Multiple sequence alignment - TraesCS5B01G567400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G567400 chr5B 100.000 5412 0 0 3116 8527 711242821 711237410 0.000000e+00 9995.0
1 TraesCS5B01G567400 chr5B 100.000 2896 0 0 1 2896 711245936 711243041 0.000000e+00 5349.0
2 TraesCS5B01G567400 chr5B 93.517 2576 163 4 4851 7424 711134085 711131512 0.000000e+00 3829.0
3 TraesCS5B01G567400 chr5B 89.172 2355 249 6 5077 7427 711183829 711181477 0.000000e+00 2931.0
4 TraesCS5B01G567400 chr5B 86.920 2500 304 20 4913 7406 695482525 695485007 0.000000e+00 2784.0
5 TraesCS5B01G567400 chr5B 86.595 2514 318 16 4913 7422 695787308 695789806 0.000000e+00 2758.0
6 TraesCS5B01G567400 chr5B 93.016 1260 78 6 1521 2770 711136874 711135615 0.000000e+00 1831.0
7 TraesCS5B01G567400 chr5B 91.021 1214 89 5 1524 2718 711187243 711186031 0.000000e+00 1620.0
8 TraesCS5B01G567400 chr5B 88.172 1209 127 10 1521 2718 711941302 711942505 0.000000e+00 1426.0
9 TraesCS5B01G567400 chr5B 87.030 1249 144 11 1521 2760 711915194 711913955 0.000000e+00 1393.0
10 TraesCS5B01G567400 chr5B 93.388 726 39 2 645 1361 711138115 711137390 0.000000e+00 1066.0
11 TraesCS5B01G567400 chr5B 90.110 273 16 5 2 270 711138704 711138439 2.280000e-90 344.0
12 TraesCS5B01G567400 chr5B 82.109 313 46 3 993 1304 710965365 710965062 8.490000e-65 259.0
13 TraesCS5B01G567400 chr5B 89.320 206 20 2 7314 7518 711181448 711181244 3.050000e-64 257.0
14 TraesCS5B01G567400 chr5B 91.011 178 4 2 418 594 711138390 711138224 6.660000e-56 230.0
15 TraesCS5B01G567400 chr5B 90.000 150 7 2 3116 3257 711134827 711134678 4.060000e-43 187.0
16 TraesCS5B01G567400 chr5B 91.667 132 10 1 2766 2896 711135568 711135437 1.890000e-41 182.0
17 TraesCS5B01G567400 chr5B 94.231 104 6 0 7962 8065 22532636 22532739 8.860000e-35 159.0
18 TraesCS5B01G567400 chr5B 90.000 120 8 4 7951 8069 677876083 677875967 1.480000e-32 152.0
19 TraesCS5B01G567400 chr5B 91.176 68 5 1 1457 1523 711137038 711136971 3.280000e-14 91.6
20 TraesCS5B01G567400 chr5D 89.458 2343 241 6 5077 7416 560500713 560503052 0.000000e+00 2953.0
21 TraesCS5B01G567400 chr5D 86.311 2491 313 22 4921 7406 560534877 560532410 0.000000e+00 2686.0
22 TraesCS5B01G567400 chr5D 91.208 1217 90 5 1518 2718 560496899 560498114 0.000000e+00 1639.0
23 TraesCS5B01G567400 chr5D 88.982 1189 114 9 1522 2697 551831536 551832720 0.000000e+00 1454.0
24 TraesCS5B01G567400 chr5D 87.741 1191 131 9 1521 2701 561950576 561951761 0.000000e+00 1376.0
25 TraesCS5B01G567400 chr5D 88.995 209 21 2 7311 7518 560503091 560503298 3.050000e-64 257.0
26 TraesCS5B01G567400 chr4A 89.155 2342 250 4 5077 7416 603679277 603681616 0.000000e+00 2915.0
27 TraesCS5B01G567400 chr4A 91.763 1214 86 4 1518 2718 603675483 603676695 0.000000e+00 1676.0
28 TraesCS5B01G567400 chr4A 89.474 209 20 2 7311 7518 603681655 603681862 6.560000e-66 263.0
29 TraesCS5B01G567400 chr4A 83.858 254 35 5 1094 1343 603674615 603674866 3.980000e-58 237.0
30 TraesCS5B01G567400 chr4A 94.175 103 6 0 7953 8055 743141106 743141208 3.190000e-34 158.0
31 TraesCS5B01G567400 chr4A 82.895 152 23 2 422 571 603674264 603674414 5.370000e-27 134.0
32 TraesCS5B01G567400 chr7A 86.478 2544 312 13 4867 7406 688997644 688995129 0.000000e+00 2763.0
33 TraesCS5B01G567400 chr7A 87.946 1261 131 17 1518 2762 689000044 688998789 0.000000e+00 1467.0
34 TraesCS5B01G567400 chr7B 86.424 2416 310 16 4998 7406 1322929 1325333 0.000000e+00 2628.0
35 TraesCS5B01G567400 chr7B 89.905 1258 106 12 1522 2762 1313733 1314986 0.000000e+00 1600.0
36 TraesCS5B01G567400 chr7B 83.578 341 47 7 990 1324 1313197 1313534 2.310000e-80 311.0
37 TraesCS5B01G567400 chr7B 88.034 234 28 0 7311 7544 1325382 1325615 2.340000e-70 278.0
38 TraesCS5B01G567400 chr7B 95.098 102 3 2 7957 8056 460585053 460584952 8.860000e-35 159.0
39 TraesCS5B01G567400 chr7B 95.604 91 3 1 268 358 428966928 428966839 2.480000e-30 145.0
40 TraesCS5B01G567400 chr7B 93.750 96 6 0 265 360 747110253 747110348 2.480000e-30 145.0
41 TraesCS5B01G567400 chr7B 95.062 81 2 2 4736 4814 729533031 729533111 8.990000e-25 126.0
42 TraesCS5B01G567400 chrUn 90.741 432 32 4 4401 4825 135057279 135056849 3.450000e-158 569.0
43 TraesCS5B01G567400 chrUn 90.741 432 32 4 4401 4825 204417414 204417844 3.450000e-158 569.0
44 TraesCS5B01G567400 chrUn 90.741 432 32 4 4401 4825 397420346 397419916 3.450000e-158 569.0
45 TraesCS5B01G567400 chr3B 91.477 352 24 4 4481 4827 700341704 700341354 5.990000e-131 479.0
46 TraesCS5B01G567400 chr3B 87.742 155 11 5 4697 4850 700341420 700341273 3.160000e-39 174.0
47 TraesCS5B01G567400 chr2A 86.545 275 30 4 4053 4322 103507201 103507473 6.470000e-76 296.0
48 TraesCS5B01G567400 chr2A 79.325 237 29 9 4447 4681 766042298 766042516 1.920000e-31 148.0
49 TraesCS5B01G567400 chr2A 93.684 95 4 2 268 362 572054214 572054306 3.210000e-29 141.0
50 TraesCS5B01G567400 chr4D 84.387 269 38 4 4057 4322 318293283 318293016 2.360000e-65 261.0
51 TraesCS5B01G567400 chr4D 83.636 275 38 7 4053 4322 260624488 260624216 1.420000e-62 252.0
52 TraesCS5B01G567400 chr4D 83.521 267 39 5 4053 4317 420147441 420147178 2.380000e-60 244.0
53 TraesCS5B01G567400 chr4D 100.000 89 0 0 7970 8058 449455701 449455613 1.900000e-36 165.0
54 TraesCS5B01G567400 chr4D 93.396 106 5 2 7960 8063 485409447 485409342 1.150000e-33 156.0
55 TraesCS5B01G567400 chr1D 85.000 260 35 4 4057 4314 390753160 390753417 2.360000e-65 261.0
56 TraesCS5B01G567400 chr1A 84.015 269 39 4 4062 4328 386372798 386372532 1.100000e-63 255.0
57 TraesCS5B01G567400 chr1A 74.208 221 47 8 1075 1290 557915508 557915293 5.490000e-12 84.2
58 TraesCS5B01G567400 chr6A 84.074 270 35 8 4053 4317 269698823 269698557 3.950000e-63 254.0
59 TraesCS5B01G567400 chr6A 90.476 105 7 3 250 353 499008418 499008520 1.490000e-27 135.0
60 TraesCS5B01G567400 chr5A 83.453 278 36 8 4053 4323 193013134 193013408 5.110000e-62 250.0
61 TraesCS5B01G567400 chr3D 83.764 271 37 6 4057 4322 534665957 534666225 5.110000e-62 250.0
62 TraesCS5B01G567400 chr3D 92.857 98 6 1 269 365 497961385 497961482 3.210000e-29 141.0
63 TraesCS5B01G567400 chr6B 96.000 100 4 0 7956 8055 607208117 607208216 6.850000e-36 163.0
64 TraesCS5B01G567400 chr6B 97.849 93 2 0 7971 8063 526478249 526478341 2.460000e-35 161.0
65 TraesCS5B01G567400 chr3A 92.727 110 4 4 7971 8077 747595952 747596060 1.150000e-33 156.0
66 TraesCS5B01G567400 chr3A 91.176 102 7 1 262 361 431818443 431818544 4.150000e-28 137.0
67 TraesCS5B01G567400 chr2B 98.837 86 1 0 268 353 486584408 486584493 4.120000e-33 154.0
68 TraesCS5B01G567400 chr2B 95.745 94 3 1 264 356 683590543 683590450 5.330000e-32 150.0
69 TraesCS5B01G567400 chr1B 92.381 105 8 0 252 356 593927060 593927164 5.330000e-32 150.0
70 TraesCS5B01G567400 chr1B 73.756 221 48 8 1075 1290 642173822 642173607 2.550000e-10 78.7
71 TraesCS5B01G567400 chr1B 73.756 221 48 8 1075 1290 642201582 642201367 2.550000e-10 78.7
72 TraesCS5B01G567400 chr1B 75.949 158 32 5 1136 1290 642176621 642176467 9.180000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G567400 chr5B 711237410 711245936 8526 True 7672.000000 9995 100.000000 1 8527 2 chr5B.!!$R6 8526
1 TraesCS5B01G567400 chr5B 695482525 695485007 2482 False 2784.000000 2784 86.920000 4913 7406 1 chr5B.!!$F2 2493
2 TraesCS5B01G567400 chr5B 695787308 695789806 2498 False 2758.000000 2758 86.595000 4913 7422 1 chr5B.!!$F3 2509
3 TraesCS5B01G567400 chr5B 711181244 711187243 5999 True 1602.666667 2931 89.837667 1524 7518 3 chr5B.!!$R5 5994
4 TraesCS5B01G567400 chr5B 711941302 711942505 1203 False 1426.000000 1426 88.172000 1521 2718 1 chr5B.!!$F4 1197
5 TraesCS5B01G567400 chr5B 711913955 711915194 1239 True 1393.000000 1393 87.030000 1521 2760 1 chr5B.!!$R3 1239
6 TraesCS5B01G567400 chr5B 711131512 711138704 7192 True 970.075000 3829 91.735625 2 7424 8 chr5B.!!$R4 7422
7 TraesCS5B01G567400 chr5D 560532410 560534877 2467 True 2686.000000 2686 86.311000 4921 7406 1 chr5D.!!$R1 2485
8 TraesCS5B01G567400 chr5D 560496899 560503298 6399 False 1616.333333 2953 89.887000 1518 7518 3 chr5D.!!$F3 6000
9 TraesCS5B01G567400 chr5D 551831536 551832720 1184 False 1454.000000 1454 88.982000 1522 2697 1 chr5D.!!$F1 1175
10 TraesCS5B01G567400 chr5D 561950576 561951761 1185 False 1376.000000 1376 87.741000 1521 2701 1 chr5D.!!$F2 1180
11 TraesCS5B01G567400 chr4A 603674264 603681862 7598 False 1045.000000 2915 87.429000 422 7518 5 chr4A.!!$F2 7096
12 TraesCS5B01G567400 chr7A 688995129 689000044 4915 True 2115.000000 2763 87.212000 1518 7406 2 chr7A.!!$R1 5888
13 TraesCS5B01G567400 chr7B 1322929 1325615 2686 False 1453.000000 2628 87.229000 4998 7544 2 chr7B.!!$F4 2546
14 TraesCS5B01G567400 chr7B 1313197 1314986 1789 False 955.500000 1600 86.741500 990 2762 2 chr7B.!!$F3 1772


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
406 410 0.108472 CCAGCGAGTGCAGATCTGAA 60.108 55.0 27.04 14.12 46.23 3.02 F
1362 1473 0.103937 CATCTCCTCTCAGCCGGTTC 59.896 60.0 1.90 0.00 0.00 3.62 F
2232 3079 0.104120 CCCAGCGTCCGACATAATCA 59.896 55.0 0.00 0.00 0.00 2.57 F
3837 6695 0.034896 GGATGTAGCCCCACGGTATG 59.965 60.0 0.00 0.00 0.00 2.39 F
3872 6730 0.031721 GGTCGGGTTATCTAGTGGCG 59.968 60.0 0.00 0.00 0.00 5.69 F
3873 6731 0.031721 GTCGGGTTATCTAGTGGCGG 59.968 60.0 0.00 0.00 0.00 6.13 F
3933 6791 0.034670 AGCTCAAGGACAAGATGGGC 60.035 55.0 0.00 0.00 40.90 5.36 F
3937 6795 0.036010 CAAGGACAAGATGGGCGACT 60.036 55.0 0.00 0.00 0.00 4.18 F
4483 7342 0.106149 CGCGCCCTCTAATTTACCCT 59.894 55.0 0.00 0.00 0.00 4.34 F
4493 7352 0.116143 AATTTACCCTGGCAGGCCAA 59.884 50.0 28.51 19.52 46.63 4.52 F
5470 8370 0.175760 TCCGCTCCAAGTAGCATGAC 59.824 55.0 0.00 0.00 42.91 3.06 F
6671 9571 0.675837 TCGTACCTCCACGGACTCTG 60.676 60.0 0.00 0.00 42.19 3.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2213 3060 0.104120 TGATTATGTCGGACGCTGGG 59.896 55.000 3.34 0.00 0.00 4.45 R
2328 3175 0.109272 CACTTGGCTGCAATCTGCTG 60.109 55.000 0.50 0.69 45.31 4.41 R
3853 6711 0.031721 CGCCACTAGATAACCCGACC 59.968 60.000 0.00 0.00 0.00 4.79 R
4697 7556 0.179015 TGTTACCATGCCACGGTTGT 60.179 50.000 0.00 0.00 37.99 3.32 R
4765 7624 0.398696 TCTTGTTACCATGCCACCGT 59.601 50.000 0.00 0.00 0.00 4.83 R
5123 8023 1.136329 ATGGACTTGGACTGGCCTGT 61.136 55.000 16.10 16.10 37.63 4.00 R
5439 8339 1.378514 GAGCGGATTGGCCTTTGGA 60.379 57.895 3.32 0.00 0.00 3.53 R
5453 8353 1.756375 GCGTCATGCTACTTGGAGCG 61.756 60.000 0.00 0.00 45.99 5.03 R
5470 8370 2.938451 TGATTTACAGAAGATGGCAGCG 59.062 45.455 0.00 0.00 0.00 5.18 R
6415 9315 3.687698 GCCCACAAGATTTAGACGCTTTA 59.312 43.478 0.00 0.00 0.00 1.85 R
6875 9775 0.326238 AAGGTCCGCCCTCTCCATAA 60.326 55.000 0.00 0.00 45.47 1.90 R
7575 10620 0.032615 CCTCTCCTACACCCAGCTCT 60.033 60.000 0.00 0.00 0.00 4.09 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 6.265577 GCAGTTTGATTACACACAAGACTTT 58.734 36.000 0.00 0.00 0.00 2.66
63 64 8.876275 TTTTCAGTTTCATTTCAGGATTTCAG 57.124 30.769 0.00 0.00 0.00 3.02
64 65 6.017400 TCAGTTTCATTTCAGGATTTCAGC 57.983 37.500 0.00 0.00 0.00 4.26
65 66 5.771666 TCAGTTTCATTTCAGGATTTCAGCT 59.228 36.000 0.00 0.00 0.00 4.24
66 67 6.072286 TCAGTTTCATTTCAGGATTTCAGCTC 60.072 38.462 0.00 0.00 0.00 4.09
79 80 1.270907 TCAGCTCAGGAGGGAAGAAC 58.729 55.000 0.00 0.00 0.00 3.01
94 95 5.932883 AGGGAAGAACTCAAACTATTTCGTC 59.067 40.000 0.00 0.00 0.00 4.20
95 96 5.932883 GGGAAGAACTCAAACTATTTCGTCT 59.067 40.000 0.00 0.00 30.20 4.18
124 125 4.839121 TCCCGCTGTTATATTTTGTCAGT 58.161 39.130 0.00 0.00 0.00 3.41
125 126 5.250200 TCCCGCTGTTATATTTTGTCAGTT 58.750 37.500 0.00 0.00 0.00 3.16
126 127 5.708230 TCCCGCTGTTATATTTTGTCAGTTT 59.292 36.000 0.00 0.00 0.00 2.66
127 128 5.799936 CCCGCTGTTATATTTTGTCAGTTTG 59.200 40.000 0.00 0.00 0.00 2.93
128 129 6.378582 CCGCTGTTATATTTTGTCAGTTTGT 58.621 36.000 0.00 0.00 0.00 2.83
129 130 6.861055 CCGCTGTTATATTTTGTCAGTTTGTT 59.139 34.615 0.00 0.00 0.00 2.83
171 175 7.882791 TCTCTAATATTCCAACAAACTGCTTCA 59.117 33.333 0.00 0.00 0.00 3.02
186 190 2.160219 TGCTTCATGTCTGCGTCATTTC 59.840 45.455 0.00 0.00 0.00 2.17
189 193 2.682836 TCATGTCTGCGTCATTTCGAA 58.317 42.857 0.00 0.00 0.00 3.71
218 222 1.188863 AGCATGATTGTGAAAGGGGC 58.811 50.000 0.00 0.00 0.00 5.80
271 275 3.574952 TGGCAAGTGGCAGGTACT 58.425 55.556 3.02 0.00 46.12 2.73
272 276 1.374947 TGGCAAGTGGCAGGTACTC 59.625 57.895 3.02 0.00 46.12 2.59
273 277 2.124507 TGGCAAGTGGCAGGTACTCC 62.125 60.000 3.02 0.00 46.12 3.85
274 278 1.377333 GCAAGTGGCAGGTACTCCC 60.377 63.158 0.00 0.00 43.97 4.30
276 280 0.250513 CAAGTGGCAGGTACTCCCTC 59.749 60.000 0.00 0.00 43.86 4.30
277 281 0.910088 AAGTGGCAGGTACTCCCTCC 60.910 60.000 0.00 0.00 43.86 4.30
278 282 2.363795 TGGCAGGTACTCCCTCCG 60.364 66.667 0.00 0.00 43.86 4.63
279 283 2.363925 GGCAGGTACTCCCTCCGT 60.364 66.667 0.00 0.00 43.86 4.69
280 284 1.076485 GGCAGGTACTCCCTCCGTA 60.076 63.158 0.00 0.00 43.86 4.02
281 285 0.685458 GGCAGGTACTCCCTCCGTAA 60.685 60.000 0.00 0.00 43.86 3.18
282 286 1.188863 GCAGGTACTCCCTCCGTAAA 58.811 55.000 0.00 0.00 43.86 2.01
283 287 1.136500 GCAGGTACTCCCTCCGTAAAG 59.864 57.143 0.00 0.00 43.86 1.85
284 288 2.731572 CAGGTACTCCCTCCGTAAAGA 58.268 52.381 0.00 0.00 43.86 2.52
285 289 3.094572 CAGGTACTCCCTCCGTAAAGAA 58.905 50.000 0.00 0.00 43.86 2.52
286 290 3.512724 CAGGTACTCCCTCCGTAAAGAAA 59.487 47.826 0.00 0.00 43.86 2.52
287 291 4.161754 CAGGTACTCCCTCCGTAAAGAAAT 59.838 45.833 0.00 0.00 43.86 2.17
288 292 5.361857 CAGGTACTCCCTCCGTAAAGAAATA 59.638 44.000 0.00 0.00 43.86 1.40
289 293 6.041751 CAGGTACTCCCTCCGTAAAGAAATAT 59.958 42.308 0.00 0.00 43.86 1.28
290 294 7.232127 CAGGTACTCCCTCCGTAAAGAAATATA 59.768 40.741 0.00 0.00 43.86 0.86
291 295 7.786464 AGGTACTCCCTCCGTAAAGAAATATAA 59.214 37.037 0.00 0.00 40.71 0.98
292 296 8.087136 GGTACTCCCTCCGTAAAGAAATATAAG 58.913 40.741 0.00 0.00 0.00 1.73
293 297 7.909485 ACTCCCTCCGTAAAGAAATATAAGA 57.091 36.000 0.00 0.00 0.00 2.10
294 298 7.953752 ACTCCCTCCGTAAAGAAATATAAGAG 58.046 38.462 0.00 0.00 0.00 2.85
295 299 6.756221 TCCCTCCGTAAAGAAATATAAGAGC 58.244 40.000 0.00 0.00 0.00 4.09
296 300 5.634020 CCCTCCGTAAAGAAATATAAGAGCG 59.366 44.000 0.00 0.00 0.00 5.03
297 301 6.214399 CCTCCGTAAAGAAATATAAGAGCGT 58.786 40.000 0.00 0.00 0.00 5.07
298 302 7.365741 CCTCCGTAAAGAAATATAAGAGCGTA 58.634 38.462 0.00 0.00 0.00 4.42
299 303 8.027771 CCTCCGTAAAGAAATATAAGAGCGTAT 58.972 37.037 0.00 0.00 0.00 3.06
317 321 9.775854 AGAGCGTATAGATTACTAAAGTAGTGA 57.224 33.333 0.00 0.00 39.81 3.41
327 331 9.733219 GATTACTAAAGTAGTGATCTAAACGCT 57.267 33.333 11.11 0.00 44.10 5.07
328 332 9.733219 ATTACTAAAGTAGTGATCTAAACGCTC 57.267 33.333 0.00 0.00 39.81 5.03
329 333 7.393841 ACTAAAGTAGTGATCTAAACGCTCT 57.606 36.000 0.00 0.00 37.69 4.09
330 334 7.828712 ACTAAAGTAGTGATCTAAACGCTCTT 58.171 34.615 0.00 0.00 37.69 2.85
331 335 8.954350 ACTAAAGTAGTGATCTAAACGCTCTTA 58.046 33.333 0.00 0.00 37.69 2.10
332 336 9.224058 CTAAAGTAGTGATCTAAACGCTCTTAC 57.776 37.037 0.00 0.00 0.00 2.34
333 337 6.754702 AGTAGTGATCTAAACGCTCTTACA 57.245 37.500 0.00 0.00 0.00 2.41
334 338 7.336161 AGTAGTGATCTAAACGCTCTTACAT 57.664 36.000 0.00 0.00 0.00 2.29
335 339 7.773149 AGTAGTGATCTAAACGCTCTTACATT 58.227 34.615 0.00 0.00 0.00 2.71
336 340 8.251721 AGTAGTGATCTAAACGCTCTTACATTT 58.748 33.333 0.00 0.00 0.00 2.32
337 341 7.295952 AGTGATCTAAACGCTCTTACATTTG 57.704 36.000 0.00 0.00 0.00 2.32
338 342 6.874134 AGTGATCTAAACGCTCTTACATTTGT 59.126 34.615 0.00 0.00 0.00 2.83
339 343 7.387948 AGTGATCTAAACGCTCTTACATTTGTT 59.612 33.333 0.00 0.00 0.00 2.83
340 344 8.015658 GTGATCTAAACGCTCTTACATTTGTTT 58.984 33.333 0.00 0.00 34.32 2.83
341 345 9.210329 TGATCTAAACGCTCTTACATTTGTTTA 57.790 29.630 0.00 0.00 32.41 2.01
342 346 9.474249 GATCTAAACGCTCTTACATTTGTTTAC 57.526 33.333 0.00 0.00 32.41 2.01
343 347 8.367943 TCTAAACGCTCTTACATTTGTTTACA 57.632 30.769 0.00 0.00 32.41 2.41
344 348 8.492748 TCTAAACGCTCTTACATTTGTTTACAG 58.507 33.333 0.00 0.00 32.41 2.74
345 349 6.854496 AACGCTCTTACATTTGTTTACAGA 57.146 33.333 0.00 0.00 0.00 3.41
346 350 6.467723 ACGCTCTTACATTTGTTTACAGAG 57.532 37.500 0.00 0.00 0.00 3.35
347 351 5.408604 ACGCTCTTACATTTGTTTACAGAGG 59.591 40.000 0.00 0.00 0.00 3.69
348 352 5.163854 CGCTCTTACATTTGTTTACAGAGGG 60.164 44.000 0.00 0.00 0.00 4.30
349 353 5.938125 GCTCTTACATTTGTTTACAGAGGGA 59.062 40.000 0.00 0.00 0.00 4.20
350 354 6.092807 GCTCTTACATTTGTTTACAGAGGGAG 59.907 42.308 0.00 0.00 0.00 4.30
351 355 7.074653 TCTTACATTTGTTTACAGAGGGAGT 57.925 36.000 0.00 0.00 0.00 3.85
352 356 8.197592 TCTTACATTTGTTTACAGAGGGAGTA 57.802 34.615 0.00 0.00 0.00 2.59
362 366 9.092338 TGTTTACAGAGGGAGTAGTTTACATAA 57.908 33.333 0.00 0.00 0.00 1.90
365 369 7.040473 ACAGAGGGAGTAGTTTACATAATCG 57.960 40.000 0.00 0.00 0.00 3.34
377 381 3.066291 ACATAATCGGTTGCACCTTCA 57.934 42.857 0.00 0.00 35.66 3.02
381 385 5.827797 ACATAATCGGTTGCACCTTCATTAT 59.172 36.000 0.00 0.00 35.66 1.28
387 391 4.436852 CGGTTGCACCTTCATTATGTACAC 60.437 45.833 0.00 0.00 35.66 2.90
392 396 3.309682 CACCTTCATTATGTACACCAGCG 59.690 47.826 0.00 0.00 0.00 5.18
401 405 0.108615 GTACACCAGCGAGTGCAGAT 60.109 55.000 8.83 0.00 46.23 2.90
402 406 0.173481 TACACCAGCGAGTGCAGATC 59.827 55.000 8.83 0.00 46.23 2.75
403 407 1.217511 CACCAGCGAGTGCAGATCT 59.782 57.895 0.00 0.00 46.23 2.75
404 408 1.082679 CACCAGCGAGTGCAGATCTG 61.083 60.000 18.84 18.84 46.23 2.90
405 409 1.253593 ACCAGCGAGTGCAGATCTGA 61.254 55.000 27.04 8.75 46.23 3.27
406 410 0.108472 CCAGCGAGTGCAGATCTGAA 60.108 55.000 27.04 14.12 46.23 3.02
407 411 0.997932 CAGCGAGTGCAGATCTGAAC 59.002 55.000 27.04 25.68 46.23 3.18
414 418 2.559440 GTGCAGATCTGAACTGATCCC 58.441 52.381 27.04 5.61 42.68 3.85
415 419 2.093288 GTGCAGATCTGAACTGATCCCA 60.093 50.000 27.04 8.27 42.68 4.37
416 420 2.775960 TGCAGATCTGAACTGATCCCAT 59.224 45.455 27.04 0.00 42.68 4.00
458 462 6.605119 TGGACTGAAGAAAAGAAAGATTCCT 58.395 36.000 0.00 0.00 0.00 3.36
466 470 9.237187 GAAGAAAAGAAAGATTCCTACTCCATT 57.763 33.333 0.00 0.00 0.00 3.16
518 524 4.398319 CAACCTTAGTTCCACCATCAGTT 58.602 43.478 0.00 0.00 32.45 3.16
554 560 2.031191 CACTGGCAAAGCAAAGCAAAAG 59.969 45.455 0.00 0.00 0.00 2.27
598 638 0.752743 CCCAATGATCACGCACCCAT 60.753 55.000 0.00 0.00 0.00 4.00
599 639 1.105457 CCAATGATCACGCACCCATT 58.895 50.000 0.00 0.00 0.00 3.16
604 644 1.293924 GATCACGCACCCATTGAGAG 58.706 55.000 0.00 0.00 0.00 3.20
630 670 0.596577 AACACAGCAGAGCAGCAATG 59.403 50.000 0.00 0.00 36.85 2.82
664 748 3.947910 ATGCCAATGTGAAAAGTGAGG 57.052 42.857 0.00 0.00 0.00 3.86
685 769 2.549754 GCTGCTGAGTCTTGCAACTTTA 59.450 45.455 11.36 0.00 38.81 1.85
688 772 3.809832 TGCTGAGTCTTGCAACTTTAGTC 59.190 43.478 0.00 0.00 36.15 2.59
706 790 3.886123 AGTCCCATTCACCTATTTTCCG 58.114 45.455 0.00 0.00 0.00 4.30
708 792 3.377172 GTCCCATTCACCTATTTTCCGTG 59.623 47.826 0.00 0.00 0.00 4.94
709 793 3.264706 TCCCATTCACCTATTTTCCGTGA 59.735 43.478 0.00 0.00 34.80 4.35
715 799 2.161609 CACCTATTTTCCGTGAAGGCAC 59.838 50.000 0.00 0.00 41.67 5.01
719 803 1.698506 TTTTCCGTGAAGGCACCAAT 58.301 45.000 0.00 0.00 42.09 3.16
721 805 0.179004 TTCCGTGAAGGCACCAATGT 60.179 50.000 0.00 0.00 42.09 2.71
726 810 1.196808 GTGAAGGCACCAATGTGTACG 59.803 52.381 0.00 0.00 44.65 3.67
727 811 0.802494 GAAGGCACCAATGTGTACGG 59.198 55.000 0.00 0.00 44.65 4.02
740 831 1.933853 GTGTACGGAGCTGCTTAATGG 59.066 52.381 2.53 0.00 0.00 3.16
743 834 0.324943 ACGGAGCTGCTTAATGGTGT 59.675 50.000 2.53 0.00 0.00 4.16
756 847 9.941664 CTGCTTAATGGTGTCTTCATATTTTAG 57.058 33.333 0.00 0.00 0.00 1.85
954 1047 4.022068 CAGTGTGCCTTACAATCCACAAAT 60.022 41.667 0.00 0.00 41.89 2.32
967 1060 7.483307 ACAATCCACAAATACATCAATACTGC 58.517 34.615 0.00 0.00 0.00 4.40
987 1080 1.293498 CTGGGTTCAGTACGCTGCT 59.707 57.895 0.00 0.00 42.29 4.24
1357 1468 0.105760 TCTCCCATCTCCTCTCAGCC 60.106 60.000 0.00 0.00 0.00 4.85
1361 1472 1.333636 CCATCTCCTCTCAGCCGGTT 61.334 60.000 1.90 0.00 0.00 4.44
1362 1473 0.103937 CATCTCCTCTCAGCCGGTTC 59.896 60.000 1.90 0.00 0.00 3.62
1363 1474 1.045911 ATCTCCTCTCAGCCGGTTCC 61.046 60.000 1.90 0.00 0.00 3.62
1364 1475 1.684049 CTCCTCTCAGCCGGTTCCT 60.684 63.158 1.90 0.00 0.00 3.36
1367 1478 2.683933 TCTCAGCCGGTTCCTCCC 60.684 66.667 1.90 0.00 0.00 4.30
1368 1479 2.685380 CTCAGCCGGTTCCTCCCT 60.685 66.667 1.90 0.00 0.00 4.20
1369 1480 2.683933 TCAGCCGGTTCCTCCCTC 60.684 66.667 1.90 0.00 0.00 4.30
1370 1481 3.787001 CAGCCGGTTCCTCCCTCC 61.787 72.222 1.90 0.00 0.00 4.30
1371 1482 4.012721 AGCCGGTTCCTCCCTCCT 62.013 66.667 1.90 0.00 0.00 3.69
1375 1710 2.722201 CGGTTCCTCCCTCCTTCCG 61.722 68.421 0.00 0.00 0.00 4.30
1382 1717 1.063867 CCTCCCTCCTTCCGTCTCTTA 60.064 57.143 0.00 0.00 0.00 2.10
1385 1720 1.137282 CCCTCCTTCCGTCTCTTAAGC 59.863 57.143 0.00 0.00 0.00 3.09
1408 1743 1.902508 TCGCTCCCATGTTCTTCTTCT 59.097 47.619 0.00 0.00 0.00 2.85
1409 1744 2.303022 TCGCTCCCATGTTCTTCTTCTT 59.697 45.455 0.00 0.00 0.00 2.52
1410 1745 2.675348 CGCTCCCATGTTCTTCTTCTTC 59.325 50.000 0.00 0.00 0.00 2.87
1411 1746 3.618507 CGCTCCCATGTTCTTCTTCTTCT 60.619 47.826 0.00 0.00 0.00 2.85
1412 1747 4.331108 GCTCCCATGTTCTTCTTCTTCTT 58.669 43.478 0.00 0.00 0.00 2.52
1413 1748 4.394610 GCTCCCATGTTCTTCTTCTTCTTC 59.605 45.833 0.00 0.00 0.00 2.87
1414 1749 5.802821 GCTCCCATGTTCTTCTTCTTCTTCT 60.803 44.000 0.00 0.00 0.00 2.85
1416 1751 6.234177 TCCCATGTTCTTCTTCTTCTTCTTC 58.766 40.000 0.00 0.00 0.00 2.87
1425 1904 8.698973 TCTTCTTCTTCTTCTTCTTCAGTCTA 57.301 34.615 0.00 0.00 0.00 2.59
1433 1912 3.676093 TCTTCTTCAGTCTACGCAGAGA 58.324 45.455 0.00 0.00 0.00 3.10
1446 1925 8.590339 GTCTACGCAGAGACTAATTTATATCG 57.410 38.462 7.57 0.00 42.26 2.92
1447 1926 7.693120 GTCTACGCAGAGACTAATTTATATCGG 59.307 40.741 7.57 0.00 42.26 4.18
1448 1927 5.162075 ACGCAGAGACTAATTTATATCGGC 58.838 41.667 0.00 0.00 0.00 5.54
1451 1930 5.808030 GCAGAGACTAATTTATATCGGCCTC 59.192 44.000 0.00 0.00 0.00 4.70
1453 1932 7.607250 CAGAGACTAATTTATATCGGCCTCTT 58.393 38.462 0.00 0.00 0.00 2.85
1471 1992 2.281970 CAGTTCTGCCTGCCTGCA 60.282 61.111 0.00 0.00 39.37 4.41
1478 1999 2.830370 GCCTGCCTGCATGTACCC 60.830 66.667 0.00 0.00 0.00 3.69
1480 2001 2.124151 CTGCCTGCATGTACCCCC 60.124 66.667 0.00 0.00 0.00 5.40
1595 2415 1.203162 ACCATGCCCCACAAGATGAAA 60.203 47.619 0.00 0.00 0.00 2.69
1687 2507 0.620121 AGGGGAGAAGGGAGCAGAAG 60.620 60.000 0.00 0.00 0.00 2.85
1714 2534 1.103398 ACACTTGCAGCCAACTGGAC 61.103 55.000 0.00 0.00 44.82 4.02
1814 2640 3.663198 AGAAGCCAACCAGGATATCTCT 58.337 45.455 2.05 0.00 41.22 3.10
2154 3001 8.633561 GTGTTATAGTAACTACCCGAAACCTAT 58.366 37.037 2.04 0.00 0.00 2.57
2206 3053 7.951530 TTCTTGCAAATCAGAGGAAAATTTC 57.048 32.000 0.00 0.00 0.00 2.17
2213 3060 3.939066 TCAGAGGAAAATTTCTCCGGTC 58.061 45.455 0.00 6.96 38.08 4.79
2218 3065 1.472878 GAAAATTTCTCCGGTCCCAGC 59.527 52.381 0.00 0.00 0.00 4.85
2232 3079 0.104120 CCCAGCGTCCGACATAATCA 59.896 55.000 0.00 0.00 0.00 2.57
2310 3157 2.906389 GGGCCTGATGATGACCATAGTA 59.094 50.000 0.84 0.00 35.17 1.82
2328 3175 6.038714 CCATAGTAGCTTGGAAGAAATTGGAC 59.961 42.308 0.00 0.00 34.81 4.02
2410 3257 1.153549 CAGAGCTAAGGACCGTGGC 60.154 63.158 7.70 7.70 0.00 5.01
2411 3258 1.609501 AGAGCTAAGGACCGTGGCA 60.610 57.895 17.46 0.00 0.00 4.92
2525 3378 4.521146 ACCACATGAAGCTAGAATTCAGG 58.479 43.478 16.53 16.53 42.53 3.86
2574 3427 2.428171 CCCAAGGGCTTTGTCATGTATG 59.572 50.000 8.62 0.00 34.87 2.39
2674 3527 3.893753 TTTGGGGATGTCCTTTCTTCA 57.106 42.857 0.00 0.00 35.95 3.02
2697 3550 0.250234 TCCAGGATCTGCTTCGGTTG 59.750 55.000 0.00 0.00 0.00 3.77
2747 3608 5.005628 TGGCTGGTTCCCTTTTACTATTT 57.994 39.130 0.00 0.00 0.00 1.40
2779 3697 4.431416 TTATGTATGGCCCTACACTTGG 57.569 45.455 21.44 0.00 34.59 3.61
2790 3708 6.126739 TGGCCCTACACTTGGTTTTAAATTTT 60.127 34.615 0.00 0.00 0.00 1.82
2873 3792 8.488764 GTTCAGTTTTGTACTTTACTAGCTCTG 58.511 37.037 0.00 0.00 33.85 3.35
2883 3802 8.989980 GTACTTTACTAGCTCTGTTGTTTTGAT 58.010 33.333 0.00 0.00 0.00 2.57
3200 4562 9.819267 GCTTAACTTAGTAGAGTATCAAACCAT 57.181 33.333 0.00 0.00 37.82 3.55
3258 4627 2.954792 ACCAAGGTATACTAGTCCGGG 58.045 52.381 0.00 5.07 0.00 5.73
3259 4628 2.245806 ACCAAGGTATACTAGTCCGGGT 59.754 50.000 0.00 5.71 0.00 5.28
3261 4630 4.106987 ACCAAGGTATACTAGTCCGGGTAT 59.893 45.833 13.39 3.82 34.10 2.73
3262 4631 5.313240 ACCAAGGTATACTAGTCCGGGTATA 59.687 44.000 13.39 2.73 34.10 1.47
3271 4640 0.877743 GTCCGGGTATACTAGTCCGC 59.122 60.000 13.77 5.03 41.02 5.54
3274 4643 0.879765 CGGGTATACTAGTCCGCCAG 59.120 60.000 7.70 2.33 35.95 4.85
3276 4645 2.161030 GGGTATACTAGTCCGCCAGAG 58.839 57.143 0.00 0.00 0.00 3.35
3277 4646 2.161030 GGTATACTAGTCCGCCAGAGG 58.839 57.143 0.00 0.00 0.00 3.69
3278 4647 2.488710 GGTATACTAGTCCGCCAGAGGT 60.489 54.545 0.00 0.00 0.00 3.85
3284 4653 1.115467 AGTCCGCCAGAGGTATTCAG 58.885 55.000 0.00 0.00 0.00 3.02
3296 5732 2.778270 AGGTATTCAGGTTAGGCCCTTC 59.222 50.000 0.00 0.00 38.26 3.46
3345 5781 2.808206 CCCTCCTGGCGGTGGTATC 61.808 68.421 1.41 0.00 41.45 2.24
3363 5799 1.999048 TCGAGAGAGACAGTCGAGAC 58.001 55.000 0.00 0.00 37.79 3.36
3371 5807 5.411977 AGAGAGACAGTCGAGACGAATAAAA 59.588 40.000 0.00 0.00 37.72 1.52
3383 5819 5.583495 AGACGAATAAAAGACGAGAGATGG 58.417 41.667 0.00 0.00 0.00 3.51
3391 5827 9.482627 AATAAAAGACGAGAGATGGTTCATATC 57.517 33.333 0.00 0.00 32.91 1.63
3407 5843 6.777580 GGTTCATATCCCTTTATGTGGTTCAT 59.222 38.462 0.00 0.00 40.25 2.57
3419 5855 1.474077 GTGGTTCATGTGAATCTGGCC 59.526 52.381 7.46 0.00 36.19 5.36
3426 5866 0.842030 TGTGAATCTGGCCCAGGACT 60.842 55.000 11.68 0.00 31.51 3.85
3428 5868 0.620556 TGAATCTGGCCCAGGACTTC 59.379 55.000 11.68 11.94 31.51 3.01
3448 5888 0.040942 ACCATGGGCCAAGTGCATAA 59.959 50.000 18.09 0.00 43.89 1.90
3473 5913 7.593825 AGGTAGCACTGTTCAAAATTATTGTC 58.406 34.615 0.00 0.00 0.00 3.18
3474 5914 6.806739 GGTAGCACTGTTCAAAATTATTGTCC 59.193 38.462 0.00 0.00 0.00 4.02
3476 5916 6.681777 AGCACTGTTCAAAATTATTGTCCTC 58.318 36.000 0.00 0.00 0.00 3.71
3481 5921 6.908825 TGTTCAAAATTATTGTCCTCCTTCG 58.091 36.000 0.00 0.00 0.00 3.79
3482 5922 6.072175 TGTTCAAAATTATTGTCCTCCTTCGG 60.072 38.462 0.00 0.00 0.00 4.30
3495 5935 3.646637 CCTCCTTCGGTCCCTATTTACAT 59.353 47.826 0.00 0.00 0.00 2.29
3499 5939 4.377897 CTTCGGTCCCTATTTACATGGTC 58.622 47.826 0.00 0.00 0.00 4.02
3524 5964 7.174946 TCTCCACATATTTCAAGGTTCAACTTC 59.825 37.037 0.00 0.00 0.00 3.01
3529 5969 2.992124 TCAAGGTTCAACTTCGACCA 57.008 45.000 0.00 0.00 35.89 4.02
3538 5978 5.278266 GGTTCAACTTCGACCATCAATTTGA 60.278 40.000 0.75 0.75 33.61 2.69
3539 5979 5.356882 TCAACTTCGACCATCAATTTGAC 57.643 39.130 0.15 0.00 0.00 3.18
3541 5981 3.750371 ACTTCGACCATCAATTTGACCA 58.250 40.909 0.15 0.00 0.00 4.02
3571 6012 8.777865 AACATGAGTTATATATGTTCCATCGG 57.222 34.615 0.00 0.00 40.01 4.18
3579 6172 0.991920 ATGTTCCATCGGACCCAAGT 59.008 50.000 0.00 0.00 0.00 3.16
3597 6190 0.543277 GTCATGAGTGCCATCTCCCA 59.457 55.000 0.00 0.00 31.94 4.37
3609 6202 2.843113 CCATCTCCCAAAGAAGAGACCT 59.157 50.000 0.00 0.00 41.74 3.85
3611 6204 2.171840 TCTCCCAAAGAAGAGACCTCG 58.828 52.381 0.00 0.00 34.23 4.63
3613 6206 0.391793 CCCAAAGAAGAGACCTCGCC 60.392 60.000 0.00 0.00 34.09 5.54
3619 6217 1.893919 GAAGAGACCTCGCCAGCCTT 61.894 60.000 0.00 0.00 34.09 4.35
3621 6219 0.614979 AGAGACCTCGCCAGCCTTAA 60.615 55.000 0.00 0.00 34.09 1.85
3624 6222 1.134371 AGACCTCGCCAGCCTTAAATC 60.134 52.381 0.00 0.00 0.00 2.17
3626 6224 1.212935 ACCTCGCCAGCCTTAAATCAT 59.787 47.619 0.00 0.00 0.00 2.45
3639 6237 5.792741 CCTTAAATCATTGTTTGCCTTCCA 58.207 37.500 0.00 0.00 0.00 3.53
3648 6246 1.202348 GTTTGCCTTCCATTTCCTCCG 59.798 52.381 0.00 0.00 0.00 4.63
3668 6266 1.021390 CCCGGAGCACTGTGAATGTC 61.021 60.000 12.86 1.91 0.00 3.06
3670 6268 1.511850 CGGAGCACTGTGAATGTCAA 58.488 50.000 12.86 0.00 0.00 3.18
3671 6269 1.462283 CGGAGCACTGTGAATGTCAAG 59.538 52.381 12.86 0.00 0.00 3.02
3672 6270 2.498167 GGAGCACTGTGAATGTCAAGT 58.502 47.619 12.86 0.00 0.00 3.16
3699 6309 0.965363 CCACCATTGGGGAAGAACCG 60.965 60.000 6.49 0.00 39.57 4.44
3700 6310 0.965363 CACCATTGGGGAAGAACCGG 60.965 60.000 7.78 0.00 41.15 5.28
3702 6312 1.304052 CATTGGGGAAGAACCGGCA 60.304 57.895 0.00 0.00 40.11 5.69
3703 6313 1.000896 ATTGGGGAAGAACCGGCAG 60.001 57.895 0.00 0.00 40.11 4.85
3718 6328 1.208614 GCAGCGGCTGAAGAAAGTG 59.791 57.895 32.72 4.90 36.96 3.16
3719 6329 1.208614 CAGCGGCTGAAGAAAGTGC 59.791 57.895 25.33 0.00 32.44 4.40
3725 6335 0.658536 GCTGAAGAAAGTGCGTGCAC 60.659 55.000 16.91 16.91 46.50 4.57
3777 6610 5.355910 GCACCTCGGTTCCTTTAATAATCAA 59.644 40.000 0.00 0.00 0.00 2.57
3778 6611 6.458342 GCACCTCGGTTCCTTTAATAATCAAG 60.458 42.308 0.00 0.00 0.00 3.02
3781 6614 6.094881 CCTCGGTTCCTTTAATAATCAAGCAA 59.905 38.462 0.00 0.00 0.00 3.91
3782 6615 7.083875 TCGGTTCCTTTAATAATCAAGCAAG 57.916 36.000 0.00 0.00 0.00 4.01
3784 6617 7.825270 TCGGTTCCTTTAATAATCAAGCAAGTA 59.175 33.333 0.00 0.00 0.00 2.24
3785 6618 8.621286 CGGTTCCTTTAATAATCAAGCAAGTAT 58.379 33.333 0.00 0.00 0.00 2.12
3786 6619 9.736023 GGTTCCTTTAATAATCAAGCAAGTATG 57.264 33.333 0.00 0.00 0.00 2.39
3818 6676 8.531146 AGTTTCAAATTAGGTGATATTGTTGGG 58.469 33.333 0.00 0.00 0.00 4.12
3819 6677 7.416964 TTCAAATTAGGTGATATTGTTGGGG 57.583 36.000 0.00 0.00 0.00 4.96
3822 6680 7.287466 TCAAATTAGGTGATATTGTTGGGGATG 59.713 37.037 0.00 0.00 0.00 3.51
3823 6681 5.725551 TTAGGTGATATTGTTGGGGATGT 57.274 39.130 0.00 0.00 0.00 3.06
3824 6682 6.833346 TTAGGTGATATTGTTGGGGATGTA 57.167 37.500 0.00 0.00 0.00 2.29
3825 6683 5.310409 AGGTGATATTGTTGGGGATGTAG 57.690 43.478 0.00 0.00 0.00 2.74
3826 6684 3.821033 GGTGATATTGTTGGGGATGTAGC 59.179 47.826 0.00 0.00 0.00 3.58
3827 6685 3.821033 GTGATATTGTTGGGGATGTAGCC 59.179 47.826 0.00 0.00 0.00 3.93
3834 6692 3.087906 GGGATGTAGCCCCACGGT 61.088 66.667 0.00 0.00 42.62 4.83
3835 6693 1.763256 GGGATGTAGCCCCACGGTA 60.763 63.158 0.00 0.00 42.62 4.02
3836 6694 1.125711 GGGATGTAGCCCCACGGTAT 61.126 60.000 0.00 0.00 42.62 2.73
3837 6695 0.034896 GGATGTAGCCCCACGGTATG 59.965 60.000 0.00 0.00 0.00 2.39
3838 6696 1.045407 GATGTAGCCCCACGGTATGA 58.955 55.000 0.00 0.00 0.00 2.15
3839 6697 0.756903 ATGTAGCCCCACGGTATGAC 59.243 55.000 0.00 0.00 0.00 3.06
3840 6698 1.332144 TGTAGCCCCACGGTATGACC 61.332 60.000 0.00 0.00 34.05 4.02
3841 6699 1.763256 TAGCCCCACGGTATGACCC 60.763 63.158 0.00 0.00 33.75 4.46
3848 6706 3.462169 CGGTATGACCCGCCCATA 58.538 61.111 0.00 0.00 41.78 2.74
3849 6707 1.980052 CGGTATGACCCGCCCATAT 59.020 57.895 0.00 0.00 41.78 1.78
3850 6708 0.108329 CGGTATGACCCGCCCATATC 60.108 60.000 0.00 0.00 41.78 1.63
3851 6709 0.981183 GGTATGACCCGCCCATATCA 59.019 55.000 0.00 0.00 30.15 2.15
3852 6710 1.559682 GGTATGACCCGCCCATATCAT 59.440 52.381 0.00 0.00 35.91 2.45
3853 6711 2.632377 GTATGACCCGCCCATATCATG 58.368 52.381 0.00 0.00 33.84 3.07
3854 6712 5.815010 GGTATGACCCGCCCATATCATGG 62.815 56.522 0.00 0.00 40.40 3.66
3865 6723 4.826274 CCATATCATGGTCGGGTTATCT 57.174 45.455 0.00 0.00 45.54 1.98
3866 6724 5.932619 CCATATCATGGTCGGGTTATCTA 57.067 43.478 0.00 0.00 45.54 1.98
3867 6725 5.907207 CCATATCATGGTCGGGTTATCTAG 58.093 45.833 0.00 0.00 45.54 2.43
3868 6726 5.422331 CCATATCATGGTCGGGTTATCTAGT 59.578 44.000 0.00 0.00 45.54 2.57
3869 6727 4.873746 ATCATGGTCGGGTTATCTAGTG 57.126 45.455 0.00 0.00 0.00 2.74
3870 6728 2.963101 TCATGGTCGGGTTATCTAGTGG 59.037 50.000 0.00 0.00 0.00 4.00
3871 6729 1.117150 TGGTCGGGTTATCTAGTGGC 58.883 55.000 0.00 0.00 0.00 5.01
3872 6730 0.031721 GGTCGGGTTATCTAGTGGCG 59.968 60.000 0.00 0.00 0.00 5.69
3873 6731 0.031721 GTCGGGTTATCTAGTGGCGG 59.968 60.000 0.00 0.00 0.00 6.13
3874 6732 1.300697 CGGGTTATCTAGTGGCGGC 60.301 63.158 0.00 0.00 0.00 6.53
3875 6733 1.745320 CGGGTTATCTAGTGGCGGCT 61.745 60.000 11.43 0.00 0.00 5.52
3876 6734 0.468648 GGGTTATCTAGTGGCGGCTT 59.531 55.000 11.43 0.60 0.00 4.35
3877 6735 1.134189 GGGTTATCTAGTGGCGGCTTT 60.134 52.381 11.43 0.18 0.00 3.51
3878 6736 2.103601 GGGTTATCTAGTGGCGGCTTTA 59.896 50.000 11.43 1.53 0.00 1.85
3879 6737 3.432608 GGGTTATCTAGTGGCGGCTTTAA 60.433 47.826 11.43 0.00 0.00 1.52
3880 6738 3.808174 GGTTATCTAGTGGCGGCTTTAAG 59.192 47.826 11.43 2.68 0.00 1.85
3881 6739 4.442472 GGTTATCTAGTGGCGGCTTTAAGA 60.442 45.833 11.43 8.35 0.00 2.10
3882 6740 3.906720 ATCTAGTGGCGGCTTTAAGAA 57.093 42.857 11.43 0.00 0.00 2.52
3883 6741 3.906720 TCTAGTGGCGGCTTTAAGAAT 57.093 42.857 11.43 0.00 0.00 2.40
3884 6742 5.546621 ATCTAGTGGCGGCTTTAAGAATA 57.453 39.130 11.43 0.00 0.00 1.75
3885 6743 4.945246 TCTAGTGGCGGCTTTAAGAATAG 58.055 43.478 11.43 1.53 0.00 1.73
3886 6744 2.919228 AGTGGCGGCTTTAAGAATAGG 58.081 47.619 11.43 0.00 0.00 2.57
3887 6745 1.333931 GTGGCGGCTTTAAGAATAGGC 59.666 52.381 11.43 0.00 0.00 3.93
3888 6746 1.211949 TGGCGGCTTTAAGAATAGGCT 59.788 47.619 11.43 0.00 35.01 4.58
3889 6747 1.874231 GGCGGCTTTAAGAATAGGCTC 59.126 52.381 0.00 0.00 35.01 4.70
3890 6748 2.561569 GCGGCTTTAAGAATAGGCTCA 58.438 47.619 0.00 0.00 35.01 4.26
3891 6749 3.142174 GCGGCTTTAAGAATAGGCTCAT 58.858 45.455 0.00 0.00 35.01 2.90
3892 6750 3.187432 GCGGCTTTAAGAATAGGCTCATC 59.813 47.826 0.00 0.00 35.01 2.92
3893 6751 4.380531 CGGCTTTAAGAATAGGCTCATCA 58.619 43.478 0.00 0.00 35.01 3.07
3894 6752 4.999950 CGGCTTTAAGAATAGGCTCATCAT 59.000 41.667 0.00 0.00 35.01 2.45
3895 6753 6.166279 CGGCTTTAAGAATAGGCTCATCATA 58.834 40.000 0.00 0.00 35.01 2.15
3896 6754 6.820656 CGGCTTTAAGAATAGGCTCATCATAT 59.179 38.462 0.00 0.00 35.01 1.78
3897 6755 7.201591 CGGCTTTAAGAATAGGCTCATCATATG 60.202 40.741 0.00 0.00 35.01 1.78
3898 6756 7.066766 GGCTTTAAGAATAGGCTCATCATATGG 59.933 40.741 2.13 0.00 34.40 2.74
3899 6757 7.066766 GCTTTAAGAATAGGCTCATCATATGGG 59.933 40.741 2.13 0.00 0.00 4.00
3904 6762 3.880591 CTCATCATATGGGCCGCG 58.119 61.111 0.00 0.00 0.00 6.46
3905 6763 1.293179 CTCATCATATGGGCCGCGA 59.707 57.895 8.23 0.00 0.00 5.87
3906 6764 0.107993 CTCATCATATGGGCCGCGAT 60.108 55.000 8.23 0.00 0.00 4.58
3907 6765 0.391528 TCATCATATGGGCCGCGATG 60.392 55.000 8.23 14.60 35.80 3.84
3908 6766 0.391528 CATCATATGGGCCGCGATGA 60.392 55.000 8.23 14.79 36.42 2.92
3909 6767 0.543277 ATCATATGGGCCGCGATGAT 59.457 50.000 8.23 17.32 34.84 2.45
3910 6768 0.108186 TCATATGGGCCGCGATGATC 60.108 55.000 8.23 0.00 0.00 2.92
3911 6769 0.391528 CATATGGGCCGCGATGATCA 60.392 55.000 8.23 0.00 0.00 2.92
3912 6770 0.324614 ATATGGGCCGCGATGATCAA 59.675 50.000 8.23 0.00 0.00 2.57
3913 6771 0.320683 TATGGGCCGCGATGATCAAG 60.321 55.000 8.23 0.00 0.00 3.02
3914 6772 2.043604 ATGGGCCGCGATGATCAAGA 62.044 55.000 8.23 0.00 0.00 3.02
3915 6773 1.958205 GGGCCGCGATGATCAAGAG 60.958 63.158 8.23 0.00 0.00 2.85
3916 6774 2.602322 GGCCGCGATGATCAAGAGC 61.602 63.158 8.23 4.89 0.00 4.09
3917 6775 1.593750 GCCGCGATGATCAAGAGCT 60.594 57.895 8.23 0.00 0.00 4.09
3918 6776 1.555741 GCCGCGATGATCAAGAGCTC 61.556 60.000 8.23 5.27 0.00 4.09
3919 6777 0.249197 CCGCGATGATCAAGAGCTCA 60.249 55.000 17.77 0.00 0.00 4.26
3920 6778 1.564207 CGCGATGATCAAGAGCTCAA 58.436 50.000 17.77 0.69 0.00 3.02
3921 6779 1.521840 CGCGATGATCAAGAGCTCAAG 59.478 52.381 17.77 7.84 0.00 3.02
3922 6780 1.865970 GCGATGATCAAGAGCTCAAGG 59.134 52.381 17.77 4.66 0.00 3.61
3923 6781 2.482664 GCGATGATCAAGAGCTCAAGGA 60.483 50.000 17.77 10.39 0.00 3.36
3924 6782 3.122297 CGATGATCAAGAGCTCAAGGAC 58.878 50.000 17.77 4.96 0.00 3.85
3925 6783 3.429960 CGATGATCAAGAGCTCAAGGACA 60.430 47.826 17.77 10.60 0.00 4.02
3926 6784 4.511527 GATGATCAAGAGCTCAAGGACAA 58.488 43.478 17.77 2.78 0.00 3.18
3927 6785 3.935315 TGATCAAGAGCTCAAGGACAAG 58.065 45.455 17.77 0.00 0.00 3.16
3928 6786 3.580022 TGATCAAGAGCTCAAGGACAAGA 59.420 43.478 17.77 1.96 0.00 3.02
3929 6787 4.224594 TGATCAAGAGCTCAAGGACAAGAT 59.775 41.667 17.77 6.70 0.00 2.40
3930 6788 3.935315 TCAAGAGCTCAAGGACAAGATG 58.065 45.455 17.77 0.00 0.00 2.90
3931 6789 3.008330 CAAGAGCTCAAGGACAAGATGG 58.992 50.000 17.77 0.00 0.00 3.51
3932 6790 1.558756 AGAGCTCAAGGACAAGATGGG 59.441 52.381 17.77 0.00 0.00 4.00
3933 6791 0.034670 AGCTCAAGGACAAGATGGGC 60.035 55.000 0.00 0.00 40.90 5.36
3934 6792 1.372087 GCTCAAGGACAAGATGGGCG 61.372 60.000 0.00 0.00 29.76 6.13
3935 6793 0.250234 CTCAAGGACAAGATGGGCGA 59.750 55.000 0.00 0.00 0.00 5.54
3936 6794 0.036388 TCAAGGACAAGATGGGCGAC 60.036 55.000 0.00 0.00 0.00 5.19
3937 6795 0.036010 CAAGGACAAGATGGGCGACT 60.036 55.000 0.00 0.00 0.00 4.18
3938 6796 0.250513 AAGGACAAGATGGGCGACTC 59.749 55.000 0.00 0.00 0.00 3.36
3939 6797 0.904865 AGGACAAGATGGGCGACTCA 60.905 55.000 0.00 0.00 0.00 3.41
3940 6798 0.179000 GGACAAGATGGGCGACTCAT 59.821 55.000 0.00 0.00 0.00 2.90
3941 6799 1.293924 GACAAGATGGGCGACTCATG 58.706 55.000 0.00 0.00 0.00 3.07
3942 6800 0.107508 ACAAGATGGGCGACTCATGG 60.108 55.000 0.00 0.00 0.00 3.66
3943 6801 0.178767 CAAGATGGGCGACTCATGGA 59.821 55.000 0.00 0.00 0.00 3.41
3944 6802 0.467384 AAGATGGGCGACTCATGGAG 59.533 55.000 0.00 0.00 35.52 3.86
3945 6803 1.596477 GATGGGCGACTCATGGAGC 60.596 63.158 0.00 0.00 32.04 4.70
3946 6804 3.451556 ATGGGCGACTCATGGAGCG 62.452 63.158 0.00 0.00 34.33 5.03
3947 6805 4.899239 GGGCGACTCATGGAGCGG 62.899 72.222 0.00 0.00 32.82 5.52
3948 6806 4.899239 GGCGACTCATGGAGCGGG 62.899 72.222 0.00 0.00 32.82 6.13
3950 6808 4.899239 CGACTCATGGAGCGGGCC 62.899 72.222 0.00 0.00 32.04 5.80
3951 6809 4.899239 GACTCATGGAGCGGGCCG 62.899 72.222 24.35 24.35 32.04 6.13
3969 6827 2.190578 GCTCGTAGCCCAATGCCT 59.809 61.111 0.00 0.00 42.71 4.75
3970 6828 1.445942 GCTCGTAGCCCAATGCCTA 59.554 57.895 0.00 0.00 42.71 3.93
3971 6829 0.179056 GCTCGTAGCCCAATGCCTAA 60.179 55.000 0.00 0.00 42.71 2.69
3972 6830 1.871080 CTCGTAGCCCAATGCCTAAG 58.129 55.000 0.00 0.00 42.71 2.18
3973 6831 0.468226 TCGTAGCCCAATGCCTAAGG 59.532 55.000 0.00 0.00 42.71 2.69
3983 6841 4.540735 GCCTAAGGCGGCGGCTTA 62.541 66.667 40.76 40.76 46.45 3.09
3984 6842 2.426023 CCTAAGGCGGCGGCTTAT 59.574 61.111 42.62 29.32 46.65 1.73
3985 6843 1.668151 CCTAAGGCGGCGGCTTATC 60.668 63.158 42.62 13.46 46.65 1.75
3986 6844 1.069090 CTAAGGCGGCGGCTTATCA 59.931 57.895 42.62 29.67 46.65 2.15
3987 6845 0.531974 CTAAGGCGGCGGCTTATCAA 60.532 55.000 42.62 29.35 46.65 2.57
3988 6846 0.107606 TAAGGCGGCGGCTTATCAAA 60.108 50.000 40.64 27.07 46.45 2.69
3989 6847 1.376609 AAGGCGGCGGCTTATCAAAG 61.377 55.000 41.69 0.00 46.45 2.77
3990 6848 2.715624 GCGGCGGCTTATCAAAGG 59.284 61.111 9.78 0.00 35.83 3.11
3991 6849 1.817941 GCGGCGGCTTATCAAAGGA 60.818 57.895 9.78 0.00 35.83 3.36
3992 6850 1.373590 GCGGCGGCTTATCAAAGGAA 61.374 55.000 9.78 0.00 35.83 3.36
3993 6851 1.091537 CGGCGGCTTATCAAAGGAAA 58.908 50.000 7.61 0.00 32.98 3.13
3994 6852 1.202143 CGGCGGCTTATCAAAGGAAAC 60.202 52.381 7.61 0.00 32.98 2.78
3995 6853 1.816224 GGCGGCTTATCAAAGGAAACA 59.184 47.619 0.00 0.00 32.98 2.83
3996 6854 2.230266 GGCGGCTTATCAAAGGAAACAA 59.770 45.455 0.00 0.00 32.98 2.83
3997 6855 3.119137 GGCGGCTTATCAAAGGAAACAAT 60.119 43.478 0.00 0.00 32.98 2.71
3998 6856 3.859386 GCGGCTTATCAAAGGAAACAATG 59.141 43.478 0.00 0.00 32.98 2.82
3999 6857 4.423732 CGGCTTATCAAAGGAAACAATGG 58.576 43.478 0.00 0.00 32.98 3.16
4000 6858 4.677779 CGGCTTATCAAAGGAAACAATGGG 60.678 45.833 0.00 0.00 32.98 4.00
4001 6859 4.466015 GGCTTATCAAAGGAAACAATGGGA 59.534 41.667 0.00 0.00 32.98 4.37
4002 6860 5.046663 GGCTTATCAAAGGAAACAATGGGAA 60.047 40.000 0.00 0.00 32.98 3.97
4003 6861 6.352137 GGCTTATCAAAGGAAACAATGGGAAT 60.352 38.462 0.00 0.00 32.98 3.01
4004 6862 7.105588 GCTTATCAAAGGAAACAATGGGAATT 58.894 34.615 0.00 0.00 32.98 2.17
4005 6863 7.278646 GCTTATCAAAGGAAACAATGGGAATTC 59.721 37.037 0.00 0.00 32.98 2.17
4006 6864 6.940430 ATCAAAGGAAACAATGGGAATTCT 57.060 33.333 5.23 0.00 0.00 2.40
4007 6865 6.345096 TCAAAGGAAACAATGGGAATTCTC 57.655 37.500 5.23 0.82 0.00 2.87
4008 6866 6.077322 TCAAAGGAAACAATGGGAATTCTCT 58.923 36.000 6.92 0.00 0.00 3.10
4009 6867 6.554605 TCAAAGGAAACAATGGGAATTCTCTT 59.445 34.615 6.92 0.00 0.00 2.85
4010 6868 7.728083 TCAAAGGAAACAATGGGAATTCTCTTA 59.272 33.333 6.92 0.00 0.00 2.10
4011 6869 7.468141 AAGGAAACAATGGGAATTCTCTTAC 57.532 36.000 6.92 0.00 0.00 2.34
4012 6870 6.794534 AGGAAACAATGGGAATTCTCTTACT 58.205 36.000 6.92 0.00 0.00 2.24
4013 6871 7.241628 AGGAAACAATGGGAATTCTCTTACTT 58.758 34.615 6.92 0.00 0.00 2.24
4014 6872 7.177392 AGGAAACAATGGGAATTCTCTTACTTG 59.823 37.037 6.92 7.70 0.00 3.16
4015 6873 6.840780 AACAATGGGAATTCTCTTACTTGG 57.159 37.500 6.92 0.00 0.00 3.61
4016 6874 5.264395 ACAATGGGAATTCTCTTACTTGGG 58.736 41.667 6.92 0.00 0.00 4.12
4017 6875 5.015178 ACAATGGGAATTCTCTTACTTGGGA 59.985 40.000 6.92 0.00 0.00 4.37
4018 6876 5.796502 ATGGGAATTCTCTTACTTGGGAA 57.203 39.130 6.92 0.00 0.00 3.97
4019 6877 5.592587 TGGGAATTCTCTTACTTGGGAAA 57.407 39.130 6.92 0.00 0.00 3.13
4020 6878 6.152638 TGGGAATTCTCTTACTTGGGAAAT 57.847 37.500 6.92 0.00 0.00 2.17
4021 6879 7.278724 TGGGAATTCTCTTACTTGGGAAATA 57.721 36.000 6.92 0.00 0.00 1.40
4022 6880 7.116736 TGGGAATTCTCTTACTTGGGAAATAC 58.883 38.462 6.92 0.00 0.00 1.89
4023 6881 6.260271 GGGAATTCTCTTACTTGGGAAATACG 59.740 42.308 5.23 0.00 0.00 3.06
4024 6882 7.046033 GGAATTCTCTTACTTGGGAAATACGA 58.954 38.462 5.23 0.00 0.00 3.43
4025 6883 7.715686 GGAATTCTCTTACTTGGGAAATACGAT 59.284 37.037 5.23 0.00 0.00 3.73
4026 6884 8.438676 AATTCTCTTACTTGGGAAATACGATG 57.561 34.615 0.00 0.00 0.00 3.84
4027 6885 6.785337 TCTCTTACTTGGGAAATACGATGA 57.215 37.500 0.00 0.00 0.00 2.92
4028 6886 6.806751 TCTCTTACTTGGGAAATACGATGAG 58.193 40.000 0.00 0.00 0.00 2.90
4029 6887 6.380274 TCTCTTACTTGGGAAATACGATGAGT 59.620 38.462 0.00 0.00 0.00 3.41
4030 6888 7.558807 TCTCTTACTTGGGAAATACGATGAGTA 59.441 37.037 0.00 0.00 40.03 2.59
4031 6889 7.713750 TCTTACTTGGGAAATACGATGAGTAG 58.286 38.462 0.00 0.00 38.94 2.57
4032 6890 5.277857 ACTTGGGAAATACGATGAGTAGG 57.722 43.478 0.00 0.00 38.94 3.18
4033 6891 4.960469 ACTTGGGAAATACGATGAGTAGGA 59.040 41.667 0.00 0.00 38.94 2.94
4034 6892 5.069251 ACTTGGGAAATACGATGAGTAGGAG 59.931 44.000 0.00 0.00 38.94 3.69
4035 6893 4.800023 TGGGAAATACGATGAGTAGGAGA 58.200 43.478 0.00 0.00 38.94 3.71
4036 6894 5.394738 TGGGAAATACGATGAGTAGGAGAT 58.605 41.667 0.00 0.00 38.94 2.75
4037 6895 6.549242 TGGGAAATACGATGAGTAGGAGATA 58.451 40.000 0.00 0.00 38.94 1.98
4038 6896 6.659668 TGGGAAATACGATGAGTAGGAGATAG 59.340 42.308 0.00 0.00 38.94 2.08
4039 6897 6.885376 GGGAAATACGATGAGTAGGAGATAGA 59.115 42.308 0.00 0.00 38.94 1.98
4040 6898 7.558444 GGGAAATACGATGAGTAGGAGATAGAT 59.442 40.741 0.00 0.00 38.94 1.98
4041 6899 8.962679 GGAAATACGATGAGTAGGAGATAGATT 58.037 37.037 0.00 0.00 38.94 2.40
4046 6904 6.821665 ACGATGAGTAGGAGATAGATTAGAGC 59.178 42.308 0.00 0.00 0.00 4.09
4047 6905 6.821160 CGATGAGTAGGAGATAGATTAGAGCA 59.179 42.308 0.00 0.00 0.00 4.26
4048 6906 7.201609 CGATGAGTAGGAGATAGATTAGAGCAC 60.202 44.444 0.00 0.00 0.00 4.40
4049 6907 5.935206 TGAGTAGGAGATAGATTAGAGCACG 59.065 44.000 0.00 0.00 0.00 5.34
4050 6908 5.250200 AGTAGGAGATAGATTAGAGCACGG 58.750 45.833 0.00 0.00 0.00 4.94
4051 6909 3.426615 AGGAGATAGATTAGAGCACGGG 58.573 50.000 0.00 0.00 0.00 5.28
4052 6910 2.094442 GGAGATAGATTAGAGCACGGGC 60.094 54.545 0.00 0.00 41.61 6.13
4053 6911 2.558795 GAGATAGATTAGAGCACGGGCA 59.441 50.000 14.57 0.00 44.61 5.36
4054 6912 2.965831 AGATAGATTAGAGCACGGGCAA 59.034 45.455 14.57 0.00 44.61 4.52
4055 6913 3.580458 AGATAGATTAGAGCACGGGCAAT 59.420 43.478 14.57 1.98 44.61 3.56
4056 6914 2.246719 AGATTAGAGCACGGGCAATC 57.753 50.000 14.57 13.01 44.61 2.67
4057 6915 1.765314 AGATTAGAGCACGGGCAATCT 59.235 47.619 14.57 15.33 44.61 2.40
4058 6916 2.965831 AGATTAGAGCACGGGCAATCTA 59.034 45.455 19.00 12.44 44.61 1.98
4059 6917 3.580458 AGATTAGAGCACGGGCAATCTAT 59.420 43.478 19.00 6.33 44.61 1.98
4060 6918 4.772624 AGATTAGAGCACGGGCAATCTATA 59.227 41.667 19.00 7.36 44.61 1.31
4061 6919 5.423610 AGATTAGAGCACGGGCAATCTATAT 59.576 40.000 19.00 10.95 44.61 0.86
4062 6920 6.607600 AGATTAGAGCACGGGCAATCTATATA 59.392 38.462 19.00 2.27 44.61 0.86
4063 6921 6.791867 TTAGAGCACGGGCAATCTATATAT 57.208 37.500 14.57 0.00 44.61 0.86
4064 6922 7.891498 TTAGAGCACGGGCAATCTATATATA 57.109 36.000 14.57 0.00 44.61 0.86
4065 6923 6.791867 AGAGCACGGGCAATCTATATATAA 57.208 37.500 14.57 0.00 44.61 0.98
4066 6924 7.182817 AGAGCACGGGCAATCTATATATAAA 57.817 36.000 14.57 0.00 44.61 1.40
4067 6925 7.620880 AGAGCACGGGCAATCTATATATAAAA 58.379 34.615 14.57 0.00 44.61 1.52
4068 6926 7.766278 AGAGCACGGGCAATCTATATATAAAAG 59.234 37.037 14.57 0.00 44.61 2.27
4069 6927 6.823689 AGCACGGGCAATCTATATATAAAAGG 59.176 38.462 14.57 0.00 44.61 3.11
4070 6928 6.038271 GCACGGGCAATCTATATATAAAAGGG 59.962 42.308 3.77 0.00 40.72 3.95
4071 6929 7.335627 CACGGGCAATCTATATATAAAAGGGA 58.664 38.462 0.00 0.00 0.00 4.20
4072 6930 7.495934 CACGGGCAATCTATATATAAAAGGGAG 59.504 40.741 0.00 0.00 0.00 4.30
4073 6931 6.483640 CGGGCAATCTATATATAAAAGGGAGC 59.516 42.308 0.00 0.00 0.00 4.70
4074 6932 6.773200 GGGCAATCTATATATAAAAGGGAGCC 59.227 42.308 0.00 0.00 0.00 4.70
4075 6933 6.773200 GGCAATCTATATATAAAAGGGAGCCC 59.227 42.308 0.00 0.00 0.00 5.19
4076 6934 6.773200 GCAATCTATATATAAAAGGGAGCCCC 59.227 42.308 0.91 2.16 45.90 5.80
4085 6943 4.315349 GGGAGCCCCTAAGGTAGG 57.685 66.667 3.16 0.00 45.81 3.18
4098 6956 6.477053 CCTAAGGTAGGGGAACTAAGTTAC 57.523 45.833 0.00 0.00 42.42 2.50
4099 6957 5.960202 CCTAAGGTAGGGGAACTAAGTTACA 59.040 44.000 0.00 0.00 42.42 2.41
4100 6958 6.441604 CCTAAGGTAGGGGAACTAAGTTACAA 59.558 42.308 0.00 0.00 42.42 2.41
4101 6959 6.370186 AAGGTAGGGGAACTAAGTTACAAG 57.630 41.667 0.00 0.00 32.37 3.16
4102 6960 4.224594 AGGTAGGGGAACTAAGTTACAAGC 59.775 45.833 0.00 0.00 32.37 4.01
4103 6961 4.224594 GGTAGGGGAACTAAGTTACAAGCT 59.775 45.833 0.00 0.00 32.37 3.74
4104 6962 4.554960 AGGGGAACTAAGTTACAAGCTC 57.445 45.455 0.00 0.00 0.00 4.09
4105 6963 4.168883 AGGGGAACTAAGTTACAAGCTCT 58.831 43.478 0.00 0.00 0.00 4.09
4106 6964 4.223255 AGGGGAACTAAGTTACAAGCTCTC 59.777 45.833 0.00 0.00 0.00 3.20
4107 6965 4.174762 GGGAACTAAGTTACAAGCTCTCG 58.825 47.826 0.00 0.00 0.00 4.04
4108 6966 4.082354 GGGAACTAAGTTACAAGCTCTCGA 60.082 45.833 0.00 0.00 0.00 4.04
4109 6967 5.096849 GGAACTAAGTTACAAGCTCTCGAG 58.903 45.833 5.93 5.93 0.00 4.04
4110 6968 5.335819 GGAACTAAGTTACAAGCTCTCGAGT 60.336 44.000 13.13 0.00 0.00 4.18
4111 6969 6.128063 GGAACTAAGTTACAAGCTCTCGAGTA 60.128 42.308 13.13 0.00 0.00 2.59
4112 6970 6.180771 ACTAAGTTACAAGCTCTCGAGTAC 57.819 41.667 13.13 5.82 0.00 2.73
4113 6971 5.939296 ACTAAGTTACAAGCTCTCGAGTACT 59.061 40.000 13.13 8.22 0.00 2.73
4114 6972 7.102346 ACTAAGTTACAAGCTCTCGAGTACTA 58.898 38.462 13.13 0.00 0.00 1.82
4115 6973 6.425577 AAGTTACAAGCTCTCGAGTACTAG 57.574 41.667 13.13 3.22 0.00 2.57
4116 6974 4.877251 AGTTACAAGCTCTCGAGTACTAGG 59.123 45.833 13.13 9.30 0.00 3.02
4117 6975 3.353370 ACAAGCTCTCGAGTACTAGGT 57.647 47.619 13.13 4.97 0.00 3.08
4118 6976 3.688235 ACAAGCTCTCGAGTACTAGGTT 58.312 45.455 13.13 11.12 0.00 3.50
4119 6977 4.841422 ACAAGCTCTCGAGTACTAGGTTA 58.159 43.478 13.13 0.00 0.00 2.85
4120 6978 4.877251 ACAAGCTCTCGAGTACTAGGTTAG 59.123 45.833 13.13 10.71 0.00 2.34
4121 6979 3.469739 AGCTCTCGAGTACTAGGTTAGC 58.530 50.000 13.13 10.42 0.00 3.09
4122 6980 3.135167 AGCTCTCGAGTACTAGGTTAGCT 59.865 47.826 13.13 12.61 33.16 3.32
4123 6981 4.344679 AGCTCTCGAGTACTAGGTTAGCTA 59.655 45.833 15.41 0.00 36.10 3.32
4124 6982 5.055812 GCTCTCGAGTACTAGGTTAGCTAA 58.944 45.833 13.13 0.86 0.00 3.09
4125 6983 5.178067 GCTCTCGAGTACTAGGTTAGCTAAG 59.822 48.000 13.13 0.00 0.00 2.18
4126 6984 6.232581 TCTCGAGTACTAGGTTAGCTAAGT 57.767 41.667 13.13 3.62 0.00 2.24
4127 6985 6.279882 TCTCGAGTACTAGGTTAGCTAAGTC 58.720 44.000 13.13 2.52 0.00 3.01
4128 6986 5.046529 TCGAGTACTAGGTTAGCTAAGTCG 58.953 45.833 6.38 8.22 33.82 4.18
4129 6987 4.318689 CGAGTACTAGGTTAGCTAAGTCGC 60.319 50.000 6.38 0.00 0.00 5.19
4130 6988 4.521146 AGTACTAGGTTAGCTAAGTCGCA 58.479 43.478 6.38 0.00 0.00 5.10
4131 6989 3.779271 ACTAGGTTAGCTAAGTCGCAC 57.221 47.619 6.38 0.00 0.00 5.34
4132 6990 2.426381 ACTAGGTTAGCTAAGTCGCACC 59.574 50.000 6.38 4.04 0.00 5.01
4133 6991 0.535797 AGGTTAGCTAAGTCGCACCC 59.464 55.000 6.38 2.60 28.92 4.61
4134 6992 0.535797 GGTTAGCTAAGTCGCACCCT 59.464 55.000 6.38 0.00 0.00 4.34
4135 6993 1.066358 GGTTAGCTAAGTCGCACCCTT 60.066 52.381 6.38 0.00 0.00 3.95
4136 6994 2.000447 GTTAGCTAAGTCGCACCCTTG 59.000 52.381 6.38 0.00 0.00 3.61
4137 6995 1.263356 TAGCTAAGTCGCACCCTTGT 58.737 50.000 0.00 0.00 0.00 3.16
4138 6996 1.263356 AGCTAAGTCGCACCCTTGTA 58.737 50.000 0.00 0.00 0.00 2.41
4139 6997 1.621814 AGCTAAGTCGCACCCTTGTAA 59.378 47.619 0.00 0.00 0.00 2.41
4140 6998 2.236395 AGCTAAGTCGCACCCTTGTAAT 59.764 45.455 0.00 0.00 0.00 1.89
4141 6999 2.608090 GCTAAGTCGCACCCTTGTAATC 59.392 50.000 0.00 0.00 0.00 1.75
4142 7000 1.722011 AAGTCGCACCCTTGTAATCG 58.278 50.000 0.00 0.00 0.00 3.34
4143 7001 0.892755 AGTCGCACCCTTGTAATCGA 59.107 50.000 0.00 0.00 0.00 3.59
4144 7002 1.274167 AGTCGCACCCTTGTAATCGAA 59.726 47.619 0.00 0.00 0.00 3.71
4145 7003 2.070783 GTCGCACCCTTGTAATCGAAA 58.929 47.619 0.00 0.00 0.00 3.46
4146 7004 2.676342 GTCGCACCCTTGTAATCGAAAT 59.324 45.455 0.00 0.00 0.00 2.17
4147 7005 2.933906 TCGCACCCTTGTAATCGAAATC 59.066 45.455 0.00 0.00 0.00 2.17
4148 7006 2.675844 CGCACCCTTGTAATCGAAATCA 59.324 45.455 0.00 0.00 0.00 2.57
4149 7007 3.485216 CGCACCCTTGTAATCGAAATCAC 60.485 47.826 0.00 0.00 0.00 3.06
4150 7008 3.438781 GCACCCTTGTAATCGAAATCACA 59.561 43.478 0.00 0.00 0.00 3.58
4151 7009 4.083003 GCACCCTTGTAATCGAAATCACAA 60.083 41.667 0.00 0.00 0.00 3.33
4152 7010 5.393027 GCACCCTTGTAATCGAAATCACAAT 60.393 40.000 0.00 0.00 31.01 2.71
4153 7011 6.258160 CACCCTTGTAATCGAAATCACAATC 58.742 40.000 0.00 0.00 31.01 2.67
4154 7012 5.943416 ACCCTTGTAATCGAAATCACAATCA 59.057 36.000 0.00 0.00 31.01 2.57
4155 7013 6.432783 ACCCTTGTAATCGAAATCACAATCAA 59.567 34.615 0.00 0.00 31.01 2.57
4156 7014 7.122650 ACCCTTGTAATCGAAATCACAATCAAT 59.877 33.333 0.00 0.00 31.01 2.57
4157 7015 8.620416 CCCTTGTAATCGAAATCACAATCAATA 58.380 33.333 0.00 0.00 31.01 1.90
4158 7016 9.655769 CCTTGTAATCGAAATCACAATCAATAG 57.344 33.333 0.00 0.00 31.01 1.73
4159 7017 9.162793 CTTGTAATCGAAATCACAATCAATAGC 57.837 33.333 0.00 0.00 31.01 2.97
4160 7018 8.207521 TGTAATCGAAATCACAATCAATAGCA 57.792 30.769 0.00 0.00 0.00 3.49
4161 7019 8.672815 TGTAATCGAAATCACAATCAATAGCAA 58.327 29.630 0.00 0.00 0.00 3.91
4162 7020 9.502145 GTAATCGAAATCACAATCAATAGCAAA 57.498 29.630 0.00 0.00 0.00 3.68
4163 7021 7.975866 ATCGAAATCACAATCAATAGCAAAC 57.024 32.000 0.00 0.00 0.00 2.93
4164 7022 6.907741 TCGAAATCACAATCAATAGCAAACA 58.092 32.000 0.00 0.00 0.00 2.83
4165 7023 7.366513 TCGAAATCACAATCAATAGCAAACAA 58.633 30.769 0.00 0.00 0.00 2.83
4166 7024 7.864882 TCGAAATCACAATCAATAGCAAACAAA 59.135 29.630 0.00 0.00 0.00 2.83
4167 7025 8.157813 CGAAATCACAATCAATAGCAAACAAAG 58.842 33.333 0.00 0.00 0.00 2.77
4168 7026 6.956299 ATCACAATCAATAGCAAACAAAGC 57.044 33.333 0.00 0.00 0.00 3.51
4169 7027 5.840715 TCACAATCAATAGCAAACAAAGCA 58.159 33.333 0.00 0.00 0.00 3.91
4170 7028 5.921976 TCACAATCAATAGCAAACAAAGCAG 59.078 36.000 0.00 0.00 0.00 4.24
4171 7029 5.119588 CACAATCAATAGCAAACAAAGCAGG 59.880 40.000 0.00 0.00 0.00 4.85
4172 7030 5.010922 ACAATCAATAGCAAACAAAGCAGGA 59.989 36.000 0.00 0.00 0.00 3.86
4173 7031 4.503741 TCAATAGCAAACAAAGCAGGAC 57.496 40.909 0.00 0.00 0.00 3.85
4174 7032 3.058293 TCAATAGCAAACAAAGCAGGACG 60.058 43.478 0.00 0.00 0.00 4.79
4175 7033 1.961793 TAGCAAACAAAGCAGGACGT 58.038 45.000 0.00 0.00 0.00 4.34
4176 7034 1.961793 AGCAAACAAAGCAGGACGTA 58.038 45.000 0.00 0.00 0.00 3.57
4177 7035 2.504367 AGCAAACAAAGCAGGACGTAT 58.496 42.857 0.00 0.00 0.00 3.06
4178 7036 2.226437 AGCAAACAAAGCAGGACGTATG 59.774 45.455 0.00 0.00 0.00 2.39
4179 7037 2.584791 CAAACAAAGCAGGACGTATGC 58.415 47.619 15.54 15.54 44.18 3.14
4187 7045 3.662247 GCAGGACGTATGCTATTACCT 57.338 47.619 15.93 0.00 40.59 3.08
4188 7046 3.576648 GCAGGACGTATGCTATTACCTC 58.423 50.000 15.93 0.00 40.59 3.85
4189 7047 3.822996 CAGGACGTATGCTATTACCTCG 58.177 50.000 0.00 0.00 0.00 4.63
4190 7048 3.501062 CAGGACGTATGCTATTACCTCGA 59.499 47.826 0.00 0.00 0.00 4.04
4191 7049 4.156190 CAGGACGTATGCTATTACCTCGAT 59.844 45.833 0.00 0.00 0.00 3.59
4192 7050 4.395542 AGGACGTATGCTATTACCTCGATC 59.604 45.833 0.00 0.00 0.00 3.69
4193 7051 4.332788 GACGTATGCTATTACCTCGATCG 58.667 47.826 9.36 9.36 0.00 3.69
4194 7052 3.750130 ACGTATGCTATTACCTCGATCGT 59.250 43.478 15.94 0.00 0.00 3.73
4195 7053 4.931601 ACGTATGCTATTACCTCGATCGTA 59.068 41.667 15.94 0.00 0.00 3.43
4196 7054 5.409520 ACGTATGCTATTACCTCGATCGTAA 59.590 40.000 15.94 7.06 0.00 3.18
4197 7055 5.958372 CGTATGCTATTACCTCGATCGTAAG 59.042 44.000 15.94 5.89 0.00 2.34
4198 7056 4.761235 TGCTATTACCTCGATCGTAAGG 57.239 45.455 18.60 18.60 38.70 2.69
4199 7057 3.504906 TGCTATTACCTCGATCGTAAGGG 59.495 47.826 22.66 18.06 36.95 3.95
4200 7058 3.119566 GCTATTACCTCGATCGTAAGGGG 60.120 52.174 22.66 16.10 36.95 4.79
4201 7059 1.035139 TTACCTCGATCGTAAGGGGC 58.965 55.000 22.66 0.00 36.95 5.80
4202 7060 0.825010 TACCTCGATCGTAAGGGGCC 60.825 60.000 22.66 0.00 36.95 5.80
4203 7061 2.335369 CTCGATCGTAAGGGGCCG 59.665 66.667 15.94 0.00 38.47 6.13
4204 7062 2.124193 TCGATCGTAAGGGGCCGA 60.124 61.111 15.94 0.00 37.51 5.54
4205 7063 1.731433 CTCGATCGTAAGGGGCCGAA 61.731 60.000 15.94 0.00 36.57 4.30
4206 7064 1.590792 CGATCGTAAGGGGCCGAAC 60.591 63.158 7.03 0.00 36.57 3.95
4207 7065 1.227468 GATCGTAAGGGGCCGAACC 60.227 63.158 0.00 0.00 36.57 3.62
4208 7066 1.683418 GATCGTAAGGGGCCGAACCT 61.683 60.000 0.00 0.00 40.96 3.50
4209 7067 1.968050 ATCGTAAGGGGCCGAACCTG 61.968 60.000 0.00 0.00 38.63 4.00
4210 7068 2.271173 GTAAGGGGCCGAACCTGG 59.729 66.667 0.00 0.00 38.63 4.45
4211 7069 2.204029 TAAGGGGCCGAACCTGGT 60.204 61.111 0.00 0.00 38.63 4.00
4212 7070 1.080722 TAAGGGGCCGAACCTGGTA 59.919 57.895 0.00 0.00 38.63 3.25
4213 7071 0.547229 TAAGGGGCCGAACCTGGTAA 60.547 55.000 0.00 0.00 38.63 2.85
4214 7072 1.428718 AAGGGGCCGAACCTGGTAAA 61.429 55.000 0.00 0.00 38.63 2.01
4215 7073 1.676635 GGGGCCGAACCTGGTAAAC 60.677 63.158 0.00 0.00 39.10 2.01
4216 7074 1.377612 GGGCCGAACCTGGTAAACT 59.622 57.895 0.00 0.00 39.10 2.66
4217 7075 0.675837 GGGCCGAACCTGGTAAACTC 60.676 60.000 0.00 0.00 39.10 3.01
4218 7076 0.323957 GGCCGAACCTGGTAAACTCT 59.676 55.000 0.00 0.00 34.51 3.24
4219 7077 1.675116 GGCCGAACCTGGTAAACTCTC 60.675 57.143 0.00 0.00 34.51 3.20
4220 7078 1.001633 GCCGAACCTGGTAAACTCTCA 59.998 52.381 0.00 0.00 0.00 3.27
4221 7079 2.354805 GCCGAACCTGGTAAACTCTCAT 60.355 50.000 0.00 0.00 0.00 2.90
4222 7080 3.522553 CCGAACCTGGTAAACTCTCATC 58.477 50.000 0.00 0.00 0.00 2.92
4223 7081 3.195825 CCGAACCTGGTAAACTCTCATCT 59.804 47.826 0.00 0.00 0.00 2.90
4224 7082 4.425520 CGAACCTGGTAAACTCTCATCTC 58.574 47.826 0.00 0.00 0.00 2.75
4225 7083 4.158764 CGAACCTGGTAAACTCTCATCTCT 59.841 45.833 0.00 0.00 0.00 3.10
4226 7084 5.656480 GAACCTGGTAAACTCTCATCTCTC 58.344 45.833 0.00 0.00 0.00 3.20
4227 7085 3.697045 ACCTGGTAAACTCTCATCTCTCG 59.303 47.826 0.00 0.00 0.00 4.04
4228 7086 3.948473 CCTGGTAAACTCTCATCTCTCGA 59.052 47.826 0.00 0.00 0.00 4.04
4229 7087 4.582656 CCTGGTAAACTCTCATCTCTCGAT 59.417 45.833 0.00 0.00 0.00 3.59
4230 7088 5.068460 CCTGGTAAACTCTCATCTCTCGATT 59.932 44.000 0.00 0.00 0.00 3.34
4231 7089 6.137794 TGGTAAACTCTCATCTCTCGATTC 57.862 41.667 0.00 0.00 0.00 2.52
4232 7090 5.652452 TGGTAAACTCTCATCTCTCGATTCA 59.348 40.000 0.00 0.00 0.00 2.57
4233 7091 6.183360 TGGTAAACTCTCATCTCTCGATTCAG 60.183 42.308 0.00 0.00 0.00 3.02
4234 7092 6.038825 GGTAAACTCTCATCTCTCGATTCAGA 59.961 42.308 0.00 0.00 0.00 3.27
4235 7093 6.713762 AAACTCTCATCTCTCGATTCAGAT 57.286 37.500 0.00 0.00 0.00 2.90
4236 7094 5.947228 ACTCTCATCTCTCGATTCAGATC 57.053 43.478 0.00 0.00 0.00 2.75
4237 7095 5.375773 ACTCTCATCTCTCGATTCAGATCA 58.624 41.667 0.00 0.00 32.33 2.92
4238 7096 5.827267 ACTCTCATCTCTCGATTCAGATCAA 59.173 40.000 0.00 0.00 32.33 2.57
4239 7097 6.070897 TCTCATCTCTCGATTCAGATCAAC 57.929 41.667 0.00 0.00 32.33 3.18
4240 7098 5.009510 TCTCATCTCTCGATTCAGATCAACC 59.990 44.000 0.00 0.00 32.33 3.77
4241 7099 4.892345 TCATCTCTCGATTCAGATCAACCT 59.108 41.667 0.00 0.00 32.33 3.50
4242 7100 4.909696 TCTCTCGATTCAGATCAACCTC 57.090 45.455 0.00 0.00 32.33 3.85
4243 7101 4.273318 TCTCTCGATTCAGATCAACCTCA 58.727 43.478 0.00 0.00 32.33 3.86
4244 7102 4.892345 TCTCTCGATTCAGATCAACCTCAT 59.108 41.667 0.00 0.00 32.33 2.90
4245 7103 5.362143 TCTCTCGATTCAGATCAACCTCATT 59.638 40.000 0.00 0.00 32.33 2.57
4246 7104 5.595885 TCTCGATTCAGATCAACCTCATTC 58.404 41.667 0.00 0.00 32.33 2.67
4247 7105 5.127682 TCTCGATTCAGATCAACCTCATTCA 59.872 40.000 0.00 0.00 32.33 2.57
4248 7106 5.733676 TCGATTCAGATCAACCTCATTCAA 58.266 37.500 0.00 0.00 32.33 2.69
4249 7107 5.814188 TCGATTCAGATCAACCTCATTCAAG 59.186 40.000 0.00 0.00 32.33 3.02
4250 7108 5.503683 CGATTCAGATCAACCTCATTCAAGC 60.504 44.000 0.00 0.00 32.33 4.01
4251 7109 4.564782 TCAGATCAACCTCATTCAAGCT 57.435 40.909 0.00 0.00 0.00 3.74
4252 7110 5.682234 TCAGATCAACCTCATTCAAGCTA 57.318 39.130 0.00 0.00 0.00 3.32
4253 7111 5.423015 TCAGATCAACCTCATTCAAGCTAC 58.577 41.667 0.00 0.00 0.00 3.58
4254 7112 4.574013 CAGATCAACCTCATTCAAGCTACC 59.426 45.833 0.00 0.00 0.00 3.18
4255 7113 2.972625 TCAACCTCATTCAAGCTACCG 58.027 47.619 0.00 0.00 0.00 4.02
4256 7114 1.398390 CAACCTCATTCAAGCTACCGC 59.602 52.381 0.00 0.00 0.00 5.68
4272 7130 2.203126 GCTTAGCTGCGATGGCCT 60.203 61.111 3.32 0.00 38.85 5.19
4273 7131 1.821332 GCTTAGCTGCGATGGCCTT 60.821 57.895 3.32 0.00 38.85 4.35
4274 7132 0.532862 GCTTAGCTGCGATGGCCTTA 60.533 55.000 3.32 0.00 38.85 2.69
4275 7133 1.221414 CTTAGCTGCGATGGCCTTAC 58.779 55.000 3.32 0.00 38.85 2.34
4276 7134 0.529773 TTAGCTGCGATGGCCTTACG 60.530 55.000 3.32 8.39 38.85 3.18
4277 7135 1.388837 TAGCTGCGATGGCCTTACGA 61.389 55.000 17.64 0.00 38.85 3.43
4278 7136 2.526120 GCTGCGATGGCCTTACGAC 61.526 63.158 17.64 10.77 38.85 4.34
4279 7137 1.141881 CTGCGATGGCCTTACGACT 59.858 57.895 17.64 0.00 38.85 4.18
4280 7138 0.384309 CTGCGATGGCCTTACGACTA 59.616 55.000 17.64 5.33 38.85 2.59
4281 7139 0.818938 TGCGATGGCCTTACGACTAA 59.181 50.000 17.64 0.00 38.85 2.24
4282 7140 1.202371 TGCGATGGCCTTACGACTAAG 60.202 52.381 17.64 0.00 38.85 2.18
4283 7141 1.202382 GCGATGGCCTTACGACTAAGT 60.202 52.381 17.64 0.00 0.00 2.24
4284 7142 2.728922 CGATGGCCTTACGACTAAGTC 58.271 52.381 3.32 0.00 0.00 3.01
4285 7143 2.543238 CGATGGCCTTACGACTAAGTCC 60.543 54.545 3.32 0.00 29.81 3.85
4286 7144 2.226962 TGGCCTTACGACTAAGTCCT 57.773 50.000 3.32 0.00 30.41 3.85
4287 7145 2.532843 TGGCCTTACGACTAAGTCCTT 58.467 47.619 3.32 0.00 30.41 3.36
4288 7146 2.901839 TGGCCTTACGACTAAGTCCTTT 59.098 45.455 3.32 0.00 30.41 3.11
4289 7147 3.325716 TGGCCTTACGACTAAGTCCTTTT 59.674 43.478 3.32 0.00 30.41 2.27
4290 7148 4.202388 TGGCCTTACGACTAAGTCCTTTTT 60.202 41.667 3.32 0.00 30.41 1.94
4291 7149 4.391216 GGCCTTACGACTAAGTCCTTTTTC 59.609 45.833 0.00 0.00 27.03 2.29
4292 7150 4.992951 GCCTTACGACTAAGTCCTTTTTCA 59.007 41.667 0.00 0.00 0.00 2.69
4293 7151 5.467735 GCCTTACGACTAAGTCCTTTTTCAA 59.532 40.000 0.00 0.00 0.00 2.69
4294 7152 6.347483 GCCTTACGACTAAGTCCTTTTTCAAG 60.347 42.308 0.00 0.00 0.00 3.02
4306 7164 4.796038 CTTTTTCAAGGACATCTGCCAT 57.204 40.909 0.00 0.00 0.00 4.40
4307 7165 4.491676 CTTTTTCAAGGACATCTGCCATG 58.508 43.478 0.00 0.00 0.00 3.66
4308 7166 3.438216 TTTCAAGGACATCTGCCATGA 57.562 42.857 0.00 0.00 31.86 3.07
4309 7167 2.408271 TCAAGGACATCTGCCATGAC 57.592 50.000 0.00 0.00 29.01 3.06
4310 7168 1.629861 TCAAGGACATCTGCCATGACA 59.370 47.619 0.00 0.00 29.01 3.58
4311 7169 2.040145 TCAAGGACATCTGCCATGACAA 59.960 45.455 0.00 0.00 29.01 3.18
4312 7170 2.821378 CAAGGACATCTGCCATGACAAA 59.179 45.455 0.00 0.00 0.00 2.83
4313 7171 3.159213 AGGACATCTGCCATGACAAAA 57.841 42.857 0.00 0.00 0.00 2.44
4314 7172 3.705051 AGGACATCTGCCATGACAAAAT 58.295 40.909 0.00 0.00 0.00 1.82
4315 7173 3.698040 AGGACATCTGCCATGACAAAATC 59.302 43.478 0.00 0.00 0.00 2.17
4316 7174 3.444742 GGACATCTGCCATGACAAAATCA 59.555 43.478 0.00 0.00 43.13 2.57
4331 7189 9.630098 ATGACAAAATCATGACACTAAATGAAC 57.370 29.630 0.00 0.00 46.85 3.18
4332 7190 8.849168 TGACAAAATCATGACACTAAATGAACT 58.151 29.630 0.00 0.00 36.44 3.01
4356 7214 9.561069 ACTAGTTACAAATCAAACTTGACATCT 57.439 29.630 0.00 0.00 40.49 2.90
4417 7276 9.442047 AGAAATATATATGTGCTAAAGTGAGCC 57.558 33.333 0.00 0.00 42.11 4.70
4418 7277 9.442047 GAAATATATATGTGCTAAAGTGAGCCT 57.558 33.333 0.00 0.00 42.11 4.58
4419 7278 8.783833 AATATATATGTGCTAAAGTGAGCCTG 57.216 34.615 0.00 0.00 42.11 4.85
4420 7279 4.760530 ATATGTGCTAAAGTGAGCCTGA 57.239 40.909 0.00 0.00 42.11 3.86
4421 7280 2.462456 TGTGCTAAAGTGAGCCTGAG 57.538 50.000 0.00 0.00 42.11 3.35
4422 7281 1.082690 GTGCTAAAGTGAGCCTGAGC 58.917 55.000 0.00 0.00 42.11 4.26
4423 7282 0.686789 TGCTAAAGTGAGCCTGAGCA 59.313 50.000 0.00 0.00 42.11 4.26
4424 7283 1.082690 GCTAAAGTGAGCCTGAGCAC 58.917 55.000 0.00 0.00 43.56 4.40
4425 7284 1.609061 GCTAAAGTGAGCCTGAGCACA 60.609 52.381 0.00 0.00 43.56 4.57
4426 7285 2.938756 GCTAAAGTGAGCCTGAGCACAT 60.939 50.000 0.00 0.00 41.77 3.21
4427 7286 2.283145 AAAGTGAGCCTGAGCACATT 57.717 45.000 0.00 0.00 41.77 2.71
4428 7287 1.531423 AAGTGAGCCTGAGCACATTG 58.469 50.000 0.00 0.00 41.77 2.82
4429 7288 0.399454 AGTGAGCCTGAGCACATTGT 59.601 50.000 0.00 0.00 41.77 2.71
4430 7289 1.625315 AGTGAGCCTGAGCACATTGTA 59.375 47.619 0.00 0.00 41.77 2.41
4431 7290 1.734465 GTGAGCCTGAGCACATTGTAC 59.266 52.381 0.00 0.00 41.77 2.90
4432 7291 1.625315 TGAGCCTGAGCACATTGTACT 59.375 47.619 0.00 0.00 43.56 2.73
4433 7292 2.038952 TGAGCCTGAGCACATTGTACTT 59.961 45.455 0.00 0.00 43.56 2.24
4434 7293 3.260632 TGAGCCTGAGCACATTGTACTTA 59.739 43.478 0.00 0.00 43.56 2.24
4435 7294 4.080919 TGAGCCTGAGCACATTGTACTTAT 60.081 41.667 0.00 0.00 43.56 1.73
4436 7295 4.446371 AGCCTGAGCACATTGTACTTATC 58.554 43.478 0.00 0.00 43.56 1.75
4437 7296 3.246226 GCCTGAGCACATTGTACTTATCG 59.754 47.826 0.00 0.00 39.53 2.92
4438 7297 3.246226 CCTGAGCACATTGTACTTATCGC 59.754 47.826 0.00 0.00 0.00 4.58
4439 7298 3.855858 TGAGCACATTGTACTTATCGCA 58.144 40.909 0.00 0.00 0.00 5.10
4440 7299 3.616821 TGAGCACATTGTACTTATCGCAC 59.383 43.478 0.00 0.00 0.00 5.34
4441 7300 3.861840 AGCACATTGTACTTATCGCACT 58.138 40.909 0.00 0.00 0.00 4.40
4442 7301 3.865745 AGCACATTGTACTTATCGCACTC 59.134 43.478 0.00 0.00 0.00 3.51
4443 7302 3.865745 GCACATTGTACTTATCGCACTCT 59.134 43.478 0.00 0.00 0.00 3.24
4444 7303 4.026475 GCACATTGTACTTATCGCACTCTC 60.026 45.833 0.00 0.00 0.00 3.20
4445 7304 4.504461 CACATTGTACTTATCGCACTCTCC 59.496 45.833 0.00 0.00 0.00 3.71
4446 7305 3.416119 TTGTACTTATCGCACTCTCCG 57.584 47.619 0.00 0.00 0.00 4.63
4447 7306 1.674441 TGTACTTATCGCACTCTCCGG 59.326 52.381 0.00 0.00 0.00 5.14
4448 7307 0.666913 TACTTATCGCACTCTCCGGC 59.333 55.000 0.00 0.00 0.00 6.13
4449 7308 1.300233 CTTATCGCACTCTCCGGCC 60.300 63.158 0.00 0.00 0.00 6.13
4450 7309 2.016393 CTTATCGCACTCTCCGGCCA 62.016 60.000 2.24 0.00 0.00 5.36
4451 7310 1.609635 TTATCGCACTCTCCGGCCAA 61.610 55.000 2.24 0.00 0.00 4.52
4452 7311 2.292794 TATCGCACTCTCCGGCCAAC 62.293 60.000 2.24 0.00 0.00 3.77
4454 7313 4.329545 GCACTCTCCGGCCAACCA 62.330 66.667 2.24 0.00 34.57 3.67
4455 7314 2.358737 CACTCTCCGGCCAACCAC 60.359 66.667 2.24 0.00 34.57 4.16
4456 7315 2.847234 ACTCTCCGGCCAACCACA 60.847 61.111 2.24 0.00 34.57 4.17
4457 7316 2.046892 CTCTCCGGCCAACCACAG 60.047 66.667 2.24 0.00 34.57 3.66
4458 7317 2.525629 TCTCCGGCCAACCACAGA 60.526 61.111 2.24 0.00 34.57 3.41
4459 7318 1.903877 CTCTCCGGCCAACCACAGAT 61.904 60.000 2.24 0.00 34.57 2.90
4460 7319 1.450312 CTCCGGCCAACCACAGATC 60.450 63.158 2.24 0.00 34.57 2.75
4461 7320 2.819595 CCGGCCAACCACAGATCG 60.820 66.667 2.24 0.00 34.57 3.69
4462 7321 2.047274 CGGCCAACCACAGATCGT 60.047 61.111 2.24 0.00 34.57 3.73
4463 7322 2.390599 CGGCCAACCACAGATCGTG 61.391 63.158 2.24 9.75 45.92 4.35
4464 7323 2.690778 GGCCAACCACAGATCGTGC 61.691 63.158 0.00 1.84 44.91 5.34
4465 7324 3.027170 GCCAACCACAGATCGTGCG 62.027 63.158 10.87 7.83 44.91 5.34
4466 7325 2.476051 CAACCACAGATCGTGCGC 59.524 61.111 0.00 0.00 44.91 6.09
4467 7326 3.112075 AACCACAGATCGTGCGCG 61.112 61.111 14.79 14.79 44.91 6.86
4474 7333 4.266070 GATCGTGCGCGCCCTCTA 62.266 66.667 30.77 6.23 38.14 2.43
4475 7334 3.768185 GATCGTGCGCGCCCTCTAA 62.768 63.158 30.77 5.30 38.14 2.10
4476 7335 3.151958 ATCGTGCGCGCCCTCTAAT 62.152 57.895 30.77 10.55 38.14 1.73
4477 7336 2.644555 ATCGTGCGCGCCCTCTAATT 62.645 55.000 30.77 1.88 38.14 1.40
4478 7337 2.461110 CGTGCGCGCCCTCTAATTT 61.461 57.895 30.77 0.00 0.00 1.82
4479 7338 1.149361 CGTGCGCGCCCTCTAATTTA 61.149 55.000 30.77 1.61 0.00 1.40
4480 7339 0.303796 GTGCGCGCCCTCTAATTTAC 59.696 55.000 30.77 12.14 0.00 2.01
4481 7340 0.812412 TGCGCGCCCTCTAATTTACC 60.812 55.000 30.77 0.00 0.00 2.85
4482 7341 1.504647 GCGCGCCCTCTAATTTACCC 61.505 60.000 23.24 0.00 0.00 3.69
4483 7342 0.106149 CGCGCCCTCTAATTTACCCT 59.894 55.000 0.00 0.00 0.00 4.34
4484 7343 1.594331 GCGCCCTCTAATTTACCCTG 58.406 55.000 0.00 0.00 0.00 4.45
4485 7344 1.814248 GCGCCCTCTAATTTACCCTGG 60.814 57.143 0.00 0.00 0.00 4.45
4486 7345 1.814248 CGCCCTCTAATTTACCCTGGC 60.814 57.143 0.00 0.00 0.00 4.85
4487 7346 1.214424 GCCCTCTAATTTACCCTGGCA 59.786 52.381 0.00 0.00 37.58 4.92
4488 7347 2.749800 GCCCTCTAATTTACCCTGGCAG 60.750 54.545 7.75 7.75 37.58 4.85
4489 7348 2.158608 CCCTCTAATTTACCCTGGCAGG 60.159 54.545 27.04 27.04 34.30 4.85
4490 7349 2.576615 CTCTAATTTACCCTGGCAGGC 58.423 52.381 28.51 0.00 32.73 4.85
4491 7350 1.214424 TCTAATTTACCCTGGCAGGCC 59.786 52.381 28.51 2.62 32.73 5.19
4492 7351 1.003646 TAATTTACCCTGGCAGGCCA 58.996 50.000 28.51 14.48 45.02 5.36
4493 7352 0.116143 AATTTACCCTGGCAGGCCAA 59.884 50.000 28.51 19.52 46.63 4.52
4494 7353 0.614697 ATTTACCCTGGCAGGCCAAC 60.615 55.000 28.51 0.00 46.63 3.77
4495 7354 2.723464 TTTACCCTGGCAGGCCAACC 62.723 60.000 28.51 6.26 46.63 3.77
4498 7357 4.748144 CCTGGCAGGCCAACCCTC 62.748 72.222 22.68 0.00 46.63 4.30
4499 7358 4.748144 CTGGCAGGCCAACCCTCC 62.748 72.222 14.82 0.00 46.63 4.30
4501 7360 4.748144 GGCAGGCCAACCCTCCAG 62.748 72.222 5.01 0.00 44.09 3.86
4503 7362 4.748144 CAGGCCAACCCTCCAGCC 62.748 72.222 5.01 0.00 44.09 4.85
4505 7364 4.299796 GGCCAACCCTCCAGCCAA 62.300 66.667 0.00 0.00 45.07 4.52
4506 7365 2.677875 GCCAACCCTCCAGCCAAG 60.678 66.667 0.00 0.00 0.00 3.61
4507 7366 3.170362 CCAACCCTCCAGCCAAGA 58.830 61.111 0.00 0.00 0.00 3.02
4508 7367 1.460255 CCAACCCTCCAGCCAAGAA 59.540 57.895 0.00 0.00 0.00 2.52
4509 7368 0.178964 CCAACCCTCCAGCCAAGAAA 60.179 55.000 0.00 0.00 0.00 2.52
4510 7369 1.703411 CAACCCTCCAGCCAAGAAAA 58.297 50.000 0.00 0.00 0.00 2.29
4511 7370 2.250924 CAACCCTCCAGCCAAGAAAAT 58.749 47.619 0.00 0.00 0.00 1.82
4512 7371 1.928868 ACCCTCCAGCCAAGAAAATG 58.071 50.000 0.00 0.00 0.00 2.32
4513 7372 0.533951 CCCTCCAGCCAAGAAAATGC 59.466 55.000 0.00 0.00 0.00 3.56
4514 7373 1.553706 CCTCCAGCCAAGAAAATGCT 58.446 50.000 0.00 0.00 35.25 3.79
4515 7374 1.475682 CCTCCAGCCAAGAAAATGCTC 59.524 52.381 0.00 0.00 31.77 4.26
4516 7375 1.475682 CTCCAGCCAAGAAAATGCTCC 59.524 52.381 0.00 0.00 31.77 4.70
4517 7376 1.203038 TCCAGCCAAGAAAATGCTCCA 60.203 47.619 0.00 0.00 31.77 3.86
4518 7377 1.203994 CCAGCCAAGAAAATGCTCCAG 59.796 52.381 0.00 0.00 31.77 3.86
4519 7378 1.203994 CAGCCAAGAAAATGCTCCAGG 59.796 52.381 0.00 0.00 31.77 4.45
4520 7379 0.533951 GCCAAGAAAATGCTCCAGGG 59.466 55.000 0.00 0.00 0.00 4.45
4521 7380 1.928868 CCAAGAAAATGCTCCAGGGT 58.071 50.000 0.00 0.00 0.00 4.34
4522 7381 1.821136 CCAAGAAAATGCTCCAGGGTC 59.179 52.381 0.00 0.00 0.00 4.46
4523 7382 1.470098 CAAGAAAATGCTCCAGGGTCG 59.530 52.381 0.00 0.00 0.00 4.79
4524 7383 0.678048 AGAAAATGCTCCAGGGTCGC 60.678 55.000 0.00 0.00 0.00 5.19
4525 7384 0.678048 GAAAATGCTCCAGGGTCGCT 60.678 55.000 0.00 0.00 0.00 4.93
4526 7385 0.678048 AAAATGCTCCAGGGTCGCTC 60.678 55.000 0.00 0.00 0.00 5.03
4527 7386 2.859273 AAATGCTCCAGGGTCGCTCG 62.859 60.000 0.00 0.00 0.00 5.03
4529 7388 4.500116 GCTCCAGGGTCGCTCGTC 62.500 72.222 0.00 0.00 0.00 4.20
4530 7389 2.752238 CTCCAGGGTCGCTCGTCT 60.752 66.667 0.00 0.00 0.00 4.18
4531 7390 2.750637 TCCAGGGTCGCTCGTCTC 60.751 66.667 0.00 0.00 0.00 3.36
4532 7391 3.827898 CCAGGGTCGCTCGTCTCC 61.828 72.222 0.00 0.00 0.00 3.71
4533 7392 4.180946 CAGGGTCGCTCGTCTCCG 62.181 72.222 0.00 0.00 0.00 4.63
4537 7396 3.745803 GTCGCTCGTCTCCGGGTT 61.746 66.667 0.00 0.00 36.74 4.11
4538 7397 3.744719 TCGCTCGTCTCCGGGTTG 61.745 66.667 0.00 0.00 36.74 3.77
4539 7398 4.796231 CGCTCGTCTCCGGGTTGG 62.796 72.222 0.00 0.00 36.74 3.77
4557 7416 4.695217 TTGGAAATCAACCGTAATGAGC 57.305 40.909 0.00 0.00 0.00 4.26
4558 7417 3.950397 TGGAAATCAACCGTAATGAGCT 58.050 40.909 0.00 0.00 0.00 4.09
4559 7418 3.938963 TGGAAATCAACCGTAATGAGCTC 59.061 43.478 6.82 6.82 0.00 4.09
4560 7419 4.192317 GGAAATCAACCGTAATGAGCTCT 58.808 43.478 16.19 0.00 0.00 4.09
4561 7420 4.636206 GGAAATCAACCGTAATGAGCTCTT 59.364 41.667 16.19 5.66 0.00 2.85
4562 7421 5.220681 GGAAATCAACCGTAATGAGCTCTTC 60.221 44.000 16.19 5.20 0.00 2.87
4563 7422 3.953712 TCAACCGTAATGAGCTCTTCA 57.046 42.857 16.19 0.00 40.85 3.02
4565 7424 5.592104 TCAACCGTAATGAGCTCTTCATA 57.408 39.130 16.19 0.00 45.82 2.15
4566 7425 5.972935 TCAACCGTAATGAGCTCTTCATAA 58.027 37.500 16.19 0.00 45.82 1.90
4567 7426 6.403049 TCAACCGTAATGAGCTCTTCATAAA 58.597 36.000 16.19 0.00 45.82 1.40
4568 7427 6.535150 TCAACCGTAATGAGCTCTTCATAAAG 59.465 38.462 16.19 0.00 45.82 1.85
4569 7428 5.360591 ACCGTAATGAGCTCTTCATAAAGG 58.639 41.667 16.19 10.26 45.82 3.11
4570 7429 4.752101 CCGTAATGAGCTCTTCATAAAGGG 59.248 45.833 16.19 4.98 45.82 3.95
4580 7439 5.329035 TCTTCATAAAGGGCAATGAAAGC 57.671 39.130 0.00 0.00 40.56 3.51
4581 7440 4.771577 TCTTCATAAAGGGCAATGAAAGCA 59.228 37.500 0.00 0.00 40.56 3.91
4582 7441 5.422970 TCTTCATAAAGGGCAATGAAAGCAT 59.577 36.000 0.00 0.00 40.56 3.79
4583 7442 5.680594 TCATAAAGGGCAATGAAAGCATT 57.319 34.783 0.00 0.00 45.33 3.56
4584 7443 6.052405 TCATAAAGGGCAATGAAAGCATTT 57.948 33.333 0.00 0.00 41.87 2.32
4585 7444 6.474630 TCATAAAGGGCAATGAAAGCATTTT 58.525 32.000 0.00 0.00 41.87 1.82
4586 7445 6.941436 TCATAAAGGGCAATGAAAGCATTTTT 59.059 30.769 0.00 0.00 41.87 1.94
4614 7473 4.817318 GGATTGGCCCAAAGAACAATAA 57.183 40.909 0.00 0.00 34.01 1.40
4615 7474 5.357742 GGATTGGCCCAAAGAACAATAAT 57.642 39.130 0.00 0.00 34.01 1.28
4616 7475 5.118286 GGATTGGCCCAAAGAACAATAATG 58.882 41.667 0.00 0.00 34.01 1.90
4617 7476 5.104982 GGATTGGCCCAAAGAACAATAATGA 60.105 40.000 0.00 0.00 34.01 2.57
4618 7477 5.815233 TTGGCCCAAAGAACAATAATGAA 57.185 34.783 0.00 0.00 0.00 2.57
4619 7478 6.371595 TTGGCCCAAAGAACAATAATGAAT 57.628 33.333 0.00 0.00 0.00 2.57
4620 7479 6.371595 TGGCCCAAAGAACAATAATGAATT 57.628 33.333 0.00 0.00 0.00 2.17
4633 7492 7.645058 CAATAATGAATTGGGACTAACTGGT 57.355 36.000 0.00 0.00 41.19 4.00
4634 7493 8.746052 CAATAATGAATTGGGACTAACTGGTA 57.254 34.615 0.00 0.00 41.19 3.25
4635 7494 8.840321 CAATAATGAATTGGGACTAACTGGTAG 58.160 37.037 0.00 0.00 41.19 3.18
4636 7495 6.388619 AATGAATTGGGACTAACTGGTAGT 57.611 37.500 4.78 4.78 46.23 2.73
4637 7496 7.504926 AATGAATTGGGACTAACTGGTAGTA 57.495 36.000 5.16 0.00 43.45 1.82
4638 7497 6.938698 TGAATTGGGACTAACTGGTAGTAA 57.061 37.500 5.16 0.00 43.45 2.24
4639 7498 7.319052 TGAATTGGGACTAACTGGTAGTAAA 57.681 36.000 5.16 1.82 43.45 2.01
4640 7499 7.747690 TGAATTGGGACTAACTGGTAGTAAAA 58.252 34.615 5.16 1.47 43.45 1.52
4641 7500 7.662669 TGAATTGGGACTAACTGGTAGTAAAAC 59.337 37.037 5.16 0.00 43.45 2.43
4642 7501 6.752285 TTGGGACTAACTGGTAGTAAAACT 57.248 37.500 5.16 0.00 43.45 2.66
4643 7502 6.350629 TGGGACTAACTGGTAGTAAAACTC 57.649 41.667 5.16 0.00 43.45 3.01
4644 7503 5.246883 TGGGACTAACTGGTAGTAAAACTCC 59.753 44.000 5.16 1.54 43.45 3.85
4645 7504 5.483231 GGGACTAACTGGTAGTAAAACTCCT 59.517 44.000 5.16 0.00 43.45 3.69
4646 7505 6.013898 GGGACTAACTGGTAGTAAAACTCCTT 60.014 42.308 5.16 0.00 43.45 3.36
4647 7506 7.448420 GGACTAACTGGTAGTAAAACTCCTTT 58.552 38.462 5.16 0.00 43.45 3.11
4648 7507 7.387122 GGACTAACTGGTAGTAAAACTCCTTTG 59.613 40.741 5.16 0.00 43.45 2.77
4649 7508 6.709397 ACTAACTGGTAGTAAAACTCCTTTGC 59.291 38.462 2.96 0.00 41.51 3.68
4650 7509 4.395625 ACTGGTAGTAAAACTCCTTTGCC 58.604 43.478 0.00 0.00 30.42 4.52
4651 7510 3.756963 CTGGTAGTAAAACTCCTTTGCCC 59.243 47.826 0.00 0.00 30.42 5.36
4652 7511 3.138653 TGGTAGTAAAACTCCTTTGCCCA 59.861 43.478 0.00 0.00 30.42 5.36
4653 7512 4.202631 TGGTAGTAAAACTCCTTTGCCCAT 60.203 41.667 0.00 0.00 30.42 4.00
4654 7513 4.770531 GGTAGTAAAACTCCTTTGCCCATT 59.229 41.667 0.00 0.00 30.42 3.16
4655 7514 5.947566 GGTAGTAAAACTCCTTTGCCCATTA 59.052 40.000 0.00 0.00 30.42 1.90
4656 7515 6.095021 GGTAGTAAAACTCCTTTGCCCATTAG 59.905 42.308 0.00 0.00 30.42 1.73
4657 7516 5.641155 AGTAAAACTCCTTTGCCCATTAGT 58.359 37.500 0.00 0.00 30.42 2.24
4658 7517 6.786122 AGTAAAACTCCTTTGCCCATTAGTA 58.214 36.000 0.00 0.00 30.42 1.82
4659 7518 7.235804 AGTAAAACTCCTTTGCCCATTAGTAA 58.764 34.615 0.00 0.00 30.42 2.24
4660 7519 7.893833 AGTAAAACTCCTTTGCCCATTAGTAAT 59.106 33.333 0.00 0.00 30.42 1.89
4661 7520 6.530019 AAACTCCTTTGCCCATTAGTAATG 57.470 37.500 14.88 14.88 38.63 1.90
4679 7538 4.390048 GGCGTGCCCACTAGAAAA 57.610 55.556 0.00 0.00 0.00 2.29
4680 7539 2.636299 GGCGTGCCCACTAGAAAAA 58.364 52.632 0.00 0.00 0.00 1.94
4704 7563 9.511272 AAAAATAAGACTAATTAGGACAACCGT 57.489 29.630 16.73 0.00 41.83 4.83
4705 7564 8.488651 AAATAAGACTAATTAGGACAACCGTG 57.511 34.615 16.73 0.00 41.83 4.94
4706 7565 4.467198 AGACTAATTAGGACAACCGTGG 57.533 45.455 16.73 0.00 41.83 4.94
4707 7566 2.934553 GACTAATTAGGACAACCGTGGC 59.065 50.000 16.73 0.00 41.83 5.01
4708 7567 2.303600 ACTAATTAGGACAACCGTGGCA 59.696 45.455 16.73 0.00 41.83 4.92
4709 7568 2.507407 AATTAGGACAACCGTGGCAT 57.493 45.000 0.00 0.00 41.83 4.40
4710 7569 1.750193 ATTAGGACAACCGTGGCATG 58.250 50.000 0.00 0.00 41.83 4.06
4711 7570 0.322098 TTAGGACAACCGTGGCATGG 60.322 55.000 24.09 24.09 41.83 3.66
4712 7571 1.485294 TAGGACAACCGTGGCATGGT 61.485 55.000 25.59 25.59 39.71 3.55
4713 7572 1.003112 GGACAACCGTGGCATGGTA 60.003 57.895 30.57 0.00 36.21 3.25
4714 7573 0.606944 GGACAACCGTGGCATGGTAA 60.607 55.000 30.57 0.00 36.21 2.85
4715 7574 0.519961 GACAACCGTGGCATGGTAAC 59.480 55.000 30.57 19.82 36.21 2.50
4734 7593 6.111382 GGTAACAAGATTACTGTTCCTACCC 58.889 44.000 0.00 0.00 0.00 3.69
4735 7594 5.836024 AACAAGATTACTGTTCCTACCCA 57.164 39.130 0.00 0.00 0.00 4.51
4736 7595 5.836024 ACAAGATTACTGTTCCTACCCAA 57.164 39.130 0.00 0.00 0.00 4.12
4737 7596 6.388619 ACAAGATTACTGTTCCTACCCAAT 57.611 37.500 0.00 0.00 0.00 3.16
4738 7597 6.790319 ACAAGATTACTGTTCCTACCCAATT 58.210 36.000 0.00 0.00 0.00 2.32
4739 7598 7.238710 ACAAGATTACTGTTCCTACCCAATTT 58.761 34.615 0.00 0.00 0.00 1.82
4740 7599 7.728532 ACAAGATTACTGTTCCTACCCAATTTT 59.271 33.333 0.00 0.00 0.00 1.82
4741 7600 8.585018 CAAGATTACTGTTCCTACCCAATTTTT 58.415 33.333 0.00 0.00 0.00 1.94
4766 7625 8.712285 TTTTACTATTCCTATGCACTACACAC 57.288 34.615 0.00 0.00 0.00 3.82
4767 7626 4.933330 ACTATTCCTATGCACTACACACG 58.067 43.478 0.00 0.00 0.00 4.49
4768 7627 2.665649 TTCCTATGCACTACACACGG 57.334 50.000 0.00 0.00 0.00 4.94
4769 7628 1.552578 TCCTATGCACTACACACGGT 58.447 50.000 0.00 0.00 0.00 4.83
4770 7629 1.203758 TCCTATGCACTACACACGGTG 59.796 52.381 6.58 6.58 39.75 4.94
4771 7630 1.640428 CTATGCACTACACACGGTGG 58.360 55.000 13.48 4.17 37.94 4.61
4772 7631 0.390603 TATGCACTACACACGGTGGC 60.391 55.000 13.48 5.51 37.94 5.01
4773 7632 2.280524 GCACTACACACGGTGGCA 60.281 61.111 13.48 0.00 37.94 4.92
4774 7633 1.671054 GCACTACACACGGTGGCAT 60.671 57.895 13.48 0.00 37.94 4.40
4775 7634 1.911293 GCACTACACACGGTGGCATG 61.911 60.000 13.48 4.40 37.94 4.06
4776 7635 1.003839 ACTACACACGGTGGCATGG 60.004 57.895 13.48 2.02 37.94 3.66
4777 7636 1.003839 CTACACACGGTGGCATGGT 60.004 57.895 13.48 5.19 37.94 3.55
4778 7637 0.248012 CTACACACGGTGGCATGGTA 59.752 55.000 13.48 6.01 37.94 3.25
4779 7638 0.685660 TACACACGGTGGCATGGTAA 59.314 50.000 13.48 0.00 37.94 2.85
4780 7639 0.887387 ACACACGGTGGCATGGTAAC 60.887 55.000 13.48 0.00 37.94 2.50
4781 7640 3.529557 ACACACGGTGGCATGGTAACA 62.530 52.381 13.48 0.00 45.35 2.41
4782 7641 4.969741 ACACACGGTGGCATGGTAACAA 62.970 50.000 13.48 0.00 44.70 2.83
4824 7683 9.899661 AAAATTACTATTCCTATGCACTACACA 57.100 29.630 0.00 0.00 0.00 3.72
4825 7684 8.888579 AATTACTATTCCTATGCACTACACAC 57.111 34.615 0.00 0.00 0.00 3.82
4826 7685 4.933330 ACTATTCCTATGCACTACACACG 58.067 43.478 0.00 0.00 0.00 4.49
4827 7686 3.887621 ATTCCTATGCACTACACACGT 57.112 42.857 0.00 0.00 0.00 4.49
4828 7687 2.933495 TCCTATGCACTACACACGTC 57.067 50.000 0.00 0.00 0.00 4.34
4829 7688 2.443416 TCCTATGCACTACACACGTCT 58.557 47.619 0.00 0.00 0.00 4.18
4830 7689 2.823747 TCCTATGCACTACACACGTCTT 59.176 45.455 0.00 0.00 0.00 3.01
4831 7690 4.011698 TCCTATGCACTACACACGTCTTA 58.988 43.478 0.00 0.00 0.00 2.10
4832 7691 4.643334 TCCTATGCACTACACACGTCTTAT 59.357 41.667 0.00 0.00 0.00 1.73
4833 7692 4.740205 CCTATGCACTACACACGTCTTATG 59.260 45.833 0.00 0.00 0.00 1.90
4834 7693 2.333926 TGCACTACACACGTCTTATGC 58.666 47.619 0.00 0.00 0.00 3.14
4835 7694 2.029380 TGCACTACACACGTCTTATGCT 60.029 45.455 7.34 0.00 33.03 3.79
4836 7695 2.599082 GCACTACACACGTCTTATGCTC 59.401 50.000 0.00 0.00 0.00 4.26
4837 7696 3.833442 CACTACACACGTCTTATGCTCA 58.167 45.455 0.00 0.00 0.00 4.26
4838 7697 3.854240 CACTACACACGTCTTATGCTCAG 59.146 47.826 0.00 0.00 0.00 3.35
4839 7698 3.506455 ACTACACACGTCTTATGCTCAGT 59.494 43.478 0.00 0.00 0.00 3.41
4840 7699 3.386768 ACACACGTCTTATGCTCAGTT 57.613 42.857 0.00 0.00 0.00 3.16
4841 7700 4.514781 ACACACGTCTTATGCTCAGTTA 57.485 40.909 0.00 0.00 0.00 2.24
4842 7701 5.073311 ACACACGTCTTATGCTCAGTTAT 57.927 39.130 0.00 0.00 0.00 1.89
4843 7702 4.864806 ACACACGTCTTATGCTCAGTTATG 59.135 41.667 0.00 0.00 0.00 1.90
4844 7703 3.865745 ACACGTCTTATGCTCAGTTATGC 59.134 43.478 0.00 0.00 0.00 3.14
4845 7704 4.115516 CACGTCTTATGCTCAGTTATGCT 58.884 43.478 0.00 0.00 0.00 3.79
4846 7705 4.568359 CACGTCTTATGCTCAGTTATGCTT 59.432 41.667 0.00 0.00 0.00 3.91
4847 7706 5.063944 CACGTCTTATGCTCAGTTATGCTTT 59.936 40.000 0.00 0.00 0.00 3.51
4848 7707 6.255670 CACGTCTTATGCTCAGTTATGCTTTA 59.744 38.462 0.00 0.00 0.00 1.85
4849 7708 6.986817 ACGTCTTATGCTCAGTTATGCTTTAT 59.013 34.615 0.00 0.00 0.00 1.40
4896 7790 6.730960 TTATAAGCTTTACGTTCCCTGTTG 57.269 37.500 3.20 0.00 0.00 3.33
4897 7791 2.632987 AGCTTTACGTTCCCTGTTGT 57.367 45.000 0.00 0.00 0.00 3.32
4919 7813 9.771915 GTTGTTTATCCAAATTTTAATGGCATG 57.228 29.630 0.00 0.00 36.62 4.06
5007 7906 2.579860 AGGCTCCACAGATTTTGAGGAT 59.420 45.455 0.00 0.00 44.21 3.24
5083 7982 8.594687 CATTTTCTGTTGTCAAGGTTGTTTTAG 58.405 33.333 0.00 0.00 0.00 1.85
5168 8068 3.795688 TGCAAATCTCCTCCAGAACTT 57.204 42.857 0.00 0.00 33.62 2.66
5311 8211 3.632145 ACCAACTTCAATAATGATCCCGC 59.368 43.478 0.00 0.00 34.96 6.13
5394 8294 3.428534 GCAACTACCGAAAAAGGCATTTG 59.571 43.478 0.00 0.00 33.69 2.32
5398 8298 1.686052 ACCGAAAAAGGCATTTGCTCA 59.314 42.857 0.00 0.00 41.70 4.26
5439 8339 4.536090 TCTTGGACCTAAGTGGACATTCAT 59.464 41.667 0.00 0.00 39.71 2.57
5453 8353 2.767960 ACATTCATCCAAAGGCCAATCC 59.232 45.455 5.01 0.00 0.00 3.01
5470 8370 0.175760 TCCGCTCCAAGTAGCATGAC 59.824 55.000 0.00 0.00 42.91 3.06
5516 8416 5.656213 TGAAGCTACTTAGGTACCTTGAC 57.344 43.478 22.11 4.40 33.01 3.18
5546 8446 3.193267 GCTTGCCAATAACATCACTTCCA 59.807 43.478 0.00 0.00 0.00 3.53
5552 8452 6.072175 TGCCAATAACATCACTTCCAAAGTAC 60.072 38.462 0.00 0.00 40.46 2.73
5628 8528 6.719370 TGAAACCTTGCCTGATAGTATTTGTT 59.281 34.615 0.00 0.00 0.00 2.83
5762 8662 3.618690 ATACTCCAAGAGTTGCCTGAC 57.381 47.619 2.05 0.00 40.28 3.51
5870 8770 7.503902 GGCCTTCATAAACTCTCATTCCTAAAT 59.496 37.037 0.00 0.00 0.00 1.40
5983 8883 5.709966 AGAAAACCTACCAATTGATTTCGC 58.290 37.500 7.12 0.00 32.21 4.70
5985 8885 5.722021 AAACCTACCAATTGATTTCGCTT 57.278 34.783 7.12 0.00 0.00 4.68
6004 8904 5.405571 TCGCTTACATTCAGAAACTTGAGTC 59.594 40.000 0.00 0.00 0.00 3.36
6113 9013 9.567776 TCAGATTGTCATAACCTTGAAAAACTA 57.432 29.630 0.00 0.00 28.21 2.24
6281 9181 3.498481 CCTCCTCATTTGGTGACCTTCAA 60.498 47.826 2.11 0.00 32.22 2.69
6415 9315 4.618227 GCGTAAAAAGATTCCAGCCATTGT 60.618 41.667 0.00 0.00 0.00 2.71
6481 9381 5.946486 TGAGATAGAGAGTAGAGGATGCAA 58.054 41.667 0.00 0.00 0.00 4.08
6648 9548 2.633488 GAGGTAAATCTGTGCTGGACC 58.367 52.381 0.00 0.00 0.00 4.46
6671 9571 0.675837 TCGTACCTCCACGGACTCTG 60.676 60.000 0.00 0.00 42.19 3.35
6810 9710 1.153086 CTTCCTCCATTCGGGGCAG 60.153 63.158 0.00 0.00 37.22 4.85
6875 9775 8.589701 ACATTAGGAAAATCGGTAAGGAATTT 57.410 30.769 0.00 0.00 0.00 1.82
7062 9962 3.074538 ACCATATCCCCCAAGAAGTATGC 59.925 47.826 0.00 0.00 0.00 3.14
7284 10185 2.685388 CGATGCTTCACCTCTCTCACTA 59.315 50.000 0.08 0.00 0.00 2.74
7296 10197 4.037446 CCTCTCTCACTAGACTATGGTTGC 59.963 50.000 0.00 0.00 0.00 4.17
7316 10217 2.766313 CTGTCGTTGAATGACCTGGAA 58.234 47.619 14.40 0.00 33.27 3.53
7343 10388 1.165270 CGGAATGGTTGGGACAGTTC 58.835 55.000 0.00 0.00 42.39 3.01
7356 10401 4.899457 TGGGACAGTTCACTTCTCTAGAAA 59.101 41.667 0.00 0.00 33.07 2.52
7368 10413 8.765219 TCACTTCTCTAGAAAAACTTTTCATCG 58.235 33.333 15.39 5.22 46.81 3.84
7416 10461 3.791245 CCTGAAAGCATACAGAGTCTCC 58.209 50.000 0.00 0.00 36.38 3.71
7418 10463 3.173151 TGAAAGCATACAGAGTCTCCCA 58.827 45.455 0.00 0.00 0.00 4.37
7444 10489 2.231235 TGAAGCTACTCGACATTGCTCA 59.769 45.455 0.00 1.07 33.10 4.26
7463 10508 3.753815 TCAATGTCCAAGTCTGATTGCA 58.246 40.909 0.00 0.00 0.00 4.08
7499 10544 3.461085 AGGATGCCCACAAGATTAGTCAT 59.539 43.478 0.00 0.00 33.88 3.06
7506 10551 4.563580 CCCACAAGATTAGTCATATCCCCG 60.564 50.000 0.00 0.00 0.00 5.73
7512 10557 4.773149 AGATTAGTCATATCCCCGAAGTCC 59.227 45.833 0.00 0.00 0.00 3.85
7522 10567 4.294523 CGAAGTCCAATTCGGGCA 57.705 55.556 1.28 0.00 44.49 5.36
7530 10575 1.005332 TCCAATTCGGGCATTGAAGGA 59.995 47.619 4.92 0.00 36.39 3.36
7533 10578 2.044123 ATTCGGGCATTGAAGGAGTC 57.956 50.000 0.00 0.00 0.00 3.36
7544 10589 1.762370 TGAAGGAGTCACTGTGAAGCA 59.238 47.619 12.81 2.22 0.00 3.91
7545 10590 2.170397 TGAAGGAGTCACTGTGAAGCAA 59.830 45.455 12.81 0.00 0.00 3.91
7546 10591 2.246719 AGGAGTCACTGTGAAGCAAC 57.753 50.000 12.81 0.00 0.00 4.17
7547 10592 0.861837 GGAGTCACTGTGAAGCAACG 59.138 55.000 12.81 0.00 0.00 4.10
7548 10593 0.233332 GAGTCACTGTGAAGCAACGC 59.767 55.000 12.81 0.00 0.00 4.84
7549 10594 1.083401 GTCACTGTGAAGCAACGCG 60.083 57.895 12.81 3.53 0.00 6.01
7550 10595 2.425773 CACTGTGAAGCAACGCGC 60.426 61.111 5.73 0.00 42.91 6.86
7560 10605 3.604130 GCAACGCGCTAATCACATT 57.396 47.368 5.73 0.00 37.77 2.71
7561 10606 1.182673 GCAACGCGCTAATCACATTG 58.817 50.000 5.73 0.19 37.77 2.82
7562 10607 1.465689 GCAACGCGCTAATCACATTGT 60.466 47.619 5.73 0.00 37.77 2.71
7563 10608 2.222931 GCAACGCGCTAATCACATTGTA 60.223 45.455 5.73 0.00 37.77 2.41
7564 10609 3.342269 CAACGCGCTAATCACATTGTAC 58.658 45.455 5.73 0.00 0.00 2.90
7565 10610 2.612604 ACGCGCTAATCACATTGTACA 58.387 42.857 5.73 0.00 0.00 2.90
7566 10611 2.997303 ACGCGCTAATCACATTGTACAA 59.003 40.909 11.41 11.41 0.00 2.41
7567 10612 3.433957 ACGCGCTAATCACATTGTACAAA 59.566 39.130 13.23 0.00 0.00 2.83
7568 10613 4.021822 CGCGCTAATCACATTGTACAAAG 58.978 43.478 13.23 11.05 0.00 2.77
7569 10614 4.435518 CGCGCTAATCACATTGTACAAAGT 60.436 41.667 13.23 11.79 0.00 2.66
7570 10615 5.390613 GCGCTAATCACATTGTACAAAGTT 58.609 37.500 13.52 3.15 0.00 2.66
7571 10616 6.539324 GCGCTAATCACATTGTACAAAGTTA 58.461 36.000 13.52 7.00 0.00 2.24
7572 10617 7.186804 GCGCTAATCACATTGTACAAAGTTAT 58.813 34.615 13.52 9.01 0.00 1.89
7573 10618 7.164171 GCGCTAATCACATTGTACAAAGTTATG 59.836 37.037 13.52 8.92 0.00 1.90
7574 10619 8.387354 CGCTAATCACATTGTACAAAGTTATGA 58.613 33.333 13.52 11.96 0.00 2.15
7579 10624 7.806690 TCACATTGTACAAAGTTATGAAGAGC 58.193 34.615 13.52 0.00 0.00 4.09
7580 10625 7.661437 TCACATTGTACAAAGTTATGAAGAGCT 59.339 33.333 13.52 0.00 0.00 4.09
7581 10626 7.747799 CACATTGTACAAAGTTATGAAGAGCTG 59.252 37.037 13.52 4.40 0.00 4.24
7582 10627 6.801539 TTGTACAAAGTTATGAAGAGCTGG 57.198 37.500 5.64 0.00 0.00 4.85
7583 10628 5.245531 TGTACAAAGTTATGAAGAGCTGGG 58.754 41.667 0.00 0.00 0.00 4.45
7584 10629 4.373156 ACAAAGTTATGAAGAGCTGGGT 57.627 40.909 0.00 0.00 0.00 4.51
7585 10630 4.074970 ACAAAGTTATGAAGAGCTGGGTG 58.925 43.478 0.00 0.00 0.00 4.61
7586 10631 4.074970 CAAAGTTATGAAGAGCTGGGTGT 58.925 43.478 0.00 0.00 0.00 4.16
7587 10632 5.221843 ACAAAGTTATGAAGAGCTGGGTGTA 60.222 40.000 0.00 0.00 0.00 2.90
7588 10633 4.744795 AGTTATGAAGAGCTGGGTGTAG 57.255 45.455 0.00 0.00 0.00 2.74
7589 10634 3.452627 AGTTATGAAGAGCTGGGTGTAGG 59.547 47.826 0.00 0.00 0.00 3.18
7590 10635 2.254152 ATGAAGAGCTGGGTGTAGGA 57.746 50.000 0.00 0.00 0.00 2.94
7591 10636 1.561643 TGAAGAGCTGGGTGTAGGAG 58.438 55.000 0.00 0.00 0.00 3.69
7592 10637 1.077169 TGAAGAGCTGGGTGTAGGAGA 59.923 52.381 0.00 0.00 0.00 3.71
7593 10638 1.754226 GAAGAGCTGGGTGTAGGAGAG 59.246 57.143 0.00 0.00 0.00 3.20
7594 10639 0.032615 AGAGCTGGGTGTAGGAGAGG 60.033 60.000 0.00 0.00 0.00 3.69
7595 10640 0.033011 GAGCTGGGTGTAGGAGAGGA 60.033 60.000 0.00 0.00 0.00 3.71
7596 10641 0.413832 AGCTGGGTGTAGGAGAGGAA 59.586 55.000 0.00 0.00 0.00 3.36
7597 10642 0.537653 GCTGGGTGTAGGAGAGGAAC 59.462 60.000 0.00 0.00 0.00 3.62
7598 10643 1.196012 CTGGGTGTAGGAGAGGAACC 58.804 60.000 0.00 0.00 0.00 3.62
7599 10644 0.613853 TGGGTGTAGGAGAGGAACCG 60.614 60.000 0.00 0.00 0.00 4.44
7600 10645 1.328430 GGGTGTAGGAGAGGAACCGG 61.328 65.000 0.00 0.00 0.00 5.28
7601 10646 0.614134 GGTGTAGGAGAGGAACCGGT 60.614 60.000 0.00 0.00 0.00 5.28
7602 10647 0.531200 GTGTAGGAGAGGAACCGGTG 59.469 60.000 8.52 0.00 0.00 4.94
7603 10648 0.613853 TGTAGGAGAGGAACCGGTGG 60.614 60.000 8.52 0.00 0.00 4.61
7604 10649 0.324091 GTAGGAGAGGAACCGGTGGA 60.324 60.000 8.52 0.00 0.00 4.02
7605 10650 0.410663 TAGGAGAGGAACCGGTGGAA 59.589 55.000 8.52 0.00 0.00 3.53
7606 10651 0.473117 AGGAGAGGAACCGGTGGAAA 60.473 55.000 8.52 0.00 0.00 3.13
7607 10652 0.618981 GGAGAGGAACCGGTGGAAAT 59.381 55.000 8.52 0.00 0.00 2.17
7608 10653 1.004394 GGAGAGGAACCGGTGGAAATT 59.996 52.381 8.52 0.00 0.00 1.82
7609 10654 2.237893 GGAGAGGAACCGGTGGAAATTA 59.762 50.000 8.52 0.00 0.00 1.40
7610 10655 3.118000 GGAGAGGAACCGGTGGAAATTAT 60.118 47.826 8.52 0.00 0.00 1.28
7611 10656 4.524053 GAGAGGAACCGGTGGAAATTATT 58.476 43.478 8.52 0.00 0.00 1.40
7612 10657 4.270008 AGAGGAACCGGTGGAAATTATTG 58.730 43.478 8.52 0.00 0.00 1.90
7613 10658 4.018779 AGAGGAACCGGTGGAAATTATTGA 60.019 41.667 8.52 0.00 0.00 2.57
7614 10659 4.014406 AGGAACCGGTGGAAATTATTGAC 58.986 43.478 8.52 0.00 0.00 3.18
7615 10660 3.129813 GGAACCGGTGGAAATTATTGACC 59.870 47.826 8.52 0.00 0.00 4.02
7616 10661 2.730382 ACCGGTGGAAATTATTGACCC 58.270 47.619 6.12 0.00 0.00 4.46
7617 10662 2.028876 CCGGTGGAAATTATTGACCCC 58.971 52.381 0.00 0.00 0.00 4.95
7618 10663 2.028876 CGGTGGAAATTATTGACCCCC 58.971 52.381 0.00 0.00 0.00 5.40
7619 10664 2.357777 CGGTGGAAATTATTGACCCCCT 60.358 50.000 0.00 0.00 0.00 4.79
7620 10665 3.296854 GGTGGAAATTATTGACCCCCTC 58.703 50.000 0.00 0.00 0.00 4.30
7621 10666 3.052869 GGTGGAAATTATTGACCCCCTCT 60.053 47.826 0.00 0.00 0.00 3.69
7622 10667 3.954258 GTGGAAATTATTGACCCCCTCTG 59.046 47.826 0.00 0.00 0.00 3.35
7623 10668 2.959030 GGAAATTATTGACCCCCTCTGC 59.041 50.000 0.00 0.00 0.00 4.26
7624 10669 2.755952 AATTATTGACCCCCTCTGCC 57.244 50.000 0.00 0.00 0.00 4.85
7625 10670 0.853530 ATTATTGACCCCCTCTGCCC 59.146 55.000 0.00 0.00 0.00 5.36
7626 10671 0.253630 TTATTGACCCCCTCTGCCCT 60.254 55.000 0.00 0.00 0.00 5.19
7627 10672 0.253630 TATTGACCCCCTCTGCCCTT 60.254 55.000 0.00 0.00 0.00 3.95
7628 10673 1.149133 ATTGACCCCCTCTGCCCTTT 61.149 55.000 0.00 0.00 0.00 3.11
7629 10674 2.080336 TTGACCCCCTCTGCCCTTTG 62.080 60.000 0.00 0.00 0.00 2.77
7630 10675 3.268032 ACCCCCTCTGCCCTTTGG 61.268 66.667 0.00 0.00 0.00 3.28
7631 10676 3.268032 CCCCCTCTGCCCTTTGGT 61.268 66.667 0.00 0.00 0.00 3.67
7632 10677 2.854076 CCCCTCTGCCCTTTGGTT 59.146 61.111 0.00 0.00 0.00 3.67
7633 10678 1.607467 CCCCTCTGCCCTTTGGTTG 60.607 63.158 0.00 0.00 0.00 3.77
7634 10679 1.607467 CCCTCTGCCCTTTGGTTGG 60.607 63.158 0.00 0.00 0.00 3.77
7635 10680 1.460255 CCTCTGCCCTTTGGTTGGA 59.540 57.895 0.00 0.00 0.00 3.53
7636 10681 0.895559 CCTCTGCCCTTTGGTTGGAC 60.896 60.000 0.00 0.00 0.00 4.02
7637 10682 0.178992 CTCTGCCCTTTGGTTGGACA 60.179 55.000 0.00 0.00 0.00 4.02
7638 10683 0.260230 TCTGCCCTTTGGTTGGACAA 59.740 50.000 0.00 0.00 0.00 3.18
7639 10684 0.389025 CTGCCCTTTGGTTGGACAAC 59.611 55.000 6.64 6.64 40.45 3.32
7640 10685 1.362355 GCCCTTTGGTTGGACAACG 59.638 57.895 8.89 0.00 42.02 4.10
7641 10686 1.104577 GCCCTTTGGTTGGACAACGA 61.105 55.000 8.89 2.56 42.02 3.85
7642 10687 0.666374 CCCTTTGGTTGGACAACGAC 59.334 55.000 8.89 0.00 42.02 4.34
7643 10688 0.306533 CCTTTGGTTGGACAACGACG 59.693 55.000 8.89 0.00 42.02 5.12
7644 10689 1.292061 CTTTGGTTGGACAACGACGA 58.708 50.000 0.00 0.00 42.02 4.20
7645 10690 1.260561 CTTTGGTTGGACAACGACGAG 59.739 52.381 0.00 0.00 42.02 4.18
7646 10691 0.531090 TTGGTTGGACAACGACGAGG 60.531 55.000 0.00 0.00 42.02 4.63
7647 10692 2.315386 GGTTGGACAACGACGAGGC 61.315 63.158 0.00 0.00 42.02 4.70
7648 10693 2.355363 TTGGACAACGACGAGGCG 60.355 61.111 0.00 0.00 37.29 5.52
7649 10694 3.851845 TTGGACAACGACGAGGCGG 62.852 63.158 0.00 0.00 35.12 6.13
7650 10695 4.047059 GGACAACGACGAGGCGGA 62.047 66.667 0.00 0.00 35.12 5.54
7651 10696 2.504244 GACAACGACGAGGCGGAG 60.504 66.667 0.00 0.00 35.12 4.63
7652 10697 3.966026 GACAACGACGAGGCGGAGG 62.966 68.421 0.00 0.00 35.12 4.30
7653 10698 4.052229 CAACGACGAGGCGGAGGT 62.052 66.667 0.00 0.00 35.12 3.85
7654 10699 4.052229 AACGACGAGGCGGAGGTG 62.052 66.667 0.00 0.00 35.12 4.00
7656 10701 4.778415 CGACGAGGCGGAGGTGTG 62.778 72.222 0.00 0.00 0.00 3.82
7666 10711 4.292784 GAGGTGTGCAGCTCCTTC 57.707 61.111 17.66 0.00 46.96 3.46
7667 10712 1.376553 GAGGTGTGCAGCTCCTTCC 60.377 63.158 17.66 0.00 46.96 3.46
7668 10713 2.116983 GAGGTGTGCAGCTCCTTCCA 62.117 60.000 17.66 0.00 46.96 3.53
7669 10714 1.673665 GGTGTGCAGCTCCTTCCAG 60.674 63.158 0.00 0.00 0.00 3.86
7670 10715 1.072159 GTGTGCAGCTCCTTCCAGT 59.928 57.895 0.00 0.00 0.00 4.00
7671 10716 0.321671 GTGTGCAGCTCCTTCCAGTA 59.678 55.000 0.00 0.00 0.00 2.74
7672 10717 1.065854 GTGTGCAGCTCCTTCCAGTAT 60.066 52.381 0.00 0.00 0.00 2.12
7673 10718 1.208052 TGTGCAGCTCCTTCCAGTATC 59.792 52.381 0.00 0.00 0.00 2.24
7674 10719 0.461548 TGCAGCTCCTTCCAGTATCG 59.538 55.000 0.00 0.00 0.00 2.92
7675 10720 0.461961 GCAGCTCCTTCCAGTATCGT 59.538 55.000 0.00 0.00 0.00 3.73
7676 10721 1.804372 GCAGCTCCTTCCAGTATCGTG 60.804 57.143 0.00 0.00 0.00 4.35
7677 10722 1.115467 AGCTCCTTCCAGTATCGTGG 58.885 55.000 0.00 0.00 39.19 4.94
7678 10723 0.530870 GCTCCTTCCAGTATCGTGGC 60.531 60.000 0.00 0.00 37.53 5.01
7679 10724 0.249073 CTCCTTCCAGTATCGTGGCG 60.249 60.000 0.00 0.00 37.53 5.69
7680 10725 0.968901 TCCTTCCAGTATCGTGGCGT 60.969 55.000 0.00 0.00 37.53 5.68
7681 10726 0.806102 CCTTCCAGTATCGTGGCGTG 60.806 60.000 0.00 0.00 37.53 5.34
7682 10727 0.806102 CTTCCAGTATCGTGGCGTGG 60.806 60.000 0.00 0.00 37.53 4.94
7683 10728 1.537814 TTCCAGTATCGTGGCGTGGT 61.538 55.000 0.00 0.00 37.53 4.16
7684 10729 1.809619 CCAGTATCGTGGCGTGGTG 60.810 63.158 0.00 0.00 0.00 4.17
7685 10730 2.125673 AGTATCGTGGCGTGGTGC 60.126 61.111 0.00 0.00 45.38 5.01
7686 10731 2.125673 GTATCGTGGCGTGGTGCT 60.126 61.111 0.00 0.00 45.43 4.40
7687 10732 2.165301 GTATCGTGGCGTGGTGCTC 61.165 63.158 0.00 0.00 45.43 4.26
7688 10733 2.641277 TATCGTGGCGTGGTGCTCA 61.641 57.895 0.00 0.00 45.43 4.26
7689 10734 2.161078 TATCGTGGCGTGGTGCTCAA 62.161 55.000 0.00 0.00 45.43 3.02
7690 10735 4.012895 CGTGGCGTGGTGCTCAAC 62.013 66.667 0.00 0.00 45.43 3.18
7691 10736 2.591715 GTGGCGTGGTGCTCAACT 60.592 61.111 0.00 0.00 45.43 3.16
7692 10737 2.280797 TGGCGTGGTGCTCAACTC 60.281 61.111 0.00 0.00 45.43 3.01
7693 10738 3.050275 GGCGTGGTGCTCAACTCC 61.050 66.667 0.00 0.00 45.43 3.85
7694 10739 2.280797 GCGTGGTGCTCAACTCCA 60.281 61.111 0.00 0.00 41.73 3.86
7695 10740 1.672356 GCGTGGTGCTCAACTCCAT 60.672 57.895 0.00 0.00 43.57 3.41
7696 10741 0.391130 GCGTGGTGCTCAACTCCATA 60.391 55.000 0.00 0.00 43.57 2.74
7697 10742 1.359848 CGTGGTGCTCAACTCCATAC 58.640 55.000 0.00 0.00 43.57 2.39
7698 10743 1.066858 CGTGGTGCTCAACTCCATACT 60.067 52.381 0.00 0.00 43.57 2.12
7699 10744 2.612972 CGTGGTGCTCAACTCCATACTT 60.613 50.000 0.00 0.00 43.57 2.24
7700 10745 3.003480 GTGGTGCTCAACTCCATACTTC 58.997 50.000 0.00 0.00 43.57 3.01
7701 10746 2.637382 TGGTGCTCAACTCCATACTTCA 59.363 45.455 0.00 0.00 37.01 3.02
7702 10747 3.264193 TGGTGCTCAACTCCATACTTCAT 59.736 43.478 0.00 0.00 37.01 2.57
7703 10748 4.469586 TGGTGCTCAACTCCATACTTCATA 59.530 41.667 0.00 0.00 37.01 2.15
7704 10749 4.811557 GGTGCTCAACTCCATACTTCATAC 59.188 45.833 0.00 0.00 31.85 2.39
7705 10750 5.395768 GGTGCTCAACTCCATACTTCATACT 60.396 44.000 0.00 0.00 31.85 2.12
7706 10751 5.751028 GTGCTCAACTCCATACTTCATACTC 59.249 44.000 0.00 0.00 0.00 2.59
7707 10752 5.422012 TGCTCAACTCCATACTTCATACTCA 59.578 40.000 0.00 0.00 0.00 3.41
7708 10753 6.098838 TGCTCAACTCCATACTTCATACTCAT 59.901 38.462 0.00 0.00 0.00 2.90
7709 10754 6.644592 GCTCAACTCCATACTTCATACTCATC 59.355 42.308 0.00 0.00 0.00 2.92
7710 10755 7.660030 TCAACTCCATACTTCATACTCATCA 57.340 36.000 0.00 0.00 0.00 3.07
7711 10756 7.492524 TCAACTCCATACTTCATACTCATCAC 58.507 38.462 0.00 0.00 0.00 3.06
7712 10757 7.124147 TCAACTCCATACTTCATACTCATCACA 59.876 37.037 0.00 0.00 0.00 3.58
7713 10758 7.423844 ACTCCATACTTCATACTCATCACAA 57.576 36.000 0.00 0.00 0.00 3.33
7714 10759 7.495901 ACTCCATACTTCATACTCATCACAAG 58.504 38.462 0.00 0.00 0.00 3.16
7715 10760 6.820335 TCCATACTTCATACTCATCACAAGG 58.180 40.000 0.00 0.00 0.00 3.61
7716 10761 6.611236 TCCATACTTCATACTCATCACAAGGA 59.389 38.462 0.00 0.00 0.00 3.36
7717 10762 6.927936 CCATACTTCATACTCATCACAAGGAG 59.072 42.308 0.00 0.00 39.23 3.69
7718 10763 5.350504 ACTTCATACTCATCACAAGGAGG 57.649 43.478 0.00 0.00 37.63 4.30
7719 10764 4.163078 ACTTCATACTCATCACAAGGAGGG 59.837 45.833 0.00 0.00 37.63 4.30
7720 10765 3.994317 TCATACTCATCACAAGGAGGGA 58.006 45.455 0.00 0.00 37.63 4.20
7721 10766 3.963374 TCATACTCATCACAAGGAGGGAG 59.037 47.826 0.00 0.00 37.63 4.30
7722 10767 1.577736 ACTCATCACAAGGAGGGAGG 58.422 55.000 0.00 0.00 37.63 4.30
7723 10768 1.203364 ACTCATCACAAGGAGGGAGGT 60.203 52.381 0.00 0.00 37.63 3.85
7724 10769 1.209019 CTCATCACAAGGAGGGAGGTG 59.791 57.143 0.00 0.00 32.09 4.00
7725 10770 0.393537 CATCACAAGGAGGGAGGTGC 60.394 60.000 0.00 0.00 29.38 5.01
7726 10771 0.548682 ATCACAAGGAGGGAGGTGCT 60.549 55.000 0.00 0.00 29.38 4.40
7727 10772 1.002868 CACAAGGAGGGAGGTGCTG 60.003 63.158 0.00 0.00 0.00 4.41
7728 10773 2.227036 ACAAGGAGGGAGGTGCTGG 61.227 63.158 0.00 0.00 0.00 4.85
7729 10774 1.920325 CAAGGAGGGAGGTGCTGGA 60.920 63.158 0.00 0.00 0.00 3.86
7730 10775 1.083706 AAGGAGGGAGGTGCTGGAT 59.916 57.895 0.00 0.00 0.00 3.41
7731 10776 0.551131 AAGGAGGGAGGTGCTGGATT 60.551 55.000 0.00 0.00 0.00 3.01
7732 10777 0.551131 AGGAGGGAGGTGCTGGATTT 60.551 55.000 0.00 0.00 0.00 2.17
7733 10778 0.394899 GGAGGGAGGTGCTGGATTTG 60.395 60.000 0.00 0.00 0.00 2.32
7734 10779 0.394899 GAGGGAGGTGCTGGATTTGG 60.395 60.000 0.00 0.00 0.00 3.28
7735 10780 0.846427 AGGGAGGTGCTGGATTTGGA 60.846 55.000 0.00 0.00 0.00 3.53
7736 10781 0.394899 GGGAGGTGCTGGATTTGGAG 60.395 60.000 0.00 0.00 0.00 3.86
7737 10782 0.394899 GGAGGTGCTGGATTTGGAGG 60.395 60.000 0.00 0.00 0.00 4.30
7738 10783 0.620556 GAGGTGCTGGATTTGGAGGA 59.379 55.000 0.00 0.00 0.00 3.71
7739 10784 0.622665 AGGTGCTGGATTTGGAGGAG 59.377 55.000 0.00 0.00 0.00 3.69
7740 10785 0.394899 GGTGCTGGATTTGGAGGAGG 60.395 60.000 0.00 0.00 0.00 4.30
7741 10786 0.329596 GTGCTGGATTTGGAGGAGGT 59.670 55.000 0.00 0.00 0.00 3.85
7742 10787 0.329261 TGCTGGATTTGGAGGAGGTG 59.671 55.000 0.00 0.00 0.00 4.00
7743 10788 0.329596 GCTGGATTTGGAGGAGGTGT 59.670 55.000 0.00 0.00 0.00 4.16
7744 10789 1.680249 GCTGGATTTGGAGGAGGTGTC 60.680 57.143 0.00 0.00 0.00 3.67
7745 10790 0.613260 TGGATTTGGAGGAGGTGTCG 59.387 55.000 0.00 0.00 0.00 4.35
7746 10791 0.744771 GGATTTGGAGGAGGTGTCGC 60.745 60.000 0.00 0.00 0.00 5.19
7747 10792 0.250513 GATTTGGAGGAGGTGTCGCT 59.749 55.000 0.00 0.00 0.00 4.93
7748 10793 0.250513 ATTTGGAGGAGGTGTCGCTC 59.749 55.000 0.00 0.00 0.00 5.03
7749 10794 0.832135 TTTGGAGGAGGTGTCGCTCT 60.832 55.000 0.00 0.00 0.00 4.09
7750 10795 1.536073 TTGGAGGAGGTGTCGCTCTG 61.536 60.000 0.00 0.00 0.00 3.35
7751 10796 2.716017 GGAGGAGGTGTCGCTCTGG 61.716 68.421 0.00 0.00 0.00 3.86
7752 10797 3.363844 GAGGAGGTGTCGCTCTGGC 62.364 68.421 0.00 0.00 0.00 4.85
7753 10798 3.386237 GGAGGTGTCGCTCTGGCT 61.386 66.667 0.00 0.00 36.09 4.75
7754 10799 2.125753 GAGGTGTCGCTCTGGCTG 60.126 66.667 0.00 0.00 36.09 4.85
7755 10800 2.919856 AGGTGTCGCTCTGGCTGT 60.920 61.111 0.00 0.00 36.09 4.40
7756 10801 2.740055 GGTGTCGCTCTGGCTGTG 60.740 66.667 0.00 0.00 36.09 3.66
7757 10802 3.418068 GTGTCGCTCTGGCTGTGC 61.418 66.667 8.18 8.18 36.09 4.57
7794 10839 3.059982 TCCTGTTGGACCGAGCTG 58.940 61.111 0.00 0.00 37.46 4.24
7795 10840 2.743928 CCTGTTGGACCGAGCTGC 60.744 66.667 0.00 0.00 34.57 5.25
7796 10841 2.345244 CTGTTGGACCGAGCTGCT 59.655 61.111 0.00 0.00 0.00 4.24
7797 10842 2.031012 TGTTGGACCGAGCTGCTG 59.969 61.111 7.01 0.00 0.00 4.41
7798 10843 3.426568 GTTGGACCGAGCTGCTGC 61.427 66.667 7.01 7.62 40.05 5.25
7826 10871 1.294459 TGCTGCTGCAGTGTAGAGG 59.706 57.895 28.50 4.24 45.31 3.69
7827 10872 1.187567 TGCTGCTGCAGTGTAGAGGA 61.188 55.000 28.50 5.25 45.31 3.71
7828 10873 0.459934 GCTGCTGCAGTGTAGAGGAG 60.460 60.000 28.50 7.63 39.41 3.69
7829 10874 0.175302 CTGCTGCAGTGTAGAGGAGG 59.825 60.000 21.21 0.00 0.00 4.30
7830 10875 0.542938 TGCTGCAGTGTAGAGGAGGT 60.543 55.000 16.64 0.00 0.00 3.85
7831 10876 1.272480 TGCTGCAGTGTAGAGGAGGTA 60.272 52.381 16.64 0.00 0.00 3.08
7832 10877 1.825474 GCTGCAGTGTAGAGGAGGTAA 59.175 52.381 16.64 0.00 0.00 2.85
7833 10878 2.159170 GCTGCAGTGTAGAGGAGGTAAG 60.159 54.545 16.64 0.00 0.00 2.34
7834 10879 1.825474 TGCAGTGTAGAGGAGGTAAGC 59.175 52.381 0.00 0.00 0.00 3.09
7835 10880 1.202313 GCAGTGTAGAGGAGGTAAGCG 60.202 57.143 0.00 0.00 0.00 4.68
7836 10881 1.405821 CAGTGTAGAGGAGGTAAGCGG 59.594 57.143 0.00 0.00 0.00 5.52
7837 10882 0.102663 GTGTAGAGGAGGTAAGCGGC 59.897 60.000 0.00 0.00 0.00 6.53
7838 10883 1.041447 TGTAGAGGAGGTAAGCGGCC 61.041 60.000 0.00 0.00 0.00 6.13
7839 10884 0.756070 GTAGAGGAGGTAAGCGGCCT 60.756 60.000 0.00 0.00 39.42 5.19
7840 10885 0.755698 TAGAGGAGGTAAGCGGCCTG 60.756 60.000 0.00 0.00 36.29 4.85
7841 10886 3.083997 AGGAGGTAAGCGGCCTGG 61.084 66.667 0.00 0.00 36.29 4.45
7842 10887 3.081409 GGAGGTAAGCGGCCTGGA 61.081 66.667 0.00 0.00 36.29 3.86
7843 10888 2.501610 GAGGTAAGCGGCCTGGAG 59.498 66.667 0.00 0.00 36.29 3.86
7844 10889 3.741830 GAGGTAAGCGGCCTGGAGC 62.742 68.421 0.00 1.55 36.29 4.70
7884 10929 2.736670 GGTTCTCTACCCCATGCATT 57.263 50.000 0.00 0.00 41.43 3.56
7885 10930 3.857157 GGTTCTCTACCCCATGCATTA 57.143 47.619 0.00 0.00 41.43 1.90
7886 10931 3.744660 GGTTCTCTACCCCATGCATTAG 58.255 50.000 0.00 0.00 41.43 1.73
7887 10932 3.142174 GTTCTCTACCCCATGCATTAGC 58.858 50.000 0.00 0.00 42.57 3.09
7926 10971 9.784680 TCTATATACAGTTTTTCAAGTCGAGTC 57.215 33.333 0.00 0.00 0.00 3.36
7927 10972 9.790389 CTATATACAGTTTTTCAAGTCGAGTCT 57.210 33.333 0.00 0.00 0.00 3.24
7929 10974 5.720261 ACAGTTTTTCAAGTCGAGTCTTC 57.280 39.130 0.00 0.00 0.00 2.87
7930 10975 5.420409 ACAGTTTTTCAAGTCGAGTCTTCT 58.580 37.500 0.00 0.00 0.00 2.85
7931 10976 5.875359 ACAGTTTTTCAAGTCGAGTCTTCTT 59.125 36.000 0.00 0.00 0.00 2.52
7932 10977 6.371825 ACAGTTTTTCAAGTCGAGTCTTCTTT 59.628 34.615 0.00 0.00 0.00 2.52
7933 10978 7.094762 ACAGTTTTTCAAGTCGAGTCTTCTTTT 60.095 33.333 0.00 0.00 0.00 2.27
7934 10979 7.750903 CAGTTTTTCAAGTCGAGTCTTCTTTTT 59.249 33.333 0.00 0.00 0.00 1.94
7957 11002 8.484641 TTTTAGATGAGATGCAGTCTTAGTTG 57.515 34.615 0.00 0.00 37.29 3.16
7958 11003 5.674052 AGATGAGATGCAGTCTTAGTTGT 57.326 39.130 0.00 0.00 37.29 3.32
7959 11004 6.782082 AGATGAGATGCAGTCTTAGTTGTA 57.218 37.500 0.00 0.00 37.29 2.41
7960 11005 7.358770 AGATGAGATGCAGTCTTAGTTGTAT 57.641 36.000 0.00 0.00 37.29 2.29
7961 11006 7.432869 AGATGAGATGCAGTCTTAGTTGTATC 58.567 38.462 0.00 8.50 37.29 2.24
7962 11007 6.782082 TGAGATGCAGTCTTAGTTGTATCT 57.218 37.500 15.04 15.04 45.43 1.98
7963 11008 7.881775 TGAGATGCAGTCTTAGTTGTATCTA 57.118 36.000 15.07 6.47 43.67 1.98
7964 11009 8.293699 TGAGATGCAGTCTTAGTTGTATCTAA 57.706 34.615 15.07 9.01 43.67 2.10
7965 11010 8.918116 TGAGATGCAGTCTTAGTTGTATCTAAT 58.082 33.333 15.07 1.41 43.67 1.73
7966 11011 9.405587 GAGATGCAGTCTTAGTTGTATCTAATC 57.594 37.037 15.07 5.50 43.67 1.75
7967 11012 9.142014 AGATGCAGTCTTAGTTGTATCTAATCT 57.858 33.333 14.12 0.00 42.45 2.40
7968 11013 9.757227 GATGCAGTCTTAGTTGTATCTAATCTT 57.243 33.333 0.00 0.00 34.74 2.40
7969 11014 9.757227 ATGCAGTCTTAGTTGTATCTAATCTTC 57.243 33.333 0.00 0.00 30.89 2.87
7970 11015 8.972127 TGCAGTCTTAGTTGTATCTAATCTTCT 58.028 33.333 0.00 0.00 30.89 2.85
7978 11023 8.700439 AGTTGTATCTAATCTTCTACTCCCTC 57.300 38.462 0.00 0.00 0.00 4.30
7979 11024 7.726738 AGTTGTATCTAATCTTCTACTCCCTCC 59.273 40.741 0.00 0.00 0.00 4.30
7980 11025 6.239396 TGTATCTAATCTTCTACTCCCTCCG 58.761 44.000 0.00 0.00 0.00 4.63
7981 11026 4.792513 TCTAATCTTCTACTCCCTCCGT 57.207 45.455 0.00 0.00 0.00 4.69
7982 11027 4.716794 TCTAATCTTCTACTCCCTCCGTC 58.283 47.826 0.00 0.00 0.00 4.79
7983 11028 2.368311 ATCTTCTACTCCCTCCGTCC 57.632 55.000 0.00 0.00 0.00 4.79
7984 11029 0.258194 TCTTCTACTCCCTCCGTCCC 59.742 60.000 0.00 0.00 0.00 4.46
7985 11030 0.033405 CTTCTACTCCCTCCGTCCCA 60.033 60.000 0.00 0.00 0.00 4.37
7986 11031 0.635009 TTCTACTCCCTCCGTCCCAT 59.365 55.000 0.00 0.00 0.00 4.00
7987 11032 1.526315 TCTACTCCCTCCGTCCCATA 58.474 55.000 0.00 0.00 0.00 2.74
7988 11033 1.854939 TCTACTCCCTCCGTCCCATAA 59.145 52.381 0.00 0.00 0.00 1.90
7989 11034 2.449730 TCTACTCCCTCCGTCCCATAAT 59.550 50.000 0.00 0.00 0.00 1.28
7990 11035 1.424638 ACTCCCTCCGTCCCATAATG 58.575 55.000 0.00 0.00 0.00 1.90
7991 11036 1.344087 ACTCCCTCCGTCCCATAATGT 60.344 52.381 0.00 0.00 0.00 2.71
7992 11037 2.090943 ACTCCCTCCGTCCCATAATGTA 60.091 50.000 0.00 0.00 0.00 2.29
7993 11038 2.969950 CTCCCTCCGTCCCATAATGTAA 59.030 50.000 0.00 0.00 0.00 2.41
7994 11039 2.969950 TCCCTCCGTCCCATAATGTAAG 59.030 50.000 0.00 0.00 0.00 2.34
7995 11040 2.969950 CCCTCCGTCCCATAATGTAAGA 59.030 50.000 0.00 0.00 0.00 2.10
7996 11041 3.244112 CCCTCCGTCCCATAATGTAAGAC 60.244 52.174 0.00 0.00 0.00 3.01
7998 11043 3.025978 TCCGTCCCATAATGTAAGACGT 58.974 45.455 9.63 0.00 46.62 4.34
7999 11044 3.448301 TCCGTCCCATAATGTAAGACGTT 59.552 43.478 9.63 0.00 46.62 3.99
8000 11045 4.081531 TCCGTCCCATAATGTAAGACGTTT 60.082 41.667 9.63 0.00 46.62 3.60
8001 11046 4.632688 CCGTCCCATAATGTAAGACGTTTT 59.367 41.667 9.63 0.00 46.62 2.43
8002 11047 5.122711 CCGTCCCATAATGTAAGACGTTTTT 59.877 40.000 9.63 0.00 46.62 1.94
8047 11092 3.720949 CGTCTTACATTATGGGACGGA 57.279 47.619 20.50 2.30 43.69 4.69
8048 11093 3.639538 CGTCTTACATTATGGGACGGAG 58.360 50.000 20.50 2.74 43.69 4.63
8049 11094 3.552273 CGTCTTACATTATGGGACGGAGG 60.552 52.174 20.50 5.87 43.69 4.30
8050 11095 2.969950 TCTTACATTATGGGACGGAGGG 59.030 50.000 0.00 0.00 0.00 4.30
8051 11096 2.779429 TACATTATGGGACGGAGGGA 57.221 50.000 0.00 0.00 0.00 4.20
8052 11097 1.424638 ACATTATGGGACGGAGGGAG 58.575 55.000 0.00 0.00 0.00 4.30
8053 11098 1.344087 ACATTATGGGACGGAGGGAGT 60.344 52.381 0.00 0.00 0.00 3.85
8054 11099 2.090943 ACATTATGGGACGGAGGGAGTA 60.091 50.000 0.00 0.00 0.00 2.59
8055 11100 2.376695 TTATGGGACGGAGGGAGTAG 57.623 55.000 0.00 0.00 0.00 2.57
8056 11101 1.229131 TATGGGACGGAGGGAGTAGT 58.771 55.000 0.00 0.00 0.00 2.73
8057 11102 1.229131 ATGGGACGGAGGGAGTAGTA 58.771 55.000 0.00 0.00 0.00 1.82
8058 11103 1.002069 TGGGACGGAGGGAGTAGTAA 58.998 55.000 0.00 0.00 0.00 2.24
8059 11104 1.358787 TGGGACGGAGGGAGTAGTAAA 59.641 52.381 0.00 0.00 0.00 2.01
8060 11105 2.023695 TGGGACGGAGGGAGTAGTAAAT 60.024 50.000 0.00 0.00 0.00 1.40
8061 11106 3.205056 TGGGACGGAGGGAGTAGTAAATA 59.795 47.826 0.00 0.00 0.00 1.40
8062 11107 4.140853 TGGGACGGAGGGAGTAGTAAATAT 60.141 45.833 0.00 0.00 0.00 1.28
8063 11108 4.837298 GGGACGGAGGGAGTAGTAAATATT 59.163 45.833 0.00 0.00 0.00 1.28
8064 11109 5.306419 GGGACGGAGGGAGTAGTAAATATTT 59.694 44.000 5.89 5.89 0.00 1.40
8065 11110 6.494835 GGGACGGAGGGAGTAGTAAATATTTA 59.505 42.308 3.71 3.71 0.00 1.40
8066 11111 7.309683 GGGACGGAGGGAGTAGTAAATATTTAG 60.310 44.444 8.18 0.00 0.00 1.85
8067 11112 7.449704 GGACGGAGGGAGTAGTAAATATTTAGA 59.550 40.741 8.18 0.00 0.00 2.10
8068 11113 8.773033 ACGGAGGGAGTAGTAAATATTTAGAA 57.227 34.615 8.18 0.00 0.00 2.10
8069 11114 9.205513 ACGGAGGGAGTAGTAAATATTTAGAAA 57.794 33.333 8.18 0.00 0.00 2.52
8105 11150 3.923017 AGAATAACTTGGCTGCACAAC 57.077 42.857 0.50 0.00 0.00 3.32
8106 11151 3.221771 AGAATAACTTGGCTGCACAACA 58.778 40.909 0.50 0.00 0.00 3.33
8107 11152 4.261741 AAGAATAACTTGGCTGCACAACAG 60.262 41.667 0.50 0.00 42.45 3.16
8108 11153 6.440052 AAGAATAACTTGGCTGCACAACAGA 61.440 40.000 0.50 0.00 42.29 3.41
8118 11163 2.929641 TGCACAACAGACTTGGAATGA 58.070 42.857 0.00 0.00 0.00 2.57
8119 11164 2.618241 TGCACAACAGACTTGGAATGAC 59.382 45.455 0.00 0.00 0.00 3.06
8120 11165 2.030805 GCACAACAGACTTGGAATGACC 60.031 50.000 0.00 0.00 39.54 4.02
8129 11174 3.735704 TGGAATGACCAAAGCCGAA 57.264 47.368 0.00 0.00 46.75 4.30
8130 11175 1.243902 TGGAATGACCAAAGCCGAAC 58.756 50.000 0.00 0.00 46.75 3.95
8131 11176 1.243902 GGAATGACCAAAGCCGAACA 58.756 50.000 0.00 0.00 38.79 3.18
8132 11177 1.068541 GGAATGACCAAAGCCGAACAC 60.069 52.381 0.00 0.00 38.79 3.32
8133 11178 1.606668 GAATGACCAAAGCCGAACACA 59.393 47.619 0.00 0.00 0.00 3.72
8134 11179 1.686355 ATGACCAAAGCCGAACACAA 58.314 45.000 0.00 0.00 0.00 3.33
8135 11180 0.736053 TGACCAAAGCCGAACACAAC 59.264 50.000 0.00 0.00 0.00 3.32
8136 11181 0.736053 GACCAAAGCCGAACACAACA 59.264 50.000 0.00 0.00 0.00 3.33
8137 11182 1.336755 GACCAAAGCCGAACACAACAT 59.663 47.619 0.00 0.00 0.00 2.71
8138 11183 1.066908 ACCAAAGCCGAACACAACATG 59.933 47.619 0.00 0.00 0.00 3.21
8139 11184 1.066908 CCAAAGCCGAACACAACATGT 59.933 47.619 0.00 0.00 46.42 3.21
8154 11199 8.169977 ACACAACATGTTATTGATTCTCTTGT 57.830 30.769 20.77 5.90 38.98 3.16
8155 11200 8.292448 ACACAACATGTTATTGATTCTCTTGTC 58.708 33.333 20.77 0.00 38.98 3.18
8156 11201 8.509690 CACAACATGTTATTGATTCTCTTGTCT 58.490 33.333 11.53 0.00 0.00 3.41
8157 11202 8.509690 ACAACATGTTATTGATTCTCTTGTCTG 58.490 33.333 11.53 0.00 0.00 3.51
8158 11203 8.509690 CAACATGTTATTGATTCTCTTGTCTGT 58.490 33.333 11.53 0.00 0.00 3.41
8159 11204 8.627208 ACATGTTATTGATTCTCTTGTCTGTT 57.373 30.769 0.00 0.00 0.00 3.16
8160 11205 9.071276 ACATGTTATTGATTCTCTTGTCTGTTT 57.929 29.630 0.00 0.00 0.00 2.83
8161 11206 9.552114 CATGTTATTGATTCTCTTGTCTGTTTC 57.448 33.333 0.00 0.00 0.00 2.78
8162 11207 8.908786 TGTTATTGATTCTCTTGTCTGTTTCT 57.091 30.769 0.00 0.00 0.00 2.52
8163 11208 9.996554 TGTTATTGATTCTCTTGTCTGTTTCTA 57.003 29.630 0.00 0.00 0.00 2.10
8166 11211 7.953158 TTGATTCTCTTGTCTGTTTCTACTG 57.047 36.000 0.00 0.00 0.00 2.74
8167 11212 5.928839 TGATTCTCTTGTCTGTTTCTACTGC 59.071 40.000 0.00 0.00 0.00 4.40
8168 11213 5.537300 TTCTCTTGTCTGTTTCTACTGCT 57.463 39.130 0.00 0.00 0.00 4.24
8169 11214 5.537300 TCTCTTGTCTGTTTCTACTGCTT 57.463 39.130 0.00 0.00 0.00 3.91
8170 11215 6.650427 TCTCTTGTCTGTTTCTACTGCTTA 57.350 37.500 0.00 0.00 0.00 3.09
8171 11216 6.448006 TCTCTTGTCTGTTTCTACTGCTTAC 58.552 40.000 0.00 0.00 0.00 2.34
8172 11217 6.265649 TCTCTTGTCTGTTTCTACTGCTTACT 59.734 38.462 0.00 0.00 0.00 2.24
8173 11218 6.817184 TCTTGTCTGTTTCTACTGCTTACTT 58.183 36.000 0.00 0.00 0.00 2.24
8174 11219 7.272978 TCTTGTCTGTTTCTACTGCTTACTTT 58.727 34.615 0.00 0.00 0.00 2.66
8175 11220 8.418662 TCTTGTCTGTTTCTACTGCTTACTTTA 58.581 33.333 0.00 0.00 0.00 1.85
8176 11221 7.941795 TGTCTGTTTCTACTGCTTACTTTAC 57.058 36.000 0.00 0.00 0.00 2.01
8177 11222 7.494211 TGTCTGTTTCTACTGCTTACTTTACA 58.506 34.615 0.00 0.00 0.00 2.41
8178 11223 8.148351 TGTCTGTTTCTACTGCTTACTTTACAT 58.852 33.333 0.00 0.00 0.00 2.29
8179 11224 9.635520 GTCTGTTTCTACTGCTTACTTTACATA 57.364 33.333 0.00 0.00 0.00 2.29
8182 11227 9.991906 TGTTTCTACTGCTTACTTTACATAACT 57.008 29.630 0.00 0.00 0.00 2.24
8209 11254 4.871993 AAAAACATTTCACGCATGCAAA 57.128 31.818 19.57 11.27 0.00 3.68
8210 11255 5.421212 AAAAACATTTCACGCATGCAAAT 57.579 30.435 19.57 13.14 0.00 2.32
8211 11256 5.421212 AAAACATTTCACGCATGCAAATT 57.579 30.435 19.57 0.60 0.00 1.82
8212 11257 5.421212 AAACATTTCACGCATGCAAATTT 57.579 30.435 19.57 6.65 0.00 1.82
8213 11258 4.650545 ACATTTCACGCATGCAAATTTC 57.349 36.364 19.57 0.00 0.00 2.17
8214 11259 4.056740 ACATTTCACGCATGCAAATTTCA 58.943 34.783 19.57 0.00 0.00 2.69
8215 11260 4.691685 ACATTTCACGCATGCAAATTTCAT 59.308 33.333 19.57 0.00 0.00 2.57
8216 11261 5.179742 ACATTTCACGCATGCAAATTTCATT 59.820 32.000 19.57 0.00 0.00 2.57
8217 11262 4.648917 TTCACGCATGCAAATTTCATTG 57.351 36.364 19.57 0.00 0.00 2.82
8218 11263 3.651206 TCACGCATGCAAATTTCATTGT 58.349 36.364 19.57 0.00 32.80 2.71
8219 11264 3.429207 TCACGCATGCAAATTTCATTGTG 59.571 39.130 19.57 12.95 32.95 3.33
8220 11265 2.158058 ACGCATGCAAATTTCATTGTGC 59.842 40.909 19.57 0.00 37.51 4.57
8221 11266 2.474856 CGCATGCAAATTTCATTGTGCC 60.475 45.455 19.57 0.00 36.12 5.01
8222 11267 2.484651 GCATGCAAATTTCATTGTGCCA 59.515 40.909 14.21 0.00 36.12 4.92
8223 11268 3.127895 GCATGCAAATTTCATTGTGCCAT 59.872 39.130 14.21 0.00 36.12 4.40
8224 11269 4.657055 CATGCAAATTTCATTGTGCCATG 58.343 39.130 0.00 0.00 36.12 3.66
8225 11270 4.004196 TGCAAATTTCATTGTGCCATGA 57.996 36.364 0.00 0.00 36.12 3.07
8226 11271 4.580868 TGCAAATTTCATTGTGCCATGAT 58.419 34.783 0.00 0.00 36.12 2.45
8227 11272 5.731591 TGCAAATTTCATTGTGCCATGATA 58.268 33.333 0.00 0.00 36.12 2.15
8228 11273 6.350103 TGCAAATTTCATTGTGCCATGATAT 58.650 32.000 0.00 0.00 36.12 1.63
8229 11274 6.480651 TGCAAATTTCATTGTGCCATGATATC 59.519 34.615 0.00 0.00 36.12 1.63
8230 11275 6.704493 GCAAATTTCATTGTGCCATGATATCT 59.296 34.615 3.98 0.00 32.80 1.98
8231 11276 7.868922 GCAAATTTCATTGTGCCATGATATCTA 59.131 33.333 3.98 0.00 32.80 1.98
8232 11277 9.406828 CAAATTTCATTGTGCCATGATATCTAG 57.593 33.333 3.98 0.00 0.00 2.43
8233 11278 6.564709 TTTCATTGTGCCATGATATCTAGC 57.435 37.500 3.98 4.91 0.00 3.42
8234 11279 5.494390 TCATTGTGCCATGATATCTAGCT 57.506 39.130 3.98 0.00 0.00 3.32
8235 11280 5.243207 TCATTGTGCCATGATATCTAGCTG 58.757 41.667 3.98 0.00 0.00 4.24
8236 11281 4.961438 TTGTGCCATGATATCTAGCTGA 57.039 40.909 3.98 0.00 0.00 4.26
8237 11282 4.263018 TGTGCCATGATATCTAGCTGAC 57.737 45.455 3.98 1.09 0.00 3.51
8238 11283 3.642848 TGTGCCATGATATCTAGCTGACA 59.357 43.478 3.98 3.44 0.00 3.58
8239 11284 4.285260 TGTGCCATGATATCTAGCTGACAT 59.715 41.667 3.98 0.00 0.00 3.06
8240 11285 4.869297 GTGCCATGATATCTAGCTGACATC 59.131 45.833 3.98 0.00 0.00 3.06
8241 11286 4.081254 TGCCATGATATCTAGCTGACATCC 60.081 45.833 3.98 0.00 27.84 3.51
8242 11287 4.081254 GCCATGATATCTAGCTGACATCCA 60.081 45.833 3.98 0.00 27.84 3.41
8243 11288 5.417811 CCATGATATCTAGCTGACATCCAC 58.582 45.833 3.98 0.00 27.84 4.02
8244 11289 5.046807 CCATGATATCTAGCTGACATCCACA 60.047 44.000 3.98 0.00 27.84 4.17
8245 11290 6.351966 CCATGATATCTAGCTGACATCCACAT 60.352 42.308 3.98 0.00 27.84 3.21
8246 11291 6.034161 TGATATCTAGCTGACATCCACATG 57.966 41.667 3.98 0.00 35.92 3.21
8247 11292 5.776716 TGATATCTAGCTGACATCCACATGA 59.223 40.000 0.00 0.00 33.72 3.07
8248 11293 3.808466 TCTAGCTGACATCCACATGAC 57.192 47.619 0.00 0.00 33.72 3.06
8249 11294 3.369175 TCTAGCTGACATCCACATGACT 58.631 45.455 0.00 0.00 33.72 3.41
8250 11295 3.771479 TCTAGCTGACATCCACATGACTT 59.229 43.478 0.00 0.00 33.72 3.01
8251 11296 4.956075 TCTAGCTGACATCCACATGACTTA 59.044 41.667 0.00 0.00 33.72 2.24
8252 11297 4.134379 AGCTGACATCCACATGACTTAG 57.866 45.455 0.00 0.00 33.72 2.18
8253 11298 3.517100 AGCTGACATCCACATGACTTAGT 59.483 43.478 0.00 0.00 33.72 2.24
8254 11299 3.868077 GCTGACATCCACATGACTTAGTC 59.132 47.826 5.27 5.27 33.72 2.59
8255 11300 4.621510 GCTGACATCCACATGACTTAGTCA 60.622 45.833 17.87 17.87 46.90 3.41
8256 11301 5.482006 CTGACATCCACATGACTTAGTCAA 58.518 41.667 19.42 2.50 45.96 3.18
8257 11302 6.053632 TGACATCCACATGACTTAGTCAAT 57.946 37.500 19.42 7.86 45.96 2.57
8258 11303 6.108687 TGACATCCACATGACTTAGTCAATC 58.891 40.000 19.42 7.49 45.96 2.67
8259 11304 6.053632 ACATCCACATGACTTAGTCAATCA 57.946 37.500 19.42 2.59 45.96 2.57
8260 11305 6.656902 ACATCCACATGACTTAGTCAATCAT 58.343 36.000 19.42 0.00 45.96 2.45
8265 11310 4.829808 CATGACTTAGTCAATCATGTGCG 58.170 43.478 19.42 0.00 45.96 5.34
8266 11311 2.672874 TGACTTAGTCAATCATGTGCGC 59.327 45.455 13.16 0.00 39.78 6.09
8267 11312 2.672874 GACTTAGTCAATCATGTGCGCA 59.327 45.455 5.66 5.66 32.09 6.09
8268 11313 2.674852 ACTTAGTCAATCATGTGCGCAG 59.325 45.455 12.22 0.00 0.00 5.18
8269 11314 1.655484 TAGTCAATCATGTGCGCAGG 58.345 50.000 12.22 5.36 0.00 4.85
8270 11315 1.226491 GTCAATCATGTGCGCAGGC 60.226 57.895 12.22 0.00 40.52 4.85
8271 11316 1.377594 TCAATCATGTGCGCAGGCT 60.378 52.632 12.22 0.00 40.82 4.58
8272 11317 0.107752 TCAATCATGTGCGCAGGCTA 60.108 50.000 12.22 0.00 40.82 3.93
8273 11318 0.734309 CAATCATGTGCGCAGGCTAA 59.266 50.000 12.22 0.00 40.82 3.09
8274 11319 0.734889 AATCATGTGCGCAGGCTAAC 59.265 50.000 12.22 0.00 40.82 2.34
8275 11320 0.392863 ATCATGTGCGCAGGCTAACA 60.393 50.000 12.22 3.96 40.82 2.41
8276 11321 0.392863 TCATGTGCGCAGGCTAACAT 60.393 50.000 12.22 6.74 36.53 2.71
8277 11322 0.452987 CATGTGCGCAGGCTAACATT 59.547 50.000 12.22 0.00 34.59 2.71
8278 11323 0.452987 ATGTGCGCAGGCTAACATTG 59.547 50.000 12.22 0.00 40.82 2.82
8279 11324 1.514873 GTGCGCAGGCTAACATTGC 60.515 57.895 12.22 0.00 40.82 3.56
8280 11325 1.675310 TGCGCAGGCTAACATTGCT 60.675 52.632 5.66 0.00 40.82 3.91
8281 11326 1.226491 GCGCAGGCTAACATTGCTG 60.226 57.895 0.30 0.00 35.73 4.41
8282 11327 1.926511 GCGCAGGCTAACATTGCTGT 61.927 55.000 0.30 0.00 35.73 4.40
8284 11329 1.466360 CGCAGGCTAACATTGCTGTTC 60.466 52.381 0.00 0.00 44.43 3.18
8285 11330 1.135286 GCAGGCTAACATTGCTGTTCC 60.135 52.381 0.00 0.00 44.43 3.62
8286 11331 2.161855 CAGGCTAACATTGCTGTTCCA 58.838 47.619 0.00 0.00 44.43 3.53
8287 11332 2.163010 CAGGCTAACATTGCTGTTCCAG 59.837 50.000 0.00 0.00 44.43 3.86
8288 11333 2.040278 AGGCTAACATTGCTGTTCCAGA 59.960 45.455 0.00 0.00 44.43 3.86
8289 11334 2.819608 GGCTAACATTGCTGTTCCAGAA 59.180 45.455 0.00 0.00 44.43 3.02
8290 11335 3.445096 GGCTAACATTGCTGTTCCAGAAT 59.555 43.478 0.00 0.00 44.43 2.40
8291 11336 4.418392 GCTAACATTGCTGTTCCAGAATG 58.582 43.478 0.00 11.45 44.43 2.67
8323 11368 4.336713 AGAACAGTTTCTTTCAGACCAAGC 59.663 41.667 0.00 0.00 39.17 4.01
8324 11369 2.614057 ACAGTTTCTTTCAGACCAAGCG 59.386 45.455 0.00 0.00 0.00 4.68
8325 11370 2.031682 CAGTTTCTTTCAGACCAAGCGG 60.032 50.000 0.00 0.00 38.77 5.52
8326 11371 2.158813 AGTTTCTTTCAGACCAAGCGGA 60.159 45.455 0.00 0.00 35.59 5.54
8327 11372 2.814336 GTTTCTTTCAGACCAAGCGGAT 59.186 45.455 0.00 0.00 35.59 4.18
8328 11373 2.859165 TCTTTCAGACCAAGCGGATT 57.141 45.000 0.00 0.00 35.59 3.01
8329 11374 2.699954 TCTTTCAGACCAAGCGGATTC 58.300 47.619 0.00 0.00 35.59 2.52
8330 11375 2.303022 TCTTTCAGACCAAGCGGATTCT 59.697 45.455 0.00 0.00 35.59 2.40
8331 11376 2.386661 TTCAGACCAAGCGGATTCTC 57.613 50.000 0.00 0.00 35.59 2.87
8332 11377 1.266178 TCAGACCAAGCGGATTCTCA 58.734 50.000 0.00 0.00 35.59 3.27
8333 11378 1.623311 TCAGACCAAGCGGATTCTCAA 59.377 47.619 0.00 0.00 35.59 3.02
8334 11379 2.005451 CAGACCAAGCGGATTCTCAAG 58.995 52.381 0.00 0.00 35.59 3.02
8335 11380 1.065854 AGACCAAGCGGATTCTCAAGG 60.066 52.381 0.00 0.00 35.59 3.61
8336 11381 0.984230 ACCAAGCGGATTCTCAAGGA 59.016 50.000 0.00 0.00 35.59 3.36
8337 11382 1.065854 ACCAAGCGGATTCTCAAGGAG 60.066 52.381 0.00 0.00 35.59 3.69
8338 11383 1.012841 CAAGCGGATTCTCAAGGAGC 58.987 55.000 0.00 0.00 0.00 4.70
8339 11384 0.460987 AAGCGGATTCTCAAGGAGCG 60.461 55.000 0.00 0.00 0.00 5.03
8340 11385 1.153549 GCGGATTCTCAAGGAGCGT 60.154 57.895 0.00 0.00 0.00 5.07
8341 11386 0.102481 GCGGATTCTCAAGGAGCGTA 59.898 55.000 0.00 0.00 0.00 4.42
8342 11387 1.841450 CGGATTCTCAAGGAGCGTAC 58.159 55.000 0.00 0.00 0.00 3.67
8343 11388 1.405821 CGGATTCTCAAGGAGCGTACT 59.594 52.381 0.00 0.00 0.00 2.73
8344 11389 2.541999 CGGATTCTCAAGGAGCGTACTC 60.542 54.545 0.00 0.00 42.66 2.59
8345 11390 2.691011 GGATTCTCAAGGAGCGTACTCT 59.309 50.000 0.00 0.00 42.98 3.24
8346 11391 3.131400 GGATTCTCAAGGAGCGTACTCTT 59.869 47.826 0.00 0.00 42.98 2.85
8347 11392 4.338682 GGATTCTCAAGGAGCGTACTCTTA 59.661 45.833 0.00 0.00 42.98 2.10
8348 11393 5.010213 GGATTCTCAAGGAGCGTACTCTTAT 59.990 44.000 0.00 0.00 42.98 1.73
8349 11394 4.902443 TCTCAAGGAGCGTACTCTTATG 57.098 45.455 0.00 0.00 42.98 1.90
8350 11395 3.632604 TCTCAAGGAGCGTACTCTTATGG 59.367 47.826 0.00 0.00 42.98 2.74
8351 11396 2.693591 TCAAGGAGCGTACTCTTATGGG 59.306 50.000 0.00 0.00 42.98 4.00
8352 11397 1.705873 AGGAGCGTACTCTTATGGGG 58.294 55.000 0.00 0.00 42.98 4.96
8353 11398 0.680061 GGAGCGTACTCTTATGGGGG 59.320 60.000 0.00 0.00 42.98 5.40
8354 11399 1.700955 GAGCGTACTCTTATGGGGGA 58.299 55.000 0.00 0.00 40.03 4.81
8355 11400 2.037144 GAGCGTACTCTTATGGGGGAA 58.963 52.381 0.00 0.00 40.03 3.97
8356 11401 2.036089 GAGCGTACTCTTATGGGGGAAG 59.964 54.545 0.00 0.00 40.03 3.46
8357 11402 2.037144 GCGTACTCTTATGGGGGAAGA 58.963 52.381 0.00 0.00 0.00 2.87
8362 11407 3.053359 CTCTTATGGGGGAAGAGGTCT 57.947 52.381 4.77 0.00 44.14 3.85
8363 11408 2.969262 CTCTTATGGGGGAAGAGGTCTC 59.031 54.545 4.77 0.00 44.14 3.36
8364 11409 2.317900 TCTTATGGGGGAAGAGGTCTCA 59.682 50.000 0.55 0.00 0.00 3.27
8365 11410 2.961536 TATGGGGGAAGAGGTCTCAA 57.038 50.000 0.55 0.00 0.00 3.02
8366 11411 1.589414 ATGGGGGAAGAGGTCTCAAG 58.411 55.000 0.55 0.00 0.00 3.02
8367 11412 0.193574 TGGGGGAAGAGGTCTCAAGT 59.806 55.000 0.55 0.00 0.00 3.16
8368 11413 0.906066 GGGGGAAGAGGTCTCAAGTC 59.094 60.000 0.55 0.00 0.00 3.01
8369 11414 0.906066 GGGGAAGAGGTCTCAAGTCC 59.094 60.000 0.55 4.28 0.00 3.85
8370 11415 1.553651 GGGGAAGAGGTCTCAAGTCCT 60.554 57.143 12.14 0.00 36.30 3.85
8371 11416 1.552792 GGGAAGAGGTCTCAAGTCCTG 59.447 57.143 0.31 0.00 33.78 3.86
8372 11417 2.530701 GGAAGAGGTCTCAAGTCCTGA 58.469 52.381 0.31 0.00 33.78 3.86
8373 11418 2.232696 GGAAGAGGTCTCAAGTCCTGAC 59.767 54.545 0.31 0.00 33.78 3.51
8374 11419 2.990740 AGAGGTCTCAAGTCCTGACT 57.009 50.000 0.31 0.00 44.94 3.41
8375 11420 2.524306 AGAGGTCTCAAGTCCTGACTG 58.476 52.381 0.00 0.00 41.58 3.51
8376 11421 2.109128 AGAGGTCTCAAGTCCTGACTGA 59.891 50.000 0.00 0.75 41.58 3.41
8377 11422 2.230266 GAGGTCTCAAGTCCTGACTGAC 59.770 54.545 0.00 4.41 41.58 3.51
8378 11423 1.273886 GGTCTCAAGTCCTGACTGACC 59.726 57.143 15.43 15.43 41.60 4.02
8379 11424 1.273886 GTCTCAAGTCCTGACTGACCC 59.726 57.143 0.00 0.00 41.58 4.46
8380 11425 1.133167 TCTCAAGTCCTGACTGACCCA 60.133 52.381 0.00 0.00 41.58 4.51
8381 11426 1.905215 CTCAAGTCCTGACTGACCCAT 59.095 52.381 0.00 0.00 41.58 4.00
8382 11427 1.625315 TCAAGTCCTGACTGACCCATG 59.375 52.381 0.00 0.00 41.58 3.66
8383 11428 1.349026 CAAGTCCTGACTGACCCATGT 59.651 52.381 0.00 0.00 41.58 3.21
8384 11429 1.270907 AGTCCTGACTGACCCATGTC 58.729 55.000 0.00 0.00 40.75 3.06
8397 11442 2.642139 CCATGTCATGGTTCTTGTGC 57.358 50.000 21.98 0.00 45.54 4.57
8398 11443 1.203052 CCATGTCATGGTTCTTGTGCC 59.797 52.381 21.98 0.00 45.54 5.01
8399 11444 2.165167 CATGTCATGGTTCTTGTGCCT 58.835 47.619 4.78 0.00 0.00 4.75
8400 11445 1.608055 TGTCATGGTTCTTGTGCCTG 58.392 50.000 0.00 0.00 0.00 4.85
8401 11446 1.142667 TGTCATGGTTCTTGTGCCTGA 59.857 47.619 0.00 0.00 0.00 3.86
8402 11447 1.537202 GTCATGGTTCTTGTGCCTGAC 59.463 52.381 0.00 0.00 0.00 3.51
8403 11448 0.518636 CATGGTTCTTGTGCCTGACG 59.481 55.000 0.00 0.00 0.00 4.35
8404 11449 0.396435 ATGGTTCTTGTGCCTGACGA 59.604 50.000 0.00 0.00 0.00 4.20
8405 11450 0.249868 TGGTTCTTGTGCCTGACGAG 60.250 55.000 0.00 0.00 37.42 4.18
8406 11451 0.033504 GGTTCTTGTGCCTGACGAGA 59.966 55.000 0.00 0.00 42.57 4.04
8407 11452 1.423395 GTTCTTGTGCCTGACGAGAG 58.577 55.000 0.00 0.00 44.57 3.20
8408 11453 0.318441 TTCTTGTGCCTGACGAGAGG 59.682 55.000 0.00 0.00 44.57 3.69
8409 11454 0.539669 TCTTGTGCCTGACGAGAGGA 60.540 55.000 8.44 0.00 39.82 3.71
8410 11455 0.318441 CTTGTGCCTGACGAGAGGAA 59.682 55.000 8.44 0.00 38.26 3.36
8411 11456 0.033504 TTGTGCCTGACGAGAGGAAC 59.966 55.000 8.27 8.27 41.73 3.62
8412 11457 1.079750 GTGCCTGACGAGAGGAACC 60.080 63.158 8.44 0.00 35.74 3.62
8413 11458 2.283529 TGCCTGACGAGAGGAACCC 61.284 63.158 8.44 0.00 34.69 4.11
8414 11459 2.283529 GCCTGACGAGAGGAACCCA 61.284 63.158 8.44 0.00 34.69 4.51
8415 11460 1.617947 GCCTGACGAGAGGAACCCAT 61.618 60.000 8.44 0.00 34.69 4.00
8416 11461 0.176680 CCTGACGAGAGGAACCCATG 59.823 60.000 0.00 0.00 34.69 3.66
8417 11462 0.460987 CTGACGAGAGGAACCCATGC 60.461 60.000 0.00 0.00 0.00 4.06
8418 11463 0.904865 TGACGAGAGGAACCCATGCT 60.905 55.000 0.00 0.00 0.00 3.79
8419 11464 0.250513 GACGAGAGGAACCCATGCTT 59.749 55.000 0.00 0.00 0.00 3.91
8420 11465 0.693049 ACGAGAGGAACCCATGCTTT 59.307 50.000 0.00 0.00 0.00 3.51
8421 11466 1.906574 ACGAGAGGAACCCATGCTTTA 59.093 47.619 0.00 0.00 0.00 1.85
8422 11467 2.505819 ACGAGAGGAACCCATGCTTTAT 59.494 45.455 0.00 0.00 0.00 1.40
8423 11468 3.709653 ACGAGAGGAACCCATGCTTTATA 59.290 43.478 0.00 0.00 0.00 0.98
8424 11469 4.348168 ACGAGAGGAACCCATGCTTTATAT 59.652 41.667 0.00 0.00 0.00 0.86
8425 11470 5.163195 ACGAGAGGAACCCATGCTTTATATT 60.163 40.000 0.00 0.00 0.00 1.28
8426 11471 5.409826 CGAGAGGAACCCATGCTTTATATTC 59.590 44.000 0.00 0.00 0.00 1.75
8427 11472 5.635120 AGAGGAACCCATGCTTTATATTCC 58.365 41.667 0.00 0.00 35.40 3.01
8428 11473 4.740902 AGGAACCCATGCTTTATATTCCC 58.259 43.478 0.00 0.00 35.72 3.97
8429 11474 3.832490 GGAACCCATGCTTTATATTCCCC 59.168 47.826 0.00 0.00 0.00 4.81
8430 11475 3.154827 ACCCATGCTTTATATTCCCCG 57.845 47.619 0.00 0.00 0.00 5.73
8431 11476 2.445525 ACCCATGCTTTATATTCCCCGT 59.554 45.455 0.00 0.00 0.00 5.28
8432 11477 3.081804 CCCATGCTTTATATTCCCCGTC 58.918 50.000 0.00 0.00 0.00 4.79
8433 11478 3.497763 CCCATGCTTTATATTCCCCGTCA 60.498 47.826 0.00 0.00 0.00 4.35
8434 11479 3.753272 CCATGCTTTATATTCCCCGTCAG 59.247 47.826 0.00 0.00 0.00 3.51
8435 11480 2.846193 TGCTTTATATTCCCCGTCAGC 58.154 47.619 0.00 0.00 0.00 4.26
8436 11481 2.438021 TGCTTTATATTCCCCGTCAGCT 59.562 45.455 0.00 0.00 0.00 4.24
8437 11482 3.118038 TGCTTTATATTCCCCGTCAGCTT 60.118 43.478 0.00 0.00 0.00 3.74
8438 11483 3.883489 GCTTTATATTCCCCGTCAGCTTT 59.117 43.478 0.00 0.00 0.00 3.51
8439 11484 4.261197 GCTTTATATTCCCCGTCAGCTTTG 60.261 45.833 0.00 0.00 0.00 2.77
8440 11485 4.764050 TTATATTCCCCGTCAGCTTTGA 57.236 40.909 0.00 0.00 0.00 2.69
8441 11486 2.396590 TATTCCCCGTCAGCTTTGAC 57.603 50.000 0.00 0.00 35.59 3.18
8442 11487 0.322546 ATTCCCCGTCAGCTTTGACC 60.323 55.000 0.86 0.00 35.52 4.02
8443 11488 2.359975 CCCCGTCAGCTTTGACCC 60.360 66.667 0.86 0.00 35.52 4.46
8444 11489 2.359975 CCCGTCAGCTTTGACCCC 60.360 66.667 0.86 0.00 35.52 4.95
8445 11490 2.742372 CCGTCAGCTTTGACCCCG 60.742 66.667 0.86 0.00 35.52 5.73
8446 11491 2.030562 CGTCAGCTTTGACCCCGT 59.969 61.111 0.86 0.00 35.52 5.28
8447 11492 1.290955 CGTCAGCTTTGACCCCGTA 59.709 57.895 0.86 0.00 35.52 4.02
8448 11493 0.320073 CGTCAGCTTTGACCCCGTAA 60.320 55.000 0.86 0.00 35.52 3.18
8449 11494 1.439679 GTCAGCTTTGACCCCGTAAG 58.560 55.000 0.00 0.00 32.97 2.34
8450 11495 1.053424 TCAGCTTTGACCCCGTAAGT 58.947 50.000 0.00 0.00 0.00 2.24
8451 11496 2.028748 GTCAGCTTTGACCCCGTAAGTA 60.029 50.000 0.00 0.00 32.97 2.24
8452 11497 2.633967 TCAGCTTTGACCCCGTAAGTAA 59.366 45.455 0.00 0.00 0.00 2.24
8453 11498 3.000727 CAGCTTTGACCCCGTAAGTAAG 58.999 50.000 0.00 0.00 0.00 2.34
8454 11499 2.901839 AGCTTTGACCCCGTAAGTAAGA 59.098 45.455 0.00 0.00 0.00 2.10
8455 11500 3.518303 AGCTTTGACCCCGTAAGTAAGAT 59.482 43.478 0.00 0.00 0.00 2.40
8456 11501 4.019591 AGCTTTGACCCCGTAAGTAAGATT 60.020 41.667 0.00 0.00 0.00 2.40
8457 11502 5.188359 AGCTTTGACCCCGTAAGTAAGATTA 59.812 40.000 0.00 0.00 0.00 1.75
8458 11503 6.053650 GCTTTGACCCCGTAAGTAAGATTAT 58.946 40.000 0.00 0.00 0.00 1.28
8459 11504 6.541278 GCTTTGACCCCGTAAGTAAGATTATT 59.459 38.462 0.00 0.00 0.00 1.40
8460 11505 7.712205 GCTTTGACCCCGTAAGTAAGATTATTA 59.288 37.037 0.00 0.00 0.00 0.98
8461 11506 8.947055 TTTGACCCCGTAAGTAAGATTATTAC 57.053 34.615 0.00 0.00 0.00 1.89
8462 11507 7.902920 TGACCCCGTAAGTAAGATTATTACT 57.097 36.000 0.00 0.00 36.85 2.24
8463 11508 8.310122 TGACCCCGTAAGTAAGATTATTACTT 57.690 34.615 17.73 17.73 44.59 2.24
8464 11509 8.761689 TGACCCCGTAAGTAAGATTATTACTTT 58.238 33.333 18.57 3.26 41.04 2.66
8465 11510 9.254133 GACCCCGTAAGTAAGATTATTACTTTC 57.746 37.037 18.57 13.66 41.04 2.62
8466 11511 8.761689 ACCCCGTAAGTAAGATTATTACTTTCA 58.238 33.333 18.57 2.83 41.04 2.69
8467 11512 9.603921 CCCCGTAAGTAAGATTATTACTTTCAA 57.396 33.333 18.57 2.21 41.04 2.69
8474 11519 9.583765 AGTAAGATTATTACTTTCAACTCGACC 57.416 33.333 0.00 0.00 31.68 4.79
8475 11520 9.362539 GTAAGATTATTACTTTCAACTCGACCA 57.637 33.333 0.00 0.00 0.00 4.02
8477 11522 9.449719 AAGATTATTACTTTCAACTCGACCATT 57.550 29.630 0.00 0.00 0.00 3.16
8478 11523 9.449719 AGATTATTACTTTCAACTCGACCATTT 57.550 29.630 0.00 0.00 0.00 2.32
8479 11524 9.704098 GATTATTACTTTCAACTCGACCATTTC 57.296 33.333 0.00 0.00 0.00 2.17
8480 11525 8.842358 TTATTACTTTCAACTCGACCATTTCT 57.158 30.769 0.00 0.00 0.00 2.52
8481 11526 7.745620 ATTACTTTCAACTCGACCATTTCTT 57.254 32.000 0.00 0.00 0.00 2.52
8482 11527 7.562454 TTACTTTCAACTCGACCATTTCTTT 57.438 32.000 0.00 0.00 0.00 2.52
8483 11528 6.451064 ACTTTCAACTCGACCATTTCTTTT 57.549 33.333 0.00 0.00 0.00 2.27
8484 11529 6.863275 ACTTTCAACTCGACCATTTCTTTTT 58.137 32.000 0.00 0.00 0.00 1.94
8485 11530 6.972901 ACTTTCAACTCGACCATTTCTTTTTC 59.027 34.615 0.00 0.00 0.00 2.29
8486 11531 6.693315 TTCAACTCGACCATTTCTTTTTCT 57.307 33.333 0.00 0.00 0.00 2.52
8487 11532 6.060028 TCAACTCGACCATTTCTTTTTCTG 57.940 37.500 0.00 0.00 0.00 3.02
8488 11533 5.588648 TCAACTCGACCATTTCTTTTTCTGT 59.411 36.000 0.00 0.00 0.00 3.41
8489 11534 5.674933 ACTCGACCATTTCTTTTTCTGTC 57.325 39.130 0.00 0.00 0.00 3.51
8490 11535 5.123227 ACTCGACCATTTCTTTTTCTGTCA 58.877 37.500 0.00 0.00 0.00 3.58
8491 11536 5.588648 ACTCGACCATTTCTTTTTCTGTCAA 59.411 36.000 0.00 0.00 0.00 3.18
8492 11537 6.263168 ACTCGACCATTTCTTTTTCTGTCAAT 59.737 34.615 0.00 0.00 0.00 2.57
8493 11538 6.437928 TCGACCATTTCTTTTTCTGTCAATG 58.562 36.000 0.00 0.00 0.00 2.82
8494 11539 5.117592 CGACCATTTCTTTTTCTGTCAATGC 59.882 40.000 0.00 0.00 0.00 3.56
8495 11540 6.165700 ACCATTTCTTTTTCTGTCAATGCT 57.834 33.333 0.00 0.00 0.00 3.79
8496 11541 6.218746 ACCATTTCTTTTTCTGTCAATGCTC 58.781 36.000 0.00 0.00 0.00 4.26
8497 11542 5.344128 CCATTTCTTTTTCTGTCAATGCTCG 59.656 40.000 0.00 0.00 0.00 5.03
8498 11543 5.749596 TTTCTTTTTCTGTCAATGCTCGA 57.250 34.783 0.00 0.00 0.00 4.04
8499 11544 5.947228 TTCTTTTTCTGTCAATGCTCGAT 57.053 34.783 0.00 0.00 0.00 3.59
8500 11545 5.947228 TCTTTTTCTGTCAATGCTCGATT 57.053 34.783 0.00 0.00 0.00 3.34
8501 11546 5.931532 TCTTTTTCTGTCAATGCTCGATTC 58.068 37.500 0.00 0.00 0.00 2.52
8502 11547 3.997319 TTTCTGTCAATGCTCGATTCG 57.003 42.857 0.00 0.00 0.00 3.34
8503 11548 2.654749 TCTGTCAATGCTCGATTCGT 57.345 45.000 5.89 0.00 0.00 3.85
8504 11549 2.959516 TCTGTCAATGCTCGATTCGTT 58.040 42.857 5.89 0.00 0.00 3.85
8505 11550 2.923655 TCTGTCAATGCTCGATTCGTTC 59.076 45.455 5.89 0.06 0.00 3.95
8506 11551 2.667969 CTGTCAATGCTCGATTCGTTCA 59.332 45.455 5.89 5.80 0.00 3.18
8507 11552 3.261580 TGTCAATGCTCGATTCGTTCAT 58.738 40.909 5.89 7.78 0.00 2.57
8508 11553 3.062504 TGTCAATGCTCGATTCGTTCATG 59.937 43.478 5.89 0.00 0.00 3.07
8509 11554 3.062639 GTCAATGCTCGATTCGTTCATGT 59.937 43.478 5.89 0.86 0.00 3.21
8510 11555 4.267690 GTCAATGCTCGATTCGTTCATGTA 59.732 41.667 5.89 1.27 0.00 2.29
8511 11556 5.049828 TCAATGCTCGATTCGTTCATGTAT 58.950 37.500 5.89 0.00 0.00 2.29
8512 11557 4.979564 ATGCTCGATTCGTTCATGTATG 57.020 40.909 5.89 0.00 0.00 2.39
8513 11558 3.780902 TGCTCGATTCGTTCATGTATGT 58.219 40.909 5.89 0.00 0.00 2.29
8514 11559 4.927422 TGCTCGATTCGTTCATGTATGTA 58.073 39.130 5.89 0.00 0.00 2.29
8515 11560 5.344884 TGCTCGATTCGTTCATGTATGTAA 58.655 37.500 5.89 0.00 0.00 2.41
8516 11561 5.983118 TGCTCGATTCGTTCATGTATGTAAT 59.017 36.000 5.89 0.00 0.00 1.89
8517 11562 6.478673 TGCTCGATTCGTTCATGTATGTAATT 59.521 34.615 5.89 0.00 0.00 1.40
8518 11563 7.011016 TGCTCGATTCGTTCATGTATGTAATTT 59.989 33.333 5.89 0.00 0.00 1.82
8519 11564 8.484799 GCTCGATTCGTTCATGTATGTAATTTA 58.515 33.333 5.89 0.00 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 5.424121 AGTCTTGTGTGTAATCAAACTGC 57.576 39.130 0.00 0.00 33.27 4.40
57 58 2.555664 TCTTCCCTCCTGAGCTGAAAT 58.444 47.619 0.00 0.00 0.00 2.17
63 64 1.270907 TGAGTTCTTCCCTCCTGAGC 58.729 55.000 0.00 0.00 0.00 4.26
64 65 3.326297 AGTTTGAGTTCTTCCCTCCTGAG 59.674 47.826 0.00 0.00 0.00 3.35
65 66 3.318313 AGTTTGAGTTCTTCCCTCCTGA 58.682 45.455 0.00 0.00 0.00 3.86
66 67 3.778954 AGTTTGAGTTCTTCCCTCCTG 57.221 47.619 0.00 0.00 0.00 3.86
79 80 6.183360 GGATGTGACAGACGAAATAGTTTGAG 60.183 42.308 0.00 0.00 31.58 3.02
94 95 2.315925 ATAACAGCGGGATGTGACAG 57.684 50.000 0.00 0.00 32.52 3.51
95 96 4.415881 AATATAACAGCGGGATGTGACA 57.584 40.909 0.00 0.00 32.52 3.58
124 125 2.235898 AGCCCTCTGCAAACAAAACAAA 59.764 40.909 0.00 0.00 44.83 2.83
125 126 1.830477 AGCCCTCTGCAAACAAAACAA 59.170 42.857 0.00 0.00 44.83 2.83
126 127 1.408702 GAGCCCTCTGCAAACAAAACA 59.591 47.619 0.00 0.00 44.83 2.83
127 128 1.683385 AGAGCCCTCTGCAAACAAAAC 59.317 47.619 0.00 0.00 44.83 2.43
128 129 1.956477 GAGAGCCCTCTGCAAACAAAA 59.044 47.619 1.91 0.00 44.83 2.44
129 130 1.609208 GAGAGCCCTCTGCAAACAAA 58.391 50.000 1.91 0.00 44.83 2.83
171 175 4.154015 TCATTTTCGAAATGACGCAGACAT 59.846 37.500 12.12 0.00 46.01 3.06
186 190 8.397215 TCACAATCATGCTTATTTCATTTTCG 57.603 30.769 0.00 0.00 0.00 3.46
189 193 9.158233 CCTTTCACAATCATGCTTATTTCATTT 57.842 29.630 0.00 0.00 0.00 2.32
230 234 6.176975 TGTTTGACGAATATGCTGGTAAAG 57.823 37.500 0.00 0.00 0.00 1.85
235 239 3.793129 GCCATGTTTGACGAATATGCTGG 60.793 47.826 6.64 0.00 36.02 4.85
239 243 4.794762 CACTTGCCATGTTTGACGAATATG 59.205 41.667 5.40 5.40 36.81 1.78
270 274 6.869388 GCTCTTATATTTCTTTACGGAGGGAG 59.131 42.308 0.00 0.00 0.00 4.30
271 275 6.516194 CGCTCTTATATTTCTTTACGGAGGGA 60.516 42.308 0.00 0.00 34.63 4.20
272 276 5.634020 CGCTCTTATATTTCTTTACGGAGGG 59.366 44.000 0.00 0.00 0.00 4.30
273 277 6.214399 ACGCTCTTATATTTCTTTACGGAGG 58.786 40.000 0.00 0.00 0.00 4.30
274 278 8.967552 ATACGCTCTTATATTTCTTTACGGAG 57.032 34.615 0.00 0.00 0.00 4.63
291 295 9.775854 TCACTACTTTAGTAATCTATACGCTCT 57.224 33.333 0.00 0.00 37.23 4.09
300 304 9.733219 GCGTTTAGATCACTACTTTAGTAATCT 57.267 33.333 4.72 4.72 37.23 2.40
301 305 9.733219 AGCGTTTAGATCACTACTTTAGTAATC 57.267 33.333 0.00 0.00 37.23 1.75
302 306 9.733219 GAGCGTTTAGATCACTACTTTAGTAAT 57.267 33.333 0.00 0.00 37.23 1.89
303 307 8.954350 AGAGCGTTTAGATCACTACTTTAGTAA 58.046 33.333 0.00 0.00 37.82 2.24
304 308 8.503458 AGAGCGTTTAGATCACTACTTTAGTA 57.497 34.615 0.00 0.00 37.82 1.82
305 309 7.393841 AGAGCGTTTAGATCACTACTTTAGT 57.606 36.000 0.00 0.00 37.82 2.24
306 310 9.224058 GTAAGAGCGTTTAGATCACTACTTTAG 57.776 37.037 0.00 0.00 37.82 1.85
307 311 8.733458 TGTAAGAGCGTTTAGATCACTACTTTA 58.267 33.333 0.00 0.00 37.82 1.85
308 312 7.600065 TGTAAGAGCGTTTAGATCACTACTTT 58.400 34.615 0.00 0.00 37.82 2.66
309 313 7.154435 TGTAAGAGCGTTTAGATCACTACTT 57.846 36.000 0.00 0.00 37.82 2.24
310 314 6.754702 TGTAAGAGCGTTTAGATCACTACT 57.245 37.500 0.00 0.00 37.82 2.57
311 315 7.988904 AATGTAAGAGCGTTTAGATCACTAC 57.011 36.000 0.00 0.00 37.82 2.73
312 316 8.033038 ACAAATGTAAGAGCGTTTAGATCACTA 58.967 33.333 0.00 0.00 37.82 2.74
313 317 6.874134 ACAAATGTAAGAGCGTTTAGATCACT 59.126 34.615 0.00 0.00 37.82 3.41
314 318 7.061752 ACAAATGTAAGAGCGTTTAGATCAC 57.938 36.000 0.00 0.00 37.82 3.06
315 319 7.667043 AACAAATGTAAGAGCGTTTAGATCA 57.333 32.000 0.00 0.00 37.82 2.92
316 320 9.474249 GTAAACAAATGTAAGAGCGTTTAGATC 57.526 33.333 0.00 0.00 31.53 2.75
317 321 8.995220 TGTAAACAAATGTAAGAGCGTTTAGAT 58.005 29.630 0.00 0.00 31.53 1.98
318 322 8.367943 TGTAAACAAATGTAAGAGCGTTTAGA 57.632 30.769 0.00 0.00 31.53 2.10
319 323 8.492748 TCTGTAAACAAATGTAAGAGCGTTTAG 58.507 33.333 0.00 0.00 31.53 1.85
320 324 8.367943 TCTGTAAACAAATGTAAGAGCGTTTA 57.632 30.769 0.00 0.00 0.00 2.01
321 325 7.254227 TCTGTAAACAAATGTAAGAGCGTTT 57.746 32.000 0.00 0.00 0.00 3.60
322 326 6.073222 CCTCTGTAAACAAATGTAAGAGCGTT 60.073 38.462 8.70 0.00 0.00 4.84
323 327 5.408604 CCTCTGTAAACAAATGTAAGAGCGT 59.591 40.000 8.70 0.00 0.00 5.07
324 328 5.163854 CCCTCTGTAAACAAATGTAAGAGCG 60.164 44.000 8.70 0.00 0.00 5.03
325 329 5.938125 TCCCTCTGTAAACAAATGTAAGAGC 59.062 40.000 8.70 0.00 0.00 4.09
326 330 7.162082 ACTCCCTCTGTAAACAAATGTAAGAG 58.838 38.462 0.00 0.00 0.00 2.85
327 331 7.074653 ACTCCCTCTGTAAACAAATGTAAGA 57.925 36.000 0.00 0.00 0.00 2.10
328 332 8.095169 ACTACTCCCTCTGTAAACAAATGTAAG 58.905 37.037 0.00 0.00 0.00 2.34
329 333 7.970102 ACTACTCCCTCTGTAAACAAATGTAA 58.030 34.615 0.00 0.00 0.00 2.41
330 334 7.549147 ACTACTCCCTCTGTAAACAAATGTA 57.451 36.000 0.00 0.00 0.00 2.29
331 335 6.435292 ACTACTCCCTCTGTAAACAAATGT 57.565 37.500 0.00 0.00 0.00 2.71
332 336 7.745620 AAACTACTCCCTCTGTAAACAAATG 57.254 36.000 0.00 0.00 0.00 2.32
333 337 8.434392 TGTAAACTACTCCCTCTGTAAACAAAT 58.566 33.333 0.00 0.00 0.00 2.32
334 338 7.794041 TGTAAACTACTCCCTCTGTAAACAAA 58.206 34.615 0.00 0.00 0.00 2.83
335 339 7.364149 TGTAAACTACTCCCTCTGTAAACAA 57.636 36.000 0.00 0.00 0.00 2.83
336 340 6.982160 TGTAAACTACTCCCTCTGTAAACA 57.018 37.500 0.00 0.00 0.00 2.83
339 343 8.627403 CGATTATGTAAACTACTCCCTCTGTAA 58.373 37.037 0.00 0.00 0.00 2.41
340 344 7.230108 CCGATTATGTAAACTACTCCCTCTGTA 59.770 40.741 0.00 0.00 0.00 2.74
341 345 6.040616 CCGATTATGTAAACTACTCCCTCTGT 59.959 42.308 0.00 0.00 0.00 3.41
342 346 6.040616 ACCGATTATGTAAACTACTCCCTCTG 59.959 42.308 0.00 0.00 0.00 3.35
343 347 6.134754 ACCGATTATGTAAACTACTCCCTCT 58.865 40.000 0.00 0.00 0.00 3.69
344 348 6.402456 ACCGATTATGTAAACTACTCCCTC 57.598 41.667 0.00 0.00 0.00 4.30
345 349 6.579865 CAACCGATTATGTAAACTACTCCCT 58.420 40.000 0.00 0.00 0.00 4.20
346 350 5.235831 GCAACCGATTATGTAAACTACTCCC 59.764 44.000 0.00 0.00 0.00 4.30
347 351 5.813672 TGCAACCGATTATGTAAACTACTCC 59.186 40.000 0.00 0.00 0.00 3.85
348 352 6.702897 GTGCAACCGATTATGTAAACTACTC 58.297 40.000 0.00 0.00 0.00 2.59
349 353 6.657836 GTGCAACCGATTATGTAAACTACT 57.342 37.500 0.00 0.00 0.00 2.57
377 381 2.093711 TGCACTCGCTGGTGTACATAAT 60.094 45.455 0.00 0.00 39.21 1.28
381 385 1.006220 CTGCACTCGCTGGTGTACA 60.006 57.895 0.00 0.00 39.21 2.90
387 391 0.108472 TTCAGATCTGCACTCGCTGG 60.108 55.000 18.36 0.00 39.64 4.85
392 396 3.456280 GGATCAGTTCAGATCTGCACTC 58.544 50.000 22.96 13.39 43.11 3.51
401 405 5.705397 AGATCAAATGGGATCAGTTCAGA 57.295 39.130 8.95 0.00 44.89 3.27
402 406 6.824553 TCTAGATCAAATGGGATCAGTTCAG 58.175 40.000 8.95 0.65 44.89 3.02
403 407 6.813293 TCTAGATCAAATGGGATCAGTTCA 57.187 37.500 8.95 0.00 44.89 3.18
404 408 7.718753 ACATTCTAGATCAAATGGGATCAGTTC 59.281 37.037 15.59 0.00 44.89 3.01
405 409 7.580910 ACATTCTAGATCAAATGGGATCAGTT 58.419 34.615 15.59 0.00 44.89 3.16
406 410 7.072202 AGACATTCTAGATCAAATGGGATCAGT 59.928 37.037 15.59 0.00 44.89 3.41
407 411 7.451732 AGACATTCTAGATCAAATGGGATCAG 58.548 38.462 15.59 5.38 44.89 2.90
408 412 7.291885 AGAGACATTCTAGATCAAATGGGATCA 59.708 37.037 15.59 0.00 44.89 2.92
409 413 7.603404 CAGAGACATTCTAGATCAAATGGGATC 59.397 40.741 15.59 11.32 38.05 3.36
410 414 7.451732 CAGAGACATTCTAGATCAAATGGGAT 58.548 38.462 15.59 5.40 37.23 3.85
411 415 6.183361 CCAGAGACATTCTAGATCAAATGGGA 60.183 42.308 15.59 0.00 37.23 4.37
412 416 5.996513 CCAGAGACATTCTAGATCAAATGGG 59.003 44.000 15.59 6.79 37.23 4.00
413 417 6.705381 GTCCAGAGACATTCTAGATCAAATGG 59.295 42.308 15.59 5.72 42.99 3.16
414 418 7.438757 CAGTCCAGAGACATTCTAGATCAAATG 59.561 40.741 11.68 11.68 46.15 2.32
415 419 7.344093 TCAGTCCAGAGACATTCTAGATCAAAT 59.656 37.037 0.00 0.00 46.15 2.32
416 420 6.665248 TCAGTCCAGAGACATTCTAGATCAAA 59.335 38.462 0.00 0.00 46.15 2.69
503 509 7.505585 TCAAATTAGAAAACTGATGGTGGAACT 59.494 33.333 0.00 0.00 36.74 3.01
518 524 5.465532 TGCCAGTGCATTCAAATTAGAAA 57.534 34.783 0.00 0.00 44.23 2.52
554 560 1.410882 CGAGAGAGACAAGGAATCCCC 59.589 57.143 0.00 0.00 0.00 4.81
604 644 1.942657 TGCTCTGCTGTGTTTGAGAAC 59.057 47.619 0.00 0.00 36.29 3.01
664 748 0.950116 AAGTTGCAAGACTCAGCAGC 59.050 50.000 0.00 8.14 42.39 5.25
685 769 3.265995 ACGGAAAATAGGTGAATGGGACT 59.734 43.478 0.00 0.00 0.00 3.85
688 772 3.616219 TCACGGAAAATAGGTGAATGGG 58.384 45.455 0.00 0.00 37.72 4.00
715 799 0.391661 AGCAGCTCCGTACACATTGG 60.392 55.000 0.00 0.00 0.00 3.16
719 803 2.616960 CATTAAGCAGCTCCGTACACA 58.383 47.619 0.00 0.00 0.00 3.72
721 805 1.553248 ACCATTAAGCAGCTCCGTACA 59.447 47.619 0.00 0.00 0.00 2.90
726 810 2.409948 AGACACCATTAAGCAGCTCC 57.590 50.000 0.00 0.00 0.00 4.70
727 811 3.338249 TGAAGACACCATTAAGCAGCTC 58.662 45.455 0.00 0.00 0.00 4.09
756 847 4.187694 TGCAACTTTGGTTCCATTCAAAC 58.812 39.130 0.00 0.00 32.73 2.93
769 860 2.877043 AAGTGAGGCTTGCAACTTTG 57.123 45.000 0.00 0.00 35.80 2.77
954 1047 2.487775 ACCCAGGGCAGTATTGATGTA 58.512 47.619 4.91 0.00 0.00 2.29
967 1060 3.388841 AGCGTACTGAACCCAGGG 58.611 61.111 2.85 2.85 44.60 4.45
1025 1118 3.853330 CCACAGCGACCGCAATCG 61.853 66.667 16.97 2.31 44.88 3.34
1203 1311 1.157585 GAAACACTCTTCCGGCTTCC 58.842 55.000 0.00 0.00 0.00 3.46
1308 1419 6.231211 AGAGTTAGTTACCTTGGATTGTGTG 58.769 40.000 0.00 0.00 0.00 3.82
1339 1450 1.462731 CGGCTGAGAGGAGATGGGAG 61.463 65.000 0.00 0.00 0.00 4.30
1357 1468 2.722201 CGGAAGGAGGGAGGAACCG 61.722 68.421 0.00 0.00 40.11 4.44
1361 1472 1.215679 AGAGACGGAAGGAGGGAGGA 61.216 60.000 0.00 0.00 0.00 3.71
1362 1473 0.324830 AAGAGACGGAAGGAGGGAGG 60.325 60.000 0.00 0.00 0.00 4.30
1363 1474 2.438800 TAAGAGACGGAAGGAGGGAG 57.561 55.000 0.00 0.00 0.00 4.30
1364 1475 2.736347 CTTAAGAGACGGAAGGAGGGA 58.264 52.381 0.00 0.00 0.00 4.20
1367 1478 2.494073 ACAGCTTAAGAGACGGAAGGAG 59.506 50.000 6.67 0.00 0.00 3.69
1368 1479 2.492484 GACAGCTTAAGAGACGGAAGGA 59.508 50.000 6.67 0.00 0.00 3.36
1369 1480 2.732597 CGACAGCTTAAGAGACGGAAGG 60.733 54.545 6.67 0.00 0.00 3.46
1370 1481 2.520979 CGACAGCTTAAGAGACGGAAG 58.479 52.381 6.67 0.00 0.00 3.46
1371 1482 1.402456 GCGACAGCTTAAGAGACGGAA 60.402 52.381 6.67 0.00 41.01 4.30
1385 1720 1.066573 AGAAGAACATGGGAGCGACAG 60.067 52.381 0.00 0.00 0.00 3.51
1396 1731 8.210265 ACTGAAGAAGAAGAAGAAGAAGAACAT 58.790 33.333 0.00 0.00 0.00 2.71
1408 1743 4.519350 TCTGCGTAGACTGAAGAAGAAGAA 59.481 41.667 0.00 0.00 0.00 2.52
1409 1744 4.072839 TCTGCGTAGACTGAAGAAGAAGA 58.927 43.478 0.00 0.00 0.00 2.87
1410 1745 4.155099 TCTCTGCGTAGACTGAAGAAGAAG 59.845 45.833 0.00 0.00 0.00 2.85
1411 1746 4.072839 TCTCTGCGTAGACTGAAGAAGAA 58.927 43.478 0.00 0.00 0.00 2.52
1412 1747 3.437395 GTCTCTGCGTAGACTGAAGAAGA 59.563 47.826 0.00 0.00 42.21 2.87
1413 1748 3.753842 GTCTCTGCGTAGACTGAAGAAG 58.246 50.000 0.00 0.00 42.21 2.85
1414 1749 3.833545 GTCTCTGCGTAGACTGAAGAA 57.166 47.619 0.00 0.00 42.21 2.52
1425 1904 5.162075 GCCGATATAAATTAGTCTCTGCGT 58.838 41.667 0.00 0.00 0.00 5.24
1433 1912 7.304497 ACTGAAGAGGCCGATATAAATTAGT 57.696 36.000 0.00 0.00 0.00 2.24
1435 1914 7.872993 CAGAACTGAAGAGGCCGATATAAATTA 59.127 37.037 0.00 0.00 0.00 1.40
1436 1915 6.708054 CAGAACTGAAGAGGCCGATATAAATT 59.292 38.462 0.00 0.00 0.00 1.82
1437 1916 6.226787 CAGAACTGAAGAGGCCGATATAAAT 58.773 40.000 0.00 0.00 0.00 1.40
1438 1917 5.601662 CAGAACTGAAGAGGCCGATATAAA 58.398 41.667 0.00 0.00 0.00 1.40
1439 1918 4.501571 GCAGAACTGAAGAGGCCGATATAA 60.502 45.833 5.97 0.00 0.00 0.98
1440 1919 3.005897 GCAGAACTGAAGAGGCCGATATA 59.994 47.826 5.97 0.00 0.00 0.86
1442 1921 1.137086 GCAGAACTGAAGAGGCCGATA 59.863 52.381 5.97 0.00 0.00 2.92
1445 1924 1.743252 GGCAGAACTGAAGAGGCCG 60.743 63.158 5.97 0.00 0.00 6.13
1446 1925 0.676151 CAGGCAGAACTGAAGAGGCC 60.676 60.000 5.97 0.00 40.97 5.19
1447 1926 1.304509 GCAGGCAGAACTGAAGAGGC 61.305 60.000 5.97 0.00 40.97 4.70
1448 1927 0.676151 GGCAGGCAGAACTGAAGAGG 60.676 60.000 5.97 0.00 40.97 3.69
1451 1930 1.584380 GCAGGCAGGCAGAACTGAAG 61.584 60.000 5.97 0.00 40.97 3.02
1453 1932 2.033141 GCAGGCAGGCAGAACTGA 59.967 61.111 5.97 0.00 40.97 3.41
1478 1999 1.054406 TTAGATTCAGAGGGGCCGGG 61.054 60.000 2.18 0.00 0.00 5.73
1480 2001 2.710096 TTTTAGATTCAGAGGGGCCG 57.290 50.000 0.00 0.00 0.00 6.13
1513 2034 1.140452 TGGCCTGCAAAAATCAAGCAA 59.860 42.857 3.32 0.00 37.89 3.91
1515 2036 1.435577 CTGGCCTGCAAAAATCAAGC 58.564 50.000 3.32 0.00 0.00 4.01
1519 2339 3.192466 CATAAGCTGGCCTGCAAAAATC 58.808 45.455 32.96 5.28 34.99 2.17
1595 2415 7.461749 TCTGGTCTATTTTCTTCATCACCTTT 58.538 34.615 0.00 0.00 0.00 3.11
1714 2534 2.426024 CCTGTTTCCATTCCATGAGCAG 59.574 50.000 0.00 0.00 0.00 4.24
1814 2640 1.837439 AGGCCGACAACTGGAATGATA 59.163 47.619 0.00 0.00 0.00 2.15
2213 3060 0.104120 TGATTATGTCGGACGCTGGG 59.896 55.000 3.34 0.00 0.00 4.45
2218 3065 3.625764 ACCCAAATTGATTATGTCGGACG 59.374 43.478 3.34 0.00 0.00 4.79
2222 3069 8.240682 TCTAAAACACCCAAATTGATTATGTCG 58.759 33.333 0.00 0.00 0.00 4.35
2310 3157 2.560105 GCTGTCCAATTTCTTCCAAGCT 59.440 45.455 0.00 0.00 0.00 3.74
2328 3175 0.109272 CACTTGGCTGCAATCTGCTG 60.109 55.000 0.50 0.69 45.31 4.41
2410 3257 6.820656 GGTATCTCTTATATGTTCCCATGCTG 59.179 42.308 0.00 0.00 32.29 4.41
2411 3258 6.501805 TGGTATCTCTTATATGTTCCCATGCT 59.498 38.462 0.00 0.00 32.29 3.79
2493 3346 5.301835 AGCTTCATGTGGTAATAGCTCAT 57.698 39.130 0.00 1.69 34.04 2.90
2525 3378 2.546368 TGCCAAGTACGTGAAACACATC 59.454 45.455 10.61 0.00 35.74 3.06
2674 3527 1.415659 CCGAAGCAGATCCTGGAATCT 59.584 52.381 0.00 1.62 36.41 2.40
2697 3550 7.255139 GCAATTGAAATGGTGTCTATAGGTACC 60.255 40.741 10.34 2.73 0.00 3.34
2747 3608 9.181061 GTAGGGCCATACATAAAGTAAGAAAAA 57.819 33.333 22.31 0.00 36.05 1.94
2752 3613 6.827727 AGTGTAGGGCCATACATAAAGTAAG 58.172 40.000 31.02 0.00 37.93 2.34
2755 3616 5.437060 CAAGTGTAGGGCCATACATAAAGT 58.563 41.667 31.02 13.24 37.93 2.66
2760 3621 2.205342 ACCAAGTGTAGGGCCATACAT 58.795 47.619 31.02 15.28 37.93 2.29
2762 3623 2.801077 AACCAAGTGTAGGGCCATAC 57.199 50.000 20.60 20.60 0.00 2.39
2846 3765 8.202137 AGAGCTAGTAAAGTACAAAACTGAACA 58.798 33.333 0.00 0.00 38.88 3.18
2869 3788 6.668323 ACCGAACATAATCAAAACAACAGAG 58.332 36.000 0.00 0.00 0.00 3.35
3200 4562 8.237949 GCTCGTAGCTCTATAAATGACATCTTA 58.762 37.037 0.00 0.00 38.45 2.10
3240 4609 6.479884 AGTATACCCGGACTAGTATACCTTG 58.520 44.000 23.87 0.33 46.59 3.61
3258 4627 2.861274 ACCTCTGGCGGACTAGTATAC 58.139 52.381 0.00 0.00 0.00 1.47
3259 4628 4.923516 ATACCTCTGGCGGACTAGTATA 57.076 45.455 0.00 0.00 0.00 1.47
3261 4630 3.117776 TGAATACCTCTGGCGGACTAGTA 60.118 47.826 0.00 0.00 0.00 1.82
3262 4631 2.308690 GAATACCTCTGGCGGACTAGT 58.691 52.381 0.00 0.00 0.00 2.57
3267 4636 0.325296 ACCTGAATACCTCTGGCGGA 60.325 55.000 0.00 0.00 45.00 5.54
3271 4640 2.104963 GGCCTAACCTGAATACCTCTGG 59.895 54.545 0.00 0.00 46.22 3.86
3274 4643 2.409570 AGGGCCTAACCTGAATACCTC 58.590 52.381 2.82 0.00 40.04 3.85
3276 4645 2.484947 CGAAGGGCCTAACCTGAATACC 60.485 54.545 6.41 0.00 40.87 2.73
3277 4646 2.835027 CGAAGGGCCTAACCTGAATAC 58.165 52.381 6.41 0.00 40.87 1.89
3296 5732 0.179001 AGGACCACCTTTGAAACCCG 60.179 55.000 0.00 0.00 45.36 5.28
3315 5751 4.066614 GGAGGGGCCTGACATGTA 57.933 61.111 0.84 0.00 0.00 2.29
3333 5769 1.077285 TCTCTCGATACCACCGCCA 60.077 57.895 0.00 0.00 0.00 5.69
3338 5774 2.285756 CGACTGTCTCTCTCGATACCAC 59.714 54.545 6.21 0.00 0.00 4.16
3345 5781 0.643310 CGTCTCGACTGTCTCTCTCG 59.357 60.000 6.21 1.32 0.00 4.04
3358 5794 4.894937 TCTCTCGTCTTTTATTCGTCTCG 58.105 43.478 0.00 0.00 0.00 4.04
3363 5799 5.805486 TGAACCATCTCTCGTCTTTTATTCG 59.195 40.000 0.00 0.00 0.00 3.34
3371 5807 3.829601 GGGATATGAACCATCTCTCGTCT 59.170 47.826 0.00 0.00 0.00 4.18
3383 5819 7.285401 ACATGAACCACATAAAGGGATATGAAC 59.715 37.037 0.00 0.00 37.46 3.18
3391 5827 5.653769 AGATTCACATGAACCACATAAAGGG 59.346 40.000 0.00 0.00 37.46 3.95
3407 5843 0.842030 AGTCCTGGGCCAGATTCACA 60.842 55.000 34.84 8.05 32.44 3.58
3419 5855 1.379044 GCCCATGGTGAAGTCCTGG 60.379 63.158 11.73 0.00 0.00 4.45
3426 5866 1.907807 GCACTTGGCCCATGGTGAA 60.908 57.895 17.78 0.00 36.11 3.18
3428 5868 0.683828 TATGCACTTGGCCCATGGTG 60.684 55.000 11.73 11.51 43.89 4.17
3448 5888 7.309194 GGACAATAATTTTGAACAGTGCTACCT 60.309 37.037 7.18 0.00 0.00 3.08
3481 5921 3.714798 TGGAGACCATGTAAATAGGGACC 59.285 47.826 0.00 0.00 0.00 4.46
3482 5922 4.163458 TGTGGAGACCATGTAAATAGGGAC 59.837 45.833 0.00 0.00 35.28 4.46
3495 5935 4.927267 ACCTTGAAATATGTGGAGACCA 57.073 40.909 0.00 0.00 0.00 4.02
3499 5939 6.824305 AGTTGAACCTTGAAATATGTGGAG 57.176 37.500 0.00 0.00 0.00 3.86
3524 5964 6.865726 TGTTTTATTGGTCAAATTGATGGTCG 59.134 34.615 0.00 0.00 0.00 4.79
3560 6001 1.065418 GACTTGGGTCCGATGGAACAT 60.065 52.381 2.90 0.00 42.10 2.71
3562 6003 0.323629 TGACTTGGGTCCGATGGAAC 59.676 55.000 0.00 0.00 41.47 3.62
3563 6004 1.065491 CATGACTTGGGTCCGATGGAA 60.065 52.381 0.00 0.00 41.47 3.53
3564 6005 0.541392 CATGACTTGGGTCCGATGGA 59.459 55.000 0.00 0.00 41.47 3.41
3565 6006 0.541392 TCATGACTTGGGTCCGATGG 59.459 55.000 0.00 0.00 41.47 3.51
3566 6007 1.208052 ACTCATGACTTGGGTCCGATG 59.792 52.381 0.00 0.00 31.57 3.84
3568 6009 0.608130 CACTCATGACTTGGGTCCGA 59.392 55.000 0.00 0.00 36.71 4.55
3569 6010 1.021390 GCACTCATGACTTGGGTCCG 61.021 60.000 0.00 0.00 36.71 4.79
3570 6011 0.678048 GGCACTCATGACTTGGGTCC 60.678 60.000 0.00 0.00 36.71 4.46
3571 6012 0.036732 TGGCACTCATGACTTGGGTC 59.963 55.000 0.00 0.00 36.71 4.46
3579 6172 1.288188 TTGGGAGATGGCACTCATGA 58.712 50.000 15.59 0.00 38.51 3.07
3597 6190 0.036858 GCTGGCGAGGTCTCTTCTTT 60.037 55.000 0.00 0.00 0.00 2.52
3609 6202 2.722094 ACAATGATTTAAGGCTGGCGA 58.278 42.857 0.00 0.00 0.00 5.54
3611 6204 3.371898 GCAAACAATGATTTAAGGCTGGC 59.628 43.478 0.00 0.00 0.00 4.85
3613 6206 4.824289 AGGCAAACAATGATTTAAGGCTG 58.176 39.130 0.00 0.00 0.00 4.85
3619 6217 6.878389 GGAAATGGAAGGCAAACAATGATTTA 59.122 34.615 0.00 0.00 0.00 1.40
3621 6219 5.013391 AGGAAATGGAAGGCAAACAATGATT 59.987 36.000 0.00 0.00 0.00 2.57
3624 6222 4.248058 GAGGAAATGGAAGGCAAACAATG 58.752 43.478 0.00 0.00 0.00 2.82
3626 6224 2.632512 GGAGGAAATGGAAGGCAAACAA 59.367 45.455 0.00 0.00 0.00 2.83
3648 6246 2.045926 ATTCACAGTGCTCCGGGC 60.046 61.111 0.00 4.52 42.22 6.13
3658 6256 1.826385 GGGGGACTTGACATTCACAG 58.174 55.000 0.00 0.00 0.00 3.66
3678 6288 1.256812 GTTCTTCCCCAATGGTGGTG 58.743 55.000 0.00 0.00 44.30 4.17
3683 6293 2.052104 GCCGGTTCTTCCCCAATGG 61.052 63.158 1.90 0.00 0.00 3.16
3685 6295 1.000896 CTGCCGGTTCTTCCCCAAT 60.001 57.895 1.90 0.00 0.00 3.16
3699 6309 1.968540 ACTTTCTTCAGCCGCTGCC 60.969 57.895 15.98 0.00 38.69 4.85
3700 6310 1.208614 CACTTTCTTCAGCCGCTGC 59.791 57.895 15.98 0.00 37.95 5.25
3702 6312 2.320587 CGCACTTTCTTCAGCCGCT 61.321 57.895 0.00 0.00 0.00 5.52
3703 6313 2.174349 CGCACTTTCTTCAGCCGC 59.826 61.111 0.00 0.00 0.00 6.53
3705 6315 1.081840 GCACGCACTTTCTTCAGCC 60.082 57.895 0.00 0.00 0.00 4.85
3707 6317 0.383491 CGTGCACGCACTTTCTTCAG 60.383 55.000 28.16 0.00 44.16 3.02
3710 6320 2.542907 CCCGTGCACGCACTTTCTT 61.543 57.895 33.17 0.00 44.16 2.52
3711 6321 2.972505 CCCGTGCACGCACTTTCT 60.973 61.111 33.17 0.00 44.16 2.52
3712 6322 3.276846 ACCCGTGCACGCACTTTC 61.277 61.111 33.17 0.00 44.16 2.62
3713 6323 3.582120 CACCCGTGCACGCACTTT 61.582 61.111 33.17 11.75 44.16 2.66
3719 6329 3.041940 GAAGTCCACCCGTGCACG 61.042 66.667 31.77 31.77 39.44 5.34
3725 6335 2.046892 CTGGCAGAAGTCCACCCG 60.047 66.667 9.42 0.00 0.00 5.28
3727 6337 0.107945 CTAGCTGGCAGAAGTCCACC 60.108 60.000 20.86 0.00 0.00 4.61
3818 6676 0.034896 CATACCGTGGGGCTACATCC 59.965 60.000 0.00 0.00 36.48 3.51
3819 6677 1.045407 TCATACCGTGGGGCTACATC 58.955 55.000 0.00 0.00 36.48 3.06
3822 6680 1.444672 GGTCATACCGTGGGGCTAC 59.555 63.158 0.00 0.00 36.48 3.58
3823 6681 1.763256 GGGTCATACCGTGGGGCTA 60.763 63.158 0.00 0.00 39.83 3.93
3824 6682 3.087906 GGGTCATACCGTGGGGCT 61.088 66.667 0.00 0.00 39.83 5.19
3832 6690 0.981183 TGATATGGGCGGGTCATACC 59.019 55.000 0.00 0.00 37.60 2.73
3833 6691 2.632377 CATGATATGGGCGGGTCATAC 58.368 52.381 0.00 0.00 30.94 2.39
3834 6692 1.559219 CCATGATATGGGCGGGTCATA 59.441 52.381 0.00 0.00 46.86 2.15
3835 6693 0.329261 CCATGATATGGGCGGGTCAT 59.671 55.000 0.00 0.00 46.86 3.06
3836 6694 1.760527 CCATGATATGGGCGGGTCA 59.239 57.895 0.00 0.00 46.86 4.02
3837 6695 4.722193 CCATGATATGGGCGGGTC 57.278 61.111 0.00 0.00 46.86 4.46
3845 6703 6.333416 CACTAGATAACCCGACCATGATATG 58.667 44.000 0.00 0.00 0.00 1.78
3846 6704 5.422331 CCACTAGATAACCCGACCATGATAT 59.578 44.000 0.00 0.00 0.00 1.63
3847 6705 4.770531 CCACTAGATAACCCGACCATGATA 59.229 45.833 0.00 0.00 0.00 2.15
3848 6706 3.578716 CCACTAGATAACCCGACCATGAT 59.421 47.826 0.00 0.00 0.00 2.45
3849 6707 2.963101 CCACTAGATAACCCGACCATGA 59.037 50.000 0.00 0.00 0.00 3.07
3850 6708 2.548067 GCCACTAGATAACCCGACCATG 60.548 54.545 0.00 0.00 0.00 3.66
3851 6709 1.692519 GCCACTAGATAACCCGACCAT 59.307 52.381 0.00 0.00 0.00 3.55
3852 6710 1.117150 GCCACTAGATAACCCGACCA 58.883 55.000 0.00 0.00 0.00 4.02
3853 6711 0.031721 CGCCACTAGATAACCCGACC 59.968 60.000 0.00 0.00 0.00 4.79
3854 6712 0.031721 CCGCCACTAGATAACCCGAC 59.968 60.000 0.00 0.00 0.00 4.79
3855 6713 1.741327 GCCGCCACTAGATAACCCGA 61.741 60.000 0.00 0.00 0.00 5.14
3856 6714 1.300697 GCCGCCACTAGATAACCCG 60.301 63.158 0.00 0.00 0.00 5.28
3857 6715 0.468648 AAGCCGCCACTAGATAACCC 59.531 55.000 0.00 0.00 0.00 4.11
3858 6716 2.327200 AAAGCCGCCACTAGATAACC 57.673 50.000 0.00 0.00 0.00 2.85
3859 6717 4.690122 TCTTAAAGCCGCCACTAGATAAC 58.310 43.478 0.00 0.00 0.00 1.89
3860 6718 5.347620 TTCTTAAAGCCGCCACTAGATAA 57.652 39.130 0.00 0.00 0.00 1.75
3861 6719 5.546621 ATTCTTAAAGCCGCCACTAGATA 57.453 39.130 0.00 0.00 0.00 1.98
3862 6720 3.906720 TTCTTAAAGCCGCCACTAGAT 57.093 42.857 0.00 0.00 0.00 1.98
3863 6721 3.906720 ATTCTTAAAGCCGCCACTAGA 57.093 42.857 0.00 0.00 0.00 2.43
3864 6722 4.058817 CCTATTCTTAAAGCCGCCACTAG 58.941 47.826 0.00 0.00 0.00 2.57
3865 6723 3.743269 GCCTATTCTTAAAGCCGCCACTA 60.743 47.826 0.00 0.00 0.00 2.74
3866 6724 2.919228 CCTATTCTTAAAGCCGCCACT 58.081 47.619 0.00 0.00 0.00 4.00
3867 6725 1.333931 GCCTATTCTTAAAGCCGCCAC 59.666 52.381 0.00 0.00 0.00 5.01
3868 6726 1.211949 AGCCTATTCTTAAAGCCGCCA 59.788 47.619 0.00 0.00 0.00 5.69
3869 6727 1.874231 GAGCCTATTCTTAAAGCCGCC 59.126 52.381 0.00 0.00 0.00 6.13
3870 6728 2.561569 TGAGCCTATTCTTAAAGCCGC 58.438 47.619 0.00 0.00 0.00 6.53
3871 6729 4.380531 TGATGAGCCTATTCTTAAAGCCG 58.619 43.478 0.00 0.00 0.00 5.52
3872 6730 7.066766 CCATATGATGAGCCTATTCTTAAAGCC 59.933 40.741 3.65 0.00 0.00 4.35
3873 6731 7.066766 CCCATATGATGAGCCTATTCTTAAAGC 59.933 40.741 3.65 0.00 0.00 3.51
3874 6732 7.066766 GCCCATATGATGAGCCTATTCTTAAAG 59.933 40.741 3.65 0.00 0.00 1.85
3875 6733 6.886459 GCCCATATGATGAGCCTATTCTTAAA 59.114 38.462 3.65 0.00 0.00 1.52
3876 6734 6.418101 GCCCATATGATGAGCCTATTCTTAA 58.582 40.000 3.65 0.00 0.00 1.85
3877 6735 5.994250 GCCCATATGATGAGCCTATTCTTA 58.006 41.667 3.65 0.00 0.00 2.10
3878 6736 4.853007 GCCCATATGATGAGCCTATTCTT 58.147 43.478 3.65 0.00 0.00 2.52
3879 6737 4.500499 GCCCATATGATGAGCCTATTCT 57.500 45.455 3.65 0.00 0.00 2.40
3886 6744 2.393768 CGCGGCCCATATGATGAGC 61.394 63.158 3.65 3.89 32.69 4.26
3887 6745 0.107993 ATCGCGGCCCATATGATGAG 60.108 55.000 6.13 0.00 0.00 2.90
3888 6746 0.391528 CATCGCGGCCCATATGATGA 60.392 55.000 6.13 0.00 38.93 2.92
3889 6747 0.391528 TCATCGCGGCCCATATGATG 60.392 55.000 6.13 4.10 38.18 3.07
3890 6748 0.543277 ATCATCGCGGCCCATATGAT 59.457 50.000 6.13 9.64 34.91 2.45
3891 6749 0.108186 GATCATCGCGGCCCATATGA 60.108 55.000 6.13 7.38 33.20 2.15
3892 6750 0.391528 TGATCATCGCGGCCCATATG 60.392 55.000 6.13 0.81 0.00 1.78
3893 6751 0.324614 TTGATCATCGCGGCCCATAT 59.675 50.000 6.13 0.00 0.00 1.78
3894 6752 0.320683 CTTGATCATCGCGGCCCATA 60.321 55.000 6.13 0.00 0.00 2.74
3895 6753 1.598962 CTTGATCATCGCGGCCCAT 60.599 57.895 6.13 0.00 0.00 4.00
3896 6754 2.203056 CTTGATCATCGCGGCCCA 60.203 61.111 6.13 0.00 0.00 5.36
3897 6755 1.958205 CTCTTGATCATCGCGGCCC 60.958 63.158 6.13 0.00 0.00 5.80
3898 6756 2.602322 GCTCTTGATCATCGCGGCC 61.602 63.158 6.13 0.00 0.00 6.13
3899 6757 1.555741 GAGCTCTTGATCATCGCGGC 61.556 60.000 6.13 0.00 0.00 6.53
3900 6758 0.249197 TGAGCTCTTGATCATCGCGG 60.249 55.000 16.19 0.00 33.24 6.46
3901 6759 1.521840 CTTGAGCTCTTGATCATCGCG 59.478 52.381 16.19 0.00 38.48 5.87
3902 6760 1.865970 CCTTGAGCTCTTGATCATCGC 59.134 52.381 16.19 0.00 38.48 4.58
3903 6761 3.122297 GTCCTTGAGCTCTTGATCATCG 58.878 50.000 16.19 0.00 38.48 3.84
3904 6762 4.134379 TGTCCTTGAGCTCTTGATCATC 57.866 45.455 16.19 0.00 38.48 2.92
3905 6763 4.224594 TCTTGTCCTTGAGCTCTTGATCAT 59.775 41.667 16.19 0.00 38.48 2.45
3906 6764 3.580022 TCTTGTCCTTGAGCTCTTGATCA 59.420 43.478 16.19 6.35 36.76 2.92
3907 6765 4.199432 TCTTGTCCTTGAGCTCTTGATC 57.801 45.455 16.19 3.77 0.00 2.92
3908 6766 4.515361 CATCTTGTCCTTGAGCTCTTGAT 58.485 43.478 16.19 4.31 0.00 2.57
3909 6767 3.307269 CCATCTTGTCCTTGAGCTCTTGA 60.307 47.826 16.19 5.81 0.00 3.02
3910 6768 3.008330 CCATCTTGTCCTTGAGCTCTTG 58.992 50.000 16.19 7.39 0.00 3.02
3911 6769 2.026449 CCCATCTTGTCCTTGAGCTCTT 60.026 50.000 16.19 0.00 0.00 2.85
3912 6770 1.558756 CCCATCTTGTCCTTGAGCTCT 59.441 52.381 16.19 0.00 0.00 4.09
3913 6771 2.016096 GCCCATCTTGTCCTTGAGCTC 61.016 57.143 6.82 6.82 0.00 4.09
3914 6772 0.034670 GCCCATCTTGTCCTTGAGCT 60.035 55.000 0.00 0.00 0.00 4.09
3915 6773 1.372087 CGCCCATCTTGTCCTTGAGC 61.372 60.000 0.00 0.00 0.00 4.26
3916 6774 0.250234 TCGCCCATCTTGTCCTTGAG 59.750 55.000 0.00 0.00 0.00 3.02
3917 6775 0.036388 GTCGCCCATCTTGTCCTTGA 60.036 55.000 0.00 0.00 0.00 3.02
3918 6776 0.036010 AGTCGCCCATCTTGTCCTTG 60.036 55.000 0.00 0.00 0.00 3.61
3919 6777 0.250513 GAGTCGCCCATCTTGTCCTT 59.749 55.000 0.00 0.00 0.00 3.36
3920 6778 0.904865 TGAGTCGCCCATCTTGTCCT 60.905 55.000 0.00 0.00 0.00 3.85
3921 6779 0.179000 ATGAGTCGCCCATCTTGTCC 59.821 55.000 0.00 0.00 0.00 4.02
3922 6780 1.293924 CATGAGTCGCCCATCTTGTC 58.706 55.000 0.00 0.00 0.00 3.18
3923 6781 0.107508 CCATGAGTCGCCCATCTTGT 60.108 55.000 0.00 0.00 0.00 3.16
3924 6782 0.178767 TCCATGAGTCGCCCATCTTG 59.821 55.000 0.00 0.00 0.00 3.02
3925 6783 0.467384 CTCCATGAGTCGCCCATCTT 59.533 55.000 0.00 0.00 0.00 2.40
3926 6784 2.037620 GCTCCATGAGTCGCCCATCT 62.038 60.000 0.00 0.00 31.39 2.90
3927 6785 1.596477 GCTCCATGAGTCGCCCATC 60.596 63.158 0.00 0.00 31.39 3.51
3928 6786 2.507944 GCTCCATGAGTCGCCCAT 59.492 61.111 0.00 0.00 31.39 4.00
3929 6787 4.147449 CGCTCCATGAGTCGCCCA 62.147 66.667 0.00 0.00 31.39 5.36
3930 6788 4.899239 CCGCTCCATGAGTCGCCC 62.899 72.222 0.00 0.00 31.62 6.13
3931 6789 4.899239 CCCGCTCCATGAGTCGCC 62.899 72.222 0.00 0.00 31.62 5.54
3933 6791 4.899239 GGCCCGCTCCATGAGTCG 62.899 72.222 0.00 0.00 31.39 4.18
3934 6792 4.899239 CGGCCCGCTCCATGAGTC 62.899 72.222 0.00 0.00 31.39 3.36
3967 6825 1.668151 GATAAGCCGCCGCCTTAGG 60.668 63.158 0.00 0.00 34.57 2.69
3968 6826 0.531974 TTGATAAGCCGCCGCCTTAG 60.532 55.000 0.00 0.00 34.57 2.18
3969 6827 0.107606 TTTGATAAGCCGCCGCCTTA 60.108 50.000 0.00 0.00 34.57 2.69
3970 6828 1.376609 CTTTGATAAGCCGCCGCCTT 61.377 55.000 0.00 0.00 34.57 4.35
3971 6829 1.819632 CTTTGATAAGCCGCCGCCT 60.820 57.895 0.00 0.00 34.57 5.52
3972 6830 2.715624 CTTTGATAAGCCGCCGCC 59.284 61.111 0.00 0.00 34.57 6.13
3973 6831 1.373590 TTCCTTTGATAAGCCGCCGC 61.374 55.000 0.00 0.00 0.00 6.53
3974 6832 1.091537 TTTCCTTTGATAAGCCGCCG 58.908 50.000 0.00 0.00 0.00 6.46
3975 6833 1.816224 TGTTTCCTTTGATAAGCCGCC 59.184 47.619 0.00 0.00 0.00 6.13
3976 6834 3.569250 TTGTTTCCTTTGATAAGCCGC 57.431 42.857 0.00 0.00 0.00 6.53
3977 6835 4.423732 CCATTGTTTCCTTTGATAAGCCG 58.576 43.478 0.00 0.00 0.00 5.52
3978 6836 4.466015 TCCCATTGTTTCCTTTGATAAGCC 59.534 41.667 0.00 0.00 0.00 4.35
3979 6837 5.659440 TCCCATTGTTTCCTTTGATAAGC 57.341 39.130 0.00 0.00 0.00 3.09
3980 6838 8.534496 AGAATTCCCATTGTTTCCTTTGATAAG 58.466 33.333 0.65 0.00 0.00 1.73
3981 6839 8.434589 AGAATTCCCATTGTTTCCTTTGATAA 57.565 30.769 0.65 0.00 0.00 1.75
3982 6840 7.895429 AGAGAATTCCCATTGTTTCCTTTGATA 59.105 33.333 0.65 0.00 0.00 2.15
3983 6841 6.727697 AGAGAATTCCCATTGTTTCCTTTGAT 59.272 34.615 0.65 0.00 0.00 2.57
3984 6842 6.077322 AGAGAATTCCCATTGTTTCCTTTGA 58.923 36.000 0.65 0.00 0.00 2.69
3985 6843 6.350629 AGAGAATTCCCATTGTTTCCTTTG 57.649 37.500 0.65 0.00 0.00 2.77
3986 6844 7.730332 AGTAAGAGAATTCCCATTGTTTCCTTT 59.270 33.333 0.65 0.00 0.00 3.11
3987 6845 7.241628 AGTAAGAGAATTCCCATTGTTTCCTT 58.758 34.615 0.65 0.00 0.00 3.36
3988 6846 6.794534 AGTAAGAGAATTCCCATTGTTTCCT 58.205 36.000 0.65 0.00 0.00 3.36
3989 6847 7.315890 CAAGTAAGAGAATTCCCATTGTTTCC 58.684 38.462 0.65 0.00 0.00 3.13
3990 6848 7.315890 CCAAGTAAGAGAATTCCCATTGTTTC 58.684 38.462 0.65 0.00 0.00 2.78
3991 6849 6.211384 CCCAAGTAAGAGAATTCCCATTGTTT 59.789 38.462 0.65 0.00 0.00 2.83
3992 6850 5.716703 CCCAAGTAAGAGAATTCCCATTGTT 59.283 40.000 0.65 0.00 0.00 2.83
3993 6851 5.015178 TCCCAAGTAAGAGAATTCCCATTGT 59.985 40.000 0.65 0.00 0.00 2.71
3994 6852 5.509498 TCCCAAGTAAGAGAATTCCCATTG 58.491 41.667 0.65 0.00 0.00 2.82
3995 6853 5.796502 TCCCAAGTAAGAGAATTCCCATT 57.203 39.130 0.65 0.00 0.00 3.16
3996 6854 5.796502 TTCCCAAGTAAGAGAATTCCCAT 57.203 39.130 0.65 0.00 0.00 4.00
3997 6855 5.592587 TTTCCCAAGTAAGAGAATTCCCA 57.407 39.130 0.65 0.00 0.00 4.37
3998 6856 6.260271 CGTATTTCCCAAGTAAGAGAATTCCC 59.740 42.308 0.65 0.00 0.00 3.97
3999 6857 7.046033 TCGTATTTCCCAAGTAAGAGAATTCC 58.954 38.462 0.65 0.00 0.00 3.01
4000 6858 8.552034 CATCGTATTTCCCAAGTAAGAGAATTC 58.448 37.037 0.00 0.00 0.00 2.17
4001 6859 8.265055 TCATCGTATTTCCCAAGTAAGAGAATT 58.735 33.333 0.00 0.00 0.00 2.17
4002 6860 7.792032 TCATCGTATTTCCCAAGTAAGAGAAT 58.208 34.615 0.00 0.00 0.00 2.40
4003 6861 7.093465 ACTCATCGTATTTCCCAAGTAAGAGAA 60.093 37.037 0.00 0.00 0.00 2.87
4004 6862 6.380274 ACTCATCGTATTTCCCAAGTAAGAGA 59.620 38.462 0.00 0.00 0.00 3.10
4005 6863 6.574350 ACTCATCGTATTTCCCAAGTAAGAG 58.426 40.000 0.00 0.00 0.00 2.85
4006 6864 6.540438 ACTCATCGTATTTCCCAAGTAAGA 57.460 37.500 0.00 0.00 0.00 2.10
4007 6865 6.924060 CCTACTCATCGTATTTCCCAAGTAAG 59.076 42.308 0.00 0.00 0.00 2.34
4008 6866 6.608405 TCCTACTCATCGTATTTCCCAAGTAA 59.392 38.462 0.00 0.00 0.00 2.24
4009 6867 6.131264 TCCTACTCATCGTATTTCCCAAGTA 58.869 40.000 0.00 0.00 0.00 2.24
4010 6868 4.960469 TCCTACTCATCGTATTTCCCAAGT 59.040 41.667 0.00 0.00 0.00 3.16
4011 6869 5.302059 TCTCCTACTCATCGTATTTCCCAAG 59.698 44.000 0.00 0.00 0.00 3.61
4012 6870 5.205821 TCTCCTACTCATCGTATTTCCCAA 58.794 41.667 0.00 0.00 0.00 4.12
4013 6871 4.800023 TCTCCTACTCATCGTATTTCCCA 58.200 43.478 0.00 0.00 0.00 4.37
4014 6872 5.986501 ATCTCCTACTCATCGTATTTCCC 57.013 43.478 0.00 0.00 0.00 3.97
4015 6873 7.925043 TCTATCTCCTACTCATCGTATTTCC 57.075 40.000 0.00 0.00 0.00 3.13
4020 6878 7.982919 GCTCTAATCTATCTCCTACTCATCGTA 59.017 40.741 0.00 0.00 0.00 3.43
4021 6879 6.821665 GCTCTAATCTATCTCCTACTCATCGT 59.178 42.308 0.00 0.00 0.00 3.73
4022 6880 6.821160 TGCTCTAATCTATCTCCTACTCATCG 59.179 42.308 0.00 0.00 0.00 3.84
4023 6881 7.201609 CGTGCTCTAATCTATCTCCTACTCATC 60.202 44.444 0.00 0.00 0.00 2.92
4024 6882 6.597672 CGTGCTCTAATCTATCTCCTACTCAT 59.402 42.308 0.00 0.00 0.00 2.90
4025 6883 5.935206 CGTGCTCTAATCTATCTCCTACTCA 59.065 44.000 0.00 0.00 0.00 3.41
4026 6884 5.353123 CCGTGCTCTAATCTATCTCCTACTC 59.647 48.000 0.00 0.00 0.00 2.59
4027 6885 5.250200 CCGTGCTCTAATCTATCTCCTACT 58.750 45.833 0.00 0.00 0.00 2.57
4028 6886 4.396790 CCCGTGCTCTAATCTATCTCCTAC 59.603 50.000 0.00 0.00 0.00 3.18
4029 6887 4.590918 CCCGTGCTCTAATCTATCTCCTA 58.409 47.826 0.00 0.00 0.00 2.94
4030 6888 3.426615 CCCGTGCTCTAATCTATCTCCT 58.573 50.000 0.00 0.00 0.00 3.69
4031 6889 2.094442 GCCCGTGCTCTAATCTATCTCC 60.094 54.545 0.00 0.00 33.53 3.71
4032 6890 2.558795 TGCCCGTGCTCTAATCTATCTC 59.441 50.000 0.00 0.00 38.71 2.75
4033 6891 2.598565 TGCCCGTGCTCTAATCTATCT 58.401 47.619 0.00 0.00 38.71 1.98
4034 6892 3.386768 TTGCCCGTGCTCTAATCTATC 57.613 47.619 0.00 0.00 38.71 2.08
4035 6893 3.580458 AGATTGCCCGTGCTCTAATCTAT 59.420 43.478 2.79 0.00 36.51 1.98
4036 6894 2.965831 AGATTGCCCGTGCTCTAATCTA 59.034 45.455 2.79 0.00 36.51 1.98
4037 6895 1.765314 AGATTGCCCGTGCTCTAATCT 59.235 47.619 0.00 0.00 34.61 2.40
4038 6896 2.246719 AGATTGCCCGTGCTCTAATC 57.753 50.000 0.00 0.00 38.71 1.75
4039 6897 5.683876 ATATAGATTGCCCGTGCTCTAAT 57.316 39.130 0.00 0.00 38.71 1.73
4040 6898 6.791867 ATATATAGATTGCCCGTGCTCTAA 57.208 37.500 0.00 0.00 38.71 2.10
4041 6899 7.891498 TTATATATAGATTGCCCGTGCTCTA 57.109 36.000 0.00 0.00 38.71 2.43
4042 6900 6.791867 TTATATATAGATTGCCCGTGCTCT 57.208 37.500 0.00 0.00 38.71 4.09
4043 6901 7.011482 CCTTTTATATATAGATTGCCCGTGCTC 59.989 40.741 0.00 0.00 38.71 4.26
4044 6902 6.823689 CCTTTTATATATAGATTGCCCGTGCT 59.176 38.462 0.00 0.00 38.71 4.40
4045 6903 6.038271 CCCTTTTATATATAGATTGCCCGTGC 59.962 42.308 0.00 0.00 38.26 5.34
4046 6904 7.335627 TCCCTTTTATATATAGATTGCCCGTG 58.664 38.462 0.00 0.00 0.00 4.94
4047 6905 7.504926 TCCCTTTTATATATAGATTGCCCGT 57.495 36.000 0.00 0.00 0.00 5.28
4048 6906 6.483640 GCTCCCTTTTATATATAGATTGCCCG 59.516 42.308 0.00 0.00 0.00 6.13
4049 6907 6.773200 GGCTCCCTTTTATATATAGATTGCCC 59.227 42.308 0.00 0.00 0.00 5.36
4050 6908 6.773200 GGGCTCCCTTTTATATATAGATTGCC 59.227 42.308 0.00 0.00 0.00 4.52
4051 6909 6.773200 GGGGCTCCCTTTTATATATAGATTGC 59.227 42.308 4.74 0.00 41.34 3.56
4068 6926 4.315349 CCTACCTTAGGGGCTCCC 57.685 66.667 0.00 0.00 45.90 4.30
4075 6933 5.960202 TGTAACTTAGTTCCCCTACCTTAGG 59.040 44.000 0.00 0.00 45.81 2.69
4076 6934 7.486407 TTGTAACTTAGTTCCCCTACCTTAG 57.514 40.000 0.00 0.00 0.00 2.18
4077 6935 6.070596 GCTTGTAACTTAGTTCCCCTACCTTA 60.071 42.308 0.00 0.00 0.00 2.69
4078 6936 5.280368 GCTTGTAACTTAGTTCCCCTACCTT 60.280 44.000 0.00 0.00 0.00 3.50
4079 6937 4.224594 GCTTGTAACTTAGTTCCCCTACCT 59.775 45.833 0.00 0.00 0.00 3.08
4080 6938 4.224594 AGCTTGTAACTTAGTTCCCCTACC 59.775 45.833 0.00 0.00 0.00 3.18
4081 6939 5.187381 AGAGCTTGTAACTTAGTTCCCCTAC 59.813 44.000 0.00 0.00 0.00 3.18
4082 6940 5.339477 AGAGCTTGTAACTTAGTTCCCCTA 58.661 41.667 0.00 0.00 0.00 3.53
4083 6941 4.168883 AGAGCTTGTAACTTAGTTCCCCT 58.831 43.478 0.00 0.00 0.00 4.79
4084 6942 4.505808 GAGAGCTTGTAACTTAGTTCCCC 58.494 47.826 0.00 0.00 0.00 4.81
4085 6943 4.082354 TCGAGAGCTTGTAACTTAGTTCCC 60.082 45.833 0.00 0.00 0.00 3.97
4086 6944 5.056894 TCGAGAGCTTGTAACTTAGTTCC 57.943 43.478 0.00 0.00 0.00 3.62
4087 6945 5.701855 ACTCGAGAGCTTGTAACTTAGTTC 58.298 41.667 21.68 0.00 0.00 3.01
4088 6946 5.708877 ACTCGAGAGCTTGTAACTTAGTT 57.291 39.130 21.68 2.32 0.00 2.24
4089 6947 5.939296 AGTACTCGAGAGCTTGTAACTTAGT 59.061 40.000 21.68 0.00 0.00 2.24
4090 6948 6.425577 AGTACTCGAGAGCTTGTAACTTAG 57.574 41.667 21.68 0.00 0.00 2.18
4091 6949 6.538021 CCTAGTACTCGAGAGCTTGTAACTTA 59.462 42.308 21.68 0.00 0.00 2.24
4092 6950 5.354792 CCTAGTACTCGAGAGCTTGTAACTT 59.645 44.000 21.68 0.00 0.00 2.66
4093 6951 4.877251 CCTAGTACTCGAGAGCTTGTAACT 59.123 45.833 21.68 10.64 0.00 2.24
4094 6952 4.635324 ACCTAGTACTCGAGAGCTTGTAAC 59.365 45.833 21.68 3.95 0.00 2.50
4095 6953 4.841422 ACCTAGTACTCGAGAGCTTGTAA 58.159 43.478 21.68 0.72 0.00 2.41
4096 6954 4.484537 ACCTAGTACTCGAGAGCTTGTA 57.515 45.455 21.68 0.00 0.00 2.41
4097 6955 3.353370 ACCTAGTACTCGAGAGCTTGT 57.647 47.619 21.68 13.06 0.00 3.16
4098 6956 4.260866 GCTAACCTAGTACTCGAGAGCTTG 60.261 50.000 21.68 15.66 0.00 4.01
4099 6957 3.878699 GCTAACCTAGTACTCGAGAGCTT 59.121 47.826 21.68 2.07 0.00 3.74
4100 6958 3.135167 AGCTAACCTAGTACTCGAGAGCT 59.865 47.826 21.68 16.06 33.04 4.09
4101 6959 3.469739 AGCTAACCTAGTACTCGAGAGC 58.530 50.000 21.68 13.92 0.00 4.09
4102 6960 6.282930 ACTTAGCTAACCTAGTACTCGAGAG 58.717 44.000 21.68 5.58 0.00 3.20
4103 6961 6.232581 ACTTAGCTAACCTAGTACTCGAGA 57.767 41.667 21.68 0.00 0.00 4.04
4104 6962 5.175491 CGACTTAGCTAACCTAGTACTCGAG 59.825 48.000 11.84 11.84 0.00 4.04
4105 6963 5.046529 CGACTTAGCTAACCTAGTACTCGA 58.953 45.833 0.86 0.00 0.00 4.04
4106 6964 4.318689 GCGACTTAGCTAACCTAGTACTCG 60.319 50.000 0.86 0.83 0.00 4.18
4107 6965 4.574013 TGCGACTTAGCTAACCTAGTACTC 59.426 45.833 0.86 0.00 38.13 2.59
4108 6966 4.335037 GTGCGACTTAGCTAACCTAGTACT 59.665 45.833 0.86 0.00 38.13 2.73
4109 6967 4.497173 GGTGCGACTTAGCTAACCTAGTAC 60.497 50.000 0.86 4.47 38.13 2.73
4110 6968 3.629398 GGTGCGACTTAGCTAACCTAGTA 59.371 47.826 0.86 0.00 38.13 1.82
4111 6969 2.426381 GGTGCGACTTAGCTAACCTAGT 59.574 50.000 0.86 0.00 38.13 2.57
4112 6970 2.223758 GGGTGCGACTTAGCTAACCTAG 60.224 54.545 0.86 0.00 34.66 3.02
4113 6971 1.753073 GGGTGCGACTTAGCTAACCTA 59.247 52.381 0.86 0.00 34.66 3.08
4114 6972 0.535797 GGGTGCGACTTAGCTAACCT 59.464 55.000 0.86 0.00 34.66 3.50
4115 6973 0.535797 AGGGTGCGACTTAGCTAACC 59.464 55.000 0.86 1.50 38.13 2.85
4116 6974 2.000447 CAAGGGTGCGACTTAGCTAAC 59.000 52.381 0.86 0.00 38.13 2.34
4117 6975 1.621814 ACAAGGGTGCGACTTAGCTAA 59.378 47.619 5.94 5.94 38.13 3.09
4118 6976 1.263356 ACAAGGGTGCGACTTAGCTA 58.737 50.000 0.00 0.00 38.13 3.32
4119 6977 1.263356 TACAAGGGTGCGACTTAGCT 58.737 50.000 0.00 0.00 38.13 3.32
4120 6978 2.088950 TTACAAGGGTGCGACTTAGC 57.911 50.000 0.00 0.00 37.71 3.09
4121 6979 2.858344 CGATTACAAGGGTGCGACTTAG 59.142 50.000 0.00 0.00 0.00 2.18
4122 6980 2.492881 TCGATTACAAGGGTGCGACTTA 59.507 45.455 0.00 0.00 0.00 2.24
4123 6981 1.274167 TCGATTACAAGGGTGCGACTT 59.726 47.619 0.00 0.00 0.00 3.01
4124 6982 0.892755 TCGATTACAAGGGTGCGACT 59.107 50.000 0.00 0.00 0.00 4.18
4125 6983 1.717194 TTCGATTACAAGGGTGCGAC 58.283 50.000 0.00 0.00 0.00 5.19
4126 6984 2.459060 TTTCGATTACAAGGGTGCGA 57.541 45.000 0.00 0.00 0.00 5.10
4127 6985 2.675844 TGATTTCGATTACAAGGGTGCG 59.324 45.455 0.00 0.00 0.00 5.34
4128 6986 3.438781 TGTGATTTCGATTACAAGGGTGC 59.561 43.478 0.00 0.00 0.00 5.01
4129 6987 5.621197 TTGTGATTTCGATTACAAGGGTG 57.379 39.130 0.00 0.00 0.00 4.61
4130 6988 5.943416 TGATTGTGATTTCGATTACAAGGGT 59.057 36.000 3.27 0.00 36.59 4.34
4131 6989 6.435430 TGATTGTGATTTCGATTACAAGGG 57.565 37.500 3.27 0.00 36.59 3.95
4132 6990 9.655769 CTATTGATTGTGATTTCGATTACAAGG 57.344 33.333 3.27 0.00 36.59 3.61
4133 6991 9.162793 GCTATTGATTGTGATTTCGATTACAAG 57.837 33.333 3.27 0.00 36.59 3.16
4134 6992 8.672815 TGCTATTGATTGTGATTTCGATTACAA 58.327 29.630 0.00 0.00 37.43 2.41
4135 6993 8.207521 TGCTATTGATTGTGATTTCGATTACA 57.792 30.769 0.00 0.00 0.00 2.41
4136 6994 9.502145 TTTGCTATTGATTGTGATTTCGATTAC 57.498 29.630 0.00 0.00 0.00 1.89
4137 6995 9.502145 GTTTGCTATTGATTGTGATTTCGATTA 57.498 29.630 0.00 0.00 0.00 1.75
4138 6996 8.028354 TGTTTGCTATTGATTGTGATTTCGATT 58.972 29.630 0.00 0.00 0.00 3.34
4139 6997 7.537715 TGTTTGCTATTGATTGTGATTTCGAT 58.462 30.769 0.00 0.00 0.00 3.59
4140 6998 6.907741 TGTTTGCTATTGATTGTGATTTCGA 58.092 32.000 0.00 0.00 0.00 3.71
4141 6999 7.565450 TTGTTTGCTATTGATTGTGATTTCG 57.435 32.000 0.00 0.00 0.00 3.46
4142 7000 7.953710 GCTTTGTTTGCTATTGATTGTGATTTC 59.046 33.333 0.00 0.00 0.00 2.17
4143 7001 7.441760 TGCTTTGTTTGCTATTGATTGTGATTT 59.558 29.630 0.00 0.00 0.00 2.17
4144 7002 6.930164 TGCTTTGTTTGCTATTGATTGTGATT 59.070 30.769 0.00 0.00 0.00 2.57
4145 7003 6.457355 TGCTTTGTTTGCTATTGATTGTGAT 58.543 32.000 0.00 0.00 0.00 3.06
4146 7004 5.840715 TGCTTTGTTTGCTATTGATTGTGA 58.159 33.333 0.00 0.00 0.00 3.58
4147 7005 5.119588 CCTGCTTTGTTTGCTATTGATTGTG 59.880 40.000 0.00 0.00 0.00 3.33
4148 7006 5.010922 TCCTGCTTTGTTTGCTATTGATTGT 59.989 36.000 0.00 0.00 0.00 2.71
4149 7007 5.346822 GTCCTGCTTTGTTTGCTATTGATTG 59.653 40.000 0.00 0.00 0.00 2.67
4150 7008 5.473039 GTCCTGCTTTGTTTGCTATTGATT 58.527 37.500 0.00 0.00 0.00 2.57
4151 7009 4.379813 CGTCCTGCTTTGTTTGCTATTGAT 60.380 41.667 0.00 0.00 0.00 2.57
4152 7010 3.058293 CGTCCTGCTTTGTTTGCTATTGA 60.058 43.478 0.00 0.00 0.00 2.57
4153 7011 3.236816 CGTCCTGCTTTGTTTGCTATTG 58.763 45.455 0.00 0.00 0.00 1.90
4154 7012 2.884639 ACGTCCTGCTTTGTTTGCTATT 59.115 40.909 0.00 0.00 0.00 1.73
4155 7013 2.504367 ACGTCCTGCTTTGTTTGCTAT 58.496 42.857 0.00 0.00 0.00 2.97
4156 7014 1.961793 ACGTCCTGCTTTGTTTGCTA 58.038 45.000 0.00 0.00 0.00 3.49
4157 7015 1.961793 TACGTCCTGCTTTGTTTGCT 58.038 45.000 0.00 0.00 0.00 3.91
4158 7016 2.584791 CATACGTCCTGCTTTGTTTGC 58.415 47.619 0.00 0.00 0.00 3.68
4159 7017 2.584791 GCATACGTCCTGCTTTGTTTG 58.415 47.619 14.03 0.00 36.68 2.93
4160 7018 2.989422 GCATACGTCCTGCTTTGTTT 57.011 45.000 14.03 0.00 36.68 2.83
4167 7025 3.576648 GAGGTAATAGCATACGTCCTGC 58.423 50.000 13.57 13.57 39.97 4.85
4168 7026 3.501062 TCGAGGTAATAGCATACGTCCTG 59.499 47.826 0.00 0.00 37.38 3.86
4169 7027 3.748083 TCGAGGTAATAGCATACGTCCT 58.252 45.455 0.00 0.00 37.38 3.85
4170 7028 4.660105 GATCGAGGTAATAGCATACGTCC 58.340 47.826 0.00 0.00 37.38 4.79
4171 7029 4.142945 ACGATCGAGGTAATAGCATACGTC 60.143 45.833 24.34 6.85 37.34 4.34
4172 7030 3.750130 ACGATCGAGGTAATAGCATACGT 59.250 43.478 24.34 0.00 0.00 3.57
4173 7031 4.337985 ACGATCGAGGTAATAGCATACG 57.662 45.455 24.34 0.00 0.00 3.06
4174 7032 6.256686 CCTTACGATCGAGGTAATAGCATAC 58.743 44.000 24.34 0.00 30.16 2.39
4175 7033 5.356190 CCCTTACGATCGAGGTAATAGCATA 59.644 44.000 24.34 0.00 30.16 3.14
4176 7034 4.158025 CCCTTACGATCGAGGTAATAGCAT 59.842 45.833 24.34 0.00 30.16 3.79
4177 7035 3.504906 CCCTTACGATCGAGGTAATAGCA 59.495 47.826 24.34 0.00 30.16 3.49
4178 7036 3.119566 CCCCTTACGATCGAGGTAATAGC 60.120 52.174 24.34 0.00 30.16 2.97
4179 7037 3.119566 GCCCCTTACGATCGAGGTAATAG 60.120 52.174 24.34 5.67 30.16 1.73
4180 7038 2.821969 GCCCCTTACGATCGAGGTAATA 59.178 50.000 24.34 0.00 30.16 0.98
4181 7039 1.617357 GCCCCTTACGATCGAGGTAAT 59.383 52.381 24.34 0.00 30.16 1.89
4182 7040 1.035139 GCCCCTTACGATCGAGGTAA 58.965 55.000 24.34 9.26 0.00 2.85
4183 7041 0.825010 GGCCCCTTACGATCGAGGTA 60.825 60.000 24.34 0.10 0.00 3.08
4184 7042 2.132352 GGCCCCTTACGATCGAGGT 61.132 63.158 24.34 1.27 0.00 3.85
4185 7043 2.735237 GGCCCCTTACGATCGAGG 59.265 66.667 24.34 18.63 0.00 4.63
4186 7044 1.731433 TTCGGCCCCTTACGATCGAG 61.731 60.000 24.34 9.65 39.06 4.04
4187 7045 1.753848 TTCGGCCCCTTACGATCGA 60.754 57.895 24.34 2.23 39.06 3.59
4188 7046 1.590792 GTTCGGCCCCTTACGATCG 60.591 63.158 14.88 14.88 39.06 3.69
4189 7047 1.227468 GGTTCGGCCCCTTACGATC 60.227 63.158 0.00 0.00 39.06 3.69
4190 7048 1.688187 AGGTTCGGCCCCTTACGAT 60.688 57.895 0.00 0.00 39.06 3.73
4191 7049 2.284112 AGGTTCGGCCCCTTACGA 60.284 61.111 0.00 0.00 38.26 3.43
4192 7050 2.125269 CAGGTTCGGCCCCTTACG 60.125 66.667 0.00 0.00 38.26 3.18
4193 7051 1.266867 TACCAGGTTCGGCCCCTTAC 61.267 60.000 0.00 0.00 38.26 2.34
4194 7052 0.547229 TTACCAGGTTCGGCCCCTTA 60.547 55.000 0.00 0.00 38.26 2.69
4195 7053 1.428718 TTTACCAGGTTCGGCCCCTT 61.429 55.000 0.00 0.00 38.26 3.95
4196 7054 1.848895 TTTACCAGGTTCGGCCCCT 60.849 57.895 0.00 0.00 38.26 4.79
4197 7055 1.676635 GTTTACCAGGTTCGGCCCC 60.677 63.158 0.00 0.00 38.26 5.80
4198 7056 0.675837 GAGTTTACCAGGTTCGGCCC 60.676 60.000 0.00 0.00 38.26 5.80
4199 7057 0.323957 AGAGTTTACCAGGTTCGGCC 59.676 55.000 0.00 0.00 37.58 6.13
4200 7058 1.001633 TGAGAGTTTACCAGGTTCGGC 59.998 52.381 0.00 0.00 0.00 5.54
4201 7059 3.195825 AGATGAGAGTTTACCAGGTTCGG 59.804 47.826 0.00 0.00 0.00 4.30
4202 7060 4.158764 AGAGATGAGAGTTTACCAGGTTCG 59.841 45.833 0.00 0.00 0.00 3.95
4203 7061 5.656480 GAGAGATGAGAGTTTACCAGGTTC 58.344 45.833 0.00 0.00 0.00 3.62
4204 7062 4.158764 CGAGAGATGAGAGTTTACCAGGTT 59.841 45.833 0.00 0.00 0.00 3.50
4205 7063 3.697045 CGAGAGATGAGAGTTTACCAGGT 59.303 47.826 0.00 0.00 0.00 4.00
4206 7064 3.948473 TCGAGAGATGAGAGTTTACCAGG 59.052 47.826 0.00 0.00 33.31 4.45
4222 7080 4.645762 TGAGGTTGATCTGAATCGAGAG 57.354 45.455 0.00 0.00 34.39 3.20
4223 7081 5.127682 TGAATGAGGTTGATCTGAATCGAGA 59.872 40.000 0.00 0.00 34.39 4.04
4224 7082 5.354767 TGAATGAGGTTGATCTGAATCGAG 58.645 41.667 0.00 0.00 34.39 4.04
4225 7083 5.343307 TGAATGAGGTTGATCTGAATCGA 57.657 39.130 0.00 0.00 34.39 3.59
4226 7084 5.503683 GCTTGAATGAGGTTGATCTGAATCG 60.504 44.000 0.00 0.00 34.39 3.34
4227 7085 5.589452 AGCTTGAATGAGGTTGATCTGAATC 59.411 40.000 0.00 0.00 0.00 2.52
4228 7086 5.507637 AGCTTGAATGAGGTTGATCTGAAT 58.492 37.500 0.00 0.00 0.00 2.57
4229 7087 4.914983 AGCTTGAATGAGGTTGATCTGAA 58.085 39.130 0.00 0.00 0.00 3.02
4230 7088 4.564782 AGCTTGAATGAGGTTGATCTGA 57.435 40.909 0.00 0.00 0.00 3.27
4231 7089 4.574013 GGTAGCTTGAATGAGGTTGATCTG 59.426 45.833 0.00 0.00 0.00 2.90
4232 7090 4.681781 CGGTAGCTTGAATGAGGTTGATCT 60.682 45.833 0.00 0.00 0.00 2.75
4233 7091 3.557595 CGGTAGCTTGAATGAGGTTGATC 59.442 47.826 0.00 0.00 0.00 2.92
4234 7092 3.535561 CGGTAGCTTGAATGAGGTTGAT 58.464 45.455 0.00 0.00 0.00 2.57
4235 7093 2.935238 GCGGTAGCTTGAATGAGGTTGA 60.935 50.000 0.00 0.00 41.01 3.18
4236 7094 1.398390 GCGGTAGCTTGAATGAGGTTG 59.602 52.381 0.00 0.00 41.01 3.77
4237 7095 1.739067 GCGGTAGCTTGAATGAGGTT 58.261 50.000 0.00 0.00 41.01 3.50
4238 7096 3.460648 GCGGTAGCTTGAATGAGGT 57.539 52.632 0.00 0.00 41.01 3.85
4255 7113 0.532862 TAAGGCCATCGCAGCTAAGC 60.533 55.000 5.01 0.00 36.38 3.09
4256 7114 1.221414 GTAAGGCCATCGCAGCTAAG 58.779 55.000 5.01 0.00 36.38 2.18
4257 7115 0.529773 CGTAAGGCCATCGCAGCTAA 60.530 55.000 5.01 0.00 36.38 3.09
4258 7116 1.067416 CGTAAGGCCATCGCAGCTA 59.933 57.895 5.01 0.00 36.38 3.32
4259 7117 2.202932 CGTAAGGCCATCGCAGCT 60.203 61.111 5.01 0.00 36.38 4.24
4260 7118 2.202878 TCGTAAGGCCATCGCAGC 60.203 61.111 5.01 0.00 36.38 5.25
4261 7119 3.706140 GTCGTAAGGCCATCGCAG 58.294 61.111 5.01 0.00 36.38 5.18
4269 7127 4.992951 TGAAAAAGGACTTAGTCGTAAGGC 59.007 41.667 8.04 0.57 42.96 4.35
4270 7128 6.147328 CCTTGAAAAAGGACTTAGTCGTAAGG 59.853 42.308 14.92 14.92 42.62 2.69
4271 7129 6.927381 TCCTTGAAAAAGGACTTAGTCGTAAG 59.073 38.462 8.04 7.57 43.68 2.34
4272 7130 6.819284 TCCTTGAAAAAGGACTTAGTCGTAA 58.181 36.000 8.04 0.00 43.68 3.18
4273 7131 6.409524 TCCTTGAAAAAGGACTTAGTCGTA 57.590 37.500 8.04 0.00 43.68 3.43
4274 7132 5.286267 TCCTTGAAAAAGGACTTAGTCGT 57.714 39.130 6.27 3.84 43.68 4.34
4283 7141 3.157087 GGCAGATGTCCTTGAAAAAGGA 58.843 45.455 3.04 3.04 46.20 3.36
4284 7142 2.892852 TGGCAGATGTCCTTGAAAAAGG 59.107 45.455 0.00 0.00 41.35 3.11
4285 7143 4.219070 TCATGGCAGATGTCCTTGAAAAAG 59.781 41.667 0.00 0.00 35.60 2.27
4286 7144 4.022068 GTCATGGCAGATGTCCTTGAAAAA 60.022 41.667 0.00 0.00 38.82 1.94
4287 7145 3.507233 GTCATGGCAGATGTCCTTGAAAA 59.493 43.478 0.00 0.00 38.82 2.29
4288 7146 3.084039 GTCATGGCAGATGTCCTTGAAA 58.916 45.455 0.00 0.00 38.82 2.69
4289 7147 2.040145 TGTCATGGCAGATGTCCTTGAA 59.960 45.455 0.00 3.74 38.82 2.69
4290 7148 1.629861 TGTCATGGCAGATGTCCTTGA 59.370 47.619 0.00 7.37 36.00 3.02
4291 7149 2.118313 TGTCATGGCAGATGTCCTTG 57.882 50.000 0.00 0.00 0.00 3.61
4292 7150 2.885135 TTGTCATGGCAGATGTCCTT 57.115 45.000 0.00 0.00 0.00 3.36
4293 7151 2.885135 TTTGTCATGGCAGATGTCCT 57.115 45.000 0.00 0.00 0.00 3.85
4294 7152 3.444742 TGATTTTGTCATGGCAGATGTCC 59.555 43.478 0.00 0.00 0.00 4.02
4295 7153 4.707030 TGATTTTGTCATGGCAGATGTC 57.293 40.909 0.00 0.00 0.00 3.06
4306 7164 8.849168 AGTTCATTTAGTGTCATGATTTTGTCA 58.151 29.630 0.00 0.00 42.06 3.58
4314 7172 9.990360 TTGTAACTAGTTCATTTAGTGTCATGA 57.010 29.630 12.39 0.00 31.96 3.07
4327 7185 9.168451 TGTCAAGTTTGATTTGTAACTAGTTCA 57.832 29.630 12.39 7.48 39.73 3.18
4330 7188 9.561069 AGATGTCAAGTTTGATTTGTAACTAGT 57.439 29.630 0.00 0.00 39.73 2.57
4333 7191 9.778741 TCTAGATGTCAAGTTTGATTTGTAACT 57.221 29.630 0.00 0.00 39.73 2.24
4335 7193 9.996554 TCTCTAGATGTCAAGTTTGATTTGTAA 57.003 29.630 0.00 0.00 39.73 2.41
4336 7194 9.996554 TTCTCTAGATGTCAAGTTTGATTTGTA 57.003 29.630 0.00 0.00 39.73 2.41
4399 7258 4.701765 CTCAGGCTCACTTTAGCACATAT 58.298 43.478 0.00 0.00 44.64 1.78
4405 7264 1.082690 GTGCTCAGGCTCACTTTAGC 58.917 55.000 0.00 0.00 41.99 3.09
4409 7268 1.202855 ACAATGTGCTCAGGCTCACTT 60.203 47.619 6.41 0.00 43.29 3.16
4410 7269 0.399454 ACAATGTGCTCAGGCTCACT 59.601 50.000 6.41 0.00 43.29 3.41
4411 7270 1.734465 GTACAATGTGCTCAGGCTCAC 59.266 52.381 0.00 0.00 43.29 3.51
4412 7271 1.625315 AGTACAATGTGCTCAGGCTCA 59.375 47.619 0.00 0.00 44.34 4.26
4413 7272 2.393271 AGTACAATGTGCTCAGGCTC 57.607 50.000 0.00 0.00 39.59 4.70
4414 7273 2.867109 AAGTACAATGTGCTCAGGCT 57.133 45.000 4.12 0.00 39.59 4.58
4415 7274 3.246226 CGATAAGTACAATGTGCTCAGGC 59.754 47.826 4.12 0.00 39.26 4.85
4416 7275 3.246226 GCGATAAGTACAATGTGCTCAGG 59.754 47.826 4.12 0.00 0.00 3.86
4417 7276 3.865164 TGCGATAAGTACAATGTGCTCAG 59.135 43.478 4.12 0.00 0.00 3.35
4418 7277 3.616821 GTGCGATAAGTACAATGTGCTCA 59.383 43.478 4.12 0.00 35.42 4.26
4419 7278 3.865745 AGTGCGATAAGTACAATGTGCTC 59.134 43.478 4.12 0.00 37.96 4.26
4420 7279 3.861840 AGTGCGATAAGTACAATGTGCT 58.138 40.909 0.00 0.00 37.96 4.40
4421 7280 3.865745 AGAGTGCGATAAGTACAATGTGC 59.134 43.478 0.00 0.00 37.96 4.57
4422 7281 4.504461 GGAGAGTGCGATAAGTACAATGTG 59.496 45.833 0.00 0.00 37.96 3.21
4423 7282 4.683832 GGAGAGTGCGATAAGTACAATGT 58.316 43.478 0.00 0.00 37.96 2.71
4424 7283 3.731216 CGGAGAGTGCGATAAGTACAATG 59.269 47.826 0.00 0.00 37.96 2.82
4425 7284 3.243434 CCGGAGAGTGCGATAAGTACAAT 60.243 47.826 0.00 0.00 37.96 2.71
4426 7285 2.098607 CCGGAGAGTGCGATAAGTACAA 59.901 50.000 0.00 0.00 37.96 2.41
4427 7286 1.674441 CCGGAGAGTGCGATAAGTACA 59.326 52.381 0.00 0.00 37.96 2.90
4428 7287 1.599916 GCCGGAGAGTGCGATAAGTAC 60.600 57.143 5.05 0.00 30.86 2.73
4429 7288 0.666913 GCCGGAGAGTGCGATAAGTA 59.333 55.000 5.05 0.00 30.86 2.24
4430 7289 1.437986 GCCGGAGAGTGCGATAAGT 59.562 57.895 5.05 0.00 30.86 2.24
4431 7290 1.300233 GGCCGGAGAGTGCGATAAG 60.300 63.158 5.05 0.00 30.86 1.73
4432 7291 1.609635 TTGGCCGGAGAGTGCGATAA 61.610 55.000 5.05 0.00 30.86 1.75
4433 7292 2.055633 TTGGCCGGAGAGTGCGATA 61.056 57.895 5.05 0.00 30.86 2.92
4434 7293 3.390521 TTGGCCGGAGAGTGCGAT 61.391 61.111 5.05 0.00 30.86 4.58
4435 7294 4.373116 GTTGGCCGGAGAGTGCGA 62.373 66.667 5.05 0.00 30.86 5.10
4437 7296 4.329545 TGGTTGGCCGGAGAGTGC 62.330 66.667 5.05 0.00 37.67 4.40
4438 7297 2.358737 GTGGTTGGCCGGAGAGTG 60.359 66.667 5.05 0.00 37.67 3.51
4439 7298 2.847234 TGTGGTTGGCCGGAGAGT 60.847 61.111 5.05 0.00 37.67 3.24
4440 7299 1.903877 ATCTGTGGTTGGCCGGAGAG 61.904 60.000 5.05 0.00 37.67 3.20
4441 7300 1.899437 GATCTGTGGTTGGCCGGAGA 61.899 60.000 5.05 0.00 37.67 3.71
4442 7301 1.450312 GATCTGTGGTTGGCCGGAG 60.450 63.158 5.05 0.00 37.67 4.63
4443 7302 2.668632 GATCTGTGGTTGGCCGGA 59.331 61.111 5.05 0.00 37.67 5.14
4444 7303 2.819595 CGATCTGTGGTTGGCCGG 60.820 66.667 0.00 0.00 37.67 6.13
4445 7304 2.047274 ACGATCTGTGGTTGGCCG 60.047 61.111 0.00 0.00 37.67 6.13
4446 7305 3.578456 CACGATCTGTGGTTGGCC 58.422 61.111 0.00 0.00 45.21 5.36
4457 7316 3.768185 TTAGAGGGCGCGCACGATC 62.768 63.158 34.42 23.96 43.93 3.69
4458 7317 2.644555 AATTAGAGGGCGCGCACGAT 62.645 55.000 34.42 25.16 43.93 3.73
4459 7318 2.845752 AAATTAGAGGGCGCGCACGA 62.846 55.000 34.42 17.89 43.93 4.35
4460 7319 1.149361 TAAATTAGAGGGCGCGCACG 61.149 55.000 34.42 0.00 44.07 5.34
4461 7320 0.303796 GTAAATTAGAGGGCGCGCAC 59.696 55.000 34.42 32.15 0.00 5.34
4462 7321 0.812412 GGTAAATTAGAGGGCGCGCA 60.812 55.000 34.42 11.89 0.00 6.09
4463 7322 1.504647 GGGTAAATTAGAGGGCGCGC 61.505 60.000 25.94 25.94 0.00 6.86
4464 7323 0.106149 AGGGTAAATTAGAGGGCGCG 59.894 55.000 0.00 0.00 0.00 6.86
4465 7324 1.594331 CAGGGTAAATTAGAGGGCGC 58.406 55.000 0.00 0.00 0.00 6.53
4466 7325 1.814248 GCCAGGGTAAATTAGAGGGCG 60.814 57.143 0.00 0.00 0.00 6.13
4467 7326 1.214424 TGCCAGGGTAAATTAGAGGGC 59.786 52.381 0.00 0.00 40.51 5.19
4468 7327 2.158608 CCTGCCAGGGTAAATTAGAGGG 60.159 54.545 1.63 0.00 0.00 4.30
4469 7328 2.749800 GCCTGCCAGGGTAAATTAGAGG 60.750 54.545 13.78 0.00 35.37 3.69
4470 7329 2.576615 GCCTGCCAGGGTAAATTAGAG 58.423 52.381 13.78 0.00 35.37 2.43
4471 7330 1.214424 GGCCTGCCAGGGTAAATTAGA 59.786 52.381 13.78 0.00 35.37 2.10
4472 7331 1.064017 TGGCCTGCCAGGGTAAATTAG 60.064 52.381 13.78 0.00 41.89 1.73
4473 7332 1.003646 TGGCCTGCCAGGGTAAATTA 58.996 50.000 13.78 0.00 41.89 1.40
4474 7333 1.780327 TGGCCTGCCAGGGTAAATT 59.220 52.632 13.78 0.00 41.89 1.82
4475 7334 3.519291 TGGCCTGCCAGGGTAAAT 58.481 55.556 13.78 0.00 41.89 1.40
4484 7343 4.748144 CTG