17
941 942 9.765795 GTATTATAGATAGAACCAACTGTTGCT 57.234 33.333 14.94 9.30 37.29 3.91
942 943 8.668510 ATTATAGATAGAACCAACTGTTGCTG 57.331 34.615 14.94 5.22 37.29 4.41
943 944 3.077359 AGATAGAACCAACTGTTGCTGC 58.923 45.455 14.94 0.08 37.29 5.25
944 945 2.340210 TAGAACCAACTGTTGCTGCA 57.660 45.000 14.94 0.00 37.29 4.41
945 946 1.473258 AGAACCAACTGTTGCTGCAA 58.527 45.000 11.69 11.69 37.29 4.08
946 947 2.034124 AGAACCAACTGTTGCTGCAAT 58.966 42.857 19.11 0.00 37.29 3.56
947 948 2.431782 AGAACCAACTGTTGCTGCAATT 59.568 40.909 19.11 6.59 37.29 2.32
948 949 2.985957 ACCAACTGTTGCTGCAATTT 57.014 40.000 19.11 9.40 0.00 1.82
949 950 3.264998 ACCAACTGTTGCTGCAATTTT 57.735 38.095 19.11 9.05 0.00 1.82
950 951 3.608796 ACCAACTGTTGCTGCAATTTTT 58.391 36.364 19.11 8.70 0.00 1.94
951 952 3.622612 ACCAACTGTTGCTGCAATTTTTC 59.377 39.130 19.11 5.67 0.00 2.29
952 953 3.302610 CCAACTGTTGCTGCAATTTTTCG 60.303 43.478 19.11 6.08 0.00 3.46
953 954 1.860326 ACTGTTGCTGCAATTTTTCGC 59.140 42.857 19.11 4.18 0.00 4.70
954 955 1.192980 CTGTTGCTGCAATTTTTCGCC 59.807 47.619 19.11 3.42 0.00 5.54
955 956 1.216122 GTTGCTGCAATTTTTCGCCA 58.784 45.000 19.11 0.00 0.00 5.69
956 957 1.596727 GTTGCTGCAATTTTTCGCCAA 59.403 42.857 19.11 0.00 0.00 4.52
957 958 1.945387 TGCTGCAATTTTTCGCCAAA 58.055 40.000 0.00 0.00 0.00 3.28
958 959 2.283298 TGCTGCAATTTTTCGCCAAAA 58.717 38.095 0.00 0.00 38.76 2.44
959 960 2.877168 TGCTGCAATTTTTCGCCAAAAT 59.123 36.364 0.00 0.00 45.50 1.82
960 961 4.060900 TGCTGCAATTTTTCGCCAAAATA 58.939 34.783 0.00 0.00 43.20 1.40
961 962 4.512944 TGCTGCAATTTTTCGCCAAAATAA 59.487 33.333 0.00 0.00 43.20 1.40
962 963 5.180868 TGCTGCAATTTTTCGCCAAAATAAT 59.819 32.000 0.00 0.00 43.20 1.28
963 964 6.369890 TGCTGCAATTTTTCGCCAAAATAATA 59.630 30.769 0.00 0.00 43.20 0.98
964 965 6.901357 GCTGCAATTTTTCGCCAAAATAATAG 59.099 34.615 0.00 5.94 43.20 1.73
965 966 7.301068 TGCAATTTTTCGCCAAAATAATAGG 57.699 32.000 5.79 0.00 43.20 2.57
966 967 6.876257 TGCAATTTTTCGCCAAAATAATAGGT 59.124 30.769 5.79 0.00 43.20 3.08
967 968 7.148507 TGCAATTTTTCGCCAAAATAATAGGTG 60.149 33.333 5.79 0.00 43.20 4.00
968 969 7.064016 GCAATTTTTCGCCAAAATAATAGGTGA 59.936 33.333 5.79 0.00 43.20 4.02
969 970 8.930760 CAATTTTTCGCCAAAATAATAGGTGAA 58.069 29.630 0.00 0.00 46.75 3.18
971 972 4.893424 TCGCCAAAATAATAGGTGAAGC 57.107 40.909 0.00 0.00 38.86 3.86
972 973 4.523083 TCGCCAAAATAATAGGTGAAGCT 58.477 39.130 0.00 0.00 38.86 3.74
973 974 4.574828 TCGCCAAAATAATAGGTGAAGCTC 59.425 41.667 0.00 0.00 38.86 4.09
974 975 4.576463 CGCCAAAATAATAGGTGAAGCTCT 59.424 41.667 0.00 0.00 34.93 4.09
975 976 5.758296 CGCCAAAATAATAGGTGAAGCTCTA 59.242 40.000 0.00 0.00 34.93 2.43
976 977 6.292919 CGCCAAAATAATAGGTGAAGCTCTAC 60.293 42.308 0.00 0.00 34.93 2.59
977 978 6.768381 GCCAAAATAATAGGTGAAGCTCTACT 59.232 38.462 0.00 0.00 0.00 2.57
978 979 7.283354 GCCAAAATAATAGGTGAAGCTCTACTT 59.717 37.037 0.00 0.00 42.98 2.24
991 992 6.613153 AAGCTCTACTTCCAGTAAATCAGT 57.387 37.500 0.00 0.00 30.77 3.41
992 993 6.613153 AGCTCTACTTCCAGTAAATCAGTT 57.387 37.500 0.00 0.00 29.00 3.16
993 994 6.635755 AGCTCTACTTCCAGTAAATCAGTTC 58.364 40.000 0.00 0.00 29.00 3.01
994 995 6.211584 AGCTCTACTTCCAGTAAATCAGTTCA 59.788 38.462 0.00 0.00 29.00 3.18
995 996 7.044798 GCTCTACTTCCAGTAAATCAGTTCAT 58.955 38.462 0.00 0.00 29.00 2.57
996 997 7.550906 GCTCTACTTCCAGTAAATCAGTTCATT 59.449 37.037 0.00 0.00 29.00 2.57
997 998 9.092876 CTCTACTTCCAGTAAATCAGTTCATTC 57.907 37.037 0.00 0.00 29.00 2.67
998 999 8.816894 TCTACTTCCAGTAAATCAGTTCATTCT 58.183 33.333 0.00 0.00 29.00 2.40
1001 1002 9.965902 ACTTCCAGTAAATCAGTTCATTCTAAT 57.034 29.630 0.00 0.00 0.00 1.73
1003 1004 8.737168 TCCAGTAAATCAGTTCATTCTAATGG 57.263 34.615 3.00 0.00 37.03 3.16
1004 1005 8.328758 TCCAGTAAATCAGTTCATTCTAATGGT 58.671 33.333 3.00 0.00 37.03 3.55
1005 1006 8.400947 CCAGTAAATCAGTTCATTCTAATGGTG 58.599 37.037 3.00 0.06 37.03 4.17
1006 1007 8.400947 CAGTAAATCAGTTCATTCTAATGGTGG 58.599 37.037 3.00 0.00 37.03 4.61
1007 1008 8.328758 AGTAAATCAGTTCATTCTAATGGTGGA 58.671 33.333 3.00 0.00 37.03 4.02
1008 1009 7.396540 AAATCAGTTCATTCTAATGGTGGAC 57.603 36.000 3.00 0.00 37.03 4.02
1009 1010 4.843728 TCAGTTCATTCTAATGGTGGACC 58.156 43.478 3.00 0.00 37.03 4.46
1010 1011 3.947834 CAGTTCATTCTAATGGTGGACCC 59.052 47.826 3.00 0.00 37.03 4.46
1011 1012 3.053619 AGTTCATTCTAATGGTGGACCCC 60.054 47.826 3.00 0.00 37.03 4.95
1012 1013 1.488812 TCATTCTAATGGTGGACCCCG 59.511 52.381 3.00 0.00 37.03 5.73
1013 1014 1.211949 CATTCTAATGGTGGACCCCGT 59.788 52.381 0.00 0.00 34.29 5.28
1014 1015 0.616371 TTCTAATGGTGGACCCCGTG 59.384 55.000 0.00 0.00 34.29 4.94
1015 1016 0.252330 TCTAATGGTGGACCCCGTGA 60.252 55.000 0.00 0.00 34.29 4.35
1016 1017 0.107848 CTAATGGTGGACCCCGTGAC 60.108 60.000 0.00 0.00 34.29 3.67
1017 1018 1.555477 TAATGGTGGACCCCGTGACC 61.555 60.000 0.00 0.00 34.29 4.02
1033 1034 1.125633 GACCGGGTTAGGAATAGGCA 58.874 55.000 6.32 0.00 34.73 4.75
1041 1042 4.464947 GGTTAGGAATAGGCATGAAAGCT 58.535 43.478 0.00 0.00 34.17 3.74
1042 1043 4.517075 GGTTAGGAATAGGCATGAAAGCTC 59.483 45.833 0.00 0.00 34.17 4.09
1047 1048 4.322567 GAATAGGCATGAAAGCTCTAGGG 58.677 47.826 0.00 0.00 34.17 3.53
1053 1054 0.984230 TGAAAGCTCTAGGGTGGGTG 59.016 55.000 0.00 0.00 0.00 4.61
1056 1057 3.009115 GCTCTAGGGTGGGTGGCA 61.009 66.667 0.00 0.00 0.00 4.92
1074 1075 0.389556 CATCGCCCATCATCTCCGAG 60.390 60.000 0.00 0.00 0.00 4.63
1097 1098 4.218417 GCTTTTCAAGAAATGCTCCACCTA 59.782 41.667 19.90 0.00 43.71 3.08
1099 1100 3.350219 TCAAGAAATGCTCCACCTACC 57.650 47.619 0.00 0.00 0.00 3.18
1107 1108 0.176910 GCTCCACCTACCTCAGCTTC 59.823 60.000 0.00 0.00 0.00 3.86
1111 1112 0.179161 CACCTACCTCAGCTTCGACG 60.179 60.000 0.00 0.00 0.00 5.12
1129 1130 3.267860 CATCGGAGAAGCTGCGGC 61.268 66.667 10.33 10.33 45.01 6.53
1136 1137 2.192608 GAGAAGCTGCGGCAACTTGG 62.193 60.000 22.09 2.50 41.70 3.61
1147 1148 2.900716 GCAACTTGGGCCAAAACTTA 57.099 45.000 21.28 0.00 0.00 2.24
1149 1150 4.529109 GCAACTTGGGCCAAAACTTATA 57.471 40.909 21.28 0.00 0.00 0.98
1150 1151 5.084818 GCAACTTGGGCCAAAACTTATAT 57.915 39.130 21.28 0.00 0.00 0.86
1155 1156 5.105351 ACTTGGGCCAAAACTTATATTGCTC 60.105 40.000 21.28 0.00 0.00 4.26
1163 1164 1.071605 CTTATATTGCTCGAGCGGGC 58.928 55.000 30.75 7.96 45.83 6.13
1173 1174 3.224324 GAGCGGGCGATGGAGGTA 61.224 66.667 0.00 0.00 0.00 3.08
1174 1175 2.524394 AGCGGGCGATGGAGGTAT 60.524 61.111 0.00 0.00 0.00 2.73
1176 1177 1.227853 GCGGGCGATGGAGGTATTT 60.228 57.895 0.00 0.00 0.00 1.40
1178 1179 0.105964 CGGGCGATGGAGGTATTTGA 59.894 55.000 0.00 0.00 0.00 2.69
1179 1180 1.594331 GGGCGATGGAGGTATTTGAC 58.406 55.000 0.00 0.00 0.00 3.18
1180 1181 1.134220 GGGCGATGGAGGTATTTGACA 60.134 52.381 0.00 0.00 0.00 3.58
1184 1185 4.130118 GCGATGGAGGTATTTGACAAGAT 58.870 43.478 0.00 0.00 0.00 2.40
1188 1189 3.202151 TGGAGGTATTTGACAAGATCCCC 59.798 47.826 0.00 0.00 0.00 4.81
1189 1190 3.467803 GAGGTATTTGACAAGATCCCCG 58.532 50.000 0.00 0.00 0.00 5.73
1190 1191 2.172717 AGGTATTTGACAAGATCCCCGG 59.827 50.000 0.00 0.00 0.00 5.73
1204 1205 4.227134 CCGGCAGGGATCGTCTGG 62.227 72.222 14.06 2.32 38.47 3.86
1207 1208 1.758514 GGCAGGGATCGTCTGGAGA 60.759 63.158 14.06 0.00 33.16 3.71
1215 1216 2.354203 GGATCGTCTGGAGAAGCTGTTT 60.354 50.000 0.00 0.00 0.00 2.83
1221 1222 2.909006 TCTGGAGAAGCTGTTTGAGGAT 59.091 45.455 0.00 0.00 0.00 3.24
1239 1240 5.660417 TGAGGATCTCAAGTCTGCTTTCTAT 59.340 40.000 0.00 0.00 37.57 1.98
1275 1276 4.832248 TCTTGGATGATGTTGAGTACCAC 58.168 43.478 0.00 0.00 0.00 4.16
1276 1277 4.532126 TCTTGGATGATGTTGAGTACCACT 59.468 41.667 0.00 0.00 0.00 4.00
1278 1279 3.582647 TGGATGATGTTGAGTACCACTGT 59.417 43.478 0.00 0.00 0.00 3.55
1281 1282 4.955811 TGATGTTGAGTACCACTGTCTT 57.044 40.909 0.00 0.00 0.00 3.01
1282 1283 4.631131 TGATGTTGAGTACCACTGTCTTG 58.369 43.478 0.00 0.00 0.00 3.02
1291 1292 2.964209 ACCACTGTCTTGAGAAGGAGA 58.036 47.619 0.00 0.00 0.00 3.71
1296 1297 3.513515 ACTGTCTTGAGAAGGAGATCCAC 59.486 47.826 0.92 0.00 38.89 4.02
1297 1298 3.510459 TGTCTTGAGAAGGAGATCCACA 58.490 45.455 0.92 0.00 38.89 4.17
1298 1299 3.513119 TGTCTTGAGAAGGAGATCCACAG 59.487 47.826 0.92 0.00 38.89 3.66
1299 1300 2.499289 TCTTGAGAAGGAGATCCACAGC 59.501 50.000 0.92 0.00 38.89 4.40
1300 1301 1.942776 TGAGAAGGAGATCCACAGCA 58.057 50.000 0.92 0.00 38.89 4.41
1301 1302 2.475155 TGAGAAGGAGATCCACAGCAT 58.525 47.619 0.92 0.00 38.89 3.79
1309 1336 1.077212 ATCCACAGCATGCCTCCAC 60.077 57.895 15.66 0.00 42.53 4.02
1311 1338 3.807538 CACAGCATGCCTCCACGC 61.808 66.667 15.66 0.00 42.53 5.34
1313 1340 3.057548 CAGCATGCCTCCACGCAA 61.058 61.111 15.66 0.00 43.24 4.85
1314 1341 2.749044 AGCATGCCTCCACGCAAG 60.749 61.111 15.66 0.00 43.24 4.01
1316 1343 2.758089 GCATGCCTCCACGCAAGAG 61.758 63.158 6.36 0.00 43.24 2.85
1324 1351 1.750399 CCACGCAAGAGGGATTGGG 60.750 63.158 2.41 2.41 45.11 4.12
1330 1357 1.004745 GCAAGAGGGATTGGGTGAAGA 59.995 52.381 0.00 0.00 0.00 2.87
1332 1359 3.766545 CAAGAGGGATTGGGTGAAGAAA 58.233 45.455 0.00 0.00 0.00 2.52
1333 1360 3.441500 AGAGGGATTGGGTGAAGAAAC 57.558 47.619 0.00 0.00 0.00 2.78
1334 1361 2.989571 AGAGGGATTGGGTGAAGAAACT 59.010 45.455 0.00 0.00 0.00 2.66
1335 1362 3.009584 AGAGGGATTGGGTGAAGAAACTC 59.990 47.826 0.00 0.00 0.00 3.01
1336 1363 2.041755 AGGGATTGGGTGAAGAAACTCC 59.958 50.000 0.00 0.00 0.00 3.85
1338 1365 3.084786 GGATTGGGTGAAGAAACTCCTG 58.915 50.000 0.00 0.00 0.00 3.86
1340 1367 0.110486 TGGGTGAAGAAACTCCTGCC 59.890 55.000 0.00 0.00 0.00 4.85
1341 1368 0.609406 GGGTGAAGAAACTCCTGCCC 60.609 60.000 0.00 0.00 0.00 5.36
1342 1369 0.110486 GGTGAAGAAACTCCTGCCCA 59.890 55.000 0.00 0.00 0.00 5.36
1343 1370 1.528129 GTGAAGAAACTCCTGCCCAG 58.472 55.000 0.00 0.00 0.00 4.45
1346 1373 1.719063 AAGAAACTCCTGCCCAGCCA 61.719 55.000 0.00 0.00 0.00 4.75
1347 1374 1.228552 GAAACTCCTGCCCAGCCAA 60.229 57.895 0.00 0.00 0.00 4.52
1348 1375 0.613012 GAAACTCCTGCCCAGCCAAT 60.613 55.000 0.00 0.00 0.00 3.16
1349 1376 0.901580 AAACTCCTGCCCAGCCAATG 60.902 55.000 0.00 0.00 0.00 2.82
1366 1402 4.631377 GCCAATGCTTGAAAATTAAGGTCC 59.369 41.667 0.00 0.00 33.53 4.46
1369 1405 6.591448 CCAATGCTTGAAAATTAAGGTCCTTC 59.409 38.462 7.61 0.00 0.00 3.46
1370 1406 5.722021 TGCTTGAAAATTAAGGTCCTTCC 57.278 39.130 7.61 0.00 0.00 3.46
1379 1415 3.090504 AGGTCCTTCCTGTTCCTCC 57.909 57.895 0.00 0.00 46.19 4.30
1381 1417 1.203492 AGGTCCTTCCTGTTCCTCCAT 60.203 52.381 0.00 0.00 46.19 3.41
1382 1418 1.065126 GGTCCTTCCTGTTCCTCCATG 60.065 57.143 0.00 0.00 0.00 3.66
1388 1424 1.909302 TCCTGTTCCTCCATGTCTTCC 59.091 52.381 0.00 0.00 0.00 3.46
1389 1425 1.065126 CCTGTTCCTCCATGTCTTCCC 60.065 57.143 0.00 0.00 0.00 3.97
1390 1426 1.630369 CTGTTCCTCCATGTCTTCCCA 59.370 52.381 0.00 0.00 0.00 4.37
1391 1427 2.040278 CTGTTCCTCCATGTCTTCCCAA 59.960 50.000 0.00 0.00 0.00 4.12
1392 1428 2.224769 TGTTCCTCCATGTCTTCCCAAC 60.225 50.000 0.00 0.00 0.00 3.77
1393 1429 0.991920 TCCTCCATGTCTTCCCAACC 59.008 55.000 0.00 0.00 0.00 3.77
1394 1430 0.995024 CCTCCATGTCTTCCCAACCT 59.005 55.000 0.00 0.00 0.00 3.50
1395 1431 1.355720 CCTCCATGTCTTCCCAACCTT 59.644 52.381 0.00 0.00 0.00 3.50
1396 1432 2.225117 CCTCCATGTCTTCCCAACCTTT 60.225 50.000 0.00 0.00 0.00 3.11
1406 1442 5.048434 GTCTTCCCAACCTTTGATTTCTCTG 60.048 44.000 0.00 0.00 0.00 3.35
1407 1443 4.722526 TCCCAACCTTTGATTTCTCTGA 57.277 40.909 0.00 0.00 0.00 3.27
1408 1444 5.261040 TCCCAACCTTTGATTTCTCTGAT 57.739 39.130 0.00 0.00 0.00 2.90
1409 1445 5.644188 TCCCAACCTTTGATTTCTCTGATT 58.356 37.500 0.00 0.00 0.00 2.57
1410 1446 6.077322 TCCCAACCTTTGATTTCTCTGATTT 58.923 36.000 0.00 0.00 0.00 2.17
1411 1447 6.554605 TCCCAACCTTTGATTTCTCTGATTTT 59.445 34.615 0.00 0.00 0.00 1.82
1415 1451 7.459795 ACCTTTGATTTCTCTGATTTTCTCC 57.540 36.000 0.00 0.00 0.00 3.71
1416 1452 6.150140 ACCTTTGATTTCTCTGATTTTCTCCG 59.850 38.462 0.00 0.00 0.00 4.63
1417 1453 6.404074 CCTTTGATTTCTCTGATTTTCTCCGG 60.404 42.308 0.00 0.00 0.00 5.14
1418 1454 3.941483 TGATTTCTCTGATTTTCTCCGGC 59.059 43.478 0.00 0.00 0.00 6.13
1419 1455 3.417069 TTTCTCTGATTTTCTCCGGCA 57.583 42.857 0.00 0.00 0.00 5.69
1421 1457 3.185246 TCTCTGATTTTCTCCGGCATC 57.815 47.619 0.00 0.00 0.00 3.91
1422 1458 2.158900 TCTCTGATTTTCTCCGGCATCC 60.159 50.000 0.00 0.00 0.00 3.51
1424 1460 2.239654 TCTGATTTTCTCCGGCATCCTT 59.760 45.455 0.00 0.00 0.00 3.36
1439 1475 4.641396 GCATCCTTGCCTACATGTATGTA 58.359 43.478 5.91 0.00 43.38 2.29
1440 1476 5.248640 GCATCCTTGCCTACATGTATGTAT 58.751 41.667 5.91 0.00 43.38 2.29
1441 1477 5.122869 GCATCCTTGCCTACATGTATGTATG 59.877 44.000 5.91 5.70 43.38 2.39
1463 1582 9.494271 GTATGCATATATGAAAAAGAGAGGTCA 57.506 33.333 17.10 0.53 0.00 4.02
1466 1585 9.412460 TGCATATATGAAAAAGAGAGGTCATTT 57.588 29.630 17.10 0.00 32.99 2.32
1473 1592 6.265422 TGAAAAAGAGAGGTCATTTCCCTTTC 59.735 38.462 0.00 0.00 33.23 2.62
1474 1593 4.308526 AAGAGAGGTCATTTCCCTTTCC 57.691 45.455 0.00 0.00 34.53 3.13
1475 1594 3.536287 AGAGAGGTCATTTCCCTTTCCT 58.464 45.455 0.00 0.00 34.53 3.36
1476 1595 4.699994 AGAGAGGTCATTTCCCTTTCCTA 58.300 43.478 0.00 0.00 34.53 2.94
1477 1596 5.292815 AGAGAGGTCATTTCCCTTTCCTAT 58.707 41.667 0.00 0.00 34.53 2.57
1478 1597 5.131809 AGAGAGGTCATTTCCCTTTCCTATG 59.868 44.000 0.00 0.00 34.53 2.23
1479 1598 4.790790 AGAGGTCATTTCCCTTTCCTATGT 59.209 41.667 0.00 0.00 30.60 2.29
1480 1599 4.860022 AGGTCATTTCCCTTTCCTATGTG 58.140 43.478 0.00 0.00 0.00 3.21
1481 1600 3.381590 GGTCATTTCCCTTTCCTATGTGC 59.618 47.826 0.00 0.00 0.00 4.57
1482 1601 4.273318 GTCATTTCCCTTTCCTATGTGCT 58.727 43.478 0.00 0.00 0.00 4.40
1483 1602 4.706962 GTCATTTCCCTTTCCTATGTGCTT 59.293 41.667 0.00 0.00 0.00 3.91
1484 1603 4.949856 TCATTTCCCTTTCCTATGTGCTTC 59.050 41.667 0.00 0.00 0.00 3.86
1486 1605 2.184533 TCCCTTTCCTATGTGCTTCGA 58.815 47.619 0.00 0.00 0.00 3.71
1488 1607 3.199946 TCCCTTTCCTATGTGCTTCGATT 59.800 43.478 0.00 0.00 0.00 3.34
1489 1608 4.407621 TCCCTTTCCTATGTGCTTCGATTA 59.592 41.667 0.00 0.00 0.00 1.75
1501 1620 7.579589 TGTGCTTCGATTATTTTGGAAAATG 57.420 32.000 7.47 0.00 38.90 2.32
1503 1622 5.580297 TGCTTCGATTATTTTGGAAAATGCC 59.420 36.000 7.47 0.00 38.90 4.40
1505 1624 5.667539 TCGATTATTTTGGAAAATGCCCA 57.332 34.783 7.47 0.00 38.90 5.36
1506 1625 6.042638 TCGATTATTTTGGAAAATGCCCAA 57.957 33.333 7.47 0.00 41.53 4.12
1513 1632 4.904895 TTGGAAAATGCCCAAATCATGA 57.095 36.364 0.00 0.00 40.42 3.07
1514 1633 4.904895 TGGAAAATGCCCAAATCATGAA 57.095 36.364 0.00 0.00 0.00 2.57
1515 1634 5.438698 TGGAAAATGCCCAAATCATGAAT 57.561 34.783 0.00 0.00 0.00 2.57
1516 1635 6.556974 TGGAAAATGCCCAAATCATGAATA 57.443 33.333 0.00 0.00 0.00 1.75
1518 1637 7.575505 TGGAAAATGCCCAAATCATGAATAAT 58.424 30.769 0.00 0.00 0.00 1.28
1519 1638 8.053963 TGGAAAATGCCCAAATCATGAATAATT 58.946 29.630 0.00 0.00 0.00 1.40
1520 1639 8.347035 GGAAAATGCCCAAATCATGAATAATTG 58.653 33.333 0.00 3.37 0.00 2.32
1521 1640 6.870971 AATGCCCAAATCATGAATAATTGC 57.129 33.333 0.00 0.00 0.00 3.56
1522 1641 5.617528 TGCCCAAATCATGAATAATTGCT 57.382 34.783 0.00 0.00 0.00 3.91
1523 1642 5.991861 TGCCCAAATCATGAATAATTGCTT 58.008 33.333 0.00 0.00 0.00 3.91
1524 1643 5.818336 TGCCCAAATCATGAATAATTGCTTG 59.182 36.000 0.00 0.00 0.00 4.01
1526 1676 6.018507 GCCCAAATCATGAATAATTGCTTGAC 60.019 38.462 0.00 0.00 0.00 3.18
1529 1679 7.488792 CCAAATCATGAATAATTGCTTGACGAA 59.511 33.333 0.00 0.00 0.00 3.85
1565 1715 9.593134 CAAGAAACCTATCTATATATGTCTGGC 57.407 37.037 0.00 0.00 0.00 4.85
1566 1716 8.312669 AGAAACCTATCTATATATGTCTGGCC 57.687 38.462 0.00 0.00 0.00 5.36
1567 1717 8.125733 AGAAACCTATCTATATATGTCTGGCCT 58.874 37.037 3.32 0.00 0.00 5.19
1568 1718 8.686739 AAACCTATCTATATATGTCTGGCCTT 57.313 34.615 3.32 0.00 0.00 4.35
1569 1719 8.686739 AACCTATCTATATATGTCTGGCCTTT 57.313 34.615 3.32 0.00 0.00 3.11
1570 1720 8.083828 ACCTATCTATATATGTCTGGCCTTTG 57.916 38.462 3.32 0.00 0.00 2.77
1571 1721 7.680310 ACCTATCTATATATGTCTGGCCTTTGT 59.320 37.037 3.32 0.00 0.00 2.83
1572 1722 9.201989 CCTATCTATATATGTCTGGCCTTTGTA 57.798 37.037 3.32 0.00 0.00 2.41
1575 1725 9.726438 ATCTATATATGTCTGGCCTTTGTAAAC 57.274 33.333 3.32 0.00 0.00 2.01
1576 1726 8.934697 TCTATATATGTCTGGCCTTTGTAAACT 58.065 33.333 3.32 0.00 0.00 2.66
1580 1730 5.811796 TGTCTGGCCTTTGTAAACTAGTA 57.188 39.130 3.32 0.00 0.00 1.82
1581 1731 5.544650 TGTCTGGCCTTTGTAAACTAGTAC 58.455 41.667 3.32 0.00 0.00 2.73
1582 1732 5.070714 TGTCTGGCCTTTGTAAACTAGTACA 59.929 40.000 3.32 0.00 32.11 2.90
1583 1733 5.638234 GTCTGGCCTTTGTAAACTAGTACAG 59.362 44.000 3.32 0.00 35.47 2.74
1584 1734 4.320870 TGGCCTTTGTAAACTAGTACAGC 58.679 43.478 3.32 0.00 35.47 4.40
1585 1735 4.202377 TGGCCTTTGTAAACTAGTACAGCA 60.202 41.667 3.32 0.00 35.47 4.41
1586 1736 4.153655 GGCCTTTGTAAACTAGTACAGCAC 59.846 45.833 0.00 0.00 35.47 4.40
1605 1755 5.385509 GCACTAGGCAAAAATAAACTGGA 57.614 39.130 0.00 0.00 43.97 3.86
1606 1756 5.402398 GCACTAGGCAAAAATAAACTGGAG 58.598 41.667 0.00 0.00 43.97 3.86
1607 1757 5.402398 CACTAGGCAAAAATAAACTGGAGC 58.598 41.667 0.00 0.00 0.00 4.70
1608 1758 3.961480 AGGCAAAAATAAACTGGAGCC 57.039 42.857 0.00 0.00 41.08 4.70
1609 1759 3.238597 AGGCAAAAATAAACTGGAGCCA 58.761 40.909 0.00 0.00 43.13 4.75
1612 1762 5.483583 AGGCAAAAATAAACTGGAGCCAATA 59.516 36.000 0.00 0.00 43.13 1.90
1613 1763 6.013812 AGGCAAAAATAAACTGGAGCCAATAA 60.014 34.615 0.00 0.00 43.13 1.40
1614 1764 6.652900 GGCAAAAATAAACTGGAGCCAATAAA 59.347 34.615 0.00 0.00 40.50 1.40
1615 1765 7.336679 GGCAAAAATAAACTGGAGCCAATAAAT 59.663 33.333 0.00 0.00 40.50 1.40
1616 1766 8.729756 GCAAAAATAAACTGGAGCCAATAAATT 58.270 29.630 0.00 0.00 0.00 1.82
1624 1774 9.620259 AAACTGGAGCCAATAAATTTTAAAACA 57.380 25.926 1.97 0.00 0.00 2.83
1625 1775 8.601845 ACTGGAGCCAATAAATTTTAAAACAC 57.398 30.769 1.97 0.00 0.00 3.32
1626 1776 7.383843 ACTGGAGCCAATAAATTTTAAAACACG 59.616 33.333 1.97 0.00 0.00 4.49
1627 1777 7.210873 TGGAGCCAATAAATTTTAAAACACGT 58.789 30.769 1.97 0.00 0.00 4.49
1628 1778 7.711339 TGGAGCCAATAAATTTTAAAACACGTT 59.289 29.630 1.97 0.00 0.00 3.99
1629 1779 9.194271 GGAGCCAATAAATTTTAAAACACGTTA 57.806 29.630 1.97 0.99 0.00 3.18
1630 1780 9.998381 GAGCCAATAAATTTTAAAACACGTTAC 57.002 29.630 1.97 0.00 0.00 2.50
1631 1781 9.752961 AGCCAATAAATTTTAAAACACGTTACT 57.247 25.926 1.97 0.00 0.00 2.24
1632 1782 9.998381 GCCAATAAATTTTAAAACACGTTACTC 57.002 29.630 1.97 0.00 0.00 2.59
1637 1787 8.806177 AAATTTTAAAACACGTTACTCATCCC 57.194 30.769 1.97 0.00 0.00 3.85
1638 1788 5.594724 TTTAAAACACGTTACTCATCCCG 57.405 39.130 0.00 0.00 0.00 5.14
1639 1789 2.825861 AAACACGTTACTCATCCCGT 57.174 45.000 0.00 0.00 0.00 5.28
1640 1790 2.825861 AACACGTTACTCATCCCGTT 57.174 45.000 0.00 0.00 0.00 4.44
1641 1791 3.940209 AACACGTTACTCATCCCGTTA 57.060 42.857 0.00 0.00 0.00 3.18
1642 1792 4.460948 AACACGTTACTCATCCCGTTAT 57.539 40.909 0.00 0.00 0.00 1.89
1643 1793 4.460948 ACACGTTACTCATCCCGTTATT 57.539 40.909 0.00 0.00 0.00 1.40
1644 1794 4.427312 ACACGTTACTCATCCCGTTATTC 58.573 43.478 0.00 0.00 0.00 1.75
1645 1795 4.159135 ACACGTTACTCATCCCGTTATTCT 59.841 41.667 0.00 0.00 0.00 2.40
1646 1796 4.503007 CACGTTACTCATCCCGTTATTCTG 59.497 45.833 0.00 0.00 0.00 3.02
1647 1797 4.400251 ACGTTACTCATCCCGTTATTCTGA 59.600 41.667 0.00 0.00 0.00 3.27
1648 1798 5.105635 ACGTTACTCATCCCGTTATTCTGAA 60.106 40.000 0.00 0.00 0.00 3.02
1649 1799 5.808540 CGTTACTCATCCCGTTATTCTGAAA 59.191 40.000 0.00 0.00 0.00 2.69
1650 1800 6.019801 CGTTACTCATCCCGTTATTCTGAAAG 60.020 42.308 0.00 0.00 0.00 2.62
1651 1801 4.770795 ACTCATCCCGTTATTCTGAAAGG 58.229 43.478 0.00 0.00 0.00 3.11
1652 1802 3.541632 TCATCCCGTTATTCTGAAAGGC 58.458 45.455 0.00 0.00 0.00 4.35
1653 1803 3.199946 TCATCCCGTTATTCTGAAAGGCT 59.800 43.478 0.00 0.00 0.00 4.58
1654 1804 3.261981 TCCCGTTATTCTGAAAGGCTC 57.738 47.619 0.00 0.00 0.00 4.70
1655 1805 2.838202 TCCCGTTATTCTGAAAGGCTCT 59.162 45.455 0.00 0.00 0.00 4.09
1656 1806 4.028131 TCCCGTTATTCTGAAAGGCTCTA 58.972 43.478 0.00 0.00 0.00 2.43
1657 1807 4.099573 TCCCGTTATTCTGAAAGGCTCTAG 59.900 45.833 0.00 0.00 0.00 2.43
1658 1808 4.099573 CCCGTTATTCTGAAAGGCTCTAGA 59.900 45.833 0.00 0.00 0.00 2.43
1659 1809 5.221541 CCCGTTATTCTGAAAGGCTCTAGAT 60.222 44.000 0.00 0.00 0.00 1.98
1660 1810 5.694006 CCGTTATTCTGAAAGGCTCTAGATG 59.306 44.000 0.00 0.00 0.00 2.90
1661 1811 6.461648 CCGTTATTCTGAAAGGCTCTAGATGA 60.462 42.308 0.00 0.00 0.00 2.92
1662 1812 7.151308 CGTTATTCTGAAAGGCTCTAGATGAT 58.849 38.462 0.00 0.00 0.00 2.45
1663 1813 7.328249 CGTTATTCTGAAAGGCTCTAGATGATC 59.672 40.741 0.00 0.00 0.00 2.92
1664 1814 6.744175 ATTCTGAAAGGCTCTAGATGATCA 57.256 37.500 0.00 0.00 0.00 2.92
1665 1815 6.744175 TTCTGAAAGGCTCTAGATGATCAT 57.256 37.500 8.25 8.25 0.00 2.45
1666 1816 6.343716 TCTGAAAGGCTCTAGATGATCATC 57.656 41.667 25.42 25.42 38.09 2.92
1667 1817 5.837438 TCTGAAAGGCTCTAGATGATCATCA 59.163 40.000 31.99 19.06 40.22 3.07
1668 1818 6.325804 TCTGAAAGGCTCTAGATGATCATCAA 59.674 38.462 31.99 18.32 40.22 2.57
1669 1819 7.016366 TCTGAAAGGCTCTAGATGATCATCAAT 59.984 37.037 31.99 18.14 40.22 2.57
1670 1820 8.198807 TGAAAGGCTCTAGATGATCATCAATA 57.801 34.615 31.99 18.28 40.22 1.90
1671 1821 8.823794 TGAAAGGCTCTAGATGATCATCAATAT 58.176 33.333 31.99 17.17 40.22 1.28
1672 1822 9.316730 GAAAGGCTCTAGATGATCATCAATATC 57.683 37.037 31.99 19.09 40.22 1.63
1673 1823 7.041635 AGGCTCTAGATGATCATCAATATCG 57.958 40.000 31.99 17.78 40.22 2.92
1674 1824 6.606796 AGGCTCTAGATGATCATCAATATCGT 59.393 38.462 31.99 18.06 40.22 3.73
1675 1825 7.777440 AGGCTCTAGATGATCATCAATATCGTA 59.223 37.037 31.99 15.81 40.22 3.43
1676 1826 8.075574 GGCTCTAGATGATCATCAATATCGTAG 58.924 40.741 31.99 22.63 40.22 3.51
1677 1827 8.835439 GCTCTAGATGATCATCAATATCGTAGA 58.165 37.037 31.99 24.81 40.05 2.59
1684 1834 7.953393 TGATCATCAATATCGTAGAATTTCGC 58.047 34.615 0.00 0.00 43.58 4.70
1685 1835 7.814587 TGATCATCAATATCGTAGAATTTCGCT 59.185 33.333 0.00 0.00 43.58 4.93
1686 1836 9.290483 GATCATCAATATCGTAGAATTTCGCTA 57.710 33.333 0.00 0.00 43.58 4.26
1687 1837 8.449085 TCATCAATATCGTAGAATTTCGCTAC 57.551 34.615 0.00 0.00 43.58 3.58
1688 1838 8.297426 TCATCAATATCGTAGAATTTCGCTACT 58.703 33.333 0.00 0.00 43.58 2.57
1689 1839 9.556030 CATCAATATCGTAGAATTTCGCTACTA 57.444 33.333 0.00 0.00 43.58 1.82
1690 1840 8.945758 TCAATATCGTAGAATTTCGCTACTAC 57.054 34.615 0.00 0.00 43.58 2.73
1691 1841 8.019669 TCAATATCGTAGAATTTCGCTACTACC 58.980 37.037 0.00 0.00 43.58 3.18
1692 1842 7.684937 ATATCGTAGAATTTCGCTACTACCT 57.315 36.000 0.00 0.00 43.58 3.08
1693 1843 5.415415 TCGTAGAATTTCGCTACTACCTC 57.585 43.478 0.00 0.00 36.85 3.85
1694 1844 4.877823 TCGTAGAATTTCGCTACTACCTCA 59.122 41.667 0.00 0.00 36.85 3.86
1695 1845 4.968788 CGTAGAATTTCGCTACTACCTCAC 59.031 45.833 0.00 0.00 36.85 3.51
1696 1846 4.388378 AGAATTTCGCTACTACCTCACC 57.612 45.455 0.00 0.00 0.00 4.02
1697 1847 3.132467 AGAATTTCGCTACTACCTCACCC 59.868 47.826 0.00 0.00 0.00 4.61
1698 1848 2.226962 TTTCGCTACTACCTCACCCT 57.773 50.000 0.00 0.00 0.00 4.34
1699 1849 1.760192 TTCGCTACTACCTCACCCTC 58.240 55.000 0.00 0.00 0.00 4.30
1700 1850 0.622136 TCGCTACTACCTCACCCTCA 59.378 55.000 0.00 0.00 0.00 3.86
1701 1851 1.005097 TCGCTACTACCTCACCCTCAA 59.995 52.381 0.00 0.00 0.00 3.02
1702 1852 1.134560 CGCTACTACCTCACCCTCAAC 59.865 57.143 0.00 0.00 0.00 3.18
1703 1853 2.458620 GCTACTACCTCACCCTCAACT 58.541 52.381 0.00 0.00 0.00 3.16
1704 1854 2.832733 GCTACTACCTCACCCTCAACTT 59.167 50.000 0.00 0.00 0.00 2.66
1705 1855 4.021916 GCTACTACCTCACCCTCAACTTA 58.978 47.826 0.00 0.00 0.00 2.24
1706 1856 4.650131 GCTACTACCTCACCCTCAACTTAT 59.350 45.833 0.00 0.00 0.00 1.73
1707 1857 5.832060 GCTACTACCTCACCCTCAACTTATA 59.168 44.000 0.00 0.00 0.00 0.98
1708 1858 6.016108 GCTACTACCTCACCCTCAACTTATAG 60.016 46.154 0.00 0.00 0.00 1.31
1709 1859 4.650131 ACTACCTCACCCTCAACTTATAGC 59.350 45.833 0.00 0.00 0.00 2.97
1710 1860 2.772515 ACCTCACCCTCAACTTATAGCC 59.227 50.000 0.00 0.00 0.00 3.93
1712 1862 3.199946 CCTCACCCTCAACTTATAGCCAA 59.800 47.826 0.00 0.00 0.00 4.52
1720 1870 5.656416 CCTCAACTTATAGCCAAATTTCCCA 59.344 40.000 0.00 0.00 0.00 4.37
1721 1871 6.183360 CCTCAACTTATAGCCAAATTTCCCAG 60.183 42.308 0.00 0.00 0.00 4.45
1723 1873 7.125391 TCAACTTATAGCCAAATTTCCCAGAT 58.875 34.615 0.00 0.00 0.00 2.90
1724 1874 7.285401 TCAACTTATAGCCAAATTTCCCAGATC 59.715 37.037 0.00 0.00 0.00 2.75
1725 1875 6.915786 ACTTATAGCCAAATTTCCCAGATCT 58.084 36.000 0.00 0.00 0.00 2.75
1726 1876 8.045720 ACTTATAGCCAAATTTCCCAGATCTA 57.954 34.615 0.00 0.00 0.00 1.98
1734 1884 7.338710 CCAAATTTCCCAGATCTAGTGTTAGA 58.661 38.462 0.00 0.00 40.10 2.10
1735 1885 7.281100 CCAAATTTCCCAGATCTAGTGTTAGAC 59.719 40.741 0.00 0.00 38.69 2.59
1736 1886 7.496346 AATTTCCCAGATCTAGTGTTAGACA 57.504 36.000 0.00 0.00 38.69 3.41
1737 1887 6.928348 TTTCCCAGATCTAGTGTTAGACAA 57.072 37.500 0.00 0.00 38.69 3.18
1738 1888 5.916661 TCCCAGATCTAGTGTTAGACAAC 57.083 43.478 0.00 0.00 38.69 3.32
1739 1889 5.580998 TCCCAGATCTAGTGTTAGACAACT 58.419 41.667 0.00 0.00 38.69 3.16
1740 1890 6.017192 TCCCAGATCTAGTGTTAGACAACTT 58.983 40.000 0.00 0.00 38.69 2.66
1742 1892 6.030849 CCAGATCTAGTGTTAGACAACTTCG 58.969 44.000 0.00 0.00 38.69 3.79
1743 1893 6.030849 CAGATCTAGTGTTAGACAACTTCGG 58.969 44.000 0.00 0.00 38.69 4.30
1744 1894 4.170292 TCTAGTGTTAGACAACTTCGGC 57.830 45.455 0.00 0.00 35.56 5.54
1746 1896 3.402628 AGTGTTAGACAACTTCGGCAT 57.597 42.857 0.00 0.00 35.56 4.40
1747 1897 3.740115 AGTGTTAGACAACTTCGGCATT 58.260 40.909 0.00 0.00 35.56 3.56
1748 1898 4.134563 AGTGTTAGACAACTTCGGCATTT 58.865 39.130 0.00 0.00 35.56 2.32
1749 1899 4.213482 AGTGTTAGACAACTTCGGCATTTC 59.787 41.667 0.00 0.00 35.56 2.17
1750 1900 3.185594 TGTTAGACAACTTCGGCATTTCG 59.814 43.478 0.00 0.00 35.56 3.46
1751 1901 1.878953 AGACAACTTCGGCATTTCGT 58.121 45.000 0.00 0.00 0.00 3.85
1752 1902 1.531149 AGACAACTTCGGCATTTCGTG 59.469 47.619 0.00 0.00 0.00 4.35
1753 1903 1.529438 GACAACTTCGGCATTTCGTGA 59.471 47.619 0.00 0.00 0.00 4.35
1754 1904 2.151202 ACAACTTCGGCATTTCGTGAT 58.849 42.857 0.00 0.00 0.00 3.06
1755 1905 2.159627 ACAACTTCGGCATTTCGTGATC 59.840 45.455 0.00 0.00 0.00 2.92
1756 1906 2.093306 ACTTCGGCATTTCGTGATCA 57.907 45.000 0.00 0.00 0.00 2.92
1757 1907 1.732259 ACTTCGGCATTTCGTGATCAC 59.268 47.619 16.21 16.21 0.00 3.06
1758 1908 1.062587 CTTCGGCATTTCGTGATCACC 59.937 52.381 20.03 4.69 0.00 4.02
1759 1909 1.081556 TCGGCATTTCGTGATCACCG 61.082 55.000 20.03 15.31 40.47 4.94
1760 1910 1.358725 CGGCATTTCGTGATCACCGT 61.359 55.000 20.03 0.91 34.61 4.83
1761 1911 0.802494 GGCATTTCGTGATCACCGTT 59.198 50.000 20.03 0.01 0.00 4.44
1762 1912 2.004017 GGCATTTCGTGATCACCGTTA 58.996 47.619 20.03 3.85 0.00 3.18
1763 1913 2.417239 GGCATTTCGTGATCACCGTTAA 59.583 45.455 20.03 9.22 0.00 2.01
1764 1914 3.064820 GGCATTTCGTGATCACCGTTAAT 59.935 43.478 20.03 10.95 0.00 1.40
1765 1915 4.028383 GCATTTCGTGATCACCGTTAATG 58.972 43.478 20.03 20.63 34.62 1.90
1766 1916 4.436852 GCATTTCGTGATCACCGTTAATGT 60.437 41.667 20.03 0.00 34.33 2.71
1767 1917 5.220510 GCATTTCGTGATCACCGTTAATGTA 60.221 40.000 20.03 0.00 34.33 2.29
1768 1918 5.766702 TTTCGTGATCACCGTTAATGTAC 57.233 39.130 20.03 0.00 0.00 2.90
1769 1919 4.707030 TCGTGATCACCGTTAATGTACT 57.293 40.909 20.03 0.00 0.00 2.73
1770 1920 4.417506 TCGTGATCACCGTTAATGTACTG 58.582 43.478 20.03 1.47 0.00 2.74
1771 1921 3.000078 CGTGATCACCGTTAATGTACTGC 60.000 47.826 20.03 0.00 0.00 4.40
1772 1922 4.181578 GTGATCACCGTTAATGTACTGCT 58.818 43.478 15.31 0.00 0.00 4.24
1773 1923 5.345702 GTGATCACCGTTAATGTACTGCTA 58.654 41.667 15.31 0.00 0.00 3.49
1774 1924 5.808540 GTGATCACCGTTAATGTACTGCTAA 59.191 40.000 15.31 0.00 0.00 3.09
1775 1925 6.311935 GTGATCACCGTTAATGTACTGCTAAA 59.688 38.462 15.31 0.00 0.00 1.85
1776 1926 6.874664 TGATCACCGTTAATGTACTGCTAAAA 59.125 34.615 0.00 0.00 0.00 1.52
1777 1927 7.551262 TGATCACCGTTAATGTACTGCTAAAAT 59.449 33.333 0.00 0.00 0.00 1.82
1778 1928 7.675962 TCACCGTTAATGTACTGCTAAAATT 57.324 32.000 0.00 0.00 0.00 1.82
1779 1929 8.774890 TCACCGTTAATGTACTGCTAAAATTA 57.225 30.769 0.00 0.00 0.00 1.40
1780 1930 8.658609 TCACCGTTAATGTACTGCTAAAATTAC 58.341 33.333 0.00 0.00 0.00 1.89
1781 1931 7.906527 CACCGTTAATGTACTGCTAAAATTACC 59.093 37.037 0.00 0.00 0.00 2.85
1782 1932 7.121272 CCGTTAATGTACTGCTAAAATTACCG 58.879 38.462 0.00 0.00 0.00 4.02
1783 1933 7.201548 CCGTTAATGTACTGCTAAAATTACCGT 60.202 37.037 0.00 0.00 0.00 4.83
1784 1934 7.633281 CGTTAATGTACTGCTAAAATTACCGTG 59.367 37.037 0.00 0.00 0.00 4.94
1785 1935 4.932268 TGTACTGCTAAAATTACCGTGC 57.068 40.909 0.00 0.00 0.00 5.34
1786 1936 3.685756 TGTACTGCTAAAATTACCGTGCC 59.314 43.478 0.00 0.00 0.00 5.01
1787 1937 2.785562 ACTGCTAAAATTACCGTGCCA 58.214 42.857 0.00 0.00 0.00 4.92
1788 1938 3.150767 ACTGCTAAAATTACCGTGCCAA 58.849 40.909 0.00 0.00 0.00 4.52
1789 1939 3.570550 ACTGCTAAAATTACCGTGCCAAA 59.429 39.130 0.00 0.00 0.00 3.28
1790 1940 3.903360 TGCTAAAATTACCGTGCCAAAC 58.097 40.909 0.00 0.00 0.00 2.93
1791 1941 3.570550 TGCTAAAATTACCGTGCCAAACT 59.429 39.130 0.00 0.00 0.00 2.66
1792 1942 4.038162 TGCTAAAATTACCGTGCCAAACTT 59.962 37.500 0.00 0.00 0.00 2.66
1793 1943 4.986034 GCTAAAATTACCGTGCCAAACTTT 59.014 37.500 0.00 0.00 0.00 2.66
1794 1944 5.464057 GCTAAAATTACCGTGCCAAACTTTT 59.536 36.000 0.00 0.00 0.00 2.27
1795 1945 5.977171 AAAATTACCGTGCCAAACTTTTC 57.023 34.783 0.00 0.00 0.00 2.29
1796 1946 4.929819 AATTACCGTGCCAAACTTTTCT 57.070 36.364 0.00 0.00 0.00 2.52
1797 1947 6.394025 AAATTACCGTGCCAAACTTTTCTA 57.606 33.333 0.00 0.00 0.00 2.10
1798 1948 4.816786 TTACCGTGCCAAACTTTTCTAC 57.183 40.909 0.00 0.00 0.00 2.59
1799 1949 1.951602 ACCGTGCCAAACTTTTCTACC 59.048 47.619 0.00 0.00 0.00 3.18
1800 1950 1.950909 CCGTGCCAAACTTTTCTACCA 59.049 47.619 0.00 0.00 0.00 3.25
1801 1951 2.287368 CCGTGCCAAACTTTTCTACCAC 60.287 50.000 0.00 0.00 0.00 4.16
1802 1952 2.356382 CGTGCCAAACTTTTCTACCACA 59.644 45.455 0.00 0.00 0.00 4.17
1803 1953 3.702330 GTGCCAAACTTTTCTACCACAC 58.298 45.455 0.00 0.00 0.00 3.82
1804 1954 2.691011 TGCCAAACTTTTCTACCACACC 59.309 45.455 0.00 0.00 0.00 4.16
1805 1955 2.691011 GCCAAACTTTTCTACCACACCA 59.309 45.455 0.00 0.00 0.00 4.17
1806 1956 3.320826 GCCAAACTTTTCTACCACACCAT 59.679 43.478 0.00 0.00 0.00 3.55
1807 1957 4.795962 GCCAAACTTTTCTACCACACCATG 60.796 45.833 0.00 0.00 0.00 3.66
1808 1958 4.298332 CAAACTTTTCTACCACACCATGC 58.702 43.478 0.00 0.00 0.00 4.06
1809 1959 2.514803 ACTTTTCTACCACACCATGCC 58.485 47.619 0.00 0.00 0.00 4.40
1810 1960 1.818674 CTTTTCTACCACACCATGCCC 59.181 52.381 0.00 0.00 0.00 5.36
1811 1961 1.072266 TTTCTACCACACCATGCCCT 58.928 50.000 0.00 0.00 0.00 5.19
1812 1962 0.327924 TTCTACCACACCATGCCCTG 59.672 55.000 0.00 0.00 0.00 4.45
1813 1963 1.750399 CTACCACACCATGCCCTGC 60.750 63.158 0.00 0.00 0.00 4.85
1814 1964 3.280938 TACCACACCATGCCCTGCC 62.281 63.158 0.00 0.00 0.00 4.85
1815 1965 4.371417 CCACACCATGCCCTGCCT 62.371 66.667 0.00 0.00 0.00 4.75
1816 1966 3.066190 CACACCATGCCCTGCCTG 61.066 66.667 0.00 0.00 0.00 4.85
1817 1967 3.583380 ACACCATGCCCTGCCTGT 61.583 61.111 0.00 0.00 0.00 4.00
1818 1968 2.283388 CACCATGCCCTGCCTGTT 60.283 61.111 0.00 0.00 0.00 3.16
1819 1969 2.283388 ACCATGCCCTGCCTGTTG 60.283 61.111 0.00 0.00 0.00 3.33
1820 1970 2.283388 CCATGCCCTGCCTGTTGT 60.283 61.111 0.00 0.00 0.00 3.32
1821 1971 1.909781 CCATGCCCTGCCTGTTGTT 60.910 57.895 0.00 0.00 0.00 2.83
1822 1972 0.611618 CCATGCCCTGCCTGTTGTTA 60.612 55.000 0.00 0.00 0.00 2.41
1823 1973 0.813184 CATGCCCTGCCTGTTGTTAG 59.187 55.000 0.00 0.00 0.00 2.34
1824 1974 0.405585 ATGCCCTGCCTGTTGTTAGT 59.594 50.000 0.00 0.00 0.00 2.24
1825 1975 0.250727 TGCCCTGCCTGTTGTTAGTC 60.251 55.000 0.00 0.00 0.00 2.59
1826 1976 1.298859 GCCCTGCCTGTTGTTAGTCG 61.299 60.000 0.00 0.00 0.00 4.18
1827 1977 1.298859 CCCTGCCTGTTGTTAGTCGC 61.299 60.000 0.00 0.00 0.00 5.19
1828 1978 1.298859 CCTGCCTGTTGTTAGTCGCC 61.299 60.000 0.00 0.00 0.00 5.54
1829 1979 0.602638 CTGCCTGTTGTTAGTCGCCA 60.603 55.000 0.00 0.00 0.00 5.69
1830 1980 0.036164 TGCCTGTTGTTAGTCGCCAT 59.964 50.000 0.00 0.00 0.00 4.40
1831 1981 1.276705 TGCCTGTTGTTAGTCGCCATA 59.723 47.619 0.00 0.00 0.00 2.74
1832 1982 1.664151 GCCTGTTGTTAGTCGCCATAC 59.336 52.381 0.00 0.00 0.00 2.39
1833 1983 2.933492 GCCTGTTGTTAGTCGCCATACA 60.933 50.000 0.00 0.00 0.00 2.29
1834 1984 3.331150 CCTGTTGTTAGTCGCCATACAA 58.669 45.455 0.00 0.00 0.00 2.41
1835 1985 3.749088 CCTGTTGTTAGTCGCCATACAAA 59.251 43.478 0.00 0.00 32.84 2.83
1836 1986 4.214545 CCTGTTGTTAGTCGCCATACAAAA 59.785 41.667 0.00 0.00 32.84 2.44
1837 1987 5.278071 CCTGTTGTTAGTCGCCATACAAAAA 60.278 40.000 0.00 0.00 32.84 1.94
1838 1988 5.512473 TGTTGTTAGTCGCCATACAAAAAC 58.488 37.500 0.00 0.00 32.84 2.43
1839 1989 4.752661 TGTTAGTCGCCATACAAAAACC 57.247 40.909 0.00 0.00 0.00 3.27
1840 1990 4.391155 TGTTAGTCGCCATACAAAAACCT 58.609 39.130 0.00 0.00 0.00 3.50
1841 1991 4.822896 TGTTAGTCGCCATACAAAAACCTT 59.177 37.500 0.00 0.00 0.00 3.50
1842 1992 3.915437 AGTCGCCATACAAAAACCTTG 57.085 42.857 0.00 0.00 0.00 3.61
1843 1993 3.219281 AGTCGCCATACAAAAACCTTGT 58.781 40.909 0.00 0.00 36.49 3.16
1844 1994 3.634910 AGTCGCCATACAAAAACCTTGTT 59.365 39.130 0.00 0.00 34.11 2.83
1845 1995 4.822896 AGTCGCCATACAAAAACCTTGTTA 59.177 37.500 0.00 0.00 34.11 2.41
1846 1996 5.299782 AGTCGCCATACAAAAACCTTGTTAA 59.700 36.000 0.00 0.00 34.11 2.01
1847 1997 6.015772 AGTCGCCATACAAAAACCTTGTTAAT 60.016 34.615 0.00 0.00 34.11 1.40
1848 1998 6.088883 GTCGCCATACAAAAACCTTGTTAATG 59.911 38.462 0.00 0.00 34.11 1.90
1849 1999 5.347364 CGCCATACAAAAACCTTGTTAATGG 59.653 40.000 12.21 12.21 39.65 3.16
1850 2000 5.641636 GCCATACAAAAACCTTGTTAATGGG 59.358 40.000 15.94 5.53 38.25 4.00
1851 2001 6.519213 GCCATACAAAAACCTTGTTAATGGGA 60.519 38.462 15.94 0.00 38.25 4.37
1852 2002 7.445945 CCATACAAAAACCTTGTTAATGGGAA 58.554 34.615 9.92 0.00 36.00 3.97
1853 2003 8.100164 CCATACAAAAACCTTGTTAATGGGAAT 58.900 33.333 9.92 0.00 36.00 3.01
1854 2004 9.500785 CATACAAAAACCTTGTTAATGGGAATT 57.499 29.630 0.00 0.00 34.11 2.17
1857 2007 9.554395 ACAAAAACCTTGTTAATGGGAATTTAG 57.446 29.630 0.00 0.00 0.00 1.85
1858 2008 9.771534 CAAAAACCTTGTTAATGGGAATTTAGA 57.228 29.630 0.00 0.00 0.00 2.10
1860 2010 9.996554 AAAACCTTGTTAATGGGAATTTAGAAG 57.003 29.630 0.00 0.00 0.00 2.85
1861 2011 8.721133 AACCTTGTTAATGGGAATTTAGAAGT 57.279 30.769 0.00 0.00 0.00 3.01
1862 2012 8.721133 ACCTTGTTAATGGGAATTTAGAAGTT 57.279 30.769 0.00 0.00 0.00 2.66
1863 2013 9.816787 ACCTTGTTAATGGGAATTTAGAAGTTA 57.183 29.630 0.00 0.00 0.00 2.24
1881 2031 8.850007 AGAAGTTACTAGAACATTTCCCTTTC 57.150 34.615 0.00 0.00 0.00 2.62
1882 2032 7.603024 AGAAGTTACTAGAACATTTCCCTTTCG 59.397 37.037 0.00 0.00 0.00 3.46
1883 2033 7.001099 AGTTACTAGAACATTTCCCTTTCGA 57.999 36.000 0.00 0.00 0.00 3.71
1884 2034 6.872547 AGTTACTAGAACATTTCCCTTTCGAC 59.127 38.462 0.00 0.00 0.00 4.20
1885 2035 5.223449 ACTAGAACATTTCCCTTTCGACA 57.777 39.130 0.00 0.00 0.00 4.35
1886 2036 5.805728 ACTAGAACATTTCCCTTTCGACAT 58.194 37.500 0.00 0.00 0.00 3.06
1887 2037 6.942976 ACTAGAACATTTCCCTTTCGACATA 58.057 36.000 0.00 0.00 0.00 2.29
1888 2038 7.565680 ACTAGAACATTTCCCTTTCGACATAT 58.434 34.615 0.00 0.00 0.00 1.78
1891 2041 8.438676 AGAACATTTCCCTTTCGACATATTAG 57.561 34.615 0.00 0.00 0.00 1.73
1893 2043 9.321562 GAACATTTCCCTTTCGACATATTAGTA 57.678 33.333 0.00 0.00 0.00 1.82
1896 2046 9.712305 CATTTCCCTTTCGACATATTAGTATCT 57.288 33.333 0.00 0.00 0.00 1.98
1930 2080 4.838904 GGTCAGTCCCTATAACAAACCT 57.161 45.455 0.00 0.00 0.00 3.50
1931 2081 4.767478 GGTCAGTCCCTATAACAAACCTC 58.233 47.826 0.00 0.00 0.00 3.85
1932 2082 4.470304 GGTCAGTCCCTATAACAAACCTCT 59.530 45.833 0.00 0.00 0.00 3.69
1933 2083 5.395435 GGTCAGTCCCTATAACAAACCTCTC 60.395 48.000 0.00 0.00 0.00 3.20
1934 2084 5.187186 GTCAGTCCCTATAACAAACCTCTCA 59.813 44.000 0.00 0.00 0.00 3.27
1935 2085 5.964477 TCAGTCCCTATAACAAACCTCTCAT 59.036 40.000 0.00 0.00 0.00 2.90
1936 2086 6.443849 TCAGTCCCTATAACAAACCTCTCATT 59.556 38.462 0.00 0.00 0.00 2.57
1937 2087 6.763610 CAGTCCCTATAACAAACCTCTCATTC 59.236 42.308 0.00 0.00 0.00 2.67
1938 2088 5.753921 GTCCCTATAACAAACCTCTCATTCG 59.246 44.000 0.00 0.00 0.00 3.34
1939 2089 5.424252 TCCCTATAACAAACCTCTCATTCGT 59.576 40.000 0.00 0.00 0.00 3.85
1940 2090 6.070424 TCCCTATAACAAACCTCTCATTCGTT 60.070 38.462 0.00 0.00 0.00 3.85
1941 2091 6.037172 CCCTATAACAAACCTCTCATTCGTTG 59.963 42.308 0.00 0.00 0.00 4.10
1942 2092 5.880054 ATAACAAACCTCTCATTCGTTGG 57.120 39.130 0.00 0.00 0.00 3.77
1943 2093 3.208747 ACAAACCTCTCATTCGTTGGT 57.791 42.857 0.00 0.00 0.00 3.67
1944 2094 4.345859 ACAAACCTCTCATTCGTTGGTA 57.654 40.909 0.00 0.00 0.00 3.25
1945 2095 4.906618 ACAAACCTCTCATTCGTTGGTAT 58.093 39.130 0.00 0.00 0.00 2.73
1946 2096 4.935808 ACAAACCTCTCATTCGTTGGTATC 59.064 41.667 0.00 0.00 0.00 2.24
1947 2097 3.821421 ACCTCTCATTCGTTGGTATCC 57.179 47.619 0.00 0.00 0.00 2.59
1948 2098 3.104512 ACCTCTCATTCGTTGGTATCCA 58.895 45.455 0.00 0.00 0.00 3.41
1949 2099 3.118738 ACCTCTCATTCGTTGGTATCCAC 60.119 47.826 0.00 0.00 30.78 4.02
1950 2100 3.118775 CCTCTCATTCGTTGGTATCCACA 60.119 47.826 0.00 0.00 30.78 4.17
1951 2101 3.857052 TCTCATTCGTTGGTATCCACAC 58.143 45.455 0.00 0.00 30.78 3.82
1952 2102 3.513912 TCTCATTCGTTGGTATCCACACT 59.486 43.478 0.00 0.00 30.78 3.55
1953 2103 3.595173 TCATTCGTTGGTATCCACACTG 58.405 45.455 0.00 0.00 30.78 3.66
1954 2104 1.803334 TTCGTTGGTATCCACACTGC 58.197 50.000 0.00 0.00 30.78 4.40
1955 2105 0.682292 TCGTTGGTATCCACACTGCA 59.318 50.000 0.00 0.00 30.78 4.41
1962 2112 3.081061 GGTATCCACACTGCATGTTTCA 58.919 45.455 0.00 0.00 40.64 2.69
1995 2145 5.178061 GGTATGCCCAAAAAGGAATTGAAG 58.822 41.667 0.00 0.00 41.22 3.02
1998 2148 3.909364 TGCCCAAAAAGGAATTGAAGGAT 59.091 39.130 0.00 0.00 41.22 3.24
2001 2151 5.187772 GCCCAAAAAGGAATTGAAGGATAGT 59.812 40.000 0.00 0.00 41.22 2.12
2018 2168 9.449719 GAAGGATAGTCTAGAGAAGATAGAAGG 57.550 40.741 0.00 0.00 36.36 3.46
2019 2169 8.751215 AGGATAGTCTAGAGAAGATAGAAGGA 57.249 38.462 0.00 0.00 36.36 3.36
2040 2190 9.722056 GAAGGAATTATAAACACTGCATACAAG 57.278 33.333 0.00 0.00 0.00 3.16
2058 2208 7.113965 GCATACAAGTTTGTTGAACATCTCAAG 59.886 37.037 0.00 0.00 44.83 3.02
2072 2222 6.851222 ACATCTCAAGTTGTTGACTGTAAG 57.149 37.500 2.11 0.00 37.79 2.34
2096 2246 2.156098 TCCAGGGAAGCCAAGCTGT 61.156 57.895 0.00 0.00 39.62 4.40
2104 2254 2.598394 GCCAAGCTGTTCCTGCCA 60.598 61.111 0.00 0.00 0.00 4.92
2115 2265 2.839098 CCTGCCAGTTCAGGTGGT 59.161 61.111 1.80 0.00 46.59 4.16
2116 2266 1.151450 CCTGCCAGTTCAGGTGGTT 59.849 57.895 1.80 0.00 46.59 3.67
2117 2267 0.468029 CCTGCCAGTTCAGGTGGTTT 60.468 55.000 1.80 0.00 46.59 3.27
2120 2270 0.881796 GCCAGTTCAGGTGGTTTAGC 59.118 55.000 0.00 0.00 37.40 3.09
2121 2271 1.817740 GCCAGTTCAGGTGGTTTAGCA 60.818 52.381 0.00 0.00 37.40 3.49
2151 2302 3.955650 GCTCCTCCGCCAATAGTAATA 57.044 47.619 0.00 0.00 0.00 0.98
2154 2305 2.565834 TCCTCCGCCAATAGTAATAGGC 59.434 50.000 0.00 0.00 43.61 3.93
2157 2308 1.076332 CGCCAATAGTAATAGGCCGC 58.924 55.000 0.00 0.00 44.18 6.53
2223 2374 3.808466 GGTGATGATCAGCTAGACACA 57.192 47.619 16.70 0.00 41.34 3.72
2231 2382 3.192541 TCAGCTAGACACAAACAGCAA 57.807 42.857 0.00 0.00 36.47 3.91
2233 2384 4.136796 TCAGCTAGACACAAACAGCAATT 58.863 39.130 0.00 0.00 36.47 2.32
2306 2460 2.948979 CCCTTGCACAGTTAGTTTGTGA 59.051 45.455 9.36 0.00 46.85 3.58
2314 2486 5.056480 CACAGTTAGTTTGTGACCATGAGA 58.944 41.667 0.00 0.00 46.85 3.27
2320 2492 7.339466 AGTTAGTTTGTGACCATGAGAAAAAGT 59.661 33.333 0.00 0.00 0.00 2.66
2323 2495 6.601613 AGTTTGTGACCATGAGAAAAAGTACA 59.398 34.615 0.00 0.00 0.00 2.90
2331 2503 6.016777 ACCATGAGAAAAAGTACAAGCAAGAG 60.017 38.462 0.00 0.00 0.00 2.85
2336 2508 8.184192 TGAGAAAAAGTACAAGCAAGAGAAAAG 58.816 33.333 0.00 0.00 0.00 2.27
2340 2512 4.390264 AGTACAAGCAAGAGAAAAGGGAC 58.610 43.478 0.00 0.00 0.00 4.46
2397 2570 9.220767 GTTTCTCAGAATTTTAGTGTGGATACT 57.779 33.333 0.00 0.00 37.61 2.12
2431 2604 1.002134 TTTGAGGCAGCTACAGGGC 60.002 57.895 0.00 0.00 0.00 5.19
2436 2609 1.077501 GGCAGCTACAGGGCATTCA 60.078 57.895 0.00 0.00 34.17 2.57
2439 2612 2.020694 GCAGCTACAGGGCATTCATGT 61.021 52.381 0.00 0.00 43.38 3.21
2440 2613 1.674441 CAGCTACAGGGCATTCATGTG 59.326 52.381 0.00 0.00 40.89 3.21
2490 2663 7.554959 ACAAGATAAGTTGGAGGAGAAACTA 57.445 36.000 0.00 0.00 35.60 2.24
2508 2681 8.712228 AGAAACTACATGGAAAAAGATTCCTT 57.288 30.769 8.55 0.00 39.31 3.36
2532 2705 7.818997 TTTAGTACTCGATGATATCTGGTGT 57.181 36.000 0.00 3.36 0.00 4.16
2537 2710 6.656632 ACTCGATGATATCTGGTGTAACAT 57.343 37.500 3.98 0.00 39.98 2.71
2541 2714 9.133627 CTCGATGATATCTGGTGTAACATTAAG 57.866 37.037 3.98 0.00 39.98 1.85
2546 2719 8.933653 TGATATCTGGTGTAACATTAAGGATGA 58.066 33.333 3.98 0.00 39.98 2.92
2556 2729 3.054139 ACATTAAGGATGAGAGGCAGCAA 60.054 43.478 0.00 0.00 39.15 3.91
2560 2733 1.153005 GATGAGAGGCAGCAAGGGG 60.153 63.158 0.00 0.00 31.86 4.79
2562 2735 1.210204 ATGAGAGGCAGCAAGGGGAA 61.210 55.000 0.00 0.00 0.00 3.97
2563 2736 1.210204 TGAGAGGCAGCAAGGGGAAT 61.210 55.000 0.00 0.00 0.00 3.01
2575 2748 3.243201 GCAAGGGGAATTGCGAAAGATAG 60.243 47.826 0.00 0.00 45.43 2.08
2589 2762 5.049680 GCGAAAGATAGTTTCACCACTCAAA 60.050 40.000 0.00 0.00 0.00 2.69
2630 2803 2.820787 AGGTTCTGGTGACTAGTCGAAG 59.179 50.000 17.85 14.11 0.00 3.79
2631 2804 2.597520 GTTCTGGTGACTAGTCGAAGC 58.402 52.381 17.85 11.33 0.00 3.86
2634 2807 0.803117 TGGTGACTAGTCGAAGCGAG 59.197 55.000 17.85 0.00 36.23 5.03
2683 2859 3.402628 AGCCGACATGTATTCCCATAC 57.597 47.619 0.00 0.00 36.52 2.39
2688 2864 4.020218 CCGACATGTATTCCCATACCTGAT 60.020 45.833 0.00 0.00 35.88 2.90
2696 2872 3.228188 TCCCATACCTGATTTGGATGC 57.772 47.619 0.00 0.00 31.94 3.91
2698 2874 3.152341 CCCATACCTGATTTGGATGCTC 58.848 50.000 0.00 0.00 31.94 4.26
2700 2876 3.819337 CCATACCTGATTTGGATGCTCAG 59.181 47.826 0.00 0.00 36.89 3.35
2708 2884 1.361204 TTGGATGCTCAGGTCTTCCA 58.639 50.000 0.00 0.00 36.40 3.53
2724 2900 6.891908 AGGTCTTCCATAGTTTGTTAATGCAT 59.108 34.615 0.00 0.00 35.89 3.96
2742 2918 4.178545 GCATTATGCACTTGAAGGTGTT 57.821 40.909 12.80 0.00 44.26 3.32
2743 2919 3.922240 GCATTATGCACTTGAAGGTGTTG 59.078 43.478 12.80 0.00 44.26 3.33
2746 2922 2.121291 TGCACTTGAAGGTGTTGTCA 57.879 45.000 0.00 0.00 39.21 3.58
2829 3005 0.392336 GATCACCTCTAGCAGCCAGG 59.608 60.000 1.67 1.67 0.00 4.45
2839 3015 1.304381 GCAGCCAGGATTGTGGGAA 60.304 57.895 0.00 0.00 38.14 3.97
2843 3019 1.026718 GCCAGGATTGTGGGAAGACG 61.027 60.000 0.00 0.00 38.14 4.18
2848 3024 1.473434 GGATTGTGGGAAGACGGCTAG 60.473 57.143 0.00 0.00 0.00 3.42
2850 3026 2.180159 TTGTGGGAAGACGGCTAGGC 62.180 60.000 6.15 6.15 0.00 3.93
2852 3028 2.359169 TGGGAAGACGGCTAGGCAG 61.359 63.158 17.45 11.41 0.00 4.85
2859 3035 3.541713 CGGCTAGGCAGGAGACCC 61.542 72.222 17.45 0.00 0.00 4.46
2862 3038 1.562672 GGCTAGGCAGGAGACCCAAA 61.563 60.000 12.16 0.00 33.88 3.28
2864 3040 0.107459 CTAGGCAGGAGACCCAAAGC 60.107 60.000 0.00 0.00 33.88 3.51
2879 3055 3.977427 CCAAAGCTGAGTTTTGGGTAAC 58.023 45.455 27.00 0.00 45.67 2.50
2882 3058 3.577805 AGCTGAGTTTTGGGTAACTGT 57.422 42.857 0.00 0.00 38.43 3.55
2885 3061 5.442391 AGCTGAGTTTTGGGTAACTGTTAA 58.558 37.500 1.10 0.00 38.43 2.01
2887 3063 6.378848 AGCTGAGTTTTGGGTAACTGTTAAAA 59.621 34.615 1.10 0.00 38.43 1.52
2895 3071 6.658188 TGGGTAACTGTTAAAAATGGGAAG 57.342 37.500 1.10 0.00 0.00 3.46
2899 3075 6.645003 GGTAACTGTTAAAAATGGGAAGCTTG 59.355 38.462 2.10 0.00 0.00 4.01
2901 3077 5.842907 ACTGTTAAAAATGGGAAGCTTGTC 58.157 37.500 2.10 0.00 0.00 3.18
2906 3082 0.673644 AATGGGAAGCTTGTCGACGG 60.674 55.000 2.10 7.51 0.00 4.79
2910 3086 1.289380 GAAGCTTGTCGACGGGACT 59.711 57.895 2.10 2.67 46.24 3.85
2947 3123 4.142609 TGGAGCTACCAACATCTTGATC 57.857 45.455 0.00 0.00 46.75 2.92
2954 3130 1.404391 CCAACATCTTGATCAGCAGGC 59.596 52.381 0.00 0.00 0.00 4.85
2958 3134 2.104451 ACATCTTGATCAGCAGGCTAGG 59.896 50.000 0.00 0.00 0.00 3.02
3000 3176 2.328819 TTTTTCCCCGAAGACGTCAA 57.671 45.000 19.50 0.00 37.88 3.18
3004 3180 0.682852 TCCCCGAAGACGTCAATTGT 59.317 50.000 19.50 0.00 37.88 2.71
3006 3182 2.498481 TCCCCGAAGACGTCAATTGTAT 59.502 45.455 19.50 0.00 37.88 2.29
3008 3184 3.430374 CCCCGAAGACGTCAATTGTATCT 60.430 47.826 19.50 4.38 37.88 1.98
3019 3195 8.771920 ACGTCAATTGTATCTTGATGAGTTAA 57.228 30.769 5.13 0.00 40.50 2.01
3053 3229 4.398358 GGTGGCAGAAGGGTTTATAAGAAC 59.602 45.833 0.00 0.00 0.00 3.01
3054 3230 5.007682 GTGGCAGAAGGGTTTATAAGAACA 58.992 41.667 0.00 0.00 0.00 3.18
3055 3231 5.007682 TGGCAGAAGGGTTTATAAGAACAC 58.992 41.667 0.00 0.00 33.07 3.32
3057 3233 5.007682 GCAGAAGGGTTTATAAGAACACCA 58.992 41.667 6.43 0.00 33.36 4.17
3064 3240 7.892609 AGGGTTTATAAGAACACCAAATGAAC 58.107 34.615 6.43 0.00 33.36 3.18
3067 3243 6.503589 TTATAAGAACACCAAATGAACGGG 57.496 37.500 0.00 0.00 0.00 5.28
3073 3249 1.745087 CACCAAATGAACGGGAGGATG 59.255 52.381 0.00 0.00 0.00 3.51
3089 3265 4.363999 GAGGATGTAGAAGATGTTGGTCG 58.636 47.826 0.00 0.00 0.00 4.79
3105 3281 4.137116 TGGTCGGGAATACTTTGATGAG 57.863 45.455 0.00 0.00 0.00 2.90
3106 3282 3.517901 TGGTCGGGAATACTTTGATGAGT 59.482 43.478 0.00 0.00 0.00 3.41
3110 3286 5.234543 GTCGGGAATACTTTGATGAGTTAGC 59.765 44.000 0.00 0.00 0.00 3.09
3111 3287 5.105106 TCGGGAATACTTTGATGAGTTAGCA 60.105 40.000 0.00 0.00 0.00 3.49
3130 3306 3.575256 AGCATCAACCTCATTTCTGCAAA 59.425 39.130 0.00 0.00 30.63 3.68
3132 3308 4.387862 GCATCAACCTCATTTCTGCAAAAG 59.612 41.667 0.00 0.00 0.00 2.27
3134 3310 3.062042 CAACCTCATTTCTGCAAAAGGC 58.938 45.455 0.00 0.00 45.13 4.35
3147 3323 4.257267 GCAAAAGGCAGGAAAGTACAAT 57.743 40.909 0.00 0.00 43.97 2.71
3148 3324 3.989817 GCAAAAGGCAGGAAAGTACAATG 59.010 43.478 0.00 0.00 43.97 2.82
3166 3348 9.326413 AGTACAATGGCAATGACTACTATTTAC 57.674 33.333 10.01 0.00 0.00 2.01
3197 3379 8.427276 TGATCTTGTGTATGATTTAGCAGAGAT 58.573 33.333 0.00 0.00 0.00 2.75
3204 3386 2.139118 GATTTAGCAGAGATGGTCGCC 58.861 52.381 0.00 0.00 0.00 5.54
3234 3416 3.492421 TGCTTCAGAATCGAAAATGGC 57.508 42.857 0.00 0.00 0.00 4.40
3241 3423 3.881688 CAGAATCGAAAATGGCTGGAGAT 59.118 43.478 0.00 0.00 0.00 2.75
3245 3427 1.408683 CGAAAATGGCTGGAGATGGGA 60.409 52.381 0.00 0.00 0.00 4.37
3248 3430 1.600058 AATGGCTGGAGATGGGAAGA 58.400 50.000 0.00 0.00 0.00 2.87
3250 3432 0.620556 TGGCTGGAGATGGGAAGAAC 59.379 55.000 0.00 0.00 0.00 3.01
3251 3433 0.106967 GGCTGGAGATGGGAAGAACC 60.107 60.000 0.00 0.00 38.08 3.62
3263 3448 2.261729 GGAAGAACCCAAGAGAGGAGT 58.738 52.381 0.00 0.00 0.00 3.85
3267 3452 2.112190 GAACCCAAGAGAGGAGTAGGG 58.888 57.143 0.00 0.00 42.07 3.53
3271 3456 0.827368 CAAGAGAGGAGTAGGGTGGC 59.173 60.000 0.00 0.00 0.00 5.01
3272 3457 0.684805 AAGAGAGGAGTAGGGTGGCG 60.685 60.000 0.00 0.00 0.00 5.69
3298 3483 1.629043 TGTTCCTCTAAGTGTCCGCT 58.371 50.000 0.00 0.00 0.00 5.52
3315 3500 5.705441 TGTCCGCTATCTTTTTGTTCAGAAT 59.295 36.000 0.00 0.00 0.00 2.40
3318 3503 7.692705 GTCCGCTATCTTTTTGTTCAGAATTAC 59.307 37.037 0.00 0.00 0.00 1.89
3322 3507 9.214953 GCTATCTTTTTGTTCAGAATTACGATG 57.785 33.333 0.00 0.00 0.00 3.84
3324 3509 6.077197 TCTTTTTGTTCAGAATTACGATGCG 58.923 36.000 0.00 0.00 0.00 4.73
3337 3522 2.912771 ACGATGCGGAATTGATTACCA 58.087 42.857 0.00 0.00 0.00 3.25
3345 3530 6.696411 TGCGGAATTGATTACCAAGAAAATT 58.304 32.000 0.00 0.00 38.31 1.82
3372 3557 2.473530 TGAAAAGTTTGCGCACTCTG 57.526 45.000 11.12 0.00 0.00 3.35
3383 3568 1.333881 GCGCACTCTGATCATTGATGC 60.334 52.381 0.30 3.66 0.00 3.91
3385 3570 3.387397 CGCACTCTGATCATTGATGCTA 58.613 45.455 3.32 0.00 0.00 3.49
3391 3576 7.468220 GCACTCTGATCATTGATGCTATTGAAA 60.468 37.037 3.32 0.00 0.00 2.69
3392 3577 8.568794 CACTCTGATCATTGATGCTATTGAAAT 58.431 33.333 3.32 0.00 0.00 2.17
3394 3579 8.459911 TCTGATCATTGATGCTATTGAAATGT 57.540 30.769 3.32 0.00 31.63 2.71
3422 3607 4.202151 ACCAGTTGAGGAAAAAGTCATTGC 60.202 41.667 0.00 0.00 0.00 3.56
3431 3616 7.552687 TGAGGAAAAAGTCATTGCGAGTATATT 59.447 33.333 0.00 0.00 0.00 1.28
3437 3622 8.492673 AAAGTCATTGCGAGTATATTCAAGAA 57.507 30.769 0.00 0.00 0.00 2.52
3443 3628 3.804325 GCGAGTATATTCAAGAAGCTGCA 59.196 43.478 1.02 0.00 0.00 4.41
3448 3633 7.313951 AGTATATTCAAGAAGCTGCAGAAAC 57.686 36.000 20.43 7.13 0.00 2.78
3450 3635 6.830873 ATATTCAAGAAGCTGCAGAAACTT 57.169 33.333 20.43 11.58 0.00 2.66
3456 3641 0.685097 AGCTGCAGAAACTTCGGGTA 59.315 50.000 20.43 0.00 0.00 3.69
3459 3644 2.353406 GCTGCAGAAACTTCGGGTACTA 60.353 50.000 20.43 0.00 0.00 1.82
3460 3645 3.863400 GCTGCAGAAACTTCGGGTACTAA 60.863 47.826 20.43 0.00 0.00 2.24
3462 3647 2.998670 GCAGAAACTTCGGGTACTAACC 59.001 50.000 0.00 0.00 45.97 2.85
3482 3667 4.364415 CCGTGGGGTGTTGTAATAATTG 57.636 45.455 0.00 0.00 0.00 2.32
3483 3668 3.129638 CCGTGGGGTGTTGTAATAATTGG 59.870 47.826 0.00 0.00 0.00 3.16
3486 3671 5.262804 GTGGGGTGTTGTAATAATTGGGTA 58.737 41.667 0.00 0.00 0.00 3.69
3487 3672 5.715753 GTGGGGTGTTGTAATAATTGGGTAA 59.284 40.000 0.00 0.00 0.00 2.85
3488 3673 6.381707 GTGGGGTGTTGTAATAATTGGGTAAT 59.618 38.462 0.00 0.00 0.00 1.89
3489 3674 6.608002 TGGGGTGTTGTAATAATTGGGTAATC 59.392 38.462 0.00 0.00 0.00 1.75
3491 3676 7.201875 GGGGTGTTGTAATAATTGGGTAATCAG 60.202 40.741 0.00 0.00 0.00 2.90
3492 3677 7.201875 GGGTGTTGTAATAATTGGGTAATCAGG 60.202 40.741 0.00 0.00 0.00 3.86
3496 3681 7.817418 TGTAATAATTGGGTAATCAGGAAGC 57.183 36.000 0.00 0.00 0.00 3.86
3499 3684 0.254747 TTGGGTAATCAGGAAGCCCG 59.745 55.000 0.00 0.00 42.10 6.13
3501 3686 0.765510 GGGTAATCAGGAAGCCCGAT 59.234 55.000 0.00 0.00 37.58 4.18
3504 3689 2.213499 GTAATCAGGAAGCCCGATGTG 58.787 52.381 0.00 0.00 37.58 3.21
3506 3691 0.620556 ATCAGGAAGCCCGATGTGTT 59.379 50.000 0.00 0.00 37.58 3.32
3507 3692 1.271856 TCAGGAAGCCCGATGTGTTA 58.728 50.000 0.00 0.00 37.58 2.41
3508 3693 1.837439 TCAGGAAGCCCGATGTGTTAT 59.163 47.619 0.00 0.00 37.58 1.89
3527 3721 8.880244 TGTGTTATACATCCCAGAAGCTATTAT 58.120 33.333 0.00 0.00 33.42 1.28
3529 3723 9.725019 TGTTATACATCCCAGAAGCTATTATTG 57.275 33.333 0.00 0.00 0.00 1.90
3532 3726 6.506538 ACATCCCAGAAGCTATTATTGAGT 57.493 37.500 0.00 0.00 0.00 3.41
3540 3734 8.844244 CCAGAAGCTATTATTGAGTTAAAGCAT 58.156 33.333 0.00 0.00 0.00 3.79
3563 3757 5.589192 TCTACGCTATCTTGCTTTTAGGAC 58.411 41.667 0.00 0.00 0.00 3.85
3566 3760 5.001232 ACGCTATCTTGCTTTTAGGACAAA 58.999 37.500 0.00 0.00 0.00 2.83
3569 3763 6.403636 CGCTATCTTGCTTTTAGGACAAACAT 60.404 38.462 0.00 0.00 0.00 2.71
3570 3764 6.749118 GCTATCTTGCTTTTAGGACAAACATG 59.251 38.462 0.00 0.00 0.00 3.21
3572 3766 6.463995 TCTTGCTTTTAGGACAAACATGTT 57.536 33.333 4.92 4.92 0.00 2.71
3573 3767 7.575414 TCTTGCTTTTAGGACAAACATGTTA 57.425 32.000 12.39 0.00 0.00 2.41
3574 3768 8.177119 TCTTGCTTTTAGGACAAACATGTTAT 57.823 30.769 12.39 2.96 0.00 1.89
3603 3803 6.384178 GTAATTTTACCAAACGCAATGTCC 57.616 37.500 0.00 0.00 0.00 4.02
3606 3806 3.634568 TTACCAAACGCAATGTCCAAG 57.365 42.857 0.00 0.00 0.00 3.61
3610 3810 2.472816 CAAACGCAATGTCCAAGCTTT 58.527 42.857 0.00 0.00 0.00 3.51
3612 3812 2.989422 ACGCAATGTCCAAGCTTTAC 57.011 45.000 0.00 0.00 0.00 2.01
3615 3815 2.668279 CGCAATGTCCAAGCTTTACCAC 60.668 50.000 0.00 0.00 0.00 4.16
3618 3818 4.487948 CAATGTCCAAGCTTTACCACATG 58.512 43.478 0.00 0.00 0.00 3.21
3624 3824 1.171308 AGCTTTACCACATGCAGCTG 58.829 50.000 10.11 10.11 39.40 4.24
3639 3839 2.097142 GCAGCTGCTAGATTTTGGTGAG 59.903 50.000 31.33 0.00 38.21 3.51
3640 3840 3.341823 CAGCTGCTAGATTTTGGTGAGT 58.658 45.455 0.00 0.00 0.00 3.41
3645 3845 3.888323 TGCTAGATTTTGGTGAGTGCAAA 59.112 39.130 0.00 0.00 0.00 3.68
3647 3847 5.163468 TGCTAGATTTTGGTGAGTGCAAAAA 60.163 36.000 0.00 0.00 32.55 1.94
3648 3848 5.403466 GCTAGATTTTGGTGAGTGCAAAAAG 59.597 40.000 0.00 0.00 32.55 2.27
3649 3849 5.596836 AGATTTTGGTGAGTGCAAAAAGA 57.403 34.783 0.00 0.00 32.55 2.52
3650 3850 6.165700 AGATTTTGGTGAGTGCAAAAAGAT 57.834 33.333 0.00 0.00 32.55 2.40
3652 3852 2.798976 TGGTGAGTGCAAAAAGATGC 57.201 45.000 0.00 0.00 46.58 3.91
3671 3871 2.224670 TGCAATTTTCCTACGGTGACCT 60.225 45.455 0.00 0.00 0.00 3.85
3673 3873 4.004982 GCAATTTTCCTACGGTGACCTTA 58.995 43.478 0.00 0.00 0.00 2.69
3678 3878 5.486735 TTTCCTACGGTGACCTTATCAAA 57.513 39.130 0.00 0.00 39.72 2.69
3685 3885 2.479560 GGTGACCTTATCAAATTGCGGC 60.480 50.000 0.00 0.00 39.72 6.53
3687 3887 3.023119 TGACCTTATCAAATTGCGGCAT 58.977 40.909 2.28 0.00 33.02 4.40
3688 3888 3.181488 TGACCTTATCAAATTGCGGCATG 60.181 43.478 2.28 0.00 33.02 4.06
3691 3891 4.584325 ACCTTATCAAATTGCGGCATGTAT 59.416 37.500 2.28 0.00 0.00 2.29
3693 3893 5.984926 CCTTATCAAATTGCGGCATGTATTT 59.015 36.000 2.28 4.30 0.00 1.40
3694 3894 6.074195 CCTTATCAAATTGCGGCATGTATTTG 60.074 38.462 23.16 23.16 38.63 2.32
3696 3896 1.938625 AATTGCGGCATGTATTTGGC 58.061 45.000 2.28 0.00 38.71 4.52
3698 3898 0.894141 TTGCGGCATGTATTTGGCTT 59.106 45.000 2.28 0.00 39.86 4.35
3699 3899 0.894141 TGCGGCATGTATTTGGCTTT 59.106 45.000 0.00 0.00 39.86 3.51
3701 3901 1.926510 GCGGCATGTATTTGGCTTTTC 59.073 47.619 0.00 0.00 39.86 2.29
3702 3902 2.673610 GCGGCATGTATTTGGCTTTTCA 60.674 45.455 0.00 0.00 39.86 2.69
3703 3903 3.181397 CGGCATGTATTTGGCTTTTCAG 58.819 45.455 0.00 0.00 39.86 3.02
3704 3904 3.524541 GGCATGTATTTGGCTTTTCAGG 58.475 45.455 0.00 0.00 39.00 3.86
3705 3905 3.195396 GGCATGTATTTGGCTTTTCAGGA 59.805 43.478 0.00 0.00 39.00 3.86
3707 3907 5.422145 GCATGTATTTGGCTTTTCAGGAAT 58.578 37.500 0.00 0.00 0.00 3.01
3708 3908 5.292589 GCATGTATTTGGCTTTTCAGGAATG 59.707 40.000 0.00 0.00 0.00 2.67
3709 3909 5.404466 TGTATTTGGCTTTTCAGGAATGG 57.596 39.130 0.00 0.00 0.00 3.16
3711 3911 5.721000 TGTATTTGGCTTTTCAGGAATGGAT 59.279 36.000 0.00 0.00 0.00 3.41
3712 3912 6.894654 TGTATTTGGCTTTTCAGGAATGGATA 59.105 34.615 0.00 0.00 0.00 2.59
3715 3918 6.872585 TTGGCTTTTCAGGAATGGATATTT 57.127 33.333 0.00 0.00 0.00 1.40
3717 3920 5.363580 TGGCTTTTCAGGAATGGATATTTCC 59.636 40.000 0.00 0.00 42.94 3.13
3734 3937 2.401766 CCAACATCGGCAGGCTGAC 61.402 63.158 20.86 16.27 33.73 3.51
3735 3938 2.045926 AACATCGGCAGGCTGACC 60.046 61.111 20.86 17.53 33.73 4.02
3744 3947 2.061220 CAGGCTGACCTCACTCCAA 58.939 57.895 9.42 0.00 46.34 3.53
3748 3951 1.476833 GGCTGACCTCACTCCAAACAA 60.477 52.381 0.00 0.00 0.00 2.83
3751 3954 3.437049 GCTGACCTCACTCCAAACAATAC 59.563 47.826 0.00 0.00 0.00 1.89
3752 3955 4.003648 CTGACCTCACTCCAAACAATACC 58.996 47.826 0.00 0.00 0.00 2.73
3754 3957 4.042809 TGACCTCACTCCAAACAATACCAT 59.957 41.667 0.00 0.00 0.00 3.55
3755 3958 4.589908 ACCTCACTCCAAACAATACCATC 58.410 43.478 0.00 0.00 0.00 3.51
3761 3964 5.653769 CACTCCAAACAATACCATCCTTCAT 59.346 40.000 0.00 0.00 0.00 2.57
3768 3971 9.613428 CAAACAATACCATCCTTCATAGTAAGA 57.387 33.333 0.00 0.00 0.00 2.10
3771 3974 9.838339 ACAATACCATCCTTCATAGTAAGAAAG 57.162 33.333 0.00 0.00 0.00 2.62
3772 3975 9.277783 CAATACCATCCTTCATAGTAAGAAAGG 57.722 37.037 0.00 0.00 0.00 3.11
3792 3998 9.454859 AGAAAGGAACAAGGATATGAAGTAAAG 57.545 33.333 0.00 0.00 0.00 1.85
3803 4009 1.003580 TGAAGTAAAGCAGCTGAGGGG 59.996 52.381 20.43 0.00 0.00 4.79
3818 4024 0.777446 AGGGGCCTAAACAAGCTTCA 59.223 50.000 0.84 0.00 0.00 3.02
3819 4025 0.888619 GGGGCCTAAACAAGCTTCAC 59.111 55.000 0.84 0.00 0.00 3.18
3822 4028 1.235724 GCCTAAACAAGCTTCACGGT 58.764 50.000 0.00 0.00 0.00 4.83
3823 4029 2.419667 GCCTAAACAAGCTTCACGGTA 58.580 47.619 0.00 0.00 0.00 4.02
3825 4031 3.863400 GCCTAAACAAGCTTCACGGTAGA 60.863 47.826 0.00 0.00 0.00 2.59
3828 4034 3.470645 AACAAGCTTCACGGTAGACTT 57.529 42.857 0.00 0.00 0.00 3.01
3829 4035 4.595762 AACAAGCTTCACGGTAGACTTA 57.404 40.909 0.00 0.00 0.00 2.24
3836 4042 4.355437 CTTCACGGTAGACTTAGCATCAG 58.645 47.826 0.00 0.00 0.00 2.90
3837 4043 2.099263 TCACGGTAGACTTAGCATCAGC 59.901 50.000 0.00 0.00 42.56 4.26
3853 4059 4.736793 GCATCAGCGGTCTTGAAAATATTG 59.263 41.667 0.00 0.00 0.00 1.90
3854 4060 5.449041 GCATCAGCGGTCTTGAAAATATTGA 60.449 40.000 0.00 0.00 0.00 2.57
3855 4061 5.801350 TCAGCGGTCTTGAAAATATTGAG 57.199 39.130 0.00 0.00 0.00 3.02
3867 4073 6.118170 TGAAAATATTGAGAGCAAGGAGGAG 58.882 40.000 0.00 0.00 37.45 3.69
3890 4096 3.204526 CTCTTGAAGCCAATCTAGCTGG 58.795 50.000 0.00 0.00 40.49 4.85
3897 4103 1.964552 CCAATCTAGCTGGCAAGGAG 58.035 55.000 0.00 0.00 0.00 3.69
3912 4118 3.813166 GCAAGGAGCAACTAACACAACTA 59.187 43.478 0.00 0.00 44.79 2.24
3914 4120 4.957684 AGGAGCAACTAACACAACTAGT 57.042 40.909 0.00 0.00 0.00 2.57
3916 4122 6.607004 AGGAGCAACTAACACAACTAGTAT 57.393 37.500 0.00 0.00 0.00 2.12
3919 4125 6.649557 GGAGCAACTAACACAACTAGTATTGT 59.350 38.462 0.00 0.00 43.67 2.71
3920 4126 7.816031 GGAGCAACTAACACAACTAGTATTGTA 59.184 37.037 9.18 0.21 40.89 2.41
3921 4127 8.530269 AGCAACTAACACAACTAGTATTGTAC 57.470 34.615 9.18 0.00 40.89 2.90
3925 4131 7.609056 ACTAACACAACTAGTATTGTACTGGG 58.391 38.462 9.18 0.07 40.89 4.45
3931 4137 3.773119 ACTAGTATTGTACTGGGGTGGTG 59.227 47.826 0.00 0.00 41.07 4.17
3934 4140 4.627015 AGTATTGTACTGGGGTGGTGATA 58.373 43.478 0.00 0.00 37.69 2.15
3936 4142 1.187974 TGTACTGGGGTGGTGATACG 58.812 55.000 0.00 0.00 0.00 3.06
3937 4143 1.272592 TGTACTGGGGTGGTGATACGA 60.273 52.381 0.00 0.00 0.00 3.43
3938 4144 1.407979 GTACTGGGGTGGTGATACGAG 59.592 57.143 0.00 0.00 0.00 4.18
3940 4146 0.460311 CTGGGGTGGTGATACGAGTC 59.540 60.000 0.00 0.00 0.00 3.36
3944 4174 0.108992 GGTGGTGATACGAGTCGCAA 60.109 55.000 13.59 0.81 0.00 4.85
3955 4185 1.656095 CGAGTCGCAATCCAGAAGTTC 59.344 52.381 0.00 0.00 0.00 3.01
3978 4208 1.003696 GCAGAGGTACTTGAAGGCCTT 59.996 52.381 20.65 20.65 41.55 4.35
3981 4211 2.711547 AGAGGTACTTGAAGGCCTTTGT 59.288 45.455 21.54 19.90 41.55 2.83
3987 4217 1.074566 CTTGAAGGCCTTTGTCCTCCT 59.925 52.381 21.54 0.00 32.45 3.69
3988 4218 0.401738 TGAAGGCCTTTGTCCTCCTG 59.598 55.000 21.54 0.00 32.45 3.86
3990 4222 0.111253 AAGGCCTTTGTCCTCCTGTG 59.889 55.000 13.78 0.00 32.45 3.66
3993 4225 1.380302 CCTTTGTCCTCCTGTGGGG 59.620 63.158 0.00 0.00 0.00 4.96
3999 4231 1.920325 TCCTCCTGTGGGGCTTGAG 60.920 63.158 0.00 0.00 34.39 3.02
4001 4233 1.298014 CTCCTGTGGGGCTTGAGAC 59.702 63.158 0.00 0.00 34.39 3.36
4006 4238 1.968540 GTGGGGCTTGAGACACTGC 60.969 63.158 0.00 0.00 0.00 4.40
4008 4240 1.968540 GGGGCTTGAGACACTGCAC 60.969 63.158 0.00 0.00 0.00 4.57
4011 4243 1.242076 GGCTTGAGACACTGCACATT 58.758 50.000 0.00 0.00 0.00 2.71
4013 4245 2.035066 GGCTTGAGACACTGCACATTTT 59.965 45.455 0.00 0.00 0.00 1.82
4015 4247 3.635331 CTTGAGACACTGCACATTTTGG 58.365 45.455 0.00 0.00 0.00 3.28
4016 4248 1.955778 TGAGACACTGCACATTTTGGG 59.044 47.619 0.00 0.00 0.00 4.12
4017 4249 1.956477 GAGACACTGCACATTTTGGGT 59.044 47.619 0.00 0.00 0.00 4.51
4021 4253 4.022068 AGACACTGCACATTTTGGGTTATG 60.022 41.667 0.00 0.00 0.00 1.90
4027 4259 4.346418 TGCACATTTTGGGTTATGAAGGTT 59.654 37.500 0.00 0.00 0.00 3.50
4031 4263 5.536916 ACATTTTGGGTTATGAAGGTTCGAA 59.463 36.000 0.00 0.00 0.00 3.71
4039 4271 5.240121 GTTATGAAGGTTCGAAGTACCCAA 58.760 41.667 0.00 0.00 36.27 4.12
4051 4283 4.340617 GAAGTACCCAAATTGGATGGTGA 58.659 43.478 14.62 0.00 40.96 4.02
4055 4287 3.697166 ACCCAAATTGGATGGTGAGTAC 58.303 45.455 14.62 0.00 40.96 2.73
4059 4291 3.281727 AATTGGATGGTGAGTACGCAT 57.718 42.857 1.64 0.00 0.00 4.73
4061 4293 3.452755 TTGGATGGTGAGTACGCATAG 57.547 47.619 1.64 0.00 0.00 2.23
4075 4307 2.763249 GCATAGCGAAGGACCAAATG 57.237 50.000 0.00 0.00 0.00 2.32
4076 4308 2.288666 GCATAGCGAAGGACCAAATGA 58.711 47.619 0.00 0.00 0.00 2.57
4077 4309 2.289002 GCATAGCGAAGGACCAAATGAG 59.711 50.000 0.00 0.00 0.00 2.90
4089 4321 3.753272 GACCAAATGAGCTGCAAGAACTA 59.247 43.478 1.02 0.00 34.07 2.24
4090 4322 4.338879 ACCAAATGAGCTGCAAGAACTAT 58.661 39.130 1.02 0.00 34.07 2.12
4091 4323 4.157289 ACCAAATGAGCTGCAAGAACTATG 59.843 41.667 1.02 0.00 34.07 2.23
4097 4329 4.253685 GAGCTGCAAGAACTATGGTTGTA 58.746 43.478 0.00 0.00 35.58 2.41
4098 4330 4.848357 AGCTGCAAGAACTATGGTTGTAT 58.152 39.130 0.00 0.00 35.58 2.29
4100 4332 4.201950 GCTGCAAGAACTATGGTTGTATGG 60.202 45.833 0.00 0.00 35.58 2.74
4101 4333 5.172687 TGCAAGAACTATGGTTGTATGGA 57.827 39.130 0.00 0.00 35.58 3.41
4105 4337 6.356556 CAAGAACTATGGTTGTATGGATGGA 58.643 40.000 0.00 0.00 35.58 3.41
4107 4339 4.357918 ACTATGGTTGTATGGATGGAGC 57.642 45.455 0.00 0.00 0.00 4.70
4112 4344 2.620367 GGTTGTATGGATGGAGCCAACA 60.620 50.000 0.00 0.00 42.16 3.33
4113 4345 3.290710 GTTGTATGGATGGAGCCAACAT 58.709 45.455 12.62 12.62 42.16 2.71
4116 4348 0.928505 ATGGATGGAGCCAACATGGA 59.071 50.000 0.00 0.00 40.96 3.41
4126 4358 0.679002 CCAACATGGACCTGCTCCTG 60.679 60.000 0.00 0.00 40.96 3.86
4128 4360 1.067295 AACATGGACCTGCTCCTGAA 58.933 50.000 0.00 0.00 40.26 3.02
4131 4363 0.908198 ATGGACCTGCTCCTGAACTC 59.092 55.000 0.00 0.00 40.26 3.01
4135 4370 1.254284 ACCTGCTCCTGAACTCGAGG 61.254 60.000 18.41 0.00 0.00 4.63
4150 4385 1.363744 CGAGGCTTTCGCTCATCTTT 58.636 50.000 0.00 0.00 43.22 2.52
4151 4386 1.061711 CGAGGCTTTCGCTCATCTTTG 59.938 52.381 0.00 0.00 43.22 2.77
4153 4388 2.485814 GAGGCTTTCGCTCATCTTTGTT 59.514 45.455 0.00 0.00 36.09 2.83
4154 4389 2.485814 AGGCTTTCGCTCATCTTTGTTC 59.514 45.455 0.00 0.00 36.09 3.18
4156 4391 2.096218 GCTTTCGCTCATCTTTGTTCGT 60.096 45.455 0.00 0.00 0.00 3.85
4158 4393 3.519908 TTCGCTCATCTTTGTTCGTTG 57.480 42.857 0.00 0.00 0.00 4.10
4159 4394 1.798223 TCGCTCATCTTTGTTCGTTGG 59.202 47.619 0.00 0.00 0.00 3.77
4175 4410 1.032014 TTGGAGCTTTGGAACTGCAC 58.968 50.000 0.00 0.00 33.68 4.57
4181 4416 1.402787 CTTTGGAACTGCACCTGGTT 58.597 50.000 0.00 0.00 0.00 3.67
4192 4427 0.035439 CACCTGGTTCGCCTTACCAT 60.035 55.000 0.00 0.00 44.29 3.55
4194 4429 1.376609 CCTGGTTCGCCTTACCATGC 61.377 60.000 0.00 0.00 44.29 4.06
4201 4436 3.483808 TCGCCTTACCATGCAATATGA 57.516 42.857 0.00 0.00 0.00 2.15
4211 4446 3.572682 CCATGCAATATGAAGCACCTCAT 59.427 43.478 0.00 2.14 44.49 2.90
4212 4447 4.546570 CATGCAATATGAAGCACCTCATG 58.453 43.478 0.00 0.00 44.49 3.07
4220 4455 0.035317 AAGCACCTCATGTCGCTCAA 59.965 50.000 0.00 0.00 32.50 3.02
4222 4457 0.390340 GCACCTCATGTCGCTCAAGA 60.390 55.000 0.00 0.00 0.00 3.02
4223 4458 1.638133 CACCTCATGTCGCTCAAGAG 58.362 55.000 0.00 5.96 40.34 2.85
4225 4460 2.106566 ACCTCATGTCGCTCAAGAGAT 58.893 47.619 11.94 0.00 42.39 2.75
4227 4462 3.701542 ACCTCATGTCGCTCAAGAGATTA 59.298 43.478 11.94 0.00 42.39 1.75
4228 4463 4.343526 ACCTCATGTCGCTCAAGAGATTAT 59.656 41.667 11.94 0.00 42.39 1.28
4231 4466 5.906073 TCATGTCGCTCAAGAGATTATTGA 58.094 37.500 0.32 0.00 35.45 2.57
4233 4468 6.644181 TCATGTCGCTCAAGAGATTATTGATC 59.356 38.462 0.32 0.00 36.16 2.92
4234 4469 4.978580 TGTCGCTCAAGAGATTATTGATCG 59.021 41.667 0.32 5.78 43.78 3.69
4235 4470 5.215903 GTCGCTCAAGAGATTATTGATCGA 58.784 41.667 9.69 9.69 46.75 3.59
4237 4472 5.860716 TCGCTCAAGAGATTATTGATCGATG 59.139 40.000 0.54 0.00 45.15 3.84
4243 4478 5.489249 AGAGATTATTGATCGATGCATGCT 58.511 37.500 20.33 4.11 39.85 3.79
4244 4479 5.938710 AGAGATTATTGATCGATGCATGCTT 59.061 36.000 20.33 13.23 39.85 3.91
4251 4486 5.952526 TGATCGATGCATGCTTGAATATT 57.047 34.783 20.33 0.00 0.00 1.28
4257 4492 3.277715 TGCATGCTTGAATATTCGGTCA 58.722 40.909 20.33 8.09 0.00 4.02
4274 4509 0.482446 TCACTTCCAACATTGCCCCT 59.518 50.000 0.00 0.00 0.00 4.79
4278 4513 0.187117 TTCCAACATTGCCCCTGTCA 59.813 50.000 0.00 0.00 0.00 3.58
4286 4521 2.680352 GCCCCTGTCACTCGAGGA 60.680 66.667 18.41 8.44 0.00 3.71
4288 4523 1.304547 CCCCTGTCACTCGAGGAGT 60.305 63.158 18.41 0.00 44.44 3.85
4291 4526 2.168496 CCCTGTCACTCGAGGAGTTTA 58.832 52.381 18.41 0.00 41.37 2.01
4292 4527 2.094649 CCCTGTCACTCGAGGAGTTTAC 60.095 54.545 18.41 5.84 41.37 2.01
4293 4528 2.557056 CCTGTCACTCGAGGAGTTTACA 59.443 50.000 18.41 9.91 41.37 2.41
4305 4540 1.226746 AGTTTACACTCAAGCGGTGC 58.773 50.000 0.00 0.00 38.14 5.01
4306 4541 0.941542 GTTTACACTCAAGCGGTGCA 59.058 50.000 0.00 0.00 38.14 4.57
4308 4543 0.941542 TTACACTCAAGCGGTGCAAC 59.058 50.000 0.00 0.00 38.14 4.17
4310 4545 2.203015 ACTCAAGCGGTGCAACGT 60.203 55.556 27.13 9.86 38.12 3.99
4317 4552 1.063488 GCGGTGCAACGTTGAGTTT 59.937 52.632 31.62 0.00 42.02 2.66
4318 4553 1.199852 GCGGTGCAACGTTGAGTTTG 61.200 55.000 31.62 16.32 42.02 2.93
4321 4556 1.131504 GGTGCAACGTTGAGTTTGTGA 59.868 47.619 31.62 1.48 42.02 3.58
4326 4561 3.181510 GCAACGTTGAGTTTGTGAAGTCT 60.182 43.478 31.62 0.00 42.02 3.24
4330 4565 3.354397 GTTGAGTTTGTGAAGTCTTGCG 58.646 45.455 0.00 0.00 36.40 4.85
4332 4567 2.866156 TGAGTTTGTGAAGTCTTGCGAG 59.134 45.455 0.00 0.00 36.40 5.03
4341 4576 2.355837 TCTTGCGAGACACACGGC 60.356 61.111 0.00 0.00 0.00 5.68
4372 4607 2.287547 TGGCAAAAGATTGAGCACGTTC 60.288 45.455 0.00 0.00 38.94 3.95
4373 4608 2.319472 GCAAAAGATTGAGCACGTTCC 58.681 47.619 0.00 0.00 38.94 3.62
4374 4609 2.922335 GCAAAAGATTGAGCACGTTCCC 60.922 50.000 0.00 0.00 38.94 3.97
4375 4610 2.270352 AAAGATTGAGCACGTTCCCA 57.730 45.000 0.00 0.00 0.00 4.37
4376 4611 2.496899 AAGATTGAGCACGTTCCCAT 57.503 45.000 0.00 0.00 0.00 4.00
4377 4612 1.742761 AGATTGAGCACGTTCCCATG 58.257 50.000 0.00 0.00 0.00 3.66
4378 4613 1.278985 AGATTGAGCACGTTCCCATGA 59.721 47.619 0.00 0.00 0.00 3.07
4379 4614 2.083774 GATTGAGCACGTTCCCATGAA 58.916 47.619 0.00 0.00 0.00 2.57
4380 4615 1.974265 TTGAGCACGTTCCCATGAAA 58.026 45.000 0.00 0.00 30.79 2.69
4381 4616 1.974265 TGAGCACGTTCCCATGAAAA 58.026 45.000 0.00 0.00 30.79 2.29
4382 4617 1.879380 TGAGCACGTTCCCATGAAAAG 59.121 47.619 0.00 0.00 30.79 2.27
4383 4618 1.880027 GAGCACGTTCCCATGAAAAGT 59.120 47.619 0.00 0.00 30.79 2.66
4384 4619 1.880027 AGCACGTTCCCATGAAAAGTC 59.120 47.619 0.00 0.00 30.79 3.01
4385 4620 1.880027 GCACGTTCCCATGAAAAGTCT 59.120 47.619 0.00 0.00 30.79 3.24
4386 4621 2.293399 GCACGTTCCCATGAAAAGTCTT 59.707 45.455 0.00 0.00 30.79 3.01
4387 4622 3.609409 GCACGTTCCCATGAAAAGTCTTC 60.609 47.826 0.00 0.00 30.79 2.87
4388 4623 3.815401 CACGTTCCCATGAAAAGTCTTCT 59.185 43.478 0.00 0.00 30.79 2.85
4389 4624 4.994852 CACGTTCCCATGAAAAGTCTTCTA 59.005 41.667 0.00 0.00 30.79 2.10
4390 4625 5.468746 CACGTTCCCATGAAAAGTCTTCTAA 59.531 40.000 0.00 0.00 30.79 2.10
4391 4626 5.701290 ACGTTCCCATGAAAAGTCTTCTAAG 59.299 40.000 0.00 0.00 30.79 2.18
4392 4627 5.701290 CGTTCCCATGAAAAGTCTTCTAAGT 59.299 40.000 0.00 0.00 30.79 2.24
4393 4628 6.128526 CGTTCCCATGAAAAGTCTTCTAAGTC 60.129 42.308 0.00 0.00 30.79 3.01
4394 4629 6.433847 TCCCATGAAAAGTCTTCTAAGTCA 57.566 37.500 0.00 0.00 0.00 3.41
4395 4630 6.837312 TCCCATGAAAAGTCTTCTAAGTCAA 58.163 36.000 0.00 0.00 0.00 3.18
4396 4631 6.936900 TCCCATGAAAAGTCTTCTAAGTCAAG 59.063 38.462 0.00 0.00 0.00 3.02
4397 4632 6.150140 CCCATGAAAAGTCTTCTAAGTCAAGG 59.850 42.308 0.00 0.00 0.00 3.61
4398 4633 6.936900 CCATGAAAAGTCTTCTAAGTCAAGGA 59.063 38.462 0.00 0.00 0.00 3.36
4399 4634 7.609532 CCATGAAAAGTCTTCTAAGTCAAGGAT 59.390 37.037 0.00 0.00 0.00 3.24
4400 4635 7.969536 TGAAAAGTCTTCTAAGTCAAGGATG 57.030 36.000 0.00 0.00 0.00 3.51
4401 4636 7.509546 TGAAAAGTCTTCTAAGTCAAGGATGT 58.490 34.615 0.00 0.00 0.00 3.06
4402 4637 8.647796 TGAAAAGTCTTCTAAGTCAAGGATGTA 58.352 33.333 0.00 0.00 0.00 2.29
4403 4638 9.490379 GAAAAGTCTTCTAAGTCAAGGATGTAA 57.510 33.333 0.00 0.00 0.00 2.41
4404 4639 9.495572 AAAAGTCTTCTAAGTCAAGGATGTAAG 57.504 33.333 0.00 0.00 0.00 2.34
4405 4640 8.423906 AAGTCTTCTAAGTCAAGGATGTAAGA 57.576 34.615 0.00 0.00 0.00 2.10
4406 4641 7.832769 AGTCTTCTAAGTCAAGGATGTAAGAC 58.167 38.462 0.00 0.00 40.20 3.01
4407 4642 7.672239 AGTCTTCTAAGTCAAGGATGTAAGACT 59.328 37.037 0.00 0.00 43.38 3.24
4408 4643 8.958506 GTCTTCTAAGTCAAGGATGTAAGACTA 58.041 37.037 0.00 0.00 40.22 2.59
4409 4644 9.702253 TCTTCTAAGTCAAGGATGTAAGACTAT 57.298 33.333 0.00 0.00 40.22 2.12
4410 4645 9.743057 CTTCTAAGTCAAGGATGTAAGACTATG 57.257 37.037 0.00 0.00 40.22 2.23
4411 4646 9.475620 TTCTAAGTCAAGGATGTAAGACTATGA 57.524 33.333 0.00 0.00 40.22 2.15
4412 4647 9.647918 TCTAAGTCAAGGATGTAAGACTATGAT 57.352 33.333 0.00 0.00 40.22 2.45
4415 4650 8.954950 AGTCAAGGATGTAAGACTATGATTTG 57.045 34.615 0.00 0.00 39.40 2.32
4416 4651 7.497249 AGTCAAGGATGTAAGACTATGATTTGC 59.503 37.037 0.00 0.00 39.40 3.68
4417 4652 6.479990 TCAAGGATGTAAGACTATGATTTGCG 59.520 38.462 0.00 0.00 0.00 4.85
4418 4653 5.918608 AGGATGTAAGACTATGATTTGCGT 58.081 37.500 0.00 0.00 0.00 5.24
4419 4654 6.349300 AGGATGTAAGACTATGATTTGCGTT 58.651 36.000 0.00 0.00 0.00 4.84
4420 4655 6.258727 AGGATGTAAGACTATGATTTGCGTTG 59.741 38.462 0.00 0.00 0.00 4.10
4421 4656 5.216566 TGTAAGACTATGATTTGCGTTGC 57.783 39.130 0.00 0.00 0.00 4.17
4422 4657 4.935205 TGTAAGACTATGATTTGCGTTGCT 59.065 37.500 0.00 0.00 0.00 3.91
4423 4658 4.346734 AAGACTATGATTTGCGTTGCTG 57.653 40.909 0.00 0.00 0.00 4.41
4424 4659 3.338249 AGACTATGATTTGCGTTGCTGT 58.662 40.909 0.00 0.00 0.00 4.40
4425 4660 3.753272 AGACTATGATTTGCGTTGCTGTT 59.247 39.130 0.00 0.00 0.00 3.16
4426 4661 4.216257 AGACTATGATTTGCGTTGCTGTTT 59.784 37.500 0.00 0.00 0.00 2.83
4427 4662 4.870363 ACTATGATTTGCGTTGCTGTTTT 58.130 34.783 0.00 0.00 0.00 2.43
4428 4663 5.288804 ACTATGATTTGCGTTGCTGTTTTT 58.711 33.333 0.00 0.00 0.00 1.94
4454 4689 9.462174 TTTTTCATTTGTATTTGTAGAGTGCTG 57.538 29.630 0.00 0.00 0.00 4.41
4455 4690 6.182039 TCATTTGTATTTGTAGAGTGCTGC 57.818 37.500 0.00 0.00 0.00 5.25
4456 4691 5.939883 TCATTTGTATTTGTAGAGTGCTGCT 59.060 36.000 0.00 0.00 0.00 4.24
4457 4692 6.430925 TCATTTGTATTTGTAGAGTGCTGCTT 59.569 34.615 0.00 0.00 0.00 3.91
4458 4693 5.862924 TTGTATTTGTAGAGTGCTGCTTC 57.137 39.130 0.00 0.00 0.00 3.86
4459 4694 4.253685 TGTATTTGTAGAGTGCTGCTTCC 58.746 43.478 0.00 0.00 0.00 3.46
4460 4695 1.795768 TTTGTAGAGTGCTGCTTCCG 58.204 50.000 0.00 0.00 0.00 4.30
4461 4696 0.679505 TTGTAGAGTGCTGCTTCCGT 59.320 50.000 0.00 0.00 0.00 4.69
4462 4697 0.038251 TGTAGAGTGCTGCTTCCGTG 60.038 55.000 0.00 0.00 0.00 4.94
4463 4698 0.243907 GTAGAGTGCTGCTTCCGTGA 59.756 55.000 0.00 0.00 0.00 4.35
4464 4699 0.528017 TAGAGTGCTGCTTCCGTGAG 59.472 55.000 0.00 0.00 0.00 3.51
4482 4717 4.863491 GTGAGGACGAACTGTTACTAACA 58.137 43.478 1.67 1.67 39.52 2.41
4483 4718 5.284079 GTGAGGACGAACTGTTACTAACAA 58.716 41.667 3.26 0.00 41.61 2.83
4484 4719 5.174579 GTGAGGACGAACTGTTACTAACAAC 59.825 44.000 3.26 0.00 41.61 3.32
4485 4720 5.068198 TGAGGACGAACTGTTACTAACAACT 59.932 40.000 3.26 0.00 41.61 3.16
4486 4721 5.910614 AGGACGAACTGTTACTAACAACTT 58.089 37.500 3.26 0.00 41.61 2.66
4487 4722 7.042797 AGGACGAACTGTTACTAACAACTTA 57.957 36.000 3.26 0.00 41.61 2.24
4488 4723 6.920210 AGGACGAACTGTTACTAACAACTTAC 59.080 38.462 3.26 0.00 41.61 2.34
4489 4724 6.144563 GGACGAACTGTTACTAACAACTTACC 59.855 42.308 3.26 0.76 41.61 2.85
4490 4725 5.985530 ACGAACTGTTACTAACAACTTACCC 59.014 40.000 3.26 0.00 41.61 3.69
4491 4726 6.183360 ACGAACTGTTACTAACAACTTACCCT 60.183 38.462 3.26 0.00 41.61 4.34
4492 4727 6.703165 CGAACTGTTACTAACAACTTACCCTT 59.297 38.462 3.26 0.00 41.61 3.95
4493 4728 7.225341 CGAACTGTTACTAACAACTTACCCTTT 59.775 37.037 3.26 0.00 41.61 3.11
4494 4729 8.812513 AACTGTTACTAACAACTTACCCTTTT 57.187 30.769 3.26 0.00 41.61 2.27
4495 4730 8.812513 ACTGTTACTAACAACTTACCCTTTTT 57.187 30.769 3.26 0.00 41.61 1.94
4518 4753 8.568732 TTTTCAACTTATTTGTTAGCTTTCCG 57.431 30.769 0.00 0.00 36.49 4.30
4519 4754 6.870971 TCAACTTATTTGTTAGCTTTCCGT 57.129 33.333 0.00 0.00 36.49 4.69
4520 4755 7.266922 TCAACTTATTTGTTAGCTTTCCGTT 57.733 32.000 0.00 0.00 36.49 4.44
4521 4756 7.357303 TCAACTTATTTGTTAGCTTTCCGTTC 58.643 34.615 0.00 0.00 36.49 3.95
4522 4757 7.227910 TCAACTTATTTGTTAGCTTTCCGTTCT 59.772 33.333 0.00 0.00 36.49 3.01
4523 4758 7.130303 ACTTATTTGTTAGCTTTCCGTTCTC 57.870 36.000 0.00 0.00 0.00 2.87
4524 4759 6.708949 ACTTATTTGTTAGCTTTCCGTTCTCA 59.291 34.615 0.00 0.00 0.00 3.27
4525 4760 4.806342 TTTGTTAGCTTTCCGTTCTCAC 57.194 40.909 0.00 0.00 0.00 3.51
4526 4761 2.400399 TGTTAGCTTTCCGTTCTCACG 58.600 47.619 0.00 0.00 46.71 4.35
4540 4775 4.302455 GTTCTCACGAGGATGTATGATGG 58.698 47.826 0.00 0.00 0.00 3.51
4541 4776 3.566351 TCTCACGAGGATGTATGATGGT 58.434 45.455 0.00 0.00 0.00 3.55
4542 4777 3.570125 TCTCACGAGGATGTATGATGGTC 59.430 47.826 0.00 0.00 0.00 4.02
4543 4778 3.566351 TCACGAGGATGTATGATGGTCT 58.434 45.455 0.00 0.00 0.00 3.85
4544 4779 3.960755 TCACGAGGATGTATGATGGTCTT 59.039 43.478 0.00 0.00 0.00 3.01
4545 4780 4.053983 CACGAGGATGTATGATGGTCTTG 58.946 47.826 0.00 0.00 0.00 3.02
4546 4781 3.706594 ACGAGGATGTATGATGGTCTTGT 59.293 43.478 0.00 0.00 0.00 3.16
4547 4782 4.053983 CGAGGATGTATGATGGTCTTGTG 58.946 47.826 0.00 0.00 0.00 3.33
4548 4783 4.442052 CGAGGATGTATGATGGTCTTGTGT 60.442 45.833 0.00 0.00 0.00 3.72
4549 4784 5.028549 AGGATGTATGATGGTCTTGTGTC 57.971 43.478 0.00 0.00 0.00 3.67
4550 4785 4.471025 AGGATGTATGATGGTCTTGTGTCA 59.529 41.667 0.00 0.00 0.00 3.58
4551 4786 5.131642 AGGATGTATGATGGTCTTGTGTCAT 59.868 40.000 0.00 0.00 35.62 3.06
4552 4787 5.237996 GGATGTATGATGGTCTTGTGTCATG 59.762 44.000 0.00 0.00 33.65 3.07
4553 4788 5.419239 TGTATGATGGTCTTGTGTCATGA 57.581 39.130 0.00 0.00 33.65 3.07
4554 4789 5.803552 TGTATGATGGTCTTGTGTCATGAA 58.196 37.500 0.00 0.00 33.65 2.57
4555 4790 5.876460 TGTATGATGGTCTTGTGTCATGAAG 59.124 40.000 0.00 0.00 33.65 3.02
4556 4791 4.622260 TGATGGTCTTGTGTCATGAAGA 57.378 40.909 0.00 0.00 0.00 2.87
4557 4792 4.318332 TGATGGTCTTGTGTCATGAAGAC 58.682 43.478 14.39 14.39 44.95 3.01
4565 4800 3.056628 GTCATGAAGACAGCGGAGG 57.943 57.895 0.00 0.00 46.77 4.30
4566 4801 0.460987 GTCATGAAGACAGCGGAGGG 60.461 60.000 0.00 0.00 46.77 4.30
4567 4802 0.614697 TCATGAAGACAGCGGAGGGA 60.615 55.000 0.00 0.00 0.00 4.20
4568 4803 0.250234 CATGAAGACAGCGGAGGGAA 59.750 55.000 0.00 0.00 0.00 3.97
4569 4804 0.250513 ATGAAGACAGCGGAGGGAAC 59.749 55.000 0.00 0.00 0.00 3.62
4570 4805 1.446272 GAAGACAGCGGAGGGAACG 60.446 63.158 0.00 0.00 0.00 3.95
4571 4806 2.156051 GAAGACAGCGGAGGGAACGT 62.156 60.000 0.00 0.00 0.00 3.99
4572 4807 1.755393 AAGACAGCGGAGGGAACGTT 61.755 55.000 0.00 0.00 0.00 3.99
4573 4808 1.737008 GACAGCGGAGGGAACGTTC 60.737 63.158 20.14 20.14 0.00 3.95
4574 4809 2.342279 CAGCGGAGGGAACGTTCA 59.658 61.111 28.24 0.00 0.00 3.18
4575 4810 1.301401 CAGCGGAGGGAACGTTCAA 60.301 57.895 28.24 0.00 0.00 2.69
4576 4811 1.301479 AGCGGAGGGAACGTTCAAC 60.301 57.895 28.24 20.01 0.00 3.18
4591 4826 5.191595 CGTTCAACGGAGAGAATTTGTAG 57.808 43.478 0.61 0.00 38.08 2.74
4592 4827 4.684703 CGTTCAACGGAGAGAATTTGTAGT 59.315 41.667 0.61 0.00 38.08 2.73
4593 4828 5.388475 CGTTCAACGGAGAGAATTTGTAGTG 60.388 44.000 0.61 0.00 38.08 2.74
4594 4829 4.566004 TCAACGGAGAGAATTTGTAGTGG 58.434 43.478 0.00 0.00 0.00 4.00
4595 4830 4.039973 TCAACGGAGAGAATTTGTAGTGGT 59.960 41.667 0.00 0.00 0.00 4.16
4596 4831 5.244402 TCAACGGAGAGAATTTGTAGTGGTA 59.756 40.000 0.00 0.00 0.00 3.25
4597 4832 5.069501 ACGGAGAGAATTTGTAGTGGTAC 57.930 43.478 0.00 0.00 0.00 3.34
4598 4833 4.525487 ACGGAGAGAATTTGTAGTGGTACA 59.475 41.667 0.00 0.00 37.38 2.90
4599 4834 5.011329 ACGGAGAGAATTTGTAGTGGTACAA 59.989 40.000 0.00 0.00 45.57 2.41
4606 4841 1.790755 TGTAGTGGTACAAAGCAGCG 58.209 50.000 0.00 0.00 44.16 5.18
4607 4842 0.442699 GTAGTGGTACAAAGCAGCGC 59.557 55.000 0.00 0.00 44.16 5.92
4608 4843 0.034198 TAGTGGTACAAAGCAGCGCA 59.966 50.000 11.47 0.00 44.16 6.09
4609 4844 0.606401 AGTGGTACAAAGCAGCGCAT 60.606 50.000 11.47 0.00 44.16 4.73
4610 4845 0.454957 GTGGTACAAAGCAGCGCATG 60.455 55.000 11.47 6.31 44.16 4.06
4611 4846 0.888736 TGGTACAAAGCAGCGCATGT 60.889 50.000 11.47 9.03 35.63 3.21
4612 4847 0.240945 GGTACAAAGCAGCGCATGTT 59.759 50.000 11.47 0.00 34.01 2.71
4613 4848 1.466950 GGTACAAAGCAGCGCATGTTA 59.533 47.619 11.47 0.00 34.01 2.41
4614 4849 2.505866 GTACAAAGCAGCGCATGTTAC 58.494 47.619 11.47 0.00 34.01 2.50
4615 4850 0.240945 ACAAAGCAGCGCATGTTACC 59.759 50.000 11.47 0.00 29.19 2.85
4616 4851 0.794229 CAAAGCAGCGCATGTTACCG 60.794 55.000 11.47 0.00 0.00 4.02
4617 4852 1.234615 AAAGCAGCGCATGTTACCGT 61.235 50.000 11.47 0.00 0.00 4.83
4618 4853 1.635663 AAGCAGCGCATGTTACCGTC 61.636 55.000 11.47 0.00 0.00 4.79
4619 4854 3.089784 CAGCGCATGTTACCGTCC 58.910 61.111 11.47 0.00 0.00 4.79
4620 4855 1.447838 CAGCGCATGTTACCGTCCT 60.448 57.895 11.47 0.00 0.00 3.85
4621 4856 0.179121 CAGCGCATGTTACCGTCCTA 60.179 55.000 11.47 0.00 0.00 2.94
4622 4857 0.179119 AGCGCATGTTACCGTCCTAC 60.179 55.000 11.47 0.00 0.00 3.18
4623 4858 1.149964 GCGCATGTTACCGTCCTACC 61.150 60.000 0.30 0.00 0.00 3.18
4624 4859 0.173935 CGCATGTTACCGTCCTACCA 59.826 55.000 0.00 0.00 0.00 3.25
4625 4860 1.404449 CGCATGTTACCGTCCTACCAA 60.404 52.381 0.00 0.00 0.00 3.67
4626 4861 2.740580 CGCATGTTACCGTCCTACCAAT 60.741 50.000 0.00 0.00 0.00 3.16
4627 4862 2.612212 GCATGTTACCGTCCTACCAATG 59.388 50.000 0.00 0.00 0.00 2.82
4628 4863 2.389962 TGTTACCGTCCTACCAATGC 57.610 50.000 0.00 0.00 0.00 3.56
4629 4864 1.624312 TGTTACCGTCCTACCAATGCA 59.376 47.619 0.00 0.00 0.00 3.96
4630 4865 2.004733 GTTACCGTCCTACCAATGCAC 58.995 52.381 0.00 0.00 0.00 4.57
4631 4866 1.268066 TACCGTCCTACCAATGCACA 58.732 50.000 0.00 0.00 0.00 4.57
4632 4867 0.036388 ACCGTCCTACCAATGCACAG 60.036 55.000 0.00 0.00 0.00 3.66
4633 4868 0.036388 CCGTCCTACCAATGCACAGT 60.036 55.000 0.00 0.00 0.00 3.55
4634 4869 1.206132 CCGTCCTACCAATGCACAGTA 59.794 52.381 0.00 0.00 0.00 2.74
4635 4870 2.540515 CGTCCTACCAATGCACAGTAG 58.459 52.381 11.05 11.05 34.52 2.57
4636 4871 2.280628 GTCCTACCAATGCACAGTAGC 58.719 52.381 12.12 0.00 33.61 3.58
4643 4878 4.697756 TGCACAGTAGCACCCGCC 62.698 66.667 0.00 0.00 40.11 6.13
4645 4880 3.706373 CACAGTAGCACCCGCCCT 61.706 66.667 0.00 0.00 39.83 5.19
4646 4881 2.038329 ACAGTAGCACCCGCCCTA 59.962 61.111 0.00 0.00 39.83 3.53
4647 4882 1.611261 ACAGTAGCACCCGCCCTAA 60.611 57.895 0.00 0.00 39.83 2.69
4648 4883 1.196104 ACAGTAGCACCCGCCCTAAA 61.196 55.000 0.00 0.00 39.83 1.85
4649 4884 0.035820 CAGTAGCACCCGCCCTAAAA 60.036 55.000 0.00 0.00 39.83 1.52
4650 4885 0.694196 AGTAGCACCCGCCCTAAAAA 59.306 50.000 0.00 0.00 39.83 1.94
4651 4886 1.092348 GTAGCACCCGCCCTAAAAAG 58.908 55.000 0.00 0.00 39.83 2.27
4652 4887 0.694196 TAGCACCCGCCCTAAAAAGT 59.306 50.000 0.00 0.00 39.83 2.66
4653 4888 0.178973 AGCACCCGCCCTAAAAAGTT 60.179 50.000 0.00 0.00 39.83 2.66
4654 4889 0.677288 GCACCCGCCCTAAAAAGTTT 59.323 50.000 0.00 0.00 0.00 2.66
4655 4890 1.069513 GCACCCGCCCTAAAAAGTTTT 59.930 47.619 0.00 0.00 0.00 2.43
4656 4891 2.864882 GCACCCGCCCTAAAAAGTTTTC 60.865 50.000 0.32 0.00 0.00 2.29
4657 4892 2.626266 CACCCGCCCTAAAAAGTTTTCT 59.374 45.455 0.32 0.00 0.00 2.52
4658 4893 3.822167 CACCCGCCCTAAAAAGTTTTCTA 59.178 43.478 0.32 0.00 0.00 2.10
4659 4894 4.077108 ACCCGCCCTAAAAAGTTTTCTAG 58.923 43.478 0.32 6.07 0.00 2.43
4660 4895 4.202493 ACCCGCCCTAAAAAGTTTTCTAGA 60.202 41.667 0.32 0.00 0.00 2.43
4661 4896 4.763279 CCCGCCCTAAAAAGTTTTCTAGAA 59.237 41.667 0.00 0.00 0.00 2.10
4662 4897 5.242171 CCCGCCCTAAAAAGTTTTCTAGAAA 59.758 40.000 13.99 13.99 0.00 2.52
4663 4898 6.071560 CCCGCCCTAAAAAGTTTTCTAGAAAT 60.072 38.462 18.37 5.46 0.00 2.17
4664 4899 7.121611 CCCGCCCTAAAAAGTTTTCTAGAAATA 59.878 37.037 18.37 6.31 0.00 1.40
4665 4900 8.517056 CCGCCCTAAAAAGTTTTCTAGAAATAA 58.483 33.333 18.37 2.07 0.00 1.40
4713 4948 9.676861 ATGTTTATCATCTCACAAGATTTCAGA 57.323 29.630 0.00 0.00 40.38 3.27
4714 4949 9.676861 TGTTTATCATCTCACAAGATTTCAGAT 57.323 29.630 0.00 0.00 40.38 2.90
4723 4958 9.091784 TCTCACAAGATTTCAGATCTAAATTCG 57.908 33.333 0.00 0.00 0.00 3.34
4724 4959 9.091784 CTCACAAGATTTCAGATCTAAATTCGA 57.908 33.333 0.00 0.00 0.00 3.71
4725 4960 9.605275 TCACAAGATTTCAGATCTAAATTCGAT 57.395 29.630 0.00 0.00 0.00 3.59
4726 4961 9.861138 CACAAGATTTCAGATCTAAATTCGATC 57.139 33.333 0.00 8.80 38.01 3.69
4727 4962 9.829507 ACAAGATTTCAGATCTAAATTCGATCT 57.170 29.630 12.16 12.16 46.30 2.75
4747 4982 9.255029 TCGATCTACATATTTTAGGGATGATCA 57.745 33.333 0.00 0.00 0.00 2.92
4758 4993 8.908786 TTTTAGGGATGATCATATGAACACTC 57.091 34.615 16.93 14.35 29.59 3.51
4759 4994 7.616528 TTAGGGATGATCATATGAACACTCA 57.383 36.000 16.93 12.61 35.56 3.41
4760 4995 6.699242 AGGGATGATCATATGAACACTCAT 57.301 37.500 16.93 16.43 44.71 2.90
4761 4996 7.803487 AGGGATGATCATATGAACACTCATA 57.197 36.000 16.93 0.00 46.23 2.15
4762 4997 7.619050 AGGGATGATCATATGAACACTCATAC 58.381 38.462 16.93 16.58 45.26 2.39
4763 4998 6.533012 GGGATGATCATATGAACACTCATACG 59.467 42.308 16.93 0.00 45.26 3.06
4764 4999 6.533012 GGATGATCATATGAACACTCATACGG 59.467 42.308 16.93 0.00 45.26 4.02
4765 5000 6.648879 TGATCATATGAACACTCATACGGA 57.351 37.500 9.99 0.33 45.26 4.69
4766 5001 6.681777 TGATCATATGAACACTCATACGGAG 58.318 40.000 9.99 0.00 45.26 4.63
4780 5015 7.969536 CTCATACGGAGGAATTGAATTGTAT 57.030 36.000 0.00 0.00 40.13 2.29
4781 5016 8.383318 CTCATACGGAGGAATTGAATTGTATT 57.617 34.615 0.00 0.00 40.13 1.89
4782 5017 8.153479 TCATACGGAGGAATTGAATTGTATTG 57.847 34.615 0.00 0.00 0.00 1.90
4783 5018 5.835113 ACGGAGGAATTGAATTGTATTGG 57.165 39.130 0.00 0.00 0.00 3.16
4784 5019 4.644685 ACGGAGGAATTGAATTGTATTGGG 59.355 41.667 0.00 0.00 0.00 4.12
4785 5020 4.887071 CGGAGGAATTGAATTGTATTGGGA 59.113 41.667 0.00 0.00 0.00 4.37
4786 5021 5.359576 CGGAGGAATTGAATTGTATTGGGAA 59.640 40.000 0.00 0.00 0.00 3.97
4787 5022 6.127479 CGGAGGAATTGAATTGTATTGGGAAA 60.127 38.462 0.00 0.00 0.00 3.13
4788 5023 7.578571 CGGAGGAATTGAATTGTATTGGGAAAA 60.579 37.037 0.00 0.00 0.00 2.29
4789 5024 8.100164 GGAGGAATTGAATTGTATTGGGAAAAA 58.900 33.333 0.00 0.00 0.00 1.94
4815 5050 9.671279 AATTCATTGGTTTTTCTTTTTGAGAGT 57.329 25.926 0.00 0.00 35.37 3.24
4816 5051 8.702163 TTCATTGGTTTTTCTTTTTGAGAGTC 57.298 30.769 0.00 0.00 35.37 3.36
4817 5052 7.835822 TCATTGGTTTTTCTTTTTGAGAGTCA 58.164 30.769 0.00 0.00 35.37 3.41
4818 5053 7.759433 TCATTGGTTTTTCTTTTTGAGAGTCAC 59.241 33.333 0.00 0.00 35.37 3.67
4819 5054 6.582677 TGGTTTTTCTTTTTGAGAGTCACA 57.417 33.333 0.00 0.00 35.37 3.58
4820 5055 7.169158 TGGTTTTTCTTTTTGAGAGTCACAT 57.831 32.000 0.00 0.00 35.37 3.21
4821 5056 7.035004 TGGTTTTTCTTTTTGAGAGTCACATG 58.965 34.615 0.00 0.00 35.37 3.21
4822 5057 7.035612 GGTTTTTCTTTTTGAGAGTCACATGT 58.964 34.615 0.00 0.00 35.37 3.21
4823 5058 8.188139 GGTTTTTCTTTTTGAGAGTCACATGTA 58.812 33.333 0.00 0.00 35.37 2.29
4824 5059 9.567848 GTTTTTCTTTTTGAGAGTCACATGTAA 57.432 29.630 0.00 0.00 35.37 2.41
4854 5089 5.418310 TTTTTGCGAGAAAACTTCGATCT 57.582 34.783 0.00 0.00 40.36 2.75
4855 5090 6.533819 TTTTTGCGAGAAAACTTCGATCTA 57.466 33.333 0.00 0.00 40.36 1.98
4856 5091 6.721571 TTTTGCGAGAAAACTTCGATCTAT 57.278 33.333 0.00 0.00 40.36 1.98
4857 5092 6.721571 TTTGCGAGAAAACTTCGATCTATT 57.278 33.333 0.00 0.00 40.36 1.73
4858 5093 5.950965 TGCGAGAAAACTTCGATCTATTC 57.049 39.130 0.00 0.00 40.36 1.75
4859 5094 5.407502 TGCGAGAAAACTTCGATCTATTCA 58.592 37.500 0.00 0.00 40.36 2.57
4860 5095 6.042777 TGCGAGAAAACTTCGATCTATTCAT 58.957 36.000 0.00 0.00 40.36 2.57
4861 5096 6.199154 TGCGAGAAAACTTCGATCTATTCATC 59.801 38.462 0.00 0.00 40.36 2.92
4862 5097 6.419413 GCGAGAAAACTTCGATCTATTCATCT 59.581 38.462 0.00 0.00 40.36 2.90
4863 5098 7.043059 GCGAGAAAACTTCGATCTATTCATCTT 60.043 37.037 0.00 0.00 40.36 2.40
4864 5099 8.476142 CGAGAAAACTTCGATCTATTCATCTTC 58.524 37.037 0.00 0.00 40.36 2.87
4865 5100 9.307121 GAGAAAACTTCGATCTATTCATCTTCA 57.693 33.333 0.00 0.00 34.02 3.02
4866 5101 9.658799 AGAAAACTTCGATCTATTCATCTTCAA 57.341 29.630 0.00 0.00 34.02 2.69
4869 5104 7.865875 ACTTCGATCTATTCATCTTCAATCG 57.134 36.000 0.00 0.00 36.71 3.34
4870 5105 7.429633 ACTTCGATCTATTCATCTTCAATCGT 58.570 34.615 0.00 0.00 36.73 3.73
4871 5106 7.380870 ACTTCGATCTATTCATCTTCAATCGTG 59.619 37.037 0.00 0.00 36.73 4.35
4872 5107 6.970484 TCGATCTATTCATCTTCAATCGTGA 58.030 36.000 0.00 0.00 36.73 4.35
4873 5108 7.597386 TCGATCTATTCATCTTCAATCGTGAT 58.403 34.615 0.00 0.00 36.73 3.06
4874 5109 8.730680 TCGATCTATTCATCTTCAATCGTGATA 58.269 33.333 0.00 0.00 36.73 2.15
4875 5110 9.008289 CGATCTATTCATCTTCAATCGTGATAG 57.992 37.037 0.00 0.00 32.48 2.08
4876 5111 9.853555 GATCTATTCATCTTCAATCGTGATAGT 57.146 33.333 0.00 0.00 32.48 2.12
4879 5114 9.899226 CTATTCATCTTCAATCGTGATAGTACA 57.101 33.333 0.00 0.00 32.48 2.90
4881 5116 7.987268 TCATCTTCAATCGTGATAGTACAAC 57.013 36.000 0.00 0.00 32.48 3.32
4882 5117 7.772166 TCATCTTCAATCGTGATAGTACAACT 58.228 34.615 0.00 0.00 32.48 3.16
4883 5118 8.899771 TCATCTTCAATCGTGATAGTACAACTA 58.100 33.333 0.00 0.00 34.82 2.24
4884 5119 9.516314 CATCTTCAATCGTGATAGTACAACTAA 57.484 33.333 0.00 0.00 33.89 2.24
4885 5120 8.906636 TCTTCAATCGTGATAGTACAACTAAC 57.093 34.615 0.00 0.00 33.89 2.34
4886 5121 8.517056 TCTTCAATCGTGATAGTACAACTAACA 58.483 33.333 0.00 0.00 33.89 2.41
4887 5122 8.456904 TTCAATCGTGATAGTACAACTAACAC 57.543 34.615 14.18 14.18 45.38 3.32
4888 5123 7.031372 TCAATCGTGATAGTACAACTAACACC 58.969 38.462 16.87 5.14 45.79 4.16
4889 5124 5.963176 TCGTGATAGTACAACTAACACCA 57.037 39.130 16.87 6.38 45.79 4.17
4890 5125 6.330004 TCGTGATAGTACAACTAACACCAA 57.670 37.500 16.87 7.22 45.79 3.67
4891 5126 6.747125 TCGTGATAGTACAACTAACACCAAA 58.253 36.000 16.87 5.42 45.79 3.28
4892 5127 7.208777 TCGTGATAGTACAACTAACACCAAAA 58.791 34.615 16.87 3.64 45.79 2.44
4893 5128 7.710044 TCGTGATAGTACAACTAACACCAAAAA 59.290 33.333 16.87 1.89 45.79 1.94
4894 5129 8.500773 CGTGATAGTACAACTAACACCAAAAAT 58.499 33.333 16.87 0.00 45.79 1.82
4929 5164 9.631257 TTACATCCAAATTCATAGATCACATGT 57.369 29.630 0.00 0.00 0.00 3.21
4931 5166 9.631257 ACATCCAAATTCATAGATCACATGTAA 57.369 29.630 0.00 0.00 0.00 2.41
4963 5198 9.674068 TTCATGCTTATAACAATTACAGGTACA 57.326 29.630 0.00 0.00 0.00 2.90
4964 5199 9.104965 TCATGCTTATAACAATTACAGGTACAC 57.895 33.333 0.00 0.00 0.00 2.90
4965 5200 9.109393 CATGCTTATAACAATTACAGGTACACT 57.891 33.333 0.00 0.00 0.00 3.55
4977 5212 3.659786 CAGGTACACTGGTTTGAATCGA 58.340 45.455 0.00 0.00 43.70 3.59
4978 5213 4.062293 CAGGTACACTGGTTTGAATCGAA 58.938 43.478 0.00 0.00 43.70 3.71
4979 5214 4.513692 CAGGTACACTGGTTTGAATCGAAA 59.486 41.667 0.00 0.00 43.70 3.46
4980 5215 5.008217 CAGGTACACTGGTTTGAATCGAAAA 59.992 40.000 0.00 0.00 43.70 2.29
4981 5216 5.008316 AGGTACACTGGTTTGAATCGAAAAC 59.992 40.000 3.13 3.13 36.90 2.43
4990 5225 6.895607 GTTTGAATCGAAAACCCAAGAAAA 57.104 33.333 0.00 0.00 32.49 2.29
4991 5226 7.477144 GTTTGAATCGAAAACCCAAGAAAAT 57.523 32.000 0.00 0.00 32.49 1.82
4992 5227 8.582433 GTTTGAATCGAAAACCCAAGAAAATA 57.418 30.769 0.00 0.00 32.49 1.40
4993 5228 8.484799 GTTTGAATCGAAAACCCAAGAAAATAC 58.515 33.333 0.00 0.00 32.49 1.89
4994 5229 7.278461 TGAATCGAAAACCCAAGAAAATACA 57.722 32.000 0.00 0.00 0.00 2.29
4995 5230 7.717568 TGAATCGAAAACCCAAGAAAATACAA 58.282 30.769 0.00 0.00 0.00 2.41
4996 5231 8.198109 TGAATCGAAAACCCAAGAAAATACAAA 58.802 29.630 0.00 0.00 0.00 2.83
4997 5232 8.587952 AATCGAAAACCCAAGAAAATACAAAG 57.412 30.769 0.00 0.00 0.00 2.77
4998 5233 7.102847 TCGAAAACCCAAGAAAATACAAAGT 57.897 32.000 0.00 0.00 0.00 2.66
4999 5234 8.223177 TCGAAAACCCAAGAAAATACAAAGTA 57.777 30.769 0.00 0.00 0.00 2.24
5000 5235 8.684520 TCGAAAACCCAAGAAAATACAAAGTAA 58.315 29.630 0.00 0.00 0.00 2.24
5001 5236 8.748582 CGAAAACCCAAGAAAATACAAAGTAAC 58.251 33.333 0.00 0.00 0.00 2.50
5002 5237 9.811995 GAAAACCCAAGAAAATACAAAGTAACT 57.188 29.630 0.00 0.00 0.00 2.24
5003 5238 9.811995 AAAACCCAAGAAAATACAAAGTAACTC 57.188 29.630 0.00 0.00 0.00 3.01
5004 5239 7.198306 ACCCAAGAAAATACAAAGTAACTCG 57.802 36.000 0.00 0.00 0.00 4.18
5005 5240 6.769341 ACCCAAGAAAATACAAAGTAACTCGT 59.231 34.615 0.00 0.00 0.00 4.18
5006 5241 7.933033 ACCCAAGAAAATACAAAGTAACTCGTA 59.067 33.333 0.00 0.00 0.00 3.43
5007 5242 8.943002 CCCAAGAAAATACAAAGTAACTCGTAT 58.057 33.333 0.00 0.00 0.00 3.06
5008 5243 9.755064 CCAAGAAAATACAAAGTAACTCGTATG 57.245 33.333 0.00 0.00 0.00 2.39
5011 5246 9.924650 AGAAAATACAAAGTAACTCGTATGACT 57.075 29.630 0.00 0.00 0.00 3.41
5042 5277 9.528018 TTTACAATGAAATCTCTTGAAAACACC 57.472 29.630 0.00 0.00 0.00 4.16
5043 5278 7.352079 ACAATGAAATCTCTTGAAAACACCT 57.648 32.000 0.00 0.00 0.00 4.00
5044 5279 7.785033 ACAATGAAATCTCTTGAAAACACCTT 58.215 30.769 0.00 0.00 0.00 3.50
5045 5280 7.922811 ACAATGAAATCTCTTGAAAACACCTTC 59.077 33.333 0.00 0.00 0.00 3.46
5046 5281 7.830099 ATGAAATCTCTTGAAAACACCTTCT 57.170 32.000 0.00 0.00 0.00 2.85
5047 5282 7.645058 TGAAATCTCTTGAAAACACCTTCTT 57.355 32.000 0.00 0.00 0.00 2.52
5048 5283 7.707104 TGAAATCTCTTGAAAACACCTTCTTC 58.293 34.615 0.00 0.00 0.00 2.87
5049 5284 5.931441 ATCTCTTGAAAACACCTTCTTCG 57.069 39.130 0.00 0.00 0.00 3.79
5050 5285 3.560068 TCTCTTGAAAACACCTTCTTCGC 59.440 43.478 0.00 0.00 0.00 4.70
5051 5286 2.286833 TCTTGAAAACACCTTCTTCGCG 59.713 45.455 0.00 0.00 0.00 5.87
5052 5287 0.941542 TGAAAACACCTTCTTCGCGG 59.058 50.000 6.13 0.00 0.00 6.46
5053 5288 0.942252 GAAAACACCTTCTTCGCGGT 59.058 50.000 6.13 0.00 0.00 5.68
5054 5289 2.137523 GAAAACACCTTCTTCGCGGTA 58.862 47.619 6.13 0.00 30.91 4.02
5055 5290 2.467566 AAACACCTTCTTCGCGGTAT 57.532 45.000 6.13 0.00 30.91 2.73
5056 5291 3.598019 AAACACCTTCTTCGCGGTATA 57.402 42.857 6.13 0.00 30.91 1.47
5057 5292 3.598019 AACACCTTCTTCGCGGTATAA 57.402 42.857 6.13 0.00 30.91 0.98
5058 5293 3.598019 ACACCTTCTTCGCGGTATAAA 57.402 42.857 6.13 0.00 30.91 1.40
5059 5294 4.133013 ACACCTTCTTCGCGGTATAAAT 57.867 40.909 6.13 0.00 30.91 1.40
5060 5295 4.510571 ACACCTTCTTCGCGGTATAAATT 58.489 39.130 6.13 0.00 30.91 1.82
5061 5296 4.939439 ACACCTTCTTCGCGGTATAAATTT 59.061 37.500 6.13 0.00 30.91 1.82
5062 5297 5.413523 ACACCTTCTTCGCGGTATAAATTTT 59.586 36.000 6.13 0.00 30.91 1.82
5063 5298 5.963586 CACCTTCTTCGCGGTATAAATTTTC 59.036 40.000 6.13 0.00 30.91 2.29
5064 5299 5.195379 CCTTCTTCGCGGTATAAATTTTCG 58.805 41.667 6.13 0.00 0.00 3.46
5065 5300 4.186241 TCTTCGCGGTATAAATTTTCGC 57.814 40.909 6.13 13.84 42.51 4.70
5066 5301 3.866910 TCTTCGCGGTATAAATTTTCGCT 59.133 39.130 6.13 0.00 43.57 4.93
5067 5302 5.042593 TCTTCGCGGTATAAATTTTCGCTA 58.957 37.500 6.13 10.18 43.57 4.26
5068 5303 4.697300 TCGCGGTATAAATTTTCGCTAC 57.303 40.909 6.13 8.06 43.57 3.58
5069 5304 4.111198 TCGCGGTATAAATTTTCGCTACA 58.889 39.130 6.13 6.64 43.57 2.74
5070 5305 4.565962 TCGCGGTATAAATTTTCGCTACAA 59.434 37.500 6.13 6.07 43.57 2.41
5071 5306 4.896238 CGCGGTATAAATTTTCGCTACAAG 59.104 41.667 18.35 6.13 43.57 3.16
5072 5307 5.276489 CGCGGTATAAATTTTCGCTACAAGA 60.276 40.000 18.35 0.00 43.57 3.02
5073 5308 6.480285 GCGGTATAAATTTTCGCTACAAGAA 58.520 36.000 15.50 0.00 42.62 2.52
5074 5309 6.962678 GCGGTATAAATTTTCGCTACAAGAAA 59.037 34.615 15.50 0.00 42.62 2.52
5075 5310 7.642586 GCGGTATAAATTTTCGCTACAAGAAAT 59.357 33.333 15.50 0.00 42.62 2.17
5082 5317 9.959749 AAATTTTCGCTACAAGAAATACTTCAA 57.040 25.926 0.00 0.00 37.43 2.69
5083 5318 9.959749 AATTTTCGCTACAAGAAATACTTCAAA 57.040 25.926 0.00 0.00 37.43 2.69
5084 5319 9.959749 ATTTTCGCTACAAGAAATACTTCAAAA 57.040 25.926 0.00 0.00 37.43 2.44
5085 5320 9.445786 TTTTCGCTACAAGAAATACTTCAAAAG 57.554 29.630 0.00 0.00 37.43 2.27
5086 5321 7.956420 TCGCTACAAGAAATACTTCAAAAGA 57.044 32.000 0.00 0.00 36.61 2.52
5087 5322 7.793902 TCGCTACAAGAAATACTTCAAAAGAC 58.206 34.615 0.00 0.00 36.61 3.01
5088 5323 7.656137 TCGCTACAAGAAATACTTCAAAAGACT 59.344 33.333 0.00 0.00 36.61 3.24
5089 5324 8.283291 CGCTACAAGAAATACTTCAAAAGACTT 58.717 33.333 0.00 0.00 36.61 3.01
5090 5325 9.600646 GCTACAAGAAATACTTCAAAAGACTTC 57.399 33.333 0.00 0.00 36.61 3.01
5093 5328 8.624776 ACAAGAAATACTTCAAAAGACTTCAGG 58.375 33.333 0.00 0.00 36.61 3.86
5094 5329 8.840321 CAAGAAATACTTCAAAAGACTTCAGGA 58.160 33.333 0.00 0.00 36.61 3.86
5095 5330 8.980481 AGAAATACTTCAAAAGACTTCAGGAA 57.020 30.769 0.00 0.00 33.64 3.36
5096 5331 9.408648 AGAAATACTTCAAAAGACTTCAGGAAA 57.591 29.630 0.00 0.00 33.64 3.13
5097 5332 9.670719 GAAATACTTCAAAAGACTTCAGGAAAG 57.329 33.333 0.00 0.00 41.08 2.62
5098 5333 8.980481 AATACTTCAAAAGACTTCAGGAAAGA 57.020 30.769 0.00 0.00 38.44 2.52
5099 5334 6.934048 ACTTCAAAAGACTTCAGGAAAGAG 57.066 37.500 0.00 0.00 38.44 2.85
5100 5335 5.825151 ACTTCAAAAGACTTCAGGAAAGAGG 59.175 40.000 0.00 0.00 38.44 3.69
5101 5336 4.137543 TCAAAAGACTTCAGGAAAGAGGC 58.862 43.478 0.00 0.00 38.44 4.70
5102 5337 4.140536 CAAAAGACTTCAGGAAAGAGGCT 58.859 43.478 0.00 0.00 38.44 4.58
5103 5338 3.415457 AAGACTTCAGGAAAGAGGCTG 57.585 47.619 0.00 0.00 38.44 4.85
5104 5339 1.003003 AGACTTCAGGAAAGAGGCTGC 59.997 52.381 0.00 0.00 38.44 5.25
5105 5340 0.767375 ACTTCAGGAAAGAGGCTGCA 59.233 50.000 0.50 0.00 38.44 4.41
5106 5341 1.143684 ACTTCAGGAAAGAGGCTGCAA 59.856 47.619 0.50 0.00 38.44 4.08
5107 5342 2.224967 ACTTCAGGAAAGAGGCTGCAAT 60.225 45.455 0.50 0.00 38.44 3.56
5108 5343 2.592102 TCAGGAAAGAGGCTGCAATT 57.408 45.000 0.50 0.00 0.00 2.32
5109 5344 2.165167 TCAGGAAAGAGGCTGCAATTG 58.835 47.619 0.00 0.00 0.00 2.32
5110 5345 1.203994 CAGGAAAGAGGCTGCAATTGG 59.796 52.381 7.72 0.00 0.00 3.16
5111 5346 1.076024 AGGAAAGAGGCTGCAATTGGA 59.924 47.619 7.72 2.96 0.00 3.53
5112 5347 1.203287 GGAAAGAGGCTGCAATTGGAC 59.797 52.381 7.72 0.00 0.00 4.02
5113 5348 2.165998 GAAAGAGGCTGCAATTGGACT 58.834 47.619 7.72 0.00 0.00 3.85
5114 5349 1.542492 AAGAGGCTGCAATTGGACTG 58.458 50.000 7.72 0.00 0.00 3.51
5115 5350 0.323178 AGAGGCTGCAATTGGACTGG 60.323 55.000 7.72 0.00 0.00 4.00
5116 5351 0.610232 GAGGCTGCAATTGGACTGGT 60.610 55.000 7.72 0.00 0.00 4.00
5117 5352 0.896940 AGGCTGCAATTGGACTGGTG 60.897 55.000 7.72 0.00 0.00 4.17
5118 5353 1.080298 GCTGCAATTGGACTGGTGC 60.080 57.895 7.72 0.00 37.51 5.01
5119 5354 1.808531 GCTGCAATTGGACTGGTGCA 61.809 55.000 7.72 0.00 44.36 4.57
5120 5355 0.675083 CTGCAATTGGACTGGTGCAA 59.325 50.000 7.72 9.84 45.71 4.08
5121 5356 0.388659 TGCAATTGGACTGGTGCAAC 59.611 50.000 9.64 0.00 43.48 4.17
5122 5357 0.664166 GCAATTGGACTGGTGCAACG 60.664 55.000 9.64 5.98 43.48 4.10
5123 5358 0.950836 CAATTGGACTGGTGCAACGA 59.049 50.000 9.64 0.00 43.48 3.85
5124 5359 1.541147 CAATTGGACTGGTGCAACGAT 59.459 47.619 9.64 0.00 43.48 3.73
5125 5360 1.167851 ATTGGACTGGTGCAACGATG 58.832 50.000 9.64 0.00 43.48 3.84
5126 5361 0.179032 TTGGACTGGTGCAACGATGT 60.179 50.000 0.00 0.00 35.98 3.06
5127 5362 0.602638 TGGACTGGTGCAACGATGTC 60.603 55.000 12.14 12.14 38.12 3.06
5128 5363 1.626654 GGACTGGTGCAACGATGTCG 61.627 60.000 13.56 0.11 46.33 4.35
5141 5376 1.986378 CGATGTCGTCACTCTTTCACC 59.014 52.381 0.00 0.00 34.11 4.02
5142 5377 2.338500 GATGTCGTCACTCTTTCACCC 58.662 52.381 0.00 0.00 0.00 4.61
5143 5378 0.031585 TGTCGTCACTCTTTCACCCG 59.968 55.000 0.00 0.00 0.00 5.28
5144 5379 1.006571 TCGTCACTCTTTCACCCGC 60.007 57.895 0.00 0.00 0.00 6.13
5145 5380 1.300620 CGTCACTCTTTCACCCGCA 60.301 57.895 0.00 0.00 0.00 5.69
5146 5381 0.670546 CGTCACTCTTTCACCCGCAT 60.671 55.000 0.00 0.00 0.00 4.73
5147 5382 0.798776 GTCACTCTTTCACCCGCATG 59.201 55.000 0.00 0.00 0.00 4.06
5148 5383 0.684535 TCACTCTTTCACCCGCATGA 59.315 50.000 0.00 0.00 0.00 3.07
5149 5384 1.071542 TCACTCTTTCACCCGCATGAA 59.928 47.619 0.00 0.00 36.80 2.57
5150 5385 1.197721 CACTCTTTCACCCGCATGAAC 59.802 52.381 0.00 0.00 38.31 3.18
5151 5386 1.202758 ACTCTTTCACCCGCATGAACA 60.203 47.619 0.00 0.00 38.31 3.18
5152 5387 2.086869 CTCTTTCACCCGCATGAACAT 58.913 47.619 0.00 0.00 38.31 2.71
5153 5388 2.489329 CTCTTTCACCCGCATGAACATT 59.511 45.455 0.00 0.00 38.31 2.71
5154 5389 3.680490 TCTTTCACCCGCATGAACATTA 58.320 40.909 0.00 0.00 38.31 1.90
5155 5390 3.438781 TCTTTCACCCGCATGAACATTAC 59.561 43.478 0.00 0.00 38.31 1.89
5156 5391 1.745232 TCACCCGCATGAACATTACC 58.255 50.000 0.00 0.00 0.00 2.85
5157 5392 1.003696 TCACCCGCATGAACATTACCA 59.996 47.619 0.00 0.00 0.00 3.25
5158 5393 1.815613 CACCCGCATGAACATTACCAA 59.184 47.619 0.00 0.00 0.00 3.67
5159 5394 2.426738 CACCCGCATGAACATTACCAAT 59.573 45.455 0.00 0.00 0.00 3.16
5160 5395 3.629855 CACCCGCATGAACATTACCAATA 59.370 43.478 0.00 0.00 0.00 1.90
5161 5396 4.097135 CACCCGCATGAACATTACCAATAA 59.903 41.667 0.00 0.00 0.00 1.40
5162 5397 4.892934 ACCCGCATGAACATTACCAATAAT 59.107 37.500 0.00 0.00 0.00 1.28
5180 5415 9.729281 ACCAATAATGATTTTTGAAAGCATCTT 57.271 25.926 9.46 0.82 0.00 2.40
5181 5416 9.982291 CCAATAATGATTTTTGAAAGCATCTTG 57.018 29.630 9.46 10.44 0.00 3.02
5185 5420 8.897872 AATGATTTTTGAAAGCATCTTGAGTT 57.102 26.923 4.83 0.00 0.00 3.01
5186 5421 7.703298 TGATTTTTGAAAGCATCTTGAGTTG 57.297 32.000 0.00 0.00 0.00 3.16
5187 5422 5.971895 TTTTTGAAAGCATCTTGAGTTGC 57.028 34.783 6.04 6.04 40.15 4.17
5188 5423 3.648339 TTGAAAGCATCTTGAGTTGCC 57.352 42.857 9.74 0.00 40.59 4.52
5189 5424 1.888512 TGAAAGCATCTTGAGTTGCCC 59.111 47.619 9.74 2.53 40.59 5.36
5190 5425 1.888512 GAAAGCATCTTGAGTTGCCCA 59.111 47.619 9.74 0.00 40.59 5.36
5191 5426 2.226962 AAGCATCTTGAGTTGCCCAT 57.773 45.000 9.74 0.00 40.59 4.00
5192 5427 2.226962 AGCATCTTGAGTTGCCCATT 57.773 45.000 9.74 0.00 40.59 3.16
5193 5428 2.097825 AGCATCTTGAGTTGCCCATTC 58.902 47.619 9.74 0.00 40.59 2.67
5194 5429 1.820519 GCATCTTGAGTTGCCCATTCA 59.179 47.619 3.25 0.00 35.36 2.57
5195 5430 2.231964 GCATCTTGAGTTGCCCATTCAA 59.768 45.455 3.25 0.00 35.36 2.69
5196 5431 3.306225 GCATCTTGAGTTGCCCATTCAAA 60.306 43.478 3.25 0.00 35.36 2.69
5197 5432 4.800249 GCATCTTGAGTTGCCCATTCAAAA 60.800 41.667 3.25 0.00 35.36 2.44
5198 5433 5.299148 CATCTTGAGTTGCCCATTCAAAAA 58.701 37.500 0.00 0.00 31.11 1.94
5199 5434 4.947645 TCTTGAGTTGCCCATTCAAAAAG 58.052 39.130 0.00 0.00 31.11 2.27
5200 5435 4.648762 TCTTGAGTTGCCCATTCAAAAAGA 59.351 37.500 0.00 0.00 31.11 2.52
5201 5436 5.305128 TCTTGAGTTGCCCATTCAAAAAGAT 59.695 36.000 0.00 0.00 31.11 2.40
5202 5437 4.885413 TGAGTTGCCCATTCAAAAAGATG 58.115 39.130 0.00 0.00 0.00 2.90
5203 5438 4.248058 GAGTTGCCCATTCAAAAAGATGG 58.752 43.478 0.00 0.00 0.00 3.51
5204 5439 3.903090 AGTTGCCCATTCAAAAAGATGGA 59.097 39.130 4.02 0.00 36.31 3.41
5205 5440 4.347583 AGTTGCCCATTCAAAAAGATGGAA 59.652 37.500 4.02 0.00 36.31 3.53
5206 5441 4.970860 TGCCCATTCAAAAAGATGGAAA 57.029 36.364 4.02 0.00 36.31 3.13
5207 5442 4.897140 TGCCCATTCAAAAAGATGGAAAG 58.103 39.130 4.02 0.00 36.31 2.62
5208 5443 4.347583 TGCCCATTCAAAAAGATGGAAAGT 59.652 37.500 4.02 0.00 36.31 2.66
5209 5444 4.692155 GCCCATTCAAAAAGATGGAAAGTG 59.308 41.667 4.02 0.00 36.31 3.16
5210 5445 5.742838 GCCCATTCAAAAAGATGGAAAGTGT 60.743 40.000 4.02 0.00 36.31 3.55
5211 5446 5.928264 CCCATTCAAAAAGATGGAAAGTGTC 59.072 40.000 4.02 0.00 36.31 3.67
5212 5447 5.630680 CCATTCAAAAAGATGGAAAGTGTCG 59.369 40.000 0.00 0.00 36.31 4.35
5213 5448 5.828299 TTCAAAAAGATGGAAAGTGTCGT 57.172 34.783 0.00 0.00 0.00 4.34
5214 5449 5.168526 TCAAAAAGATGGAAAGTGTCGTG 57.831 39.130 0.00 0.00 0.00 4.35
5215 5450 4.036262 TCAAAAAGATGGAAAGTGTCGTGG 59.964 41.667 0.00 0.00 0.00 4.94
5216 5451 3.485463 AAAGATGGAAAGTGTCGTGGA 57.515 42.857 0.00 0.00 0.00 4.02
5217 5452 3.485463 AAGATGGAAAGTGTCGTGGAA 57.515 42.857 0.00 0.00 0.00 3.53
5218 5453 3.485463 AGATGGAAAGTGTCGTGGAAA 57.515 42.857 0.00 0.00 0.00 3.13
5219 5454 3.403038 AGATGGAAAGTGTCGTGGAAAG 58.597 45.455 0.00 0.00 0.00 2.62
5220 5455 1.961793 TGGAAAGTGTCGTGGAAAGG 58.038 50.000 0.00 0.00 0.00 3.11
5221 5456 1.210967 TGGAAAGTGTCGTGGAAAGGT 59.789 47.619 0.00 0.00 0.00 3.50
5222 5457 1.871676 GGAAAGTGTCGTGGAAAGGTC 59.128 52.381 0.00 0.00 0.00 3.85
5223 5458 2.557317 GAAAGTGTCGTGGAAAGGTCA 58.443 47.619 0.00 0.00 0.00 4.02
5224 5459 1.949465 AAGTGTCGTGGAAAGGTCAC 58.051 50.000 0.00 0.00 0.00 3.67
5229 5464 3.655481 GTGGAAAGGTCACGGCAG 58.345 61.111 0.00 0.00 0.00 4.85
5230 5465 1.070786 GTGGAAAGGTCACGGCAGA 59.929 57.895 0.00 0.00 0.00 4.26
5231 5466 0.321653 GTGGAAAGGTCACGGCAGAT 60.322 55.000 0.00 0.00 0.00 2.90
5232 5467 0.321564 TGGAAAGGTCACGGCAGATG 60.322 55.000 0.00 0.00 0.00 2.90
5233 5468 0.321653 GGAAAGGTCACGGCAGATGT 60.322 55.000 0.00 0.00 0.00 3.06
5234 5469 1.079503 GAAAGGTCACGGCAGATGTC 58.920 55.000 0.00 0.00 0.00 3.06
5235 5470 0.321653 AAAGGTCACGGCAGATGTCC 60.322 55.000 0.00 0.00 0.00 4.02
5236 5471 1.194781 AAGGTCACGGCAGATGTCCT 61.195 55.000 0.00 0.00 37.22 3.85
5237 5472 0.324368 AGGTCACGGCAGATGTCCTA 60.324 55.000 0.00 0.00 34.37 2.94
5238 5473 0.103208 GGTCACGGCAGATGTCCTAG 59.897 60.000 0.00 0.00 0.00 3.02
5239 5474 0.528684 GTCACGGCAGATGTCCTAGC 60.529 60.000 0.00 0.00 0.00 3.42
5240 5475 0.970427 TCACGGCAGATGTCCTAGCA 60.970 55.000 0.00 0.00 0.00 3.49
5241 5476 0.108186 CACGGCAGATGTCCTAGCAA 60.108 55.000 0.00 0.00 0.00 3.91
5242 5477 0.613260 ACGGCAGATGTCCTAGCAAA 59.387 50.000 0.00 0.00 0.00 3.68
5243 5478 1.003118 ACGGCAGATGTCCTAGCAAAA 59.997 47.619 0.00 0.00 0.00 2.44
5244 5479 1.667724 CGGCAGATGTCCTAGCAAAAG 59.332 52.381 0.00 0.00 0.00 2.27
5245 5480 2.019984 GGCAGATGTCCTAGCAAAAGG 58.980 52.381 0.00 0.00 38.06 3.11
5246 5481 2.356125 GGCAGATGTCCTAGCAAAAGGA 60.356 50.000 0.00 0.00 43.58 3.36
5256 5491 5.734720 TCCTAGCAAAAGGACTTAGTCATG 58.265 41.667 14.72 8.22 40.86 3.07
5257 5492 4.878397 CCTAGCAAAAGGACTTAGTCATGG 59.122 45.833 14.72 2.35 39.15 3.66
5258 5493 4.640771 AGCAAAAGGACTTAGTCATGGA 57.359 40.909 14.72 0.00 33.68 3.41
5259 5494 4.583871 AGCAAAAGGACTTAGTCATGGAG 58.416 43.478 14.72 2.04 33.68 3.86
5260 5495 3.127721 GCAAAAGGACTTAGTCATGGAGC 59.872 47.826 14.72 8.17 33.68 4.70
5261 5496 3.636153 AAAGGACTTAGTCATGGAGCC 57.364 47.619 14.72 0.00 33.68 4.70
5262 5497 2.254152 AGGACTTAGTCATGGAGCCA 57.746 50.000 14.72 0.00 33.68 4.75
5263 5498 2.769209 AGGACTTAGTCATGGAGCCAT 58.231 47.619 14.72 0.00 37.08 4.40
5264 5499 2.703007 AGGACTTAGTCATGGAGCCATC 59.297 50.000 14.72 0.00 33.90 3.51
5265 5500 2.546795 GGACTTAGTCATGGAGCCATCG 60.547 54.545 14.72 0.00 33.90 3.84
5266 5501 1.202580 ACTTAGTCATGGAGCCATCGC 60.203 52.381 0.00 0.00 33.90 4.58
5267 5502 0.829990 TTAGTCATGGAGCCATCGCA 59.170 50.000 0.00 0.00 37.52 5.10
5268 5503 0.829990 TAGTCATGGAGCCATCGCAA 59.170 50.000 0.00 0.00 37.52 4.85
5269 5504 0.745845 AGTCATGGAGCCATCGCAAC 60.746 55.000 0.00 0.00 37.52 4.17
5270 5505 0.745845 GTCATGGAGCCATCGCAACT 60.746 55.000 0.00 0.00 37.52 3.16
5271 5506 0.829990 TCATGGAGCCATCGCAACTA 59.170 50.000 0.00 0.00 37.52 2.24
5272 5507 1.202568 TCATGGAGCCATCGCAACTAG 60.203 52.381 0.00 0.00 37.52 2.57
5273 5508 0.107456 ATGGAGCCATCGCAACTAGG 59.893 55.000 0.00 0.00 37.52 3.02
5274 5509 1.264749 TGGAGCCATCGCAACTAGGT 61.265 55.000 0.00 0.00 37.52 3.08
5275 5510 0.750850 GGAGCCATCGCAACTAGGTA 59.249 55.000 0.00 0.00 37.52 3.08
5276 5511 1.269831 GGAGCCATCGCAACTAGGTAG 60.270 57.143 0.00 0.00 37.52 3.18
5277 5512 0.105039 AGCCATCGCAACTAGGTAGC 59.895 55.000 0.00 0.00 37.52 3.58
5278 5513 0.105039 GCCATCGCAACTAGGTAGCT 59.895 55.000 0.00 0.00 34.03 3.32
5279 5514 1.473434 GCCATCGCAACTAGGTAGCTT 60.473 52.381 0.00 0.00 34.03 3.74
5280 5515 2.223971 GCCATCGCAACTAGGTAGCTTA 60.224 50.000 0.00 0.00 34.03 3.09
5281 5516 3.740141 GCCATCGCAACTAGGTAGCTTAA 60.740 47.826 0.00 0.00 34.03 1.85
5282 5517 4.439057 CCATCGCAACTAGGTAGCTTAAA 58.561 43.478 0.00 0.00 0.00 1.52
5283 5518 4.508124 CCATCGCAACTAGGTAGCTTAAAG 59.492 45.833 0.00 0.00 0.00 1.85
5284 5519 4.119442 TCGCAACTAGGTAGCTTAAAGG 57.881 45.455 0.00 0.00 0.00 3.11
5285 5520 3.118884 TCGCAACTAGGTAGCTTAAAGGG 60.119 47.826 0.00 0.00 0.00 3.95
5286 5521 3.542648 GCAACTAGGTAGCTTAAAGGGG 58.457 50.000 0.00 0.00 0.00 4.79
5287 5522 3.054582 GCAACTAGGTAGCTTAAAGGGGT 60.055 47.826 0.00 0.00 0.00 4.95
5288 5523 4.567116 GCAACTAGGTAGCTTAAAGGGGTT 60.567 45.833 0.00 0.00 0.00 4.11
5289 5524 5.338626 GCAACTAGGTAGCTTAAAGGGGTTA 60.339 44.000 0.00 0.00 0.00 2.85
5290 5525 6.714278 CAACTAGGTAGCTTAAAGGGGTTAA 58.286 40.000 0.00 0.00 0.00 2.01
5291 5526 6.957853 ACTAGGTAGCTTAAAGGGGTTAAA 57.042 37.500 0.00 0.00 31.22 1.52
5292 5527 6.715280 ACTAGGTAGCTTAAAGGGGTTAAAC 58.285 40.000 0.00 0.00 31.22 2.01
5293 5528 4.582869 AGGTAGCTTAAAGGGGTTAAACG 58.417 43.478 0.00 0.00 31.22 3.60
5294 5529 3.691118 GGTAGCTTAAAGGGGTTAAACGG 59.309 47.826 0.00 0.00 31.22 4.44
5295 5530 2.799017 AGCTTAAAGGGGTTAAACGGG 58.201 47.619 0.00 0.00 31.22 5.28
5296 5531 2.108776 AGCTTAAAGGGGTTAAACGGGT 59.891 45.455 0.00 0.00 31.22 5.28
5297 5532 2.489329 GCTTAAAGGGGTTAAACGGGTC 59.511 50.000 0.00 0.00 31.22 4.46
5298 5533 3.753815 CTTAAAGGGGTTAAACGGGTCA 58.246 45.455 0.00 0.00 31.22 4.02
5299 5534 2.752075 AAAGGGGTTAAACGGGTCAA 57.248 45.000 0.00 0.00 0.00 3.18
5300 5535 2.752075 AAGGGGTTAAACGGGTCAAA 57.248 45.000 0.00 0.00 0.00 2.69
5301 5536 2.281539 AGGGGTTAAACGGGTCAAAG 57.718 50.000 0.00 0.00 0.00 2.77
5302 5537 1.202964 AGGGGTTAAACGGGTCAAAGG 60.203 52.381 0.00 0.00 0.00 3.11
5303 5538 1.202915 GGGGTTAAACGGGTCAAAGGA 60.203 52.381 0.00 0.00 0.00 3.36
5304 5539 1.881973 GGGTTAAACGGGTCAAAGGAC 59.118 52.381 0.00 0.00 43.55 3.85
5305 5540 2.574450 GGTTAAACGGGTCAAAGGACA 58.426 47.619 0.00 0.00 46.17 4.02
5306 5541 2.291465 GGTTAAACGGGTCAAAGGACAC 59.709 50.000 0.00 0.00 46.17 3.67
5310 5545 3.153825 GGGTCAAAGGACACGGGA 58.846 61.111 0.00 0.00 46.17 5.14
5311 5546 1.003718 GGGTCAAAGGACACGGGAG 60.004 63.158 0.00 0.00 46.17 4.30
5312 5547 1.752833 GGTCAAAGGACACGGGAGT 59.247 57.895 0.00 0.00 46.17 3.85
5313 5548 0.108019 GGTCAAAGGACACGGGAGTT 59.892 55.000 0.00 0.00 46.17 3.01
5314 5549 1.476291 GGTCAAAGGACACGGGAGTTT 60.476 52.381 0.00 0.00 46.17 2.66
5315 5550 2.224354 GGTCAAAGGACACGGGAGTTTA 60.224 50.000 0.00 0.00 46.17 2.01
5316 5551 3.558533 GGTCAAAGGACACGGGAGTTTAT 60.559 47.826 0.00 0.00 46.17 1.40
5317 5552 4.322953 GGTCAAAGGACACGGGAGTTTATA 60.323 45.833 0.00 0.00 46.17 0.98
5318 5553 4.628766 GTCAAAGGACACGGGAGTTTATAC 59.371 45.833 0.00 0.00 44.67 1.47
5319 5554 4.529377 TCAAAGGACACGGGAGTTTATACT 59.471 41.667 0.00 0.00 44.67 2.12
5320 5555 4.467198 AAGGACACGGGAGTTTATACTG 57.533 45.455 0.00 0.00 44.67 2.74
5321 5556 2.764572 AGGACACGGGAGTTTATACTGG 59.235 50.000 0.00 0.00 44.67 4.00
5322 5557 2.498885 GGACACGGGAGTTTATACTGGT 59.501 50.000 0.00 0.00 44.67 4.00
5323 5558 3.055602 GGACACGGGAGTTTATACTGGTT 60.056 47.826 0.00 0.00 44.67 3.67
5324 5559 4.179298 GACACGGGAGTTTATACTGGTTC 58.821 47.826 0.00 0.00 44.67 3.62
5325 5560 3.184541 CACGGGAGTTTATACTGGTTCG 58.815 50.000 0.00 0.00 44.67 3.95
5326 5561 2.167075 ACGGGAGTTTATACTGGTTCGG 59.833 50.000 0.00 0.00 43.33 4.30
5327 5562 2.558378 GGGAGTTTATACTGGTTCGGC 58.442 52.381 0.00 0.00 33.84 5.54
5328 5563 2.558378 GGAGTTTATACTGGTTCGGCC 58.442 52.381 0.00 0.00 33.84 6.13
5329 5564 2.558378 GAGTTTATACTGGTTCGGCCC 58.442 52.381 0.00 0.00 33.84 5.80
5330 5565 1.211212 AGTTTATACTGGTTCGGCCCC 59.789 52.381 0.00 0.00 36.04 5.80
5331 5566 1.211212 GTTTATACTGGTTCGGCCCCT 59.789 52.381 0.00 0.00 36.04 4.79
5332 5567 1.587066 TTATACTGGTTCGGCCCCTT 58.413 50.000 0.00 0.00 36.04 3.95
5333 5568 0.834612 TATACTGGTTCGGCCCCTTG 59.165 55.000 0.00 0.00 36.04 3.61
5334 5569 2.552231 ATACTGGTTCGGCCCCTTGC 62.552 60.000 0.00 0.00 40.16 4.01
5344 5579 2.668632 CCCCTTGCGCTGAAGGTA 59.331 61.111 21.31 0.00 41.02 3.08
5345 5580 1.002624 CCCCTTGCGCTGAAGGTAA 60.003 57.895 21.31 0.17 41.02 2.85
5346 5581 0.608035 CCCCTTGCGCTGAAGGTAAA 60.608 55.000 21.31 0.00 41.02 2.01
5347 5582 0.804989 CCCTTGCGCTGAAGGTAAAG 59.195 55.000 21.31 8.92 41.02 1.85
5348 5583 0.804989 CCTTGCGCTGAAGGTAAAGG 59.195 55.000 16.42 10.78 38.19 3.11
5349 5584 0.169009 CTTGCGCTGAAGGTAAAGGC 59.831 55.000 9.73 0.00 0.00 4.35
5350 5585 1.241315 TTGCGCTGAAGGTAAAGGCC 61.241 55.000 9.73 0.00 0.00 5.19
5351 5586 1.377333 GCGCTGAAGGTAAAGGCCT 60.377 57.895 0.00 0.00 41.41 5.19
5352 5587 0.107848 GCGCTGAAGGTAAAGGCCTA 60.108 55.000 5.16 0.00 38.03 3.93
5353 5588 1.677820 GCGCTGAAGGTAAAGGCCTAA 60.678 52.381 5.16 0.00 38.03 2.69
5354 5589 2.919228 CGCTGAAGGTAAAGGCCTAAT 58.081 47.619 5.16 0.00 38.03 1.73
5355 5590 2.872858 CGCTGAAGGTAAAGGCCTAATC 59.127 50.000 5.16 0.00 38.03 1.75
5356 5591 3.215151 GCTGAAGGTAAAGGCCTAATCC 58.785 50.000 5.16 8.92 38.03 3.01
5357 5592 3.371595 GCTGAAGGTAAAGGCCTAATCCA 60.372 47.826 5.16 0.00 38.03 3.41
5358 5593 4.455606 CTGAAGGTAAAGGCCTAATCCAG 58.544 47.826 5.16 3.84 38.03 3.86
5359 5594 3.850173 TGAAGGTAAAGGCCTAATCCAGT 59.150 43.478 5.16 0.80 38.03 4.00
5360 5595 4.291249 TGAAGGTAAAGGCCTAATCCAGTT 59.709 41.667 5.16 0.00 38.03 3.16
5361 5596 4.236527 AGGTAAAGGCCTAATCCAGTTG 57.763 45.455 5.16 0.00 37.04 3.16
5362 5597 3.850173 AGGTAAAGGCCTAATCCAGTTGA 59.150 43.478 5.16 0.00 37.04 3.18
5363 5598 4.080299 AGGTAAAGGCCTAATCCAGTTGAG 60.080 45.833 5.16 0.00 37.04 3.02
5364 5599 3.372440 AAAGGCCTAATCCAGTTGAGG 57.628 47.619 5.16 0.00 0.00 3.86
5365 5600 1.972588 AGGCCTAATCCAGTTGAGGT 58.027 50.000 1.29 0.00 0.00 3.85
5366 5601 1.561542 AGGCCTAATCCAGTTGAGGTG 59.438 52.381 1.29 0.00 0.00 4.00
5367 5602 1.408822 GGCCTAATCCAGTTGAGGTGG 60.409 57.143 0.00 0.00 36.28 4.61
5368 5603 1.282157 GCCTAATCCAGTTGAGGTGGT 59.718 52.381 0.00 0.00 36.37 4.16
5369 5604 2.504175 GCCTAATCCAGTTGAGGTGGTA 59.496 50.000 0.00 0.00 36.37 3.25
5370 5605 3.136626 GCCTAATCCAGTTGAGGTGGTAT 59.863 47.826 0.00 0.00 36.37 2.73
5371 5606 4.385310 GCCTAATCCAGTTGAGGTGGTATT 60.385 45.833 0.00 0.00 36.37 1.89
5372 5607 5.126067 CCTAATCCAGTTGAGGTGGTATTG 58.874 45.833 0.00 0.00 36.37 1.90
5373 5608 2.489938 TCCAGTTGAGGTGGTATTGC 57.510 50.000 0.00 0.00 36.37 3.56
5374 5609 1.985159 TCCAGTTGAGGTGGTATTGCT 59.015 47.619 0.00 0.00 36.37 3.91
5375 5610 2.375174 TCCAGTTGAGGTGGTATTGCTT 59.625 45.455 0.00 0.00 36.37 3.91
5376 5611 3.585289 TCCAGTTGAGGTGGTATTGCTTA 59.415 43.478 0.00 0.00 36.37 3.09
5377 5612 4.227300 TCCAGTTGAGGTGGTATTGCTTAT 59.773 41.667 0.00 0.00 36.37 1.73
5378 5613 4.336433 CCAGTTGAGGTGGTATTGCTTATG 59.664 45.833 0.00 0.00 0.00 1.90
5379 5614 4.943705 CAGTTGAGGTGGTATTGCTTATGT 59.056 41.667 0.00 0.00 0.00 2.29
5380 5615 5.065218 CAGTTGAGGTGGTATTGCTTATGTC 59.935 44.000 0.00 0.00 0.00 3.06
5381 5616 5.045578 AGTTGAGGTGGTATTGCTTATGTCT 60.046 40.000 0.00 0.00 0.00 3.41
5382 5617 5.023533 TGAGGTGGTATTGCTTATGTCTC 57.976 43.478 0.00 0.00 0.00 3.36
5383 5618 4.051922 GAGGTGGTATTGCTTATGTCTCG 58.948 47.826 0.00 0.00 0.00 4.04
5384 5619 3.704566 AGGTGGTATTGCTTATGTCTCGA 59.295 43.478 0.00 0.00 0.00 4.04
5385 5620 4.345257 AGGTGGTATTGCTTATGTCTCGAT 59.655 41.667 0.00 0.00 0.00 3.59
5386 5621 5.057149 GGTGGTATTGCTTATGTCTCGATT 58.943 41.667 0.00 0.00 0.00 3.34
5387 5622 6.041637 AGGTGGTATTGCTTATGTCTCGATTA 59.958 38.462 0.00 0.00 0.00 1.75
5388 5623 6.145696 GGTGGTATTGCTTATGTCTCGATTAC 59.854 42.308 0.00 0.00 0.00 1.89
5389 5624 6.145696 GTGGTATTGCTTATGTCTCGATTACC 59.854 42.308 0.00 0.00 0.00 2.85
5390 5625 6.183360 TGGTATTGCTTATGTCTCGATTACCA 60.183 38.462 0.00 0.00 0.00 3.25
5391 5626 6.366332 GGTATTGCTTATGTCTCGATTACCAG 59.634 42.308 0.00 0.00 0.00 4.00
5392 5627 4.322080 TGCTTATGTCTCGATTACCAGG 57.678 45.455 0.00 0.00 0.00 4.45
5393 5628 3.069586 TGCTTATGTCTCGATTACCAGGG 59.930 47.826 0.00 0.00 0.00 4.45
5394 5629 3.321111 GCTTATGTCTCGATTACCAGGGA 59.679 47.826 0.00 0.00 0.00 4.20
5395 5630 4.559704 GCTTATGTCTCGATTACCAGGGAG 60.560 50.000 0.00 0.00 0.00 4.30
5396 5631 1.112113 TGTCTCGATTACCAGGGAGC 58.888 55.000 0.00 0.00 0.00 4.70
5397 5632 0.030908 GTCTCGATTACCAGGGAGCG 59.969 60.000 0.00 0.00 0.00 5.03
5398 5633 0.106868 TCTCGATTACCAGGGAGCGA 60.107 55.000 5.48 5.48 0.00 4.93
5399 5634 0.744874 CTCGATTACCAGGGAGCGAA 59.255 55.000 6.85 0.00 0.00 4.70
5400 5635 1.341531 CTCGATTACCAGGGAGCGAAT 59.658 52.381 6.85 0.00 0.00 3.34
5401 5636 1.340248 TCGATTACCAGGGAGCGAATC 59.660 52.381 3.26 0.00 0.00 2.52
5414 5649 2.594541 CGAATCCGCTTGACCTAGC 58.405 57.895 0.00 0.00 37.80 3.42
5415 5650 0.103208 CGAATCCGCTTGACCTAGCT 59.897 55.000 0.00 0.00 39.03 3.32
5416 5651 1.471676 CGAATCCGCTTGACCTAGCTT 60.472 52.381 0.00 0.00 39.03 3.74
5417 5652 2.633488 GAATCCGCTTGACCTAGCTTT 58.367 47.619 0.00 0.00 39.03 3.51
5418 5653 2.317530 ATCCGCTTGACCTAGCTTTC 57.682 50.000 0.00 0.00 39.03 2.62
5419 5654 0.108804 TCCGCTTGACCTAGCTTTCG 60.109 55.000 0.00 0.00 39.03 3.46
5420 5655 0.108804 CCGCTTGACCTAGCTTTCGA 60.109 55.000 0.00 0.00 39.03 3.71
5421 5656 1.471676 CCGCTTGACCTAGCTTTCGAT 60.472 52.381 0.00 0.00 39.03 3.59
5422 5657 1.855360 CGCTTGACCTAGCTTTCGATC 59.145 52.381 0.00 0.00 39.03 3.69
5423 5658 2.480416 CGCTTGACCTAGCTTTCGATCT 60.480 50.000 0.00 0.00 39.03 2.75
5424 5659 3.526534 GCTTGACCTAGCTTTCGATCTT 58.473 45.455 0.00 0.00 38.15 2.40
5425 5660 3.935828 GCTTGACCTAGCTTTCGATCTTT 59.064 43.478 0.00 0.00 38.15 2.52
5426 5661 4.393371 GCTTGACCTAGCTTTCGATCTTTT 59.607 41.667 0.00 0.00 38.15 2.27
5427 5662 5.581085 GCTTGACCTAGCTTTCGATCTTTTA 59.419 40.000 0.00 0.00 38.15 1.52
5428 5663 6.258947 GCTTGACCTAGCTTTCGATCTTTTAT 59.741 38.462 0.00 0.00 38.15 1.40
5429 5664 7.517575 GCTTGACCTAGCTTTCGATCTTTTATC 60.518 40.741 0.00 0.00 38.15 1.75
5430 5665 7.113658 TGACCTAGCTTTCGATCTTTTATCT 57.886 36.000 0.00 0.00 0.00 1.98
5431 5666 7.203910 TGACCTAGCTTTCGATCTTTTATCTC 58.796 38.462 0.00 0.00 0.00 2.75
5432 5667 7.068839 TGACCTAGCTTTCGATCTTTTATCTCT 59.931 37.037 0.00 0.00 0.00 3.10
5433 5668 7.787028 ACCTAGCTTTCGATCTTTTATCTCTT 58.213 34.615 0.00 0.00 0.00 2.85
5434 5669 7.708752 ACCTAGCTTTCGATCTTTTATCTCTTG 59.291 37.037 0.00 0.00 0.00 3.02
5435 5670 7.708752 CCTAGCTTTCGATCTTTTATCTCTTGT 59.291 37.037 0.00 0.00 0.00 3.16
5436 5671 7.532682 AGCTTTCGATCTTTTATCTCTTGTC 57.467 36.000 0.00 0.00 0.00 3.18
5437 5672 6.536941 AGCTTTCGATCTTTTATCTCTTGTCC 59.463 38.462 0.00 0.00 0.00 4.02
5438 5673 6.536941 GCTTTCGATCTTTTATCTCTTGTCCT 59.463 38.462 0.00 0.00 0.00 3.85
5439 5674 7.065204 GCTTTCGATCTTTTATCTCTTGTCCTT 59.935 37.037 0.00 0.00 0.00 3.36
5440 5675 7.834068 TTCGATCTTTTATCTCTTGTCCTTG 57.166 36.000 0.00 0.00 0.00 3.61
5441 5676 7.170393 TCGATCTTTTATCTCTTGTCCTTGA 57.830 36.000 0.00 0.00 0.00 3.02
5442 5677 7.611770 TCGATCTTTTATCTCTTGTCCTTGAA 58.388 34.615 0.00 0.00 0.00 2.69
5443 5678 7.545965 TCGATCTTTTATCTCTTGTCCTTGAAC 59.454 37.037 0.00 0.00 0.00 3.18
5444 5679 7.201565 CGATCTTTTATCTCTTGTCCTTGAACC 60.202 40.741 0.00 0.00 0.00 3.62
5445 5680 5.932303 TCTTTTATCTCTTGTCCTTGAACCG 59.068 40.000 0.00 0.00 0.00 4.44
5446 5681 2.100605 ATCTCTTGTCCTTGAACCGC 57.899 50.000 0.00 0.00 0.00 5.68
5447 5682 0.034896 TCTCTTGTCCTTGAACCGCC 59.965 55.000 0.00 0.00 0.00 6.13
5448 5683 0.250295 CTCTTGTCCTTGAACCGCCA 60.250 55.000 0.00 0.00 0.00 5.69
5449 5684 0.534203 TCTTGTCCTTGAACCGCCAC 60.534 55.000 0.00 0.00 0.00 5.01
5450 5685 1.515521 CTTGTCCTTGAACCGCCACC 61.516 60.000 0.00 0.00 0.00 4.61
5451 5686 3.047877 GTCCTTGAACCGCCACCG 61.048 66.667 0.00 0.00 0.00 4.94
5461 5696 4.675029 CGCCACCGGGTCGTTTCT 62.675 66.667 6.32 0.00 36.17 2.52
5462 5697 2.281276 GCCACCGGGTCGTTTCTT 60.281 61.111 6.32 0.00 36.17 2.52
5463 5698 1.895231 GCCACCGGGTCGTTTCTTT 60.895 57.895 6.32 0.00 36.17 2.52
5464 5699 0.603439 GCCACCGGGTCGTTTCTTTA 60.603 55.000 6.32 0.00 36.17 1.85
5465 5700 1.947212 GCCACCGGGTCGTTTCTTTAT 60.947 52.381 6.32 0.00 36.17 1.40
5466 5701 2.677613 GCCACCGGGTCGTTTCTTTATA 60.678 50.000 6.32 0.00 36.17 0.98
5467 5702 3.800531 CCACCGGGTCGTTTCTTTATAT 58.199 45.455 6.32 0.00 0.00 0.86
5468 5703 4.740334 GCCACCGGGTCGTTTCTTTATATA 60.740 45.833 6.32 0.00 36.17 0.86
5469 5704 4.746611 CCACCGGGTCGTTTCTTTATATAC 59.253 45.833 6.32 0.00 0.00 1.47
5470 5705 5.350633 CACCGGGTCGTTTCTTTATATACA 58.649 41.667 6.32 0.00 0.00 2.29
5471 5706 5.232838 CACCGGGTCGTTTCTTTATATACAC 59.767 44.000 6.32 0.00 0.00 2.90
5472 5707 5.105392 ACCGGGTCGTTTCTTTATATACACA 60.105 40.000 6.32 0.00 0.00 3.72
5473 5708 5.461078 CCGGGTCGTTTCTTTATATACACAG 59.539 44.000 0.00 0.00 0.00 3.66
5474 5709 5.461078 CGGGTCGTTTCTTTATATACACAGG 59.539 44.000 0.00 0.00 0.00 4.00
5475 5710 6.343703 GGGTCGTTTCTTTATATACACAGGT 58.656 40.000 0.00 0.00 0.00 4.00
5476 5711 6.820152 GGGTCGTTTCTTTATATACACAGGTT 59.180 38.462 0.00 0.00 0.00 3.50
5477 5712 7.201582 GGGTCGTTTCTTTATATACACAGGTTG 60.202 40.741 0.00 0.00 0.00 3.77
5478 5713 7.546667 GGTCGTTTCTTTATATACACAGGTTGA 59.453 37.037 0.00 0.00 0.00 3.18
5479 5714 8.378421 GTCGTTTCTTTATATACACAGGTTGAC 58.622 37.037 0.00 0.00 0.00 3.18
5480 5715 7.274033 TCGTTTCTTTATATACACAGGTTGACG 59.726 37.037 0.00 0.00 0.00 4.35
5481 5716 6.897259 TTCTTTATATACACAGGTTGACGC 57.103 37.500 0.00 0.00 0.00 5.19
5482 5717 5.353938 TCTTTATATACACAGGTTGACGCC 58.646 41.667 0.00 0.00 0.00 5.68
5483 5718 2.614829 ATATACACAGGTTGACGCCC 57.385 50.000 0.00 0.00 0.00 6.13
5484 5719 1.268066 TATACACAGGTTGACGCCCA 58.732 50.000 0.00 0.00 0.00 5.36
5485 5720 0.036388 ATACACAGGTTGACGCCCAG 60.036 55.000 0.00 0.00 0.00 4.45
5486 5721 1.404479 TACACAGGTTGACGCCCAGT 61.404 55.000 0.00 0.00 0.00 4.00
5487 5722 2.111043 ACAGGTTGACGCCCAGTG 59.889 61.111 0.00 0.00 0.00 3.66
5488 5723 2.669569 CAGGTTGACGCCCAGTGG 60.670 66.667 0.63 0.63 0.00 4.00
5498 5733 3.488423 CCCAGTGGCTCTTGGAGT 58.512 61.111 2.61 0.00 31.33 3.85
5499 5734 1.298014 CCCAGTGGCTCTTGGAGTC 59.702 63.158 2.61 0.00 34.49 3.36
5500 5735 1.298014 CCAGTGGCTCTTGGAGTCC 59.702 63.158 0.73 0.73 32.68 3.85
5501 5736 1.298014 CAGTGGCTCTTGGAGTCCC 59.702 63.158 6.74 0.00 32.68 4.46
5502 5737 2.266055 GTGGCTCTTGGAGTCCCG 59.734 66.667 6.74