Multiple sequence alignment - TraesCS5B01G566900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G566900 chr5B 100.000 7564 0 0 1 7564 710966350 710958787 0.000000e+00 13969.0
1 TraesCS5B01G566900 chr5B 83.836 2821 430 22 3348 6158 695482635 695485439 0.000000e+00 2660.0
2 TraesCS5B01G566900 chr5B 83.528 2823 435 26 3348 6158 695787418 695790222 0.000000e+00 2610.0
3 TraesCS5B01G566900 chr5B 83.885 2538 381 23 3348 5871 711133908 711131385 0.000000e+00 2396.0
4 TraesCS5B01G566900 chr5B 84.155 2474 365 24 3436 5897 711183790 711181332 0.000000e+00 2372.0
5 TraesCS5B01G566900 chr5B 83.744 2393 361 24 3348 5726 711240909 711238531 0.000000e+00 2239.0
6 TraesCS5B01G566900 chr5B 81.575 1194 193 15 1682 2853 711187215 711186027 0.000000e+00 961.0
7 TraesCS5B01G566900 chr5B 81.749 1178 185 15 1640 2807 711827314 711828471 0.000000e+00 957.0
8 TraesCS5B01G566900 chr5B 80.083 1200 208 19 1626 2807 711941275 711942461 0.000000e+00 863.0
9 TraesCS5B01G566900 chr5B 80.219 1188 200 22 1640 2807 711136887 711135715 0.000000e+00 859.0
10 TraesCS5B01G566900 chr5B 79.074 1209 223 19 1642 2834 711915205 711914011 0.000000e+00 804.0
11 TraesCS5B01G566900 chr5B 84.978 679 97 5 5771 6446 710960725 710960049 0.000000e+00 684.0
12 TraesCS5B01G566900 chr5B 80.528 909 141 23 6012 6905 711148605 711147718 0.000000e+00 665.0
13 TraesCS5B01G566900 chr5B 79.978 899 148 20 1919 2807 711153316 711152440 1.070000e-177 634.0
14 TraesCS5B01G566900 chr5B 85.821 536 69 7 5915 6446 710960725 710960193 5.120000e-156 562.0
15 TraesCS5B01G566900 chr5B 80.523 688 120 13 5920 6601 695789696 695790375 4.050000e-142 516.0
16 TraesCS5B01G566900 chr5B 83.367 493 56 15 1 468 361013672 361014163 4.190000e-117 433.0
17 TraesCS5B01G566900 chr5B 82.887 485 58 14 1 464 361112507 361112027 5.460000e-111 412.0
18 TraesCS5B01G566900 chr5B 84.136 353 52 1 978 1330 695785174 695785522 9.400000e-89 339.0
19 TraesCS5B01G566900 chr5B 84.478 335 52 0 996 1330 695480435 695480769 1.570000e-86 331.0
20 TraesCS5B01G566900 chr5B 83.235 340 48 6 966 1300 711155124 711154789 3.430000e-78 303.0
21 TraesCS5B01G566900 chr5B 81.250 320 60 0 997 1316 711940810 711941129 7.530000e-65 259.0
22 TraesCS5B01G566900 chr5B 89.831 59 3 1 7290 7345 712104054 712104112 1.050000e-08 73.1
23 TraesCS5B01G566900 chr5D 84.233 2613 398 14 3553 6158 555429229 555426624 0.000000e+00 2531.0
24 TraesCS5B01G566900 chr5D 84.217 2471 369 18 3436 5897 560500752 560503210 0.000000e+00 2383.0
25 TraesCS5B01G566900 chr5D 80.402 1194 203 18 1683 2857 560538031 560536850 0.000000e+00 880.0
26 TraesCS5B01G566900 chr5D 80.930 645 115 7 5960 6601 555427110 555426471 3.150000e-138 503.0
27 TraesCS5B01G566900 chr5D 87.397 365 34 6 1 354 344939737 344939374 7.060000e-110 409.0
28 TraesCS5B01G566900 chr5D 87.390 341 35 5 1869 2202 560514725 560515064 1.190000e-102 385.0
29 TraesCS5B01G566900 chr5D 80.594 505 92 5 6062 6564 561637205 561636705 1.190000e-102 385.0
30 TraesCS5B01G566900 chr5D 83.602 372 53 7 964 1330 551830965 551831333 7.270000e-90 342.0
31 TraesCS5B01G566900 chr5D 82.161 398 68 3 6207 6602 560502947 560503343 9.400000e-89 339.0
32 TraesCS5B01G566900 chr5D 83.003 353 56 1 978 1330 555434108 555433760 4.410000e-82 316.0
33 TraesCS5B01G566900 chr5D 82.748 313 43 9 925 1231 560512441 560512748 1.250000e-67 268.0
34 TraesCS5B01G566900 chr5D 81.138 334 62 1 997 1330 552854622 552854290 4.500000e-67 267.0
35 TraesCS5B01G566900 chr5D 81.138 334 62 1 997 1330 561949921 561950253 4.500000e-67 267.0
36 TraesCS5B01G566900 chr5D 85.926 135 19 0 6419 6553 561943693 561943827 2.200000e-30 145.0
37 TraesCS5B01G566900 chr5D 94.915 59 2 1 6848 6905 551836970 551837028 2.910000e-14 91.6
38 TraesCS5B01G566900 chr5D 91.045 67 2 1 854 916 560512396 560512462 3.760000e-13 87.9
39 TraesCS5B01G566900 chr4A 84.236 2474 363 23 3436 5897 603679316 603681774 0.000000e+00 2383.0
40 TraesCS5B01G566900 chr4A 81.532 888 134 17 1929 2807 603699485 603700351 0.000000e+00 704.0
41 TraesCS5B01G566900 chr4A 84.412 340 34 11 1 322 683552331 683551993 4.410000e-82 316.0
42 TraesCS5B01G566900 chr4A 78.974 390 60 10 925 1310 603697924 603698295 5.860000e-61 246.0
43 TraesCS5B01G566900 chr4A 88.372 86 4 3 837 916 603697860 603697945 1.740000e-16 99.0
44 TraesCS5B01G566900 chr4A 81.111 90 16 1 7216 7305 603682425 603682513 3.790000e-08 71.3
45 TraesCS5B01G566900 chr7A 82.700 2659 437 18 3366 6014 688997486 688994841 0.000000e+00 2340.0
46 TraesCS5B01G566900 chr7A 80.911 1252 196 31 1630 2855 689000065 688998831 0.000000e+00 948.0
47 TraesCS5B01G566900 chr7B 82.950 1607 249 22 4728 6326 1370725 1372314 0.000000e+00 1426.0
48 TraesCS5B01G566900 chr7B 79.449 944 177 14 5626 6564 1372959 1373890 0.000000e+00 652.0
49 TraesCS5B01G566900 chr7B 79.681 689 122 13 5764 6446 1372952 1373628 1.480000e-131 481.0
50 TraesCS5B01G566900 chr7B 83.265 490 61 9 1 471 507226481 507226968 1.510000e-116 431.0
51 TraesCS5B01G566900 chr7B 78.333 540 109 8 5626 6162 1373241 1373775 7.270000e-90 342.0
52 TraesCS5B01G566900 chr1D 82.542 1243 195 13 1641 2869 435265431 435264197 0.000000e+00 1074.0
53 TraesCS5B01G566900 chr1D 84.584 493 50 16 1 468 383180410 383180901 4.130000e-127 466.0
54 TraesCS5B01G566900 chr3D 78.328 1172 232 17 1652 2811 571137698 571136537 0.000000e+00 737.0
55 TraesCS5B01G566900 chr3D 86.448 487 46 14 4 471 467734912 467734427 4.050000e-142 516.0
56 TraesCS5B01G566900 chr3D 87.379 412 36 6 1 397 545795968 545796378 6.920000e-125 459.0
57 TraesCS5B01G566900 chr7D 83.773 493 54 14 1 468 168500851 168500360 1.940000e-120 444.0
58 TraesCS5B01G566900 chr3A 83.265 490 60 15 1 471 610341581 610341095 1.510000e-116 431.0
59 TraesCS5B01G566900 chr2A 86.070 402 39 10 1 386 5385545 5385945 4.220000e-112 416.0
60 TraesCS5B01G566900 chr2A 85.621 306 27 9 1 292 131317129 131316827 9.540000e-79 305.0
61 TraesCS5B01G566900 chr2A 90.476 42 4 0 428 469 523235823 523235782 1.000000e-03 56.5
62 TraesCS5B01G566900 chr1A 82.424 495 58 14 1 468 557890301 557890793 9.140000e-109 405.0
63 TraesCS5B01G566900 chr1A 90.476 42 4 0 428 469 296564378 296564337 1.000000e-03 56.5
64 TraesCS5B01G566900 chr4B 85.598 368 32 9 1 347 592196113 592195746 4.310000e-97 366.0
65 TraesCS5B01G566900 chr2B 90.674 193 18 0 1 193 2338302 2338110 2.710000e-64 257.0
66 TraesCS5B01G566900 chr1B 90.476 42 4 0 428 469 382945678 382945637 1.000000e-03 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G566900 chr5B 710958787 710966350 7563 True 13969.000000 13969 100.000000 1 7564 1 chr5B.!!$R2 7563
1 TraesCS5B01G566900 chr5B 711238531 711240909 2378 True 2239.000000 2239 83.744000 3348 5726 1 chr5B.!!$R3 2378
2 TraesCS5B01G566900 chr5B 711181332 711187215 5883 True 1666.500000 2372 82.865000 1682 5897 2 chr5B.!!$R8 4215
3 TraesCS5B01G566900 chr5B 711131385 711136887 5502 True 1627.500000 2396 82.052000 1640 5871 2 chr5B.!!$R6 4231
4 TraesCS5B01G566900 chr5B 695480435 695485439 5004 False 1495.500000 2660 84.157000 996 6158 2 chr5B.!!$F4 5162
5 TraesCS5B01G566900 chr5B 695785174 695790375 5201 False 1155.000000 2610 82.729000 978 6601 3 chr5B.!!$F5 5623
6 TraesCS5B01G566900 chr5B 711827314 711828471 1157 False 957.000000 957 81.749000 1640 2807 1 chr5B.!!$F2 1167
7 TraesCS5B01G566900 chr5B 711914011 711915205 1194 True 804.000000 804 79.074000 1642 2834 1 chr5B.!!$R4 1192
8 TraesCS5B01G566900 chr5B 710960049 710960725 676 True 623.000000 684 85.399500 5771 6446 2 chr5B.!!$R5 675
9 TraesCS5B01G566900 chr5B 711940810 711942461 1651 False 561.000000 863 80.666500 997 2807 2 chr5B.!!$F6 1810
10 TraesCS5B01G566900 chr5B 711147718 711155124 7406 True 534.000000 665 81.247000 966 6905 3 chr5B.!!$R7 5939
11 TraesCS5B01G566900 chr5D 555426471 555429229 2758 True 1517.000000 2531 82.581500 3553 6601 2 chr5D.!!$R6 3048
12 TraesCS5B01G566900 chr5D 560500752 560503343 2591 False 1361.000000 2383 83.189000 3436 6602 2 chr5D.!!$F5 3166
13 TraesCS5B01G566900 chr5D 560536850 560538031 1181 True 880.000000 880 80.402000 1683 2857 1 chr5D.!!$R4 1174
14 TraesCS5B01G566900 chr5D 561636705 561637205 500 True 385.000000 385 80.594000 6062 6564 1 chr5D.!!$R5 502
15 TraesCS5B01G566900 chr5D 560512396 560515064 2668 False 246.966667 385 87.061000 854 2202 3 chr5D.!!$F6 1348
16 TraesCS5B01G566900 chr4A 603679316 603682513 3197 False 1227.150000 2383 82.673500 3436 7305 2 chr4A.!!$F1 3869
17 TraesCS5B01G566900 chr4A 603697860 603700351 2491 False 349.666667 704 82.959333 837 2807 3 chr4A.!!$F2 1970
18 TraesCS5B01G566900 chr7A 688994841 689000065 5224 True 1644.000000 2340 81.805500 1630 6014 2 chr7A.!!$R1 4384
19 TraesCS5B01G566900 chr7B 1370725 1373890 3165 False 725.250000 1426 80.103250 4728 6564 4 chr7B.!!$F2 1836
20 TraesCS5B01G566900 chr1D 435264197 435265431 1234 True 1074.000000 1074 82.542000 1641 2869 1 chr1D.!!$R1 1228
21 TraesCS5B01G566900 chr3D 571136537 571137698 1161 True 737.000000 737 78.328000 1652 2811 1 chr3D.!!$R2 1159


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
738 739 0.029681 AGATATCCAGGGGCACACCT 60.030 55.0 0.00 0.00 43.08 4.00 F
750 751 0.243636 GCACACCTCCCCATTTTTCG 59.756 55.0 0.00 0.00 0.00 3.46 F
1638 3271 0.175760 TTGGGCTAGCGACTGACATC 59.824 55.0 9.00 0.00 0.00 3.06 F
2937 5167 0.036388 TAGCCAGGAACCTGCTTTCG 60.036 55.0 14.66 3.01 42.35 3.46 F
3259 7797 0.172803 AAGAGTGCCCTAACGCTACG 59.827 55.0 0.00 0.00 29.35 3.51 F
3485 8026 0.396811 ACACCAAAGTTCCTCCGGAG 59.603 55.0 25.36 25.36 31.21 4.63 F
4180 8721 0.540597 GGCAACCTTCCCAAGCTCTT 60.541 55.0 0.00 0.00 0.00 2.85 F
5811 10379 0.182775 GTGGTTGGGACAGTTGACCT 59.817 55.0 0.96 0.00 42.39 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1623 3256 0.378962 AGTCGATGTCAGTCGCTAGC 59.621 55.0 4.06 4.06 41.22 3.42 R
2536 4717 0.395724 CATGCCCTTGGGGTCCTTAC 60.396 60.0 7.91 0.00 46.51 2.34 R
3240 7778 0.172803 CGTAGCGTTAGGGCACTCTT 59.827 55.0 0.00 0.00 34.64 2.85 R
3919 8460 0.040067 GTCAGGCAAGGTTTCAAGCG 60.040 55.0 0.00 0.00 0.00 4.68 R
4205 8746 0.313043 CAGGCAGTTTGGTGAGCTTG 59.687 55.0 0.00 0.00 0.00 4.01 R
4574 9115 0.995024 CACCAAATGAGGAGGGGAGT 59.005 55.0 0.00 0.00 0.00 3.85 R
5756 10324 0.034089 GGCCTTGGCACTCTACCAAT 60.034 55.0 14.04 0.00 45.84 3.16 R
7391 14056 0.099436 GCAGGTCATGTGGATTTCGC 59.901 55.0 0.00 0.00 0.00 4.70 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 3.292460 ACGACCAAGGGTTTGATTTTCA 58.708 40.909 0.00 0.00 35.25 2.69
23 24 3.317993 ACGACCAAGGGTTTGATTTTCAG 59.682 43.478 0.00 0.00 35.25 3.02
24 25 3.305335 CGACCAAGGGTTTGATTTTCAGG 60.305 47.826 0.00 0.00 35.25 3.86
25 26 2.972021 ACCAAGGGTTTGATTTTCAGGG 59.028 45.455 0.00 0.00 36.36 4.45
26 27 2.972021 CCAAGGGTTTGATTTTCAGGGT 59.028 45.455 0.00 0.00 36.36 4.34
27 28 3.244181 CCAAGGGTTTGATTTTCAGGGTG 60.244 47.826 0.00 0.00 36.36 4.61
28 29 3.611025 AGGGTTTGATTTTCAGGGTGA 57.389 42.857 0.00 0.00 0.00 4.02
29 30 3.500343 AGGGTTTGATTTTCAGGGTGAG 58.500 45.455 0.00 0.00 0.00 3.51
30 31 3.140144 AGGGTTTGATTTTCAGGGTGAGA 59.860 43.478 0.00 0.00 0.00 3.27
31 32 3.895041 GGGTTTGATTTTCAGGGTGAGAA 59.105 43.478 0.00 0.00 0.00 2.87
32 33 4.528206 GGGTTTGATTTTCAGGGTGAGAAT 59.472 41.667 0.00 0.00 34.40 2.40
33 34 5.473039 GGTTTGATTTTCAGGGTGAGAATG 58.527 41.667 0.00 0.00 32.23 2.67
34 35 5.011023 GGTTTGATTTTCAGGGTGAGAATGT 59.989 40.000 0.00 0.00 32.23 2.71
35 36 6.462909 GGTTTGATTTTCAGGGTGAGAATGTT 60.463 38.462 0.00 0.00 32.23 2.71
36 37 5.710513 TGATTTTCAGGGTGAGAATGTTG 57.289 39.130 0.00 0.00 32.23 3.33
37 38 5.384336 TGATTTTCAGGGTGAGAATGTTGA 58.616 37.500 0.00 0.00 32.23 3.18
38 39 5.474532 TGATTTTCAGGGTGAGAATGTTGAG 59.525 40.000 0.00 0.00 32.23 3.02
39 40 2.479566 TCAGGGTGAGAATGTTGAGC 57.520 50.000 0.00 0.00 0.00 4.26
40 41 1.003580 TCAGGGTGAGAATGTTGAGCC 59.996 52.381 0.00 0.00 0.00 4.70
41 42 1.004044 CAGGGTGAGAATGTTGAGCCT 59.996 52.381 0.00 0.00 36.76 4.58
42 43 1.004044 AGGGTGAGAATGTTGAGCCTG 59.996 52.381 0.00 0.00 35.00 4.85
43 44 1.003580 GGGTGAGAATGTTGAGCCTGA 59.996 52.381 0.00 0.00 0.00 3.86
44 45 2.354259 GGTGAGAATGTTGAGCCTGAG 58.646 52.381 0.00 0.00 0.00 3.35
45 46 1.736681 GTGAGAATGTTGAGCCTGAGC 59.263 52.381 0.00 0.00 40.32 4.26
46 47 1.348696 TGAGAATGTTGAGCCTGAGCA 59.651 47.619 0.00 0.00 43.56 4.26
47 48 1.736681 GAGAATGTTGAGCCTGAGCAC 59.263 52.381 0.00 0.00 43.56 4.40
48 49 0.807496 GAATGTTGAGCCTGAGCACC 59.193 55.000 0.00 0.00 43.56 5.01
49 50 0.610232 AATGTTGAGCCTGAGCACCC 60.610 55.000 0.00 0.00 43.56 4.61
50 51 1.782201 ATGTTGAGCCTGAGCACCCA 61.782 55.000 0.00 0.00 43.56 4.51
51 52 1.968540 GTTGAGCCTGAGCACCCAC 60.969 63.158 0.00 0.00 43.56 4.61
52 53 3.196207 TTGAGCCTGAGCACCCACC 62.196 63.158 0.00 0.00 43.56 4.61
53 54 3.325753 GAGCCTGAGCACCCACCT 61.326 66.667 0.00 0.00 43.56 4.00
54 55 3.322318 GAGCCTGAGCACCCACCTC 62.322 68.421 0.00 0.00 43.56 3.85
55 56 4.416738 GCCTGAGCACCCACCTCC 62.417 72.222 0.00 0.00 39.53 4.30
56 57 2.608988 CCTGAGCACCCACCTCCT 60.609 66.667 0.00 0.00 0.00 3.69
57 58 2.667418 CTGAGCACCCACCTCCTG 59.333 66.667 0.00 0.00 0.00 3.86
58 59 3.618780 CTGAGCACCCACCTCCTGC 62.619 68.421 0.00 0.00 0.00 4.85
59 60 3.640407 GAGCACCCACCTCCTGCA 61.640 66.667 0.00 0.00 33.06 4.41
60 61 3.177884 AGCACCCACCTCCTGCAA 61.178 61.111 0.00 0.00 33.06 4.08
61 62 2.985847 GCACCCACCTCCTGCAAC 60.986 66.667 0.00 0.00 0.00 4.17
62 63 2.282462 CACCCACCTCCTGCAACC 60.282 66.667 0.00 0.00 0.00 3.77
63 64 2.450502 ACCCACCTCCTGCAACCT 60.451 61.111 0.00 0.00 0.00 3.50
64 65 2.084930 ACCCACCTCCTGCAACCTT 61.085 57.895 0.00 0.00 0.00 3.50
65 66 1.153756 CCCACCTCCTGCAACCTTT 59.846 57.895 0.00 0.00 0.00 3.11
66 67 1.181098 CCCACCTCCTGCAACCTTTG 61.181 60.000 0.00 0.00 0.00 2.77
67 68 0.178992 CCACCTCCTGCAACCTTTGA 60.179 55.000 0.00 0.00 0.00 2.69
68 69 1.691196 CACCTCCTGCAACCTTTGAA 58.309 50.000 0.00 0.00 0.00 2.69
69 70 2.242043 CACCTCCTGCAACCTTTGAAT 58.758 47.619 0.00 0.00 0.00 2.57
70 71 3.420893 CACCTCCTGCAACCTTTGAATA 58.579 45.455 0.00 0.00 0.00 1.75
71 72 3.441572 CACCTCCTGCAACCTTTGAATAG 59.558 47.826 0.00 0.00 0.00 1.73
72 73 3.074538 ACCTCCTGCAACCTTTGAATAGT 59.925 43.478 0.00 0.00 0.00 2.12
73 74 4.082125 CCTCCTGCAACCTTTGAATAGTT 58.918 43.478 0.00 0.00 0.00 2.24
74 75 4.524328 CCTCCTGCAACCTTTGAATAGTTT 59.476 41.667 0.00 0.00 0.00 2.66
75 76 5.452078 TCCTGCAACCTTTGAATAGTTTG 57.548 39.130 0.00 0.00 0.00 2.93
76 77 4.892934 TCCTGCAACCTTTGAATAGTTTGT 59.107 37.500 0.00 0.00 0.00 2.83
77 78 5.009610 TCCTGCAACCTTTGAATAGTTTGTC 59.990 40.000 0.00 0.00 0.00 3.18
78 79 5.195001 TGCAACCTTTGAATAGTTTGTCC 57.805 39.130 0.00 0.00 0.00 4.02
79 80 4.646945 TGCAACCTTTGAATAGTTTGTCCA 59.353 37.500 0.00 0.00 0.00 4.02
80 81 5.127845 TGCAACCTTTGAATAGTTTGTCCAA 59.872 36.000 0.00 0.00 0.00 3.53
81 82 6.183360 TGCAACCTTTGAATAGTTTGTCCAAT 60.183 34.615 0.00 0.00 0.00 3.16
82 83 6.705825 GCAACCTTTGAATAGTTTGTCCAATT 59.294 34.615 0.00 0.00 0.00 2.32
83 84 7.226523 GCAACCTTTGAATAGTTTGTCCAATTT 59.773 33.333 0.00 0.00 0.00 1.82
84 85 9.108284 CAACCTTTGAATAGTTTGTCCAATTTT 57.892 29.630 0.00 0.00 0.00 1.82
90 91 9.619316 TTGAATAGTTTGTCCAATTTTATCGTG 57.381 29.630 0.00 0.00 0.00 4.35
91 92 9.004717 TGAATAGTTTGTCCAATTTTATCGTGA 57.995 29.630 0.00 0.00 0.00 4.35
92 93 9.490663 GAATAGTTTGTCCAATTTTATCGTGAG 57.509 33.333 0.00 0.00 0.00 3.51
93 94 6.877611 AGTTTGTCCAATTTTATCGTGAGT 57.122 33.333 0.00 0.00 0.00 3.41
94 95 7.272037 AGTTTGTCCAATTTTATCGTGAGTT 57.728 32.000 0.00 0.00 0.00 3.01
95 96 7.138736 AGTTTGTCCAATTTTATCGTGAGTTG 58.861 34.615 0.00 0.00 0.00 3.16
96 97 5.041951 TGTCCAATTTTATCGTGAGTTGC 57.958 39.130 0.00 0.00 0.00 4.17
97 98 4.088648 GTCCAATTTTATCGTGAGTTGCG 58.911 43.478 0.00 0.00 0.00 4.85
98 99 3.749088 TCCAATTTTATCGTGAGTTGCGT 59.251 39.130 0.00 0.00 0.00 5.24
99 100 3.845775 CCAATTTTATCGTGAGTTGCGTG 59.154 43.478 0.00 0.00 0.00 5.34
100 101 4.377943 CCAATTTTATCGTGAGTTGCGTGA 60.378 41.667 0.00 0.00 0.00 4.35
101 102 5.323900 CAATTTTATCGTGAGTTGCGTGAT 58.676 37.500 0.00 0.00 0.00 3.06
102 103 4.577687 TTTTATCGTGAGTTGCGTGATC 57.422 40.909 0.00 0.00 0.00 2.92
103 104 1.822581 TATCGTGAGTTGCGTGATCG 58.177 50.000 0.00 0.00 40.37 3.69
104 105 0.170339 ATCGTGAGTTGCGTGATCGA 59.830 50.000 0.00 0.00 39.71 3.59
105 106 0.039888 TCGTGAGTTGCGTGATCGAA 60.040 50.000 0.00 0.00 39.71 3.71
106 107 0.781787 CGTGAGTTGCGTGATCGAAA 59.218 50.000 0.00 0.00 39.71 3.46
112 113 1.859383 TTGCGTGATCGAAACACTCA 58.141 45.000 18.82 15.71 39.71 3.41
113 114 2.078849 TGCGTGATCGAAACACTCAT 57.921 45.000 18.82 0.00 39.71 2.90
114 115 3.224884 TGCGTGATCGAAACACTCATA 57.775 42.857 18.82 5.16 39.71 2.15
115 116 2.921121 TGCGTGATCGAAACACTCATAC 59.079 45.455 18.82 3.84 39.71 2.39
116 117 2.035674 GCGTGATCGAAACACTCATACG 60.036 50.000 18.82 7.69 39.71 3.06
117 118 2.035674 CGTGATCGAAACACTCATACGC 60.036 50.000 18.82 0.00 39.71 4.42
118 119 2.921121 GTGATCGAAACACTCATACGCA 59.079 45.455 15.57 0.00 35.66 5.24
119 120 3.000674 GTGATCGAAACACTCATACGCAG 60.001 47.826 15.57 0.00 35.66 5.18
120 121 1.346365 TCGAAACACTCATACGCAGC 58.654 50.000 0.00 0.00 0.00 5.25
121 122 1.067846 TCGAAACACTCATACGCAGCT 60.068 47.619 0.00 0.00 0.00 4.24
122 123 1.059692 CGAAACACTCATACGCAGCTG 59.940 52.381 10.11 10.11 0.00 4.24
123 124 0.798776 AAACACTCATACGCAGCTGC 59.201 50.000 29.12 29.12 37.78 5.25
124 125 0.320683 AACACTCATACGCAGCTGCA 60.321 50.000 36.03 20.16 42.21 4.41
125 126 0.320683 ACACTCATACGCAGCTGCAA 60.321 50.000 36.03 24.51 42.21 4.08
126 127 0.372679 CACTCATACGCAGCTGCAAG 59.627 55.000 36.03 23.84 42.21 4.01
127 128 0.247460 ACTCATACGCAGCTGCAAGA 59.753 50.000 36.03 24.63 42.21 3.02
128 129 1.134580 ACTCATACGCAGCTGCAAGAT 60.135 47.619 36.03 22.69 42.21 2.40
138 139 3.587797 AGCTGCAAGATGATTTGGTTG 57.412 42.857 1.02 0.00 34.07 3.77
139 140 3.159472 AGCTGCAAGATGATTTGGTTGA 58.841 40.909 1.02 0.00 34.07 3.18
140 141 3.192844 AGCTGCAAGATGATTTGGTTGAG 59.807 43.478 1.02 0.00 34.07 3.02
141 142 3.508762 CTGCAAGATGATTTGGTTGAGC 58.491 45.455 0.00 0.00 34.07 4.26
142 143 2.892215 TGCAAGATGATTTGGTTGAGCA 59.108 40.909 0.00 0.00 0.00 4.26
143 144 3.248266 GCAAGATGATTTGGTTGAGCAC 58.752 45.455 0.00 0.00 0.00 4.40
144 145 3.305539 GCAAGATGATTTGGTTGAGCACA 60.306 43.478 0.00 0.00 0.00 4.57
145 146 4.619863 GCAAGATGATTTGGTTGAGCACAT 60.620 41.667 0.00 0.00 0.00 3.21
146 147 5.475719 CAAGATGATTTGGTTGAGCACATT 58.524 37.500 0.00 0.00 0.00 2.71
147 148 5.068234 AGATGATTTGGTTGAGCACATTG 57.932 39.130 0.00 0.00 0.00 2.82
148 149 3.663995 TGATTTGGTTGAGCACATTGG 57.336 42.857 0.00 0.00 0.00 3.16
149 150 2.288948 TGATTTGGTTGAGCACATTGGC 60.289 45.455 0.00 0.00 0.00 4.52
150 151 1.117994 TTTGGTTGAGCACATTGGCA 58.882 45.000 0.00 0.00 35.83 4.92
151 152 1.117994 TTGGTTGAGCACATTGGCAA 58.882 45.000 0.68 0.68 35.83 4.52
152 153 1.340088 TGGTTGAGCACATTGGCAAT 58.660 45.000 6.96 6.96 35.83 3.56
153 154 1.273048 TGGTTGAGCACATTGGCAATC 59.727 47.619 10.36 0.00 35.83 2.67
154 155 1.273048 GGTTGAGCACATTGGCAATCA 59.727 47.619 10.36 2.78 35.83 2.57
155 156 2.602878 GTTGAGCACATTGGCAATCAG 58.397 47.619 10.36 6.90 35.83 2.90
156 157 1.913778 TGAGCACATTGGCAATCAGT 58.086 45.000 10.36 3.37 35.83 3.41
157 158 3.070476 TGAGCACATTGGCAATCAGTA 57.930 42.857 10.36 0.00 35.83 2.74
158 159 3.011818 TGAGCACATTGGCAATCAGTAG 58.988 45.455 10.36 1.08 35.83 2.57
159 160 3.273434 GAGCACATTGGCAATCAGTAGA 58.727 45.455 10.36 0.00 35.83 2.59
160 161 3.881688 GAGCACATTGGCAATCAGTAGAT 59.118 43.478 10.36 0.86 35.83 1.98
161 162 3.881688 AGCACATTGGCAATCAGTAGATC 59.118 43.478 10.36 0.00 35.83 2.75
162 163 3.881688 GCACATTGGCAATCAGTAGATCT 59.118 43.478 10.36 0.00 31.90 2.75
163 164 5.059161 GCACATTGGCAATCAGTAGATCTA 58.941 41.667 10.36 0.00 31.90 1.98
164 165 5.704515 GCACATTGGCAATCAGTAGATCTAT 59.295 40.000 10.36 0.00 31.90 1.98
165 166 6.128336 GCACATTGGCAATCAGTAGATCTATC 60.128 42.308 10.36 0.20 31.90 2.08
166 167 6.932960 CACATTGGCAATCAGTAGATCTATCA 59.067 38.462 10.36 0.00 31.90 2.15
167 168 7.117956 CACATTGGCAATCAGTAGATCTATCAG 59.882 40.741 10.36 0.00 31.90 2.90
168 169 6.737720 TTGGCAATCAGTAGATCTATCAGT 57.262 37.500 5.57 0.00 31.90 3.41
169 170 6.737720 TGGCAATCAGTAGATCTATCAGTT 57.262 37.500 5.57 0.00 31.90 3.16
170 171 7.129457 TGGCAATCAGTAGATCTATCAGTTT 57.871 36.000 5.57 0.00 31.90 2.66
171 172 8.250143 TGGCAATCAGTAGATCTATCAGTTTA 57.750 34.615 5.57 0.00 31.90 2.01
172 173 8.704668 TGGCAATCAGTAGATCTATCAGTTTAA 58.295 33.333 5.57 0.00 31.90 1.52
173 174 9.717942 GGCAATCAGTAGATCTATCAGTTTAAT 57.282 33.333 5.57 0.00 31.90 1.40
187 188 9.334693 CTATCAGTTTAATCTCTTTTTGTGTGC 57.665 33.333 0.00 0.00 0.00 4.57
188 189 7.094508 TCAGTTTAATCTCTTTTTGTGTGCA 57.905 32.000 0.00 0.00 0.00 4.57
189 190 6.972328 TCAGTTTAATCTCTTTTTGTGTGCAC 59.028 34.615 10.75 10.75 0.00 4.57
190 191 6.751425 CAGTTTAATCTCTTTTTGTGTGCACA 59.249 34.615 17.42 17.42 39.98 4.57
200 201 2.106477 TGTGTGCACAAACTGAGTGA 57.894 45.000 23.59 0.00 39.30 3.41
201 202 2.642427 TGTGTGCACAAACTGAGTGAT 58.358 42.857 23.59 0.00 39.30 3.06
202 203 3.016031 TGTGTGCACAAACTGAGTGATT 58.984 40.909 23.59 0.00 39.30 2.57
203 204 3.443329 TGTGTGCACAAACTGAGTGATTT 59.557 39.130 23.59 0.00 39.30 2.17
204 205 3.792956 GTGTGCACAAACTGAGTGATTTG 59.207 43.478 23.59 0.00 39.30 2.32
206 207 4.637977 TGTGCACAAACTGAGTGATTTGTA 59.362 37.500 19.28 0.00 45.05 2.41
207 208 5.124617 TGTGCACAAACTGAGTGATTTGTAA 59.875 36.000 19.28 0.00 45.05 2.41
208 209 5.682862 GTGCACAAACTGAGTGATTTGTAAG 59.317 40.000 13.17 0.00 45.05 2.34
209 210 5.588246 TGCACAAACTGAGTGATTTGTAAGA 59.412 36.000 1.26 0.00 45.05 2.10
210 211 5.909610 GCACAAACTGAGTGATTTGTAAGAC 59.090 40.000 1.26 0.00 45.05 3.01
211 212 6.238484 GCACAAACTGAGTGATTTGTAAGACT 60.238 38.462 1.26 0.00 45.05 3.24
212 213 7.042051 GCACAAACTGAGTGATTTGTAAGACTA 60.042 37.037 1.26 0.00 45.05 2.59
213 214 8.993121 CACAAACTGAGTGATTTGTAAGACTAT 58.007 33.333 1.26 0.00 45.05 2.12
214 215 9.561069 ACAAACTGAGTGATTTGTAAGACTATT 57.439 29.630 0.00 0.00 45.01 1.73
217 218 9.778741 AACTGAGTGATTTGTAAGACTATTTGA 57.221 29.630 0.00 0.00 0.00 2.69
218 219 9.950496 ACTGAGTGATTTGTAAGACTATTTGAT 57.050 29.630 0.00 0.00 0.00 2.57
261 262 9.878667 TTGGATTGTAATACAAGACTATTTCGA 57.121 29.630 11.70 0.00 41.94 3.71
262 263 9.878667 TGGATTGTAATACAAGACTATTTCGAA 57.121 29.630 11.70 0.00 41.94 3.71
312 313 9.891828 TTACTATGCTTCATTTTGTTGTACTTG 57.108 29.630 0.00 0.00 0.00 3.16
313 314 7.370383 ACTATGCTTCATTTTGTTGTACTTGG 58.630 34.615 0.00 0.00 0.00 3.61
314 315 5.590530 TGCTTCATTTTGTTGTACTTGGT 57.409 34.783 0.00 0.00 0.00 3.67
315 316 5.587289 TGCTTCATTTTGTTGTACTTGGTC 58.413 37.500 0.00 0.00 0.00 4.02
316 317 5.359576 TGCTTCATTTTGTTGTACTTGGTCT 59.640 36.000 0.00 0.00 0.00 3.85
317 318 5.915196 GCTTCATTTTGTTGTACTTGGTCTC 59.085 40.000 0.00 0.00 0.00 3.36
318 319 6.385649 TTCATTTTGTTGTACTTGGTCTCC 57.614 37.500 0.00 0.00 0.00 3.71
319 320 4.513692 TCATTTTGTTGTACTTGGTCTCCG 59.486 41.667 0.00 0.00 0.00 4.63
320 321 2.536761 TTGTTGTACTTGGTCTCCGG 57.463 50.000 0.00 0.00 0.00 5.14
321 322 0.034337 TGTTGTACTTGGTCTCCGGC 59.966 55.000 0.00 0.00 0.00 6.13
322 323 0.034337 GTTGTACTTGGTCTCCGGCA 59.966 55.000 0.00 0.00 0.00 5.69
323 324 0.320374 TTGTACTTGGTCTCCGGCAG 59.680 55.000 0.00 0.00 0.00 4.85
324 325 0.541063 TGTACTTGGTCTCCGGCAGA 60.541 55.000 0.00 0.00 0.00 4.26
325 326 0.824759 GTACTTGGTCTCCGGCAGAT 59.175 55.000 0.00 0.00 32.08 2.90
326 327 0.824109 TACTTGGTCTCCGGCAGATG 59.176 55.000 0.00 0.00 32.08 2.90
327 328 1.153289 CTTGGTCTCCGGCAGATGG 60.153 63.158 0.00 0.00 32.08 3.51
328 329 2.599645 CTTGGTCTCCGGCAGATGGG 62.600 65.000 0.00 0.00 32.08 4.00
329 330 2.764128 GGTCTCCGGCAGATGGGA 60.764 66.667 0.00 0.00 32.08 4.37
330 331 2.143419 GGTCTCCGGCAGATGGGAT 61.143 63.158 0.00 0.00 32.08 3.85
331 332 1.070445 GTCTCCGGCAGATGGGATG 59.930 63.158 0.00 0.00 32.08 3.51
332 333 2.142761 TCTCCGGCAGATGGGATGG 61.143 63.158 0.00 0.00 0.00 3.51
333 334 3.170672 TCCGGCAGATGGGATGGG 61.171 66.667 0.00 0.00 0.00 4.00
334 335 4.275508 CCGGCAGATGGGATGGGG 62.276 72.222 0.00 0.00 0.00 4.96
335 336 4.962836 CGGCAGATGGGATGGGGC 62.963 72.222 0.00 0.00 0.00 5.80
336 337 4.610526 GGCAGATGGGATGGGGCC 62.611 72.222 0.00 0.00 0.00 5.80
337 338 4.962836 GCAGATGGGATGGGGCCG 62.963 72.222 0.00 0.00 0.00 6.13
338 339 3.170672 CAGATGGGATGGGGCCGA 61.171 66.667 0.00 0.00 0.00 5.54
339 340 2.368192 AGATGGGATGGGGCCGAA 60.368 61.111 0.00 0.00 0.00 4.30
340 341 2.113986 GATGGGATGGGGCCGAAG 59.886 66.667 0.00 0.00 0.00 3.79
341 342 2.368192 ATGGGATGGGGCCGAAGA 60.368 61.111 0.00 0.00 0.00 2.87
342 343 1.994885 GATGGGATGGGGCCGAAGAA 61.995 60.000 0.00 0.00 0.00 2.52
343 344 1.999634 ATGGGATGGGGCCGAAGAAG 62.000 60.000 0.00 0.00 0.00 2.85
344 345 2.517166 GGATGGGGCCGAAGAAGC 60.517 66.667 0.00 0.00 0.00 3.86
345 346 2.897350 GATGGGGCCGAAGAAGCG 60.897 66.667 0.00 0.00 0.00 4.68
378 379 4.944372 CTCGGCCGACGCATACCC 62.944 72.222 27.28 0.00 43.86 3.69
380 381 4.823419 CGGCCGACGCATACCCAA 62.823 66.667 24.07 0.00 36.38 4.12
381 382 2.437002 GGCCGACGCATACCCAAA 60.437 61.111 0.00 0.00 36.38 3.28
382 383 2.041686 GGCCGACGCATACCCAAAA 61.042 57.895 0.00 0.00 36.38 2.44
383 384 1.135939 GCCGACGCATACCCAAAAC 59.864 57.895 0.00 0.00 34.03 2.43
384 385 1.798087 CCGACGCATACCCAAAACC 59.202 57.895 0.00 0.00 0.00 3.27
385 386 1.422269 CGACGCATACCCAAAACCG 59.578 57.895 0.00 0.00 0.00 4.44
386 387 1.798087 GACGCATACCCAAAACCGG 59.202 57.895 0.00 0.00 0.00 5.28
387 388 0.674269 GACGCATACCCAAAACCGGA 60.674 55.000 9.46 0.00 0.00 5.14
388 389 0.956902 ACGCATACCCAAAACCGGAC 60.957 55.000 9.46 0.00 0.00 4.79
389 390 1.798087 GCATACCCAAAACCGGACG 59.202 57.895 9.46 0.00 0.00 4.79
390 391 1.650314 GCATACCCAAAACCGGACGG 61.650 60.000 9.46 9.56 42.03 4.79
391 392 0.036199 CATACCCAAAACCGGACGGA 60.036 55.000 18.80 0.00 38.96 4.69
392 393 0.036105 ATACCCAAAACCGGACGGAC 60.036 55.000 18.80 0.00 38.96 4.79
393 394 1.406065 TACCCAAAACCGGACGGACA 61.406 55.000 18.80 0.00 38.96 4.02
394 395 2.255881 CCCAAAACCGGACGGACAC 61.256 63.158 18.80 0.00 38.96 3.67
400 401 4.112341 CCGGACGGACACGGTCTC 62.112 72.222 4.40 0.00 46.48 3.36
401 402 3.359523 CGGACGGACACGGTCTCA 61.360 66.667 0.00 0.00 46.48 3.27
402 403 2.697761 CGGACGGACACGGTCTCAT 61.698 63.158 0.00 0.00 46.48 2.90
403 404 1.590147 GGACGGACACGGTCTCATT 59.410 57.895 0.00 0.00 46.48 2.57
404 405 0.458025 GGACGGACACGGTCTCATTC 60.458 60.000 0.00 0.00 46.48 2.67
405 406 0.458025 GACGGACACGGTCTCATTCC 60.458 60.000 0.00 0.00 46.48 3.01
406 407 0.898789 ACGGACACGGTCTCATTCCT 60.899 55.000 4.41 0.00 46.48 3.36
407 408 0.458543 CGGACACGGTCTCATTCCTG 60.459 60.000 4.41 0.00 36.18 3.86
408 409 0.608640 GGACACGGTCTCATTCCTGT 59.391 55.000 4.41 0.00 32.47 4.00
409 410 1.404315 GGACACGGTCTCATTCCTGTC 60.404 57.143 4.41 0.00 35.01 3.51
410 411 0.608640 ACACGGTCTCATTCCTGTCC 59.391 55.000 0.00 0.00 0.00 4.02
411 412 0.608130 CACGGTCTCATTCCTGTCCA 59.392 55.000 0.00 0.00 0.00 4.02
412 413 1.001974 CACGGTCTCATTCCTGTCCAA 59.998 52.381 0.00 0.00 0.00 3.53
413 414 1.697432 ACGGTCTCATTCCTGTCCAAA 59.303 47.619 0.00 0.00 0.00 3.28
414 415 2.076863 CGGTCTCATTCCTGTCCAAAC 58.923 52.381 0.00 0.00 0.00 2.93
415 416 2.076863 GGTCTCATTCCTGTCCAAACG 58.923 52.381 0.00 0.00 0.00 3.60
416 417 2.076863 GTCTCATTCCTGTCCAAACGG 58.923 52.381 0.00 0.00 0.00 4.44
417 418 1.974957 TCTCATTCCTGTCCAAACGGA 59.025 47.619 0.00 0.00 33.20 4.69
418 419 2.571653 TCTCATTCCTGTCCAAACGGAT 59.428 45.455 0.00 0.00 34.24 4.18
419 420 3.009033 TCTCATTCCTGTCCAAACGGATT 59.991 43.478 0.00 0.00 34.24 3.01
420 421 4.224147 TCTCATTCCTGTCCAAACGGATTA 59.776 41.667 0.00 0.00 34.24 1.75
421 422 5.104527 TCTCATTCCTGTCCAAACGGATTAT 60.105 40.000 0.00 0.00 34.24 1.28
422 423 5.505780 TCATTCCTGTCCAAACGGATTATT 58.494 37.500 0.00 0.00 34.24 1.40
423 424 5.588648 TCATTCCTGTCCAAACGGATTATTC 59.411 40.000 0.00 0.00 34.24 1.75
424 425 4.561500 TCCTGTCCAAACGGATTATTCA 57.438 40.909 0.00 0.00 34.24 2.57
425 426 4.513442 TCCTGTCCAAACGGATTATTCAG 58.487 43.478 0.00 0.00 34.24 3.02
426 427 4.224147 TCCTGTCCAAACGGATTATTCAGA 59.776 41.667 0.00 0.00 34.24 3.27
427 428 4.332819 CCTGTCCAAACGGATTATTCAGAC 59.667 45.833 0.00 0.00 34.24 3.51
428 429 4.900684 TGTCCAAACGGATTATTCAGACA 58.099 39.130 0.00 0.00 34.24 3.41
429 430 5.309638 TGTCCAAACGGATTATTCAGACAA 58.690 37.500 0.00 0.00 34.24 3.18
430 431 5.765677 TGTCCAAACGGATTATTCAGACAAA 59.234 36.000 0.00 0.00 34.24 2.83
431 432 6.263392 TGTCCAAACGGATTATTCAGACAAAA 59.737 34.615 0.00 0.00 34.24 2.44
432 433 6.581166 GTCCAAACGGATTATTCAGACAAAAC 59.419 38.462 0.00 0.00 34.24 2.43
433 434 6.263392 TCCAAACGGATTATTCAGACAAAACA 59.737 34.615 0.00 0.00 0.00 2.83
434 435 6.582295 CCAAACGGATTATTCAGACAAAACAG 59.418 38.462 0.00 0.00 0.00 3.16
435 436 7.359595 CAAACGGATTATTCAGACAAAACAGA 58.640 34.615 0.00 0.00 0.00 3.41
436 437 7.687941 AACGGATTATTCAGACAAAACAGAT 57.312 32.000 0.00 0.00 0.00 2.90
437 438 7.076842 ACGGATTATTCAGACAAAACAGATG 57.923 36.000 0.00 0.00 0.00 2.90
438 439 6.655003 ACGGATTATTCAGACAAAACAGATGT 59.345 34.615 0.00 0.00 0.00 3.06
439 440 7.174946 ACGGATTATTCAGACAAAACAGATGTT 59.825 33.333 0.00 0.00 40.50 2.71
441 442 9.132521 GGATTATTCAGACAAAACAGATGTTTG 57.867 33.333 11.47 8.49 46.47 2.93
442 443 9.683069 GATTATTCAGACAAAACAGATGTTTGT 57.317 29.630 11.47 11.17 46.47 2.83
450 451 4.400529 AAACAGATGTTTGTTTGGGGTC 57.599 40.909 10.04 0.00 46.44 4.46
451 452 3.025322 ACAGATGTTTGTTTGGGGTCA 57.975 42.857 0.00 0.00 0.00 4.02
452 453 3.575805 ACAGATGTTTGTTTGGGGTCAT 58.424 40.909 0.00 0.00 0.00 3.06
453 454 3.321682 ACAGATGTTTGTTTGGGGTCATG 59.678 43.478 0.00 0.00 0.00 3.07
454 455 2.299867 AGATGTTTGTTTGGGGTCATGC 59.700 45.455 0.00 0.00 0.00 4.06
455 456 0.387202 TGTTTGTTTGGGGTCATGCG 59.613 50.000 0.00 0.00 0.00 4.73
456 457 0.387565 GTTTGTTTGGGGTCATGCGT 59.612 50.000 0.00 0.00 0.00 5.24
457 458 1.115467 TTTGTTTGGGGTCATGCGTT 58.885 45.000 0.00 0.00 0.00 4.84
458 459 0.387202 TTGTTTGGGGTCATGCGTTG 59.613 50.000 0.00 0.00 0.00 4.10
459 460 1.288752 GTTTGGGGTCATGCGTTGG 59.711 57.895 0.00 0.00 0.00 3.77
460 461 1.151679 TTTGGGGTCATGCGTTGGA 59.848 52.632 0.00 0.00 0.00 3.53
461 462 0.893270 TTTGGGGTCATGCGTTGGAG 60.893 55.000 0.00 0.00 0.00 3.86
462 463 2.063015 TTGGGGTCATGCGTTGGAGT 62.063 55.000 0.00 0.00 0.00 3.85
463 464 1.303317 GGGGTCATGCGTTGGAGTT 60.303 57.895 0.00 0.00 0.00 3.01
464 465 0.035820 GGGGTCATGCGTTGGAGTTA 60.036 55.000 0.00 0.00 0.00 2.24
465 466 1.369625 GGGTCATGCGTTGGAGTTAG 58.630 55.000 0.00 0.00 0.00 2.34
466 467 0.727398 GGTCATGCGTTGGAGTTAGC 59.273 55.000 0.00 0.00 0.00 3.09
467 468 0.727398 GTCATGCGTTGGAGTTAGCC 59.273 55.000 0.00 0.00 0.00 3.93
468 469 0.613260 TCATGCGTTGGAGTTAGCCT 59.387 50.000 0.00 0.00 0.00 4.58
469 470 0.729116 CATGCGTTGGAGTTAGCCTG 59.271 55.000 0.00 0.00 0.00 4.85
470 471 0.613260 ATGCGTTGGAGTTAGCCTGA 59.387 50.000 0.00 0.00 0.00 3.86
471 472 0.037326 TGCGTTGGAGTTAGCCTGAG 60.037 55.000 0.00 0.00 0.00 3.35
472 473 0.741221 GCGTTGGAGTTAGCCTGAGG 60.741 60.000 0.00 0.00 0.00 3.86
473 474 0.108138 CGTTGGAGTTAGCCTGAGGG 60.108 60.000 0.00 0.00 0.00 4.30
474 475 0.253327 GTTGGAGTTAGCCTGAGGGG 59.747 60.000 0.00 0.00 38.36 4.79
475 476 0.914417 TTGGAGTTAGCCTGAGGGGG 60.914 60.000 0.00 0.00 35.12 5.40
476 477 1.003051 GGAGTTAGCCTGAGGGGGA 59.997 63.158 0.00 0.00 35.12 4.81
477 478 0.620700 GGAGTTAGCCTGAGGGGGAA 60.621 60.000 0.00 0.00 35.12 3.97
478 479 1.286248 GAGTTAGCCTGAGGGGGAAA 58.714 55.000 0.00 0.00 35.12 3.13
479 480 1.847088 GAGTTAGCCTGAGGGGGAAAT 59.153 52.381 0.00 0.00 35.12 2.17
480 481 1.566231 AGTTAGCCTGAGGGGGAAATG 59.434 52.381 0.00 0.00 35.12 2.32
481 482 0.926293 TTAGCCTGAGGGGGAAATGG 59.074 55.000 0.00 0.00 35.12 3.16
482 483 1.645402 TAGCCTGAGGGGGAAATGGC 61.645 60.000 0.00 0.00 40.54 4.40
483 484 2.280079 CCTGAGGGGGAAATGGCC 59.720 66.667 0.00 0.00 0.00 5.36
488 489 2.280079 GGGGGAAATGGCCCTCTG 59.720 66.667 0.00 0.00 45.78 3.35
489 490 3.379989 GGGGGAAATGGCCCTCTGG 62.380 68.421 0.00 0.00 45.78 3.86
491 492 2.626467 GGGAAATGGCCCTCTGGGT 61.626 63.158 0.00 0.00 46.51 4.51
500 501 2.557920 GCCCTCTGGGTCATATTCTG 57.442 55.000 4.42 0.00 46.51 3.02
501 502 1.544314 GCCCTCTGGGTCATATTCTGC 60.544 57.143 4.42 0.00 46.51 4.26
502 503 1.770658 CCCTCTGGGTCATATTCTGCA 59.229 52.381 0.00 0.00 38.25 4.41
503 504 2.374504 CCCTCTGGGTCATATTCTGCAT 59.625 50.000 0.00 0.00 38.25 3.96
504 505 3.181436 CCCTCTGGGTCATATTCTGCATT 60.181 47.826 0.00 0.00 38.25 3.56
505 506 4.070716 CCTCTGGGTCATATTCTGCATTC 58.929 47.826 0.00 0.00 0.00 2.67
506 507 3.732212 TCTGGGTCATATTCTGCATTCG 58.268 45.455 0.00 0.00 0.00 3.34
507 508 3.134623 TCTGGGTCATATTCTGCATTCGT 59.865 43.478 0.00 0.00 0.00 3.85
508 509 3.466836 TGGGTCATATTCTGCATTCGTC 58.533 45.455 0.00 0.00 0.00 4.20
509 510 3.134623 TGGGTCATATTCTGCATTCGTCT 59.865 43.478 0.00 0.00 0.00 4.18
510 511 3.496130 GGGTCATATTCTGCATTCGTCTG 59.504 47.826 0.00 0.00 0.00 3.51
511 512 3.059325 GGTCATATTCTGCATTCGTCTGC 60.059 47.826 5.23 5.23 42.62 4.26
512 513 3.059325 GTCATATTCTGCATTCGTCTGCC 60.059 47.826 8.98 0.00 41.58 4.85
513 514 1.953559 TATTCTGCATTCGTCTGCCC 58.046 50.000 8.98 0.00 41.58 5.36
514 515 1.091771 ATTCTGCATTCGTCTGCCCG 61.092 55.000 8.98 2.14 41.58 6.13
515 516 3.197790 CTGCATTCGTCTGCCCGG 61.198 66.667 0.00 0.00 41.58 5.73
516 517 3.664025 CTGCATTCGTCTGCCCGGA 62.664 63.158 0.73 0.00 41.58 5.14
517 518 2.203070 GCATTCGTCTGCCCGGAT 60.203 61.111 0.73 0.00 36.10 4.18
518 519 2.537560 GCATTCGTCTGCCCGGATG 61.538 63.158 0.73 0.00 44.85 3.51
519 520 1.889105 CATTCGTCTGCCCGGATGG 60.889 63.158 0.73 0.00 39.62 3.51
551 552 4.088762 CACGCGCGGCATCTTGTT 62.089 61.111 35.22 6.31 0.00 2.83
552 553 4.088762 ACGCGCGGCATCTTGTTG 62.089 61.111 35.22 1.22 0.00 3.33
553 554 3.787676 CGCGCGGCATCTTGTTGA 61.788 61.111 24.84 0.00 0.00 3.18
554 555 2.560861 GCGCGGCATCTTGTTGAA 59.439 55.556 8.83 0.00 0.00 2.69
555 556 1.137404 GCGCGGCATCTTGTTGAAT 59.863 52.632 8.83 0.00 0.00 2.57
556 557 0.456653 GCGCGGCATCTTGTTGAATT 60.457 50.000 8.83 0.00 0.00 2.17
557 558 1.202132 GCGCGGCATCTTGTTGAATTA 60.202 47.619 8.83 0.00 0.00 1.40
558 559 2.730715 GCGCGGCATCTTGTTGAATTAA 60.731 45.455 8.83 0.00 0.00 1.40
559 560 3.694734 CGCGGCATCTTGTTGAATTAAT 58.305 40.909 0.00 0.00 0.00 1.40
560 561 3.725740 CGCGGCATCTTGTTGAATTAATC 59.274 43.478 0.00 0.00 0.00 1.75
561 562 4.044426 GCGGCATCTTGTTGAATTAATCC 58.956 43.478 0.00 0.00 0.00 3.01
562 563 4.282068 CGGCATCTTGTTGAATTAATCCG 58.718 43.478 0.00 0.00 0.00 4.18
563 564 4.035091 CGGCATCTTGTTGAATTAATCCGA 59.965 41.667 0.00 0.00 34.50 4.55
564 565 5.514279 GGCATCTTGTTGAATTAATCCGAG 58.486 41.667 0.00 0.00 0.00 4.63
565 566 4.972440 GCATCTTGTTGAATTAATCCGAGC 59.028 41.667 0.00 0.00 0.00 5.03
566 567 5.514279 CATCTTGTTGAATTAATCCGAGCC 58.486 41.667 0.00 0.00 0.00 4.70
567 568 4.584874 TCTTGTTGAATTAATCCGAGCCA 58.415 39.130 0.00 0.00 0.00 4.75
568 569 5.192927 TCTTGTTGAATTAATCCGAGCCAT 58.807 37.500 0.00 0.00 0.00 4.40
569 570 5.652014 TCTTGTTGAATTAATCCGAGCCATT 59.348 36.000 0.00 0.00 0.00 3.16
570 571 6.826231 TCTTGTTGAATTAATCCGAGCCATTA 59.174 34.615 0.00 0.00 0.00 1.90
571 572 7.338196 TCTTGTTGAATTAATCCGAGCCATTAA 59.662 33.333 0.00 0.00 31.76 1.40
572 573 7.026631 TGTTGAATTAATCCGAGCCATTAAG 57.973 36.000 0.00 0.00 30.94 1.85
573 574 6.601613 TGTTGAATTAATCCGAGCCATTAAGT 59.398 34.615 0.00 0.00 30.94 2.24
574 575 6.618287 TGAATTAATCCGAGCCATTAAGTG 57.382 37.500 0.00 0.00 30.94 3.16
588 589 4.997395 CCATTAAGTGGGATAATCTGACGG 59.003 45.833 0.00 0.00 44.79 4.79
589 590 5.454755 CCATTAAGTGGGATAATCTGACGGT 60.455 44.000 0.00 0.00 44.79 4.83
590 591 6.239487 CCATTAAGTGGGATAATCTGACGGTA 60.239 42.308 0.00 0.00 44.79 4.02
591 592 4.939052 AAGTGGGATAATCTGACGGTAG 57.061 45.455 0.00 0.00 0.00 3.18
592 593 3.912248 AGTGGGATAATCTGACGGTAGT 58.088 45.455 0.00 0.00 0.00 2.73
593 594 5.057843 AGTGGGATAATCTGACGGTAGTA 57.942 43.478 0.00 0.00 0.00 1.82
594 595 5.452255 AGTGGGATAATCTGACGGTAGTAA 58.548 41.667 0.00 0.00 0.00 2.24
595 596 6.075984 AGTGGGATAATCTGACGGTAGTAAT 58.924 40.000 0.00 0.00 0.00 1.89
596 597 6.208994 AGTGGGATAATCTGACGGTAGTAATC 59.791 42.308 0.00 0.00 0.00 1.75
597 598 6.015688 GTGGGATAATCTGACGGTAGTAATCA 60.016 42.308 0.00 0.00 0.00 2.57
598 599 6.208797 TGGGATAATCTGACGGTAGTAATCAG 59.791 42.308 0.00 0.00 41.06 2.90
603 604 5.562506 TCTGACGGTAGTAATCAGACTTG 57.437 43.478 0.00 0.00 43.01 3.16
604 605 4.398358 TCTGACGGTAGTAATCAGACTTGG 59.602 45.833 0.00 0.00 43.01 3.61
605 606 4.084287 TGACGGTAGTAATCAGACTTGGT 58.916 43.478 0.00 0.00 0.00 3.67
606 607 5.255687 TGACGGTAGTAATCAGACTTGGTA 58.744 41.667 0.00 0.00 0.00 3.25
607 608 5.124457 TGACGGTAGTAATCAGACTTGGTAC 59.876 44.000 0.00 0.00 0.00 3.34
608 609 4.400567 ACGGTAGTAATCAGACTTGGTACC 59.599 45.833 4.43 4.43 0.00 3.34
609 610 4.202090 CGGTAGTAATCAGACTTGGTACCC 60.202 50.000 10.07 0.00 0.00 3.69
610 611 4.961099 GGTAGTAATCAGACTTGGTACCCT 59.039 45.833 10.07 0.00 0.00 4.34
611 612 5.424573 GGTAGTAATCAGACTTGGTACCCTT 59.575 44.000 10.07 0.00 0.00 3.95
612 613 6.608808 GGTAGTAATCAGACTTGGTACCCTTA 59.391 42.308 10.07 0.00 0.00 2.69
613 614 6.541934 AGTAATCAGACTTGGTACCCTTAC 57.458 41.667 10.07 4.90 0.00 2.34
614 615 4.467198 AATCAGACTTGGTACCCTTACG 57.533 45.455 10.07 0.00 0.00 3.18
615 616 3.159213 TCAGACTTGGTACCCTTACGA 57.841 47.619 10.07 0.00 0.00 3.43
616 617 3.087031 TCAGACTTGGTACCCTTACGAG 58.913 50.000 10.07 0.54 0.00 4.18
617 618 2.824341 CAGACTTGGTACCCTTACGAGT 59.176 50.000 10.07 3.81 31.49 4.18
618 619 2.824341 AGACTTGGTACCCTTACGAGTG 59.176 50.000 10.07 0.00 29.91 3.51
619 620 1.897802 ACTTGGTACCCTTACGAGTGG 59.102 52.381 10.07 0.00 29.10 4.00
620 621 1.897802 CTTGGTACCCTTACGAGTGGT 59.102 52.381 10.07 0.00 36.15 4.16
621 622 2.014010 TGGTACCCTTACGAGTGGTT 57.986 50.000 10.07 0.00 33.55 3.67
622 623 2.328319 TGGTACCCTTACGAGTGGTTT 58.672 47.619 10.07 0.00 33.55 3.27
623 624 3.505386 TGGTACCCTTACGAGTGGTTTA 58.495 45.455 10.07 0.00 33.55 2.01
624 625 3.900601 TGGTACCCTTACGAGTGGTTTAA 59.099 43.478 10.07 0.00 33.55 1.52
625 626 4.346418 TGGTACCCTTACGAGTGGTTTAAA 59.654 41.667 10.07 0.00 33.55 1.52
626 627 4.931601 GGTACCCTTACGAGTGGTTTAAAG 59.068 45.833 0.00 0.00 33.55 1.85
627 628 4.961438 ACCCTTACGAGTGGTTTAAAGA 57.039 40.909 0.00 0.00 0.00 2.52
628 629 5.294734 ACCCTTACGAGTGGTTTAAAGAA 57.705 39.130 0.00 0.00 0.00 2.52
629 630 5.683681 ACCCTTACGAGTGGTTTAAAGAAA 58.316 37.500 0.00 0.00 0.00 2.52
630 631 5.761726 ACCCTTACGAGTGGTTTAAAGAAAG 59.238 40.000 0.00 0.00 0.00 2.62
631 632 5.993441 CCCTTACGAGTGGTTTAAAGAAAGA 59.007 40.000 0.00 0.00 0.00 2.52
632 633 6.484308 CCCTTACGAGTGGTTTAAAGAAAGAA 59.516 38.462 0.00 0.00 0.00 2.52
633 634 7.012610 CCCTTACGAGTGGTTTAAAGAAAGAAA 59.987 37.037 0.00 0.00 0.00 2.52
634 635 8.400186 CCTTACGAGTGGTTTAAAGAAAGAAAA 58.600 33.333 0.00 0.00 0.00 2.29
635 636 9.946165 CTTACGAGTGGTTTAAAGAAAGAAAAT 57.054 29.630 0.00 0.00 0.00 1.82
636 637 9.724839 TTACGAGTGGTTTAAAGAAAGAAAATG 57.275 29.630 0.00 0.00 0.00 2.32
637 638 7.768240 ACGAGTGGTTTAAAGAAAGAAAATGT 58.232 30.769 0.00 0.00 0.00 2.71
638 639 8.248253 ACGAGTGGTTTAAAGAAAGAAAATGTT 58.752 29.630 0.00 0.00 0.00 2.71
639 640 9.083080 CGAGTGGTTTAAAGAAAGAAAATGTTT 57.917 29.630 0.00 0.00 0.00 2.83
641 642 8.664798 AGTGGTTTAAAGAAAGAAAATGTTTGC 58.335 29.630 0.00 0.00 0.00 3.68
642 643 7.908082 GTGGTTTAAAGAAAGAAAATGTTTGCC 59.092 33.333 0.00 0.00 0.00 4.52
643 644 7.826744 TGGTTTAAAGAAAGAAAATGTTTGCCT 59.173 29.630 0.00 0.00 0.00 4.75
644 645 8.673711 GGTTTAAAGAAAGAAAATGTTTGCCTT 58.326 29.630 0.00 0.00 0.00 4.35
669 670 5.549742 TTTTTGAGATCAATGTTTGCCCT 57.450 34.783 0.00 0.00 35.55 5.19
670 671 5.549742 TTTTGAGATCAATGTTTGCCCTT 57.450 34.783 0.00 0.00 35.55 3.95
671 672 5.549742 TTTGAGATCAATGTTTGCCCTTT 57.450 34.783 0.00 0.00 35.55 3.11
672 673 5.549742 TTGAGATCAATGTTTGCCCTTTT 57.450 34.783 0.00 0.00 0.00 2.27
673 674 6.662865 TTGAGATCAATGTTTGCCCTTTTA 57.337 33.333 0.00 0.00 0.00 1.52
674 675 6.662865 TGAGATCAATGTTTGCCCTTTTAA 57.337 33.333 0.00 0.00 0.00 1.52
675 676 7.243604 TGAGATCAATGTTTGCCCTTTTAAT 57.756 32.000 0.00 0.00 0.00 1.40
676 677 8.359875 TGAGATCAATGTTTGCCCTTTTAATA 57.640 30.769 0.00 0.00 0.00 0.98
677 678 8.469200 TGAGATCAATGTTTGCCCTTTTAATAG 58.531 33.333 0.00 0.00 0.00 1.73
678 679 8.366359 AGATCAATGTTTGCCCTTTTAATAGT 57.634 30.769 0.00 0.00 0.00 2.12
679 680 9.474313 AGATCAATGTTTGCCCTTTTAATAGTA 57.526 29.630 0.00 0.00 0.00 1.82
680 681 9.736023 GATCAATGTTTGCCCTTTTAATAGTAG 57.264 33.333 0.00 0.00 0.00 2.57
681 682 8.644374 TCAATGTTTGCCCTTTTAATAGTAGT 57.356 30.769 0.00 0.00 0.00 2.73
682 683 8.519526 TCAATGTTTGCCCTTTTAATAGTAGTG 58.480 33.333 0.00 0.00 0.00 2.74
683 684 8.303876 CAATGTTTGCCCTTTTAATAGTAGTGT 58.696 33.333 0.00 0.00 0.00 3.55
684 685 9.523168 AATGTTTGCCCTTTTAATAGTAGTGTA 57.477 29.630 0.00 0.00 0.00 2.90
685 686 8.326680 TGTTTGCCCTTTTAATAGTAGTGTAC 57.673 34.615 0.00 0.00 0.00 2.90
686 687 8.158789 TGTTTGCCCTTTTAATAGTAGTGTACT 58.841 33.333 0.00 0.00 42.68 2.73
687 688 8.663025 GTTTGCCCTTTTAATAGTAGTGTACTC 58.337 37.037 0.00 0.00 40.14 2.59
688 689 6.881570 TGCCCTTTTAATAGTAGTGTACTCC 58.118 40.000 0.00 0.00 40.14 3.85
689 690 6.441284 TGCCCTTTTAATAGTAGTGTACTCCA 59.559 38.462 0.00 0.00 40.14 3.86
690 691 6.985059 GCCCTTTTAATAGTAGTGTACTCCAG 59.015 42.308 0.00 0.00 40.14 3.86
691 692 7.498443 CCCTTTTAATAGTAGTGTACTCCAGG 58.502 42.308 0.00 0.00 40.14 4.45
692 693 7.418712 CCCTTTTAATAGTAGTGTACTCCAGGG 60.419 44.444 0.00 0.00 40.14 4.45
693 694 7.418712 CCTTTTAATAGTAGTGTACTCCAGGGG 60.419 44.444 0.00 0.00 40.14 4.79
694 695 2.449137 TAGTAGTGTACTCCAGGGGC 57.551 55.000 0.00 0.00 40.14 5.80
695 696 0.412244 AGTAGTGTACTCCAGGGGCA 59.588 55.000 0.00 0.00 32.47 5.36
696 697 0.535797 GTAGTGTACTCCAGGGGCAC 59.464 60.000 0.00 0.00 0.00 5.01
697 698 0.412244 TAGTGTACTCCAGGGGCACT 59.588 55.000 5.06 5.06 42.25 4.40
698 699 0.473886 AGTGTACTCCAGGGGCACTT 60.474 55.000 0.00 0.00 37.12 3.16
699 700 0.036294 GTGTACTCCAGGGGCACTTC 60.036 60.000 0.00 0.00 0.00 3.01
700 701 0.178903 TGTACTCCAGGGGCACTTCT 60.179 55.000 0.00 0.00 0.00 2.85
701 702 1.078159 TGTACTCCAGGGGCACTTCTA 59.922 52.381 0.00 0.00 0.00 2.10
702 703 1.481363 GTACTCCAGGGGCACTTCTAC 59.519 57.143 0.00 0.00 0.00 2.59
703 704 0.117340 ACTCCAGGGGCACTTCTACT 59.883 55.000 0.00 0.00 0.00 2.57
704 705 1.280457 CTCCAGGGGCACTTCTACTT 58.720 55.000 0.00 0.00 0.00 2.24
705 706 1.208293 CTCCAGGGGCACTTCTACTTC 59.792 57.143 0.00 0.00 0.00 3.01
706 707 1.203313 TCCAGGGGCACTTCTACTTCT 60.203 52.381 0.00 0.00 0.00 2.85
707 708 2.043939 TCCAGGGGCACTTCTACTTCTA 59.956 50.000 0.00 0.00 0.00 2.10
708 709 2.168728 CCAGGGGCACTTCTACTTCTAC 59.831 54.545 0.00 0.00 0.00 2.59
709 710 3.100671 CAGGGGCACTTCTACTTCTACT 58.899 50.000 0.00 0.00 0.00 2.57
710 711 3.100671 AGGGGCACTTCTACTTCTACTG 58.899 50.000 0.00 0.00 0.00 2.74
711 712 2.418884 GGGGCACTTCTACTTCTACTGC 60.419 54.545 0.00 0.00 0.00 4.40
712 713 2.233922 GGGCACTTCTACTTCTACTGCA 59.766 50.000 0.00 0.00 0.00 4.41
713 714 3.516615 GGCACTTCTACTTCTACTGCAG 58.483 50.000 13.48 13.48 0.00 4.41
714 715 3.516615 GCACTTCTACTTCTACTGCAGG 58.483 50.000 19.93 0.36 0.00 4.85
715 716 3.516615 CACTTCTACTTCTACTGCAGGC 58.483 50.000 19.93 0.00 0.00 4.85
716 717 2.164624 ACTTCTACTTCTACTGCAGGCG 59.835 50.000 19.93 8.47 0.00 5.52
717 718 2.124277 TCTACTTCTACTGCAGGCGA 57.876 50.000 19.93 10.90 0.00 5.54
718 719 1.743958 TCTACTTCTACTGCAGGCGAC 59.256 52.381 19.93 0.00 0.00 5.19
719 720 1.472878 CTACTTCTACTGCAGGCGACA 59.527 52.381 19.93 4.40 0.00 4.35
720 721 0.244994 ACTTCTACTGCAGGCGACAG 59.755 55.000 19.93 14.28 41.08 3.51
721 722 0.528017 CTTCTACTGCAGGCGACAGA 59.472 55.000 19.93 9.16 38.55 3.41
722 723 1.135915 CTTCTACTGCAGGCGACAGAT 59.864 52.381 19.93 0.00 38.55 2.90
723 724 2.052782 TCTACTGCAGGCGACAGATA 57.947 50.000 19.93 0.00 38.55 1.98
724 725 2.587522 TCTACTGCAGGCGACAGATAT 58.412 47.619 19.93 0.00 38.55 1.63
725 726 2.554462 TCTACTGCAGGCGACAGATATC 59.446 50.000 19.93 0.00 38.55 1.63
726 727 0.390860 ACTGCAGGCGACAGATATCC 59.609 55.000 19.93 0.00 38.55 2.59
727 728 0.390492 CTGCAGGCGACAGATATCCA 59.610 55.000 5.57 0.00 37.32 3.41
728 729 0.390492 TGCAGGCGACAGATATCCAG 59.610 55.000 0.00 0.00 0.00 3.86
729 730 0.320247 GCAGGCGACAGATATCCAGG 60.320 60.000 0.00 0.00 0.00 4.45
730 731 0.319728 CAGGCGACAGATATCCAGGG 59.680 60.000 0.00 0.00 0.00 4.45
731 732 0.833834 AGGCGACAGATATCCAGGGG 60.834 60.000 0.00 0.00 0.00 4.79
732 733 1.004440 GCGACAGATATCCAGGGGC 60.004 63.158 0.00 0.00 0.00 5.80
733 734 1.758440 GCGACAGATATCCAGGGGCA 61.758 60.000 0.00 0.00 0.00 5.36
734 735 0.034059 CGACAGATATCCAGGGGCAC 59.966 60.000 0.00 0.00 0.00 5.01
735 736 1.131638 GACAGATATCCAGGGGCACA 58.868 55.000 0.00 0.00 0.00 4.57
736 737 0.839946 ACAGATATCCAGGGGCACAC 59.160 55.000 0.00 0.00 0.00 3.82
737 738 0.109342 CAGATATCCAGGGGCACACC 59.891 60.000 0.00 0.00 39.11 4.16
738 739 0.029681 AGATATCCAGGGGCACACCT 60.030 55.000 0.00 0.00 43.08 4.00
739 740 0.398318 GATATCCAGGGGCACACCTC 59.602 60.000 0.00 0.00 39.34 3.85
740 741 1.062488 ATATCCAGGGGCACACCTCC 61.062 60.000 0.00 0.00 39.34 4.30
746 747 2.445155 GGGCACACCTCCCCATTT 59.555 61.111 0.00 0.00 41.13 2.32
747 748 1.229177 GGGCACACCTCCCCATTTT 60.229 57.895 0.00 0.00 41.13 1.82
748 749 0.835971 GGGCACACCTCCCCATTTTT 60.836 55.000 0.00 0.00 41.13 1.94
749 750 0.608130 GGCACACCTCCCCATTTTTC 59.392 55.000 0.00 0.00 0.00 2.29
750 751 0.243636 GCACACCTCCCCATTTTTCG 59.756 55.000 0.00 0.00 0.00 3.46
751 752 1.904287 CACACCTCCCCATTTTTCGA 58.096 50.000 0.00 0.00 0.00 3.71
752 753 2.446435 CACACCTCCCCATTTTTCGAT 58.554 47.619 0.00 0.00 0.00 3.59
753 754 2.423538 CACACCTCCCCATTTTTCGATC 59.576 50.000 0.00 0.00 0.00 3.69
754 755 2.024414 CACCTCCCCATTTTTCGATCC 58.976 52.381 0.00 0.00 0.00 3.36
755 756 1.308998 CCTCCCCATTTTTCGATCCG 58.691 55.000 0.00 0.00 0.00 4.18
756 757 1.408266 CCTCCCCATTTTTCGATCCGT 60.408 52.381 0.00 0.00 0.00 4.69
757 758 1.670811 CTCCCCATTTTTCGATCCGTG 59.329 52.381 0.00 0.00 0.00 4.94
758 759 0.738389 CCCCATTTTTCGATCCGTGG 59.262 55.000 0.00 0.00 0.00 4.94
759 760 1.680555 CCCCATTTTTCGATCCGTGGA 60.681 52.381 8.48 0.00 0.00 4.02
760 761 1.670811 CCCATTTTTCGATCCGTGGAG 59.329 52.381 8.48 0.00 0.00 3.86
761 762 1.064060 CCATTTTTCGATCCGTGGAGC 59.936 52.381 0.00 0.00 0.00 4.70
762 763 1.064060 CATTTTTCGATCCGTGGAGCC 59.936 52.381 0.00 0.00 0.00 4.70
763 764 1.017177 TTTTTCGATCCGTGGAGCCG 61.017 55.000 0.00 3.11 0.00 5.52
764 765 4.508128 TTCGATCCGTGGAGCCGC 62.508 66.667 0.00 0.00 0.00 6.53
772 773 4.740822 GTGGAGCCGCCCAACCAT 62.741 66.667 2.52 0.00 38.06 3.55
773 774 3.012119 TGGAGCCGCCCAACCATA 61.012 61.111 0.00 0.00 34.97 2.74
774 775 2.382770 TGGAGCCGCCCAACCATAT 61.383 57.895 0.00 0.00 34.97 1.78
775 776 1.152756 GGAGCCGCCCAACCATATT 60.153 57.895 0.00 0.00 0.00 1.28
776 777 0.755327 GGAGCCGCCCAACCATATTT 60.755 55.000 0.00 0.00 0.00 1.40
777 778 1.111277 GAGCCGCCCAACCATATTTT 58.889 50.000 0.00 0.00 0.00 1.82
778 779 2.303175 GAGCCGCCCAACCATATTTTA 58.697 47.619 0.00 0.00 0.00 1.52
779 780 2.691011 GAGCCGCCCAACCATATTTTAA 59.309 45.455 0.00 0.00 0.00 1.52
780 781 3.304829 AGCCGCCCAACCATATTTTAAT 58.695 40.909 0.00 0.00 0.00 1.40
781 782 3.709141 AGCCGCCCAACCATATTTTAATT 59.291 39.130 0.00 0.00 0.00 1.40
782 783 4.163268 AGCCGCCCAACCATATTTTAATTT 59.837 37.500 0.00 0.00 0.00 1.82
783 784 4.509970 GCCGCCCAACCATATTTTAATTTC 59.490 41.667 0.00 0.00 0.00 2.17
784 785 4.742659 CCGCCCAACCATATTTTAATTTCG 59.257 41.667 0.00 0.00 0.00 3.46
785 786 5.344884 CGCCCAACCATATTTTAATTTCGT 58.655 37.500 0.00 0.00 0.00 3.85
786 787 5.457473 CGCCCAACCATATTTTAATTTCGTC 59.543 40.000 0.00 0.00 0.00 4.20
787 788 5.751509 GCCCAACCATATTTTAATTTCGTCC 59.248 40.000 0.00 0.00 0.00 4.79
788 789 6.406512 GCCCAACCATATTTTAATTTCGTCCT 60.407 38.462 0.00 0.00 0.00 3.85
789 790 7.200455 CCCAACCATATTTTAATTTCGTCCTC 58.800 38.462 0.00 0.00 0.00 3.71
790 791 6.910433 CCAACCATATTTTAATTTCGTCCTCG 59.090 38.462 0.00 0.00 38.55 4.63
791 792 7.201661 CCAACCATATTTTAATTTCGTCCTCGA 60.202 37.037 0.00 0.00 44.66 4.04
805 806 1.858091 CCTCGAACGAATGAGGGATG 58.142 55.000 11.92 0.00 46.55 3.51
806 807 1.212616 CTCGAACGAATGAGGGATGC 58.787 55.000 0.00 0.00 0.00 3.91
807 808 0.534873 TCGAACGAATGAGGGATGCA 59.465 50.000 0.00 0.00 0.00 3.96
808 809 0.652592 CGAACGAATGAGGGATGCAC 59.347 55.000 0.00 0.00 0.00 4.57
809 810 1.017387 GAACGAATGAGGGATGCACC 58.983 55.000 0.00 0.00 38.08 5.01
824 825 6.655078 GGATGCACCCATATTTTAATCTGT 57.345 37.500 0.00 0.00 0.00 3.41
825 826 6.681777 GGATGCACCCATATTTTAATCTGTC 58.318 40.000 0.00 0.00 0.00 3.51
826 827 6.491403 GGATGCACCCATATTTTAATCTGTCT 59.509 38.462 0.00 0.00 0.00 3.41
827 828 6.698008 TGCACCCATATTTTAATCTGTCTG 57.302 37.500 0.00 0.00 0.00 3.51
828 829 6.186957 TGCACCCATATTTTAATCTGTCTGT 58.813 36.000 0.00 0.00 0.00 3.41
829 830 6.318648 TGCACCCATATTTTAATCTGTCTGTC 59.681 38.462 0.00 0.00 0.00 3.51
830 831 6.543831 GCACCCATATTTTAATCTGTCTGTCT 59.456 38.462 0.00 0.00 0.00 3.41
831 832 7.254932 GCACCCATATTTTAATCTGTCTGTCTC 60.255 40.741 0.00 0.00 0.00 3.36
832 833 7.989741 CACCCATATTTTAATCTGTCTGTCTCT 59.010 37.037 0.00 0.00 0.00 3.10
833 834 8.552296 ACCCATATTTTAATCTGTCTGTCTCTT 58.448 33.333 0.00 0.00 0.00 2.85
834 835 8.834465 CCCATATTTTAATCTGTCTGTCTCTTG 58.166 37.037 0.00 0.00 0.00 3.02
835 836 9.388506 CCATATTTTAATCTGTCTGTCTCTTGT 57.611 33.333 0.00 0.00 0.00 3.16
838 839 6.545504 TTTAATCTGTCTGTCTCTTGTTGC 57.454 37.500 0.00 0.00 0.00 4.17
839 840 2.533266 TCTGTCTGTCTCTTGTTGCC 57.467 50.000 0.00 0.00 0.00 4.52
840 841 2.042464 TCTGTCTGTCTCTTGTTGCCT 58.958 47.619 0.00 0.00 0.00 4.75
841 842 3.230976 TCTGTCTGTCTCTTGTTGCCTA 58.769 45.455 0.00 0.00 0.00 3.93
842 843 3.005897 TCTGTCTGTCTCTTGTTGCCTAC 59.994 47.826 0.00 0.00 0.00 3.18
843 844 2.965831 TGTCTGTCTCTTGTTGCCTACT 59.034 45.455 0.00 0.00 0.00 2.57
844 845 3.388024 TGTCTGTCTCTTGTTGCCTACTT 59.612 43.478 0.00 0.00 0.00 2.24
845 846 3.743396 GTCTGTCTCTTGTTGCCTACTTG 59.257 47.826 0.00 0.00 0.00 3.16
846 847 3.070018 CTGTCTCTTGTTGCCTACTTGG 58.930 50.000 0.00 0.00 39.35 3.61
847 848 2.703536 TGTCTCTTGTTGCCTACTTGGA 59.296 45.455 0.00 0.00 38.35 3.53
848 849 3.327757 TGTCTCTTGTTGCCTACTTGGAT 59.672 43.478 0.00 0.00 38.35 3.41
849 850 3.686726 GTCTCTTGTTGCCTACTTGGATG 59.313 47.826 0.00 0.00 38.35 3.51
850 851 2.421424 CTCTTGTTGCCTACTTGGATGC 59.579 50.000 0.00 0.00 38.35 3.91
851 852 2.161855 CTTGTTGCCTACTTGGATGCA 58.838 47.619 0.00 0.00 38.35 3.96
852 853 1.533625 TGTTGCCTACTTGGATGCAC 58.466 50.000 0.00 0.00 38.35 4.57
853 854 1.073763 TGTTGCCTACTTGGATGCACT 59.926 47.619 0.00 0.00 38.35 4.40
854 855 1.740025 GTTGCCTACTTGGATGCACTC 59.260 52.381 0.00 0.00 38.35 3.51
855 856 1.279496 TGCCTACTTGGATGCACTCT 58.721 50.000 0.00 0.00 38.35 3.24
905 910 2.159170 TCATTCTCGTCACACACACACA 60.159 45.455 0.00 0.00 0.00 3.72
916 921 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
917 922 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
918 923 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
919 924 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
920 925 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
921 926 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
922 927 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
923 928 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
924 929 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
925 930 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
926 931 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
927 932 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
928 933 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
929 934 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
930 935 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
931 936 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
932 937 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
933 938 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
934 939 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
935 940 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
936 941 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
937 942 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
938 943 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
939 944 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
940 945 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
941 946 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
942 947 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
943 948 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
944 949 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
945 950 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
946 951 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
948 953 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
950 955 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
952 957 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
954 959 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
958 963 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
960 965 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
962 967 0.871722 ACACACACACACACACACAC 59.128 50.000 0.00 0.00 0.00 3.82
963 968 0.871057 CACACACACACACACACACA 59.129 50.000 0.00 0.00 0.00 3.72
984 990 1.297893 GCAATAGCTTGGCTTCGCG 60.298 57.895 0.00 0.00 40.44 5.87
1064 1070 3.726517 CGTCGGCAAGCTTGGTGG 61.727 66.667 27.10 2.64 0.00 4.61
1110 1116 2.952702 GCAGTGGAGGTACAGAGAGGAT 60.953 54.545 0.00 0.00 0.00 3.24
1143 1149 5.768980 TGGAGGACAAGATGAAAGATCTT 57.231 39.130 0.88 0.88 38.78 2.40
1156 1162 1.817099 GATCTTGAGGCCGTGCTGG 60.817 63.158 0.00 0.00 42.50 4.85
1189 1195 4.176851 GGTCGCGTCGAGGAGGAC 62.177 72.222 9.75 14.06 36.23 3.85
1199 1205 0.250295 CGAGGAGGACAAGGTGCAAA 60.250 55.000 0.00 0.00 0.00 3.68
1295 1301 3.329386 CCAACGAGCTCATCAAGAAGAA 58.671 45.455 15.40 0.00 0.00 2.52
1300 1306 3.370366 CGAGCTCATCAAGAAGAACCAAG 59.630 47.826 15.40 0.00 0.00 3.61
1302 1308 3.080319 GCTCATCAAGAAGAACCAAGCT 58.920 45.455 0.00 0.00 0.00 3.74
1345 1351 8.736751 TTTGATTCTTAATTTGCTTACGAACC 57.263 30.769 0.00 0.00 32.34 3.62
1346 1352 7.441890 TGATTCTTAATTTGCTTACGAACCA 57.558 32.000 0.00 0.00 32.34 3.67
1347 1353 8.050778 TGATTCTTAATTTGCTTACGAACCAT 57.949 30.769 0.00 0.00 32.34 3.55
1349 1355 6.811253 TCTTAATTTGCTTACGAACCATGT 57.189 33.333 0.00 0.00 0.00 3.21
1350 1356 7.908827 TCTTAATTTGCTTACGAACCATGTA 57.091 32.000 0.00 0.00 0.00 2.29
1351 1357 7.970384 TCTTAATTTGCTTACGAACCATGTAG 58.030 34.615 0.00 0.00 0.00 2.74
1352 1358 5.560966 AATTTGCTTACGAACCATGTAGG 57.439 39.130 0.00 0.00 45.67 3.18
1353 1359 3.965379 TTGCTTACGAACCATGTAGGA 57.035 42.857 0.00 0.00 41.22 2.94
1354 1360 4.481368 TTGCTTACGAACCATGTAGGAT 57.519 40.909 0.00 0.00 41.22 3.24
1355 1361 4.054780 TGCTTACGAACCATGTAGGATC 57.945 45.455 0.00 0.00 41.22 3.36
1358 1364 1.874129 ACGAACCATGTAGGATCCCA 58.126 50.000 8.55 0.00 41.22 4.37
1359 1365 2.193127 ACGAACCATGTAGGATCCCAA 58.807 47.619 8.55 0.00 41.22 4.12
1361 1367 2.093181 CGAACCATGTAGGATCCCAACA 60.093 50.000 17.41 17.41 41.22 3.33
1362 1368 3.279434 GAACCATGTAGGATCCCAACAC 58.721 50.000 17.44 7.82 41.22 3.32
1363 1369 2.274542 ACCATGTAGGATCCCAACACA 58.725 47.619 17.44 12.66 41.22 3.72
1365 1371 3.117888 ACCATGTAGGATCCCAACACATC 60.118 47.826 17.44 0.00 41.22 3.06
1366 1372 3.137176 CCATGTAGGATCCCAACACATCT 59.863 47.826 17.44 2.08 41.22 2.90
1367 1373 4.347876 CCATGTAGGATCCCAACACATCTA 59.652 45.833 17.44 0.00 41.22 1.98
1368 1374 5.300752 CATGTAGGATCCCAACACATCTAC 58.699 45.833 17.44 7.25 0.00 2.59
1372 1378 6.670464 TGTAGGATCCCAACACATCTACTTTA 59.330 38.462 8.55 0.00 0.00 1.85
1373 1379 6.240549 AGGATCCCAACACATCTACTTTAG 57.759 41.667 8.55 0.00 0.00 1.85
1376 1382 6.316390 GGATCCCAACACATCTACTTTAGTTG 59.684 42.308 0.00 0.00 36.89 3.16
1384 1390 7.054855 CACATCTACTTTAGTTGTGCTTCTC 57.945 40.000 10.12 0.00 44.61 2.87
1385 1391 6.646653 CACATCTACTTTAGTTGTGCTTCTCA 59.353 38.462 10.12 0.00 44.61 3.27
1386 1392 7.171508 CACATCTACTTTAGTTGTGCTTCTCAA 59.828 37.037 10.12 0.00 44.61 3.02
1387 1393 7.715249 ACATCTACTTTAGTTGTGCTTCTCAAA 59.285 33.333 0.00 0.00 37.34 2.69
1388 1394 7.478520 TCTACTTTAGTTGTGCTTCTCAAAC 57.521 36.000 0.00 0.00 0.00 2.93
1389 1395 7.045416 TCTACTTTAGTTGTGCTTCTCAAACA 58.955 34.615 0.00 0.00 0.00 2.83
1390 1396 5.880341 ACTTTAGTTGTGCTTCTCAAACAC 58.120 37.500 0.00 0.00 34.86 3.32
1394 1400 3.067180 AGTTGTGCTTCTCAAACACCATG 59.933 43.478 0.00 0.00 33.30 3.66
1396 1402 2.618241 TGTGCTTCTCAAACACCATGTC 59.382 45.455 0.00 0.00 33.30 3.06
1397 1403 2.618241 GTGCTTCTCAAACACCATGTCA 59.382 45.455 0.00 0.00 0.00 3.58
1398 1404 2.880268 TGCTTCTCAAACACCATGTCAG 59.120 45.455 0.00 0.00 0.00 3.51
1399 1405 2.351157 GCTTCTCAAACACCATGTCAGC 60.351 50.000 0.00 0.00 0.00 4.26
1401 1407 4.318332 CTTCTCAAACACCATGTCAGCTA 58.682 43.478 0.00 0.00 0.00 3.32
1402 1408 3.664107 TCTCAAACACCATGTCAGCTAC 58.336 45.455 0.00 0.00 0.00 3.58
1403 1409 3.070878 TCTCAAACACCATGTCAGCTACA 59.929 43.478 0.00 0.00 43.86 2.74
1404 1410 3.138304 TCAAACACCATGTCAGCTACAC 58.862 45.455 0.00 0.00 42.09 2.90
1405 1411 2.877786 CAAACACCATGTCAGCTACACA 59.122 45.455 0.32 0.32 42.09 3.72
1411 1800 3.769300 ACCATGTCAGCTACACATAGTCA 59.231 43.478 9.58 0.00 42.09 3.41
1413 1802 3.868757 TGTCAGCTACACATAGTCACC 57.131 47.619 0.00 0.00 31.43 4.02
1416 1805 3.024547 TCAGCTACACATAGTCACCTCC 58.975 50.000 0.00 0.00 0.00 4.30
1418 1807 3.386078 CAGCTACACATAGTCACCTCCAT 59.614 47.826 0.00 0.00 0.00 3.41
1419 1808 3.639094 AGCTACACATAGTCACCTCCATC 59.361 47.826 0.00 0.00 0.00 3.51
1424 1813 5.431765 ACACATAGTCACCTCCATCAAATC 58.568 41.667 0.00 0.00 0.00 2.17
1425 1814 4.509230 CACATAGTCACCTCCATCAAATCG 59.491 45.833 0.00 0.00 0.00 3.34
1427 1816 1.210478 AGTCACCTCCATCAAATCGGG 59.790 52.381 0.00 0.00 0.00 5.14
1428 1817 0.546122 TCACCTCCATCAAATCGGGG 59.454 55.000 0.00 0.00 0.00 5.73
1433 1822 2.017049 CTCCATCAAATCGGGGTGTTC 58.983 52.381 0.00 0.00 0.00 3.18
1434 1823 1.102978 CCATCAAATCGGGGTGTTCC 58.897 55.000 0.00 0.00 0.00 3.62
1438 1827 2.510613 TCAAATCGGGGTGTTCCTTTC 58.489 47.619 0.00 0.00 35.33 2.62
1440 1829 3.328343 TCAAATCGGGGTGTTCCTTTCTA 59.672 43.478 0.00 0.00 35.33 2.10
1441 1830 4.076394 CAAATCGGGGTGTTCCTTTCTAA 58.924 43.478 0.00 0.00 35.33 2.10
1442 1831 4.586306 AATCGGGGTGTTCCTTTCTAAT 57.414 40.909 0.00 0.00 35.33 1.73
1449 1838 3.056821 GGTGTTCCTTTCTAATGCCCAAC 60.057 47.826 0.00 0.00 0.00 3.77
1450 1839 3.572255 GTGTTCCTTTCTAATGCCCAACA 59.428 43.478 0.00 0.00 0.00 3.33
1451 1840 3.826157 TGTTCCTTTCTAATGCCCAACAG 59.174 43.478 0.00 0.00 0.00 3.16
1454 1843 4.585879 TCCTTTCTAATGCCCAACAGTAC 58.414 43.478 0.00 0.00 0.00 2.73
1455 1844 4.288626 TCCTTTCTAATGCCCAACAGTACT 59.711 41.667 0.00 0.00 0.00 2.73
1456 1845 4.396166 CCTTTCTAATGCCCAACAGTACTG 59.604 45.833 21.44 21.44 0.00 2.74
1457 1846 4.901197 TTCTAATGCCCAACAGTACTGA 57.099 40.909 29.30 5.99 0.00 3.41
1459 1848 4.093743 TCTAATGCCCAACAGTACTGAGA 58.906 43.478 29.30 14.47 0.00 3.27
1460 1849 3.788227 AATGCCCAACAGTACTGAGAA 57.212 42.857 29.30 9.67 0.00 2.87
1462 1851 3.788227 TGCCCAACAGTACTGAGAATT 57.212 42.857 29.30 10.18 0.00 2.17
1463 1852 4.098914 TGCCCAACAGTACTGAGAATTT 57.901 40.909 29.30 9.79 0.00 1.82
1465 1854 4.278170 TGCCCAACAGTACTGAGAATTTTG 59.722 41.667 29.30 19.59 0.00 2.44
1466 1855 4.518970 GCCCAACAGTACTGAGAATTTTGA 59.481 41.667 29.30 0.00 0.00 2.69
1467 1856 5.183904 GCCCAACAGTACTGAGAATTTTGAT 59.816 40.000 29.30 0.00 0.00 2.57
1468 1857 6.374333 GCCCAACAGTACTGAGAATTTTGATA 59.626 38.462 29.30 0.00 0.00 2.15
1469 1858 7.414540 GCCCAACAGTACTGAGAATTTTGATAG 60.415 40.741 29.30 13.46 0.00 2.08
1470 1859 7.824289 CCCAACAGTACTGAGAATTTTGATAGA 59.176 37.037 29.30 0.00 0.00 1.98
1474 1863 9.593134 ACAGTACTGAGAATTTTGATAGATCAC 57.407 33.333 29.30 0.00 36.36 3.06
1475 1864 9.591792 CAGTACTGAGAATTTTGATAGATCACA 57.408 33.333 18.45 0.00 36.36 3.58
1476 1865 9.814899 AGTACTGAGAATTTTGATAGATCACAG 57.185 33.333 0.00 0.00 36.36 3.66
1478 1867 7.052873 ACTGAGAATTTTGATAGATCACAGGG 58.947 38.462 0.00 0.00 36.36 4.45
1479 1868 5.824624 TGAGAATTTTGATAGATCACAGGGC 59.175 40.000 0.00 0.00 36.36 5.19
1480 1869 4.818546 AGAATTTTGATAGATCACAGGGCG 59.181 41.667 0.00 0.00 36.36 6.13
1482 1871 0.758734 TTGATAGATCACAGGGCGGG 59.241 55.000 0.00 0.00 36.36 6.13
1483 1872 1.004440 GATAGATCACAGGGCGGGC 60.004 63.158 0.00 0.00 0.00 6.13
1484 1873 2.456287 GATAGATCACAGGGCGGGCC 62.456 65.000 13.58 13.58 0.00 5.80
1485 1874 3.993865 TAGATCACAGGGCGGGCCA 62.994 63.158 23.67 1.53 37.98 5.36
1487 1876 3.936772 GATCACAGGGCGGGCCAAA 62.937 63.158 23.67 5.05 37.98 3.28
1488 1877 4.966787 TCACAGGGCGGGCCAAAC 62.967 66.667 23.67 0.00 37.98 2.93
1492 1881 3.404438 AGGGCGGGCCAAACGATA 61.404 61.111 23.67 0.00 37.98 2.92
1494 1883 2.767445 GGGCGGGCCAAACGATAAC 61.767 63.158 16.76 0.00 37.98 1.89
1502 3017 1.395954 GCCAAACGATAACCGGAGAAC 59.604 52.381 9.46 0.00 43.93 3.01
1507 3022 4.724074 AACGATAACCGGAGAACATGTA 57.276 40.909 9.46 0.00 43.93 2.29
1511 3026 6.110707 ACGATAACCGGAGAACATGTATTTT 58.889 36.000 9.46 0.00 43.93 1.82
1512 3027 7.267128 ACGATAACCGGAGAACATGTATTTTA 58.733 34.615 9.46 0.00 43.93 1.52
1513 3028 7.929785 ACGATAACCGGAGAACATGTATTTTAT 59.070 33.333 9.46 0.00 43.93 1.40
1519 3034 7.280205 ACCGGAGAACATGTATTTTATTGTCTC 59.720 37.037 9.46 4.29 0.00 3.36
1520 3035 7.337718 CGGAGAACATGTATTTTATTGTCTCG 58.662 38.462 0.00 0.00 0.00 4.04
1522 3037 8.328864 GGAGAACATGTATTTTATTGTCTCGTC 58.671 37.037 0.00 0.00 0.00 4.20
1523 3038 7.895870 AGAACATGTATTTTATTGTCTCGTCG 58.104 34.615 0.00 0.00 0.00 5.12
1526 3044 6.809689 ACATGTATTTTATTGTCTCGTCGTGA 59.190 34.615 0.00 0.00 0.00 4.35
1528 3050 5.574055 TGTATTTTATTGTCTCGTCGTGACC 59.426 40.000 21.11 7.27 33.83 4.02
1530 3052 3.928727 TTATTGTCTCGTCGTGACCTT 57.071 42.857 21.11 12.64 33.83 3.50
1531 3053 2.814280 ATTGTCTCGTCGTGACCTTT 57.186 45.000 21.11 6.54 33.83 3.11
1534 3056 0.728466 GTCTCGTCGTGACCTTTCCG 60.728 60.000 14.93 0.00 0.00 4.30
1535 3057 1.168407 TCTCGTCGTGACCTTTCCGT 61.168 55.000 0.00 0.00 0.00 4.69
1537 3059 0.950836 TCGTCGTGACCTTTCCGTTA 59.049 50.000 0.00 0.00 0.00 3.18
1539 3061 1.916000 CGTCGTGACCTTTCCGTTATC 59.084 52.381 0.00 0.00 0.00 1.75
1540 3062 2.265683 GTCGTGACCTTTCCGTTATCC 58.734 52.381 0.00 0.00 0.00 2.59
1542 3064 1.997606 CGTGACCTTTCCGTTATCCAC 59.002 52.381 0.00 0.00 0.00 4.02
1543 3065 2.610976 CGTGACCTTTCCGTTATCCACA 60.611 50.000 0.00 0.00 0.00 4.17
1544 3066 3.000727 GTGACCTTTCCGTTATCCACAG 58.999 50.000 0.00 0.00 0.00 3.66
1546 3068 3.325425 TGACCTTTCCGTTATCCACAGAA 59.675 43.478 0.00 0.00 0.00 3.02
1548 3070 4.918588 ACCTTTCCGTTATCCACAGAAAT 58.081 39.130 0.00 0.00 32.42 2.17
1550 3072 6.478129 ACCTTTCCGTTATCCACAGAAATAA 58.522 36.000 0.00 0.00 32.42 1.40
1552 3074 7.067008 ACCTTTCCGTTATCCACAGAAATAATG 59.933 37.037 0.00 0.00 32.42 1.90
1553 3075 7.282224 CCTTTCCGTTATCCACAGAAATAATGA 59.718 37.037 0.00 0.00 32.42 2.57
1554 3076 8.568676 TTTCCGTTATCCACAGAAATAATGAA 57.431 30.769 0.00 0.00 28.44 2.57
1555 3077 7.548196 TCCGTTATCCACAGAAATAATGAAC 57.452 36.000 0.00 0.00 0.00 3.18
1557 3079 6.256975 CCGTTATCCACAGAAATAATGAACGA 59.743 38.462 0.00 0.00 38.48 3.85
1558 3080 7.201574 CCGTTATCCACAGAAATAATGAACGAA 60.202 37.037 0.00 0.00 38.48 3.85
1559 3081 7.634817 CGTTATCCACAGAAATAATGAACGAAC 59.365 37.037 0.00 0.00 38.48 3.95
1560 3082 5.873179 TCCACAGAAATAATGAACGAACC 57.127 39.130 0.00 0.00 0.00 3.62
1561 3083 4.698304 TCCACAGAAATAATGAACGAACCC 59.302 41.667 0.00 0.00 0.00 4.11
1563 3085 5.183140 CCACAGAAATAATGAACGAACCCTT 59.817 40.000 0.00 0.00 0.00 3.95
1565 3087 6.001460 ACAGAAATAATGAACGAACCCTTCA 58.999 36.000 0.00 0.00 32.24 3.02
1566 3088 6.659242 ACAGAAATAATGAACGAACCCTTCAT 59.341 34.615 0.00 0.00 39.56 2.57
1567 3089 7.176690 ACAGAAATAATGAACGAACCCTTCATT 59.823 33.333 13.43 13.43 45.84 2.57
1568 3090 8.028938 CAGAAATAATGAACGAACCCTTCATTT 58.971 33.333 13.95 0.92 42.97 2.32
1570 3092 9.203421 GAAATAATGAACGAACCCTTCATTTTT 57.797 29.630 13.95 10.59 42.97 1.94
1594 3221 9.753674 TTTTAATGGGAAATCAGAGTATGAACT 57.246 29.630 0.00 0.00 42.53 3.01
1609 3236 7.639162 AGTATGAACTCTGAAACTAAACGTG 57.361 36.000 0.00 0.00 0.00 4.49
1612 3239 5.412640 TGAACTCTGAAACTAAACGTGACA 58.587 37.500 0.00 0.00 0.00 3.58
1614 3241 4.369182 ACTCTGAAACTAAACGTGACAGG 58.631 43.478 0.00 0.00 33.43 4.00
1615 3242 3.724374 TCTGAAACTAAACGTGACAGGG 58.276 45.455 0.00 0.00 33.43 4.45
1617 3250 4.039973 TCTGAAACTAAACGTGACAGGGAT 59.960 41.667 0.00 0.00 33.43 3.85
1620 3253 6.469410 TGAAACTAAACGTGACAGGGATATT 58.531 36.000 0.00 0.00 0.00 1.28
1621 3254 6.370442 TGAAACTAAACGTGACAGGGATATTG 59.630 38.462 0.00 0.00 0.00 1.90
1623 3256 2.710096 AACGTGACAGGGATATTGGG 57.290 50.000 0.00 0.00 0.00 4.12
1624 3257 0.180406 ACGTGACAGGGATATTGGGC 59.820 55.000 0.00 0.00 0.00 5.36
1628 3261 1.699634 TGACAGGGATATTGGGCTAGC 59.300 52.381 6.04 6.04 0.00 3.42
1635 3268 2.610727 GGATATTGGGCTAGCGACTGAC 60.611 54.545 9.00 0.00 0.00 3.51
1636 3269 1.480789 TATTGGGCTAGCGACTGACA 58.519 50.000 9.00 0.00 0.00 3.58
1638 3271 0.175760 TTGGGCTAGCGACTGACATC 59.824 55.000 9.00 0.00 0.00 3.06
1652 3285 5.276868 CGACTGACATCGACTTCAACTTTTT 60.277 40.000 0.00 0.00 45.13 1.94
1722 3357 3.554934 GATGACAATGCCCCACAAGATA 58.445 45.455 0.00 0.00 0.00 1.98
1729 3364 3.806949 TGCCCCACAAGATAAAGAACT 57.193 42.857 0.00 0.00 0.00 3.01
1748 3383 7.388460 AGAACTTGAGCAAGAAAATAGATGG 57.612 36.000 16.47 0.00 40.79 3.51
1787 3674 1.649321 AGGGATCTCAGTCTTGTGCA 58.351 50.000 0.00 0.00 0.00 4.57
1812 3699 0.480252 AAGCAAGGGCAGAAGGAAGT 59.520 50.000 0.00 0.00 44.61 3.01
1819 3706 4.227864 AGGGCAGAAGGAAGTAGAAATG 57.772 45.455 0.00 0.00 0.00 2.32
1841 3842 5.101628 TGATGAAACTTTTGCAGTCAACAC 58.898 37.500 0.00 0.00 32.94 3.32
1859 3860 1.002468 CACTGGTGAAGGCACGAAAAG 60.002 52.381 0.00 0.00 46.09 2.27
1905 4032 6.521162 GGAGAAGGAGAAGATAATCAACCTC 58.479 44.000 0.00 0.00 31.36 3.85
1909 4036 8.016054 AGAAGGAGAAGATAATCAACCTCCTAT 58.984 37.037 8.91 0.00 46.90 2.57
1926 4071 5.227569 TCCTATTGACAAGTGAAGCTGAA 57.772 39.130 0.00 0.00 0.00 3.02
1938 4107 4.278170 AGTGAAGCTGAAGAGGATATCTCG 59.722 45.833 2.05 0.00 46.82 4.04
1953 4122 7.102346 AGGATATCTCGATCATTCCAATTGTC 58.898 38.462 4.43 0.00 0.00 3.18
2013 4182 3.054802 CAGTTCTGGCAGATAAGAGGGTT 60.055 47.826 19.50 0.00 0.00 4.11
2019 4188 2.169978 GGCAGATAAGAGGGTTACCGTT 59.830 50.000 0.00 0.00 43.47 4.44
2026 4195 3.851458 AGAGGGTTACCGTTTTTGACT 57.149 42.857 0.00 0.00 43.47 3.41
2029 4198 3.878699 GAGGGTTACCGTTTTTGACTTCA 59.121 43.478 0.00 0.00 43.47 3.02
2031 4200 3.628942 GGGTTACCGTTTTTGACTTCACT 59.371 43.478 0.00 0.00 0.00 3.41
2043 4212 1.302832 CTTCACTGCCTGGGTCCAC 60.303 63.158 0.00 0.00 0.00 4.02
2059 4228 1.139256 TCCACGTGTCCAAGCAGTTTA 59.861 47.619 15.65 0.00 0.00 2.01
2060 4229 1.531149 CCACGTGTCCAAGCAGTTTAG 59.469 52.381 15.65 0.00 0.00 1.85
2220 4398 5.837979 TCTCTGGGAAGAAGATGGAGATAAG 59.162 44.000 0.00 0.00 0.00 1.73
2250 4431 3.499918 AGTTGAAGCAGATGTTACAGCAC 59.500 43.478 2.79 0.00 0.00 4.40
2280 4461 4.744237 AGGGTAGCCGGATTATAGTAACA 58.256 43.478 5.05 0.00 0.00 2.41
2349 4530 5.530543 TGCAAATGAAAGGAAATTTTGTCCC 59.469 36.000 0.00 0.00 35.59 4.46
2353 4534 3.068873 TGAAAGGAAATTTTGTCCCGTGG 59.931 43.478 0.00 0.00 35.59 4.94
2378 4559 0.883833 CCACATGAAGTCAACCTGGC 59.116 55.000 0.00 0.00 0.00 4.85
2407 4588 1.625315 CACCTGATGACTGTTGGGAGA 59.375 52.381 0.00 0.00 0.00 3.71
2441 4622 1.700955 GCATTTGGGCCTGATGATCT 58.299 50.000 19.44 0.00 0.00 2.75
2450 4631 1.674962 GCCTGATGATCTCCAAAGTGC 59.325 52.381 0.00 0.00 0.00 4.40
2475 4656 3.204382 TGGAAGGTATTGGGAGGGAAATC 59.796 47.826 0.00 0.00 0.00 2.17
2536 4717 2.787473 TGGGCAAGTAATGTCTGAGG 57.213 50.000 0.00 0.00 32.85 3.86
2595 4788 4.824289 CCAAGGTTGATTTGGGAGAATTG 58.176 43.478 0.00 0.00 41.11 2.32
2669 4868 9.696917 GAAGATGGACTTTAAAATGTGTTTCAT 57.303 29.630 0.00 0.00 39.13 2.57
2719 4918 5.121105 TCATCATGAACAGCAACCATCTAG 58.879 41.667 0.00 0.00 0.00 2.43
2721 4920 4.910195 TCATGAACAGCAACCATCTAGTT 58.090 39.130 0.00 0.00 0.00 2.24
2724 4923 4.713553 TGAACAGCAACCATCTAGTTCAA 58.286 39.130 0.00 0.00 41.39 2.69
2811 5010 5.982890 TGGGAATGTCCTTTCTTCAAATC 57.017 39.130 0.00 0.00 36.57 2.17
2814 5013 4.160439 GGAATGTCCTTTCTTCAAATCCCC 59.840 45.833 0.00 0.00 32.53 4.81
2815 5014 3.169512 TGTCCTTTCTTCAAATCCCCC 57.830 47.619 0.00 0.00 0.00 5.40
2819 5018 5.016245 TGTCCTTTCTTCAAATCCCCCTATT 59.984 40.000 0.00 0.00 0.00 1.73
2821 5020 6.440647 GTCCTTTCTTCAAATCCCCCTATTTT 59.559 38.462 0.00 0.00 0.00 1.82
2838 5039 8.645110 CCCCTATTTTCTTCGGTTAGTATCTAA 58.355 37.037 0.00 0.00 0.00 2.10
2871 5072 8.924511 TTCTCTTATTTCTGTTTGGTCATCTT 57.075 30.769 0.00 0.00 0.00 2.40
2872 5073 8.553459 TCTCTTATTTCTGTTTGGTCATCTTC 57.447 34.615 0.00 0.00 0.00 2.87
2873 5074 8.156820 TCTCTTATTTCTGTTTGGTCATCTTCA 58.843 33.333 0.00 0.00 0.00 3.02
2874 5075 8.099364 TCTTATTTCTGTTTGGTCATCTTCAC 57.901 34.615 0.00 0.00 0.00 3.18
2880 5081 5.934043 TCTGTTTGGTCATCTTCACTATGTG 59.066 40.000 0.00 0.00 34.45 3.21
2881 5082 4.455533 TGTTTGGTCATCTTCACTATGTGC 59.544 41.667 0.00 0.00 32.98 4.57
2883 5084 4.492494 TGGTCATCTTCACTATGTGCAT 57.508 40.909 0.00 0.00 32.98 3.96
2885 5086 5.255687 TGGTCATCTTCACTATGTGCATTT 58.744 37.500 0.00 0.00 32.98 2.32
2887 5088 6.127925 TGGTCATCTTCACTATGTGCATTTTC 60.128 38.462 0.00 0.00 32.98 2.29
2889 5090 7.185453 GTCATCTTCACTATGTGCATTTTCTC 58.815 38.462 0.00 0.00 32.98 2.87
2890 5091 7.065563 GTCATCTTCACTATGTGCATTTTCTCT 59.934 37.037 0.00 0.00 32.98 3.10
2892 5093 7.369803 TCTTCACTATGTGCATTTTCTCTTC 57.630 36.000 0.00 0.00 32.98 2.87
2894 5095 5.559770 TCACTATGTGCATTTTCTCTTCCA 58.440 37.500 0.00 0.00 32.98 3.53
2895 5096 5.412594 TCACTATGTGCATTTTCTCTTCCAC 59.587 40.000 0.00 0.00 32.98 4.02
2903 5104 7.500892 TGTGCATTTTCTCTTCCACTTTTACTA 59.499 33.333 0.00 0.00 0.00 1.82
2904 5105 7.803659 GTGCATTTTCTCTTCCACTTTTACTAC 59.196 37.037 0.00 0.00 0.00 2.73
2905 5106 7.500892 TGCATTTTCTCTTCCACTTTTACTACA 59.499 33.333 0.00 0.00 0.00 2.74
2906 5107 8.515414 GCATTTTCTCTTCCACTTTTACTACAT 58.485 33.333 0.00 0.00 0.00 2.29
2909 5110 8.974060 TTTCTCTTCCACTTTTACTACATTGT 57.026 30.769 0.00 0.00 0.00 2.71
2910 5111 7.962964 TCTCTTCCACTTTTACTACATTGTG 57.037 36.000 0.00 0.00 0.00 3.33
2913 5114 6.770785 TCTTCCACTTTTACTACATTGTGCTT 59.229 34.615 0.00 0.00 0.00 3.91
2924 5125 7.088589 ACTACATTGTGCTTTTTATAGCCAG 57.911 36.000 0.00 0.00 40.49 4.85
2929 5130 3.761752 TGTGCTTTTTATAGCCAGGAACC 59.238 43.478 0.00 0.00 40.49 3.62
2937 5167 0.036388 TAGCCAGGAACCTGCTTTCG 60.036 55.000 14.66 3.01 42.35 3.46
2938 5168 1.302511 GCCAGGAACCTGCTTTCGA 60.303 57.895 14.66 0.00 42.35 3.71
2939 5169 0.678048 GCCAGGAACCTGCTTTCGAT 60.678 55.000 14.66 0.00 42.35 3.59
2941 5171 1.611673 CCAGGAACCTGCTTTCGATGT 60.612 52.381 14.66 0.00 42.35 3.06
2942 5172 2.354704 CCAGGAACCTGCTTTCGATGTA 60.355 50.000 14.66 0.00 42.35 2.29
2943 5173 2.673368 CAGGAACCTGCTTTCGATGTAC 59.327 50.000 7.95 0.00 37.24 2.90
2944 5174 2.567615 AGGAACCTGCTTTCGATGTACT 59.432 45.455 0.00 0.00 0.00 2.73
2952 5184 7.376615 ACCTGCTTTCGATGTACTATTATACC 58.623 38.462 0.00 0.00 0.00 2.73
2953 5185 7.014905 ACCTGCTTTCGATGTACTATTATACCA 59.985 37.037 0.00 0.00 0.00 3.25
2955 5187 8.981724 TGCTTTCGATGTACTATTATACCATC 57.018 34.615 0.00 0.00 0.00 3.51
3002 5234 6.417191 CGTAAGTAAATGTTACCATGCACT 57.583 37.500 0.00 0.00 30.91 4.40
3003 5235 6.837992 CGTAAGTAAATGTTACCATGCACTT 58.162 36.000 0.00 5.47 38.48 3.16
3006 5238 6.648879 AGTAAATGTTACCATGCACTTTGT 57.351 33.333 0.00 0.00 0.00 2.83
3008 5240 8.172352 AGTAAATGTTACCATGCACTTTGTTA 57.828 30.769 0.00 0.00 0.00 2.41
3010 5242 9.418045 GTAAATGTTACCATGCACTTTGTTATT 57.582 29.630 0.00 0.00 0.00 1.40
3014 5586 4.605640 ACCATGCACTTTGTTATTGCTT 57.394 36.364 0.00 0.00 37.16 3.91
3076 5663 9.878737 ACTATGATAGGTTATTGGTACACTAGT 57.121 33.333 4.27 0.00 39.29 2.57
3091 5921 9.478238 TGGTACACTAGTTATTTATAGTCCACA 57.522 33.333 0.00 0.00 29.77 4.17
3092 5922 9.962783 GGTACACTAGTTATTTATAGTCCACAG 57.037 37.037 0.00 0.00 29.77 3.66
3107 5937 4.135306 GTCCACAGACTACGAGGATATCA 58.865 47.826 4.83 0.00 40.10 2.15
3110 5940 4.261656 CCACAGACTACGAGGATATCAACC 60.262 50.000 4.83 0.00 0.00 3.77
3112 5942 4.580995 ACAGACTACGAGGATATCAACCAG 59.419 45.833 4.83 0.00 0.00 4.00
3113 5943 4.822350 CAGACTACGAGGATATCAACCAGA 59.178 45.833 4.83 0.00 0.00 3.86
3114 5944 5.049060 CAGACTACGAGGATATCAACCAGAG 60.049 48.000 4.83 0.00 0.00 3.35
3115 5945 5.050126 ACTACGAGGATATCAACCAGAGA 57.950 43.478 4.83 0.00 0.00 3.10
3116 5946 5.067273 ACTACGAGGATATCAACCAGAGAG 58.933 45.833 4.83 0.00 0.00 3.20
3118 5948 5.050126 ACGAGGATATCAACCAGAGAGTA 57.950 43.478 4.83 0.00 0.00 2.59
3120 5950 6.071984 ACGAGGATATCAACCAGAGAGTATT 58.928 40.000 4.83 0.00 0.00 1.89
3122 5952 7.070074 ACGAGGATATCAACCAGAGAGTATTTT 59.930 37.037 4.83 0.00 0.00 1.82
3123 5953 7.596995 CGAGGATATCAACCAGAGAGTATTTTC 59.403 40.741 4.83 0.00 0.00 2.29
3124 5954 7.740805 AGGATATCAACCAGAGAGTATTTTCC 58.259 38.462 4.83 0.00 0.00 3.13
3126 5956 7.442666 GGATATCAACCAGAGAGTATTTTCCAC 59.557 40.741 4.83 0.00 0.00 4.02
3127 5957 5.560722 TCAACCAGAGAGTATTTTCCACA 57.439 39.130 0.00 0.00 0.00 4.17
3128 5958 5.305585 TCAACCAGAGAGTATTTTCCACAC 58.694 41.667 0.00 0.00 0.00 3.82
3129 5959 4.287766 ACCAGAGAGTATTTTCCACACC 57.712 45.455 0.00 0.00 0.00 4.16
3133 5963 5.770162 CCAGAGAGTATTTTCCACACCTTTT 59.230 40.000 0.00 0.00 0.00 2.27
3158 7696 4.824479 CCTGCAAATCCAGGGTTTTATT 57.176 40.909 0.00 0.00 46.93 1.40
3163 7701 6.777782 TGCAAATCCAGGGTTTTATTTGAAT 58.222 32.000 12.66 0.00 40.24 2.57
3168 7706 9.859152 AAATCCAGGGTTTTATTTGAATGAAAA 57.141 25.926 0.00 0.00 0.00 2.29
3172 7710 8.773645 CCAGGGTTTTATTTGAATGAAAAAGTC 58.226 33.333 0.00 0.00 0.00 3.01
3184 7722 9.844790 TTGAATGAAAAAGTCATAACTGCATAG 57.155 29.630 0.00 0.00 46.80 2.23
3186 7724 9.713740 GAATGAAAAAGTCATAACTGCATAGAG 57.286 33.333 0.00 0.00 46.80 2.43
3187 7725 7.076842 TGAAAAAGTCATAACTGCATAGAGC 57.923 36.000 0.00 0.00 45.96 4.09
3199 7737 2.079158 GCATAGAGCAGCTGTTCACAA 58.921 47.619 29.15 16.07 44.79 3.33
3200 7738 2.159599 GCATAGAGCAGCTGTTCACAAC 60.160 50.000 29.15 14.02 44.79 3.32
3201 7739 3.332919 CATAGAGCAGCTGTTCACAACT 58.667 45.455 29.15 12.98 0.00 3.16
3202 7740 4.498241 CATAGAGCAGCTGTTCACAACTA 58.502 43.478 29.15 14.63 0.00 2.24
3204 7742 3.397482 AGAGCAGCTGTTCACAACTAAG 58.603 45.455 29.15 0.00 0.00 2.18
3208 7746 4.453819 AGCAGCTGTTCACAACTAAGATTC 59.546 41.667 16.64 0.00 0.00 2.52
3210 7748 4.756642 CAGCTGTTCACAACTAAGATTCCA 59.243 41.667 5.25 0.00 0.00 3.53
3212 7750 6.595326 CAGCTGTTCACAACTAAGATTCCATA 59.405 38.462 5.25 0.00 0.00 2.74
3216 7754 6.818644 TGTTCACAACTAAGATTCCATAGAGC 59.181 38.462 2.14 0.00 0.00 4.09
3222 7760 6.245890 ACTAAGATTCCATAGAGCAGCTTT 57.754 37.500 0.00 0.00 0.00 3.51
3223 7761 6.657875 ACTAAGATTCCATAGAGCAGCTTTT 58.342 36.000 0.00 0.00 0.00 2.27
3224 7762 5.831702 AAGATTCCATAGAGCAGCTTTTG 57.168 39.130 0.00 0.00 0.00 2.44
3226 7764 4.639310 AGATTCCATAGAGCAGCTTTTGTG 59.361 41.667 0.00 0.00 0.00 3.33
3227 7765 2.715046 TCCATAGAGCAGCTTTTGTGG 58.285 47.619 14.12 14.12 0.00 4.17
3231 7769 2.638480 AGAGCAGCTTTTGTGGTACA 57.362 45.000 0.00 0.00 0.00 2.90
3235 7773 2.880890 AGCAGCTTTTGTGGTACAAGAG 59.119 45.455 7.61 7.61 44.16 2.85
3236 7774 2.030805 GCAGCTTTTGTGGTACAAGAGG 60.031 50.000 12.33 1.16 44.16 3.69
3237 7775 2.030805 CAGCTTTTGTGGTACAAGAGGC 60.031 50.000 12.33 9.57 44.16 4.70
3238 7776 2.158608 AGCTTTTGTGGTACAAGAGGCT 60.159 45.455 12.33 11.15 44.16 4.58
3239 7777 2.030805 GCTTTTGTGGTACAAGAGGCTG 60.031 50.000 12.33 0.00 44.16 4.85
3240 7778 3.476552 CTTTTGTGGTACAAGAGGCTGA 58.523 45.455 0.00 0.00 44.16 4.26
3241 7779 3.569194 TTTGTGGTACAAGAGGCTGAA 57.431 42.857 0.00 0.00 44.16 3.02
3242 7780 2.839486 TGTGGTACAAGAGGCTGAAG 57.161 50.000 0.00 0.00 44.16 3.02
3243 7781 2.325484 TGTGGTACAAGAGGCTGAAGA 58.675 47.619 0.00 0.00 44.16 2.87
3244 7782 2.300152 TGTGGTACAAGAGGCTGAAGAG 59.700 50.000 0.00 0.00 44.16 2.85
3246 7784 2.300152 TGGTACAAGAGGCTGAAGAGTG 59.700 50.000 0.00 0.00 31.92 3.51
3247 7785 2.342179 GTACAAGAGGCTGAAGAGTGC 58.658 52.381 0.00 0.00 0.00 4.40
3256 7794 0.247736 CTGAAGAGTGCCCTAACGCT 59.752 55.000 0.00 0.00 0.00 5.07
3257 7795 1.476891 CTGAAGAGTGCCCTAACGCTA 59.523 52.381 0.00 0.00 29.35 4.26
3258 7796 1.203994 TGAAGAGTGCCCTAACGCTAC 59.796 52.381 0.00 0.00 29.35 3.58
3259 7797 0.172803 AAGAGTGCCCTAACGCTACG 59.827 55.000 0.00 0.00 29.35 3.51
3260 7798 1.226888 GAGTGCCCTAACGCTACGG 60.227 63.158 0.00 0.00 0.00 4.02
3261 7799 2.889018 GTGCCCTAACGCTACGGC 60.889 66.667 0.00 0.00 41.99 5.68
3263 7801 2.125431 GCCCTAACGCTACGGCAA 60.125 61.111 1.54 0.00 41.25 4.52
3264 7802 2.171725 GCCCTAACGCTACGGCAAG 61.172 63.158 1.54 0.00 41.25 4.01
3265 7803 2.171725 CCCTAACGCTACGGCAAGC 61.172 63.158 0.00 0.00 38.60 4.01
3271 7809 2.107141 GCTACGGCAAGCGAGGAT 59.893 61.111 0.00 0.00 38.54 3.24
3272 7810 2.240500 GCTACGGCAAGCGAGGATG 61.241 63.158 0.00 0.00 38.54 3.51
3273 7811 2.202878 TACGGCAAGCGAGGATGC 60.203 61.111 0.00 0.00 41.82 3.91
3274 7812 2.906182 CTACGGCAAGCGAGGATGCA 62.906 60.000 0.00 0.00 44.32 3.96
3275 7813 2.906182 TACGGCAAGCGAGGATGCAG 62.906 60.000 0.00 0.00 44.32 4.41
3276 7814 3.207669 GGCAAGCGAGGATGCAGG 61.208 66.667 0.00 0.00 44.32 4.85
3277 7815 2.437359 GCAAGCGAGGATGCAGGT 60.437 61.111 0.00 0.00 42.12 4.00
3278 7816 2.758089 GCAAGCGAGGATGCAGGTG 61.758 63.158 0.00 0.00 42.12 4.00
3279 7817 2.437359 AAGCGAGGATGCAGGTGC 60.437 61.111 0.00 0.00 42.50 5.01
3280 7818 2.964310 AAGCGAGGATGCAGGTGCT 61.964 57.895 3.18 0.00 42.66 4.40
3281 7819 2.866085 AAGCGAGGATGCAGGTGCTC 62.866 60.000 3.18 0.00 42.66 4.26
3282 7820 2.202987 CGAGGATGCAGGTGCTCC 60.203 66.667 3.18 7.76 42.66 4.70
3283 7821 2.729479 CGAGGATGCAGGTGCTCCT 61.729 63.158 17.64 17.64 45.05 3.69
3284 7822 1.395045 CGAGGATGCAGGTGCTCCTA 61.395 60.000 17.63 0.00 43.61 2.94
3285 7823 0.833287 GAGGATGCAGGTGCTCCTAA 59.167 55.000 17.63 0.00 43.61 2.69
3286 7824 1.419387 GAGGATGCAGGTGCTCCTAAT 59.581 52.381 17.63 4.48 43.61 1.73
3287 7825 2.634940 GAGGATGCAGGTGCTCCTAATA 59.365 50.000 17.63 0.00 43.61 0.98
3288 7826 3.048600 AGGATGCAGGTGCTCCTAATAA 58.951 45.455 16.66 0.00 42.61 1.40
3289 7827 3.142174 GGATGCAGGTGCTCCTAATAAC 58.858 50.000 7.08 0.00 43.07 1.89
3290 7828 2.710096 TGCAGGTGCTCCTAATAACC 57.290 50.000 7.08 0.00 43.07 2.85
3291 7829 1.211949 TGCAGGTGCTCCTAATAACCC 59.788 52.381 7.08 0.00 43.07 4.11
3292 7830 1.211949 GCAGGTGCTCCTAATAACCCA 59.788 52.381 7.08 0.00 43.07 4.51
3293 7831 2.746472 GCAGGTGCTCCTAATAACCCAG 60.746 54.545 7.08 0.00 43.07 4.45
3294 7832 2.505819 CAGGTGCTCCTAATAACCCAGT 59.494 50.000 7.08 0.00 43.07 4.00
3295 7833 3.709653 CAGGTGCTCCTAATAACCCAGTA 59.290 47.826 7.08 0.00 43.07 2.74
3296 7834 3.967987 AGGTGCTCCTAATAACCCAGTAG 59.032 47.826 5.27 0.00 43.12 2.57
3297 7835 3.710165 GGTGCTCCTAATAACCCAGTAGT 59.290 47.826 0.00 0.00 0.00 2.73
3298 7836 4.897670 GGTGCTCCTAATAACCCAGTAGTA 59.102 45.833 0.00 0.00 0.00 1.82
3299 7837 5.364735 GGTGCTCCTAATAACCCAGTAGTAA 59.635 44.000 0.00 0.00 0.00 2.24
3300 7838 6.279123 GTGCTCCTAATAACCCAGTAGTAAC 58.721 44.000 0.00 0.00 0.00 2.50
3301 7839 5.959594 TGCTCCTAATAACCCAGTAGTAACA 59.040 40.000 0.00 0.00 0.00 2.41
3302 7840 6.441284 TGCTCCTAATAACCCAGTAGTAACAA 59.559 38.462 0.00 0.00 0.00 2.83
3303 7841 6.985059 GCTCCTAATAACCCAGTAGTAACAAG 59.015 42.308 0.00 0.00 0.00 3.16
3304 7842 7.364497 GCTCCTAATAACCCAGTAGTAACAAGT 60.364 40.741 0.00 0.00 0.00 3.16
3305 7843 9.193806 CTCCTAATAACCCAGTAGTAACAAGTA 57.806 37.037 0.00 0.00 0.00 2.24
3306 7844 9.193806 TCCTAATAACCCAGTAGTAACAAGTAG 57.806 37.037 0.00 0.00 0.00 2.57
3307 7845 9.193806 CCTAATAACCCAGTAGTAACAAGTAGA 57.806 37.037 0.00 0.00 0.00 2.59
3310 7848 5.997384 ACCCAGTAGTAACAAGTAGAAGG 57.003 43.478 0.00 0.00 0.00 3.46
3311 7849 5.648247 ACCCAGTAGTAACAAGTAGAAGGA 58.352 41.667 0.00 0.00 0.00 3.36
3312 7850 5.479724 ACCCAGTAGTAACAAGTAGAAGGAC 59.520 44.000 0.00 0.00 0.00 3.85
3313 7851 5.392811 CCCAGTAGTAACAAGTAGAAGGACG 60.393 48.000 0.00 0.00 0.00 4.79
3314 7852 5.413833 CCAGTAGTAACAAGTAGAAGGACGA 59.586 44.000 0.00 0.00 0.00 4.20
3315 7853 6.313252 CAGTAGTAACAAGTAGAAGGACGAC 58.687 44.000 0.00 0.00 0.00 4.34
3316 7854 6.149142 CAGTAGTAACAAGTAGAAGGACGACT 59.851 42.308 0.00 0.00 36.07 4.18
3317 7855 7.332926 CAGTAGTAACAAGTAGAAGGACGACTA 59.667 40.741 0.00 0.00 33.56 2.59
3318 7856 8.046107 AGTAGTAACAAGTAGAAGGACGACTAT 58.954 37.037 0.00 0.00 33.56 2.12
3319 7857 7.086230 AGTAACAAGTAGAAGGACGACTATG 57.914 40.000 0.00 0.00 33.56 2.23
3320 7858 6.883217 AGTAACAAGTAGAAGGACGACTATGA 59.117 38.462 0.00 0.00 33.56 2.15
3321 7859 6.585695 AACAAGTAGAAGGACGACTATGAA 57.414 37.500 0.00 0.00 33.56 2.57
3322 7860 6.585695 ACAAGTAGAAGGACGACTATGAAA 57.414 37.500 0.00 0.00 33.56 2.69
3323 7861 7.171630 ACAAGTAGAAGGACGACTATGAAAT 57.828 36.000 0.00 0.00 33.56 2.17
3324 7862 7.259161 ACAAGTAGAAGGACGACTATGAAATC 58.741 38.462 0.00 0.00 33.56 2.17
3325 7863 7.122948 ACAAGTAGAAGGACGACTATGAAATCT 59.877 37.037 0.00 0.00 33.56 2.40
3326 7864 7.648039 AGTAGAAGGACGACTATGAAATCTT 57.352 36.000 0.00 0.00 32.96 2.40
3327 7865 8.068892 AGTAGAAGGACGACTATGAAATCTTT 57.931 34.615 0.00 0.00 32.96 2.52
3328 7866 9.186837 AGTAGAAGGACGACTATGAAATCTTTA 57.813 33.333 0.00 0.00 32.96 1.85
3329 7867 9.798994 GTAGAAGGACGACTATGAAATCTTTAA 57.201 33.333 0.00 0.00 0.00 1.52
3330 7868 8.934507 AGAAGGACGACTATGAAATCTTTAAG 57.065 34.615 0.00 0.00 0.00 1.85
3331 7869 8.532819 AGAAGGACGACTATGAAATCTTTAAGT 58.467 33.333 0.00 0.00 0.00 2.24
3332 7870 9.152595 GAAGGACGACTATGAAATCTTTAAGTT 57.847 33.333 0.00 0.00 0.00 2.66
3333 7871 8.480643 AGGACGACTATGAAATCTTTAAGTTG 57.519 34.615 0.00 0.00 0.00 3.16
3334 7872 8.311836 AGGACGACTATGAAATCTTTAAGTTGA 58.688 33.333 0.00 0.00 0.00 3.18
3335 7873 9.099454 GGACGACTATGAAATCTTTAAGTTGAT 57.901 33.333 0.00 0.00 0.00 2.57
3362 7900 6.877611 TGGGAACTTTATTGTCTTCTGTTC 57.122 37.500 0.00 0.00 33.70 3.18
3364 7902 7.004086 TGGGAACTTTATTGTCTTCTGTTCAT 58.996 34.615 0.00 0.00 35.45 2.57
3394 7935 9.635404 ATTTTAATATTTCGTATTCCCAGTGGA 57.365 29.630 11.95 0.00 39.54 4.02
3405 7946 7.394923 TCGTATTCCCAGTGGATTTTACATTTT 59.605 33.333 11.95 0.00 41.40 1.82
3410 7951 9.717942 TTCCCAGTGGATTTTACATTTTTAATG 57.282 29.630 11.95 0.00 41.40 1.90
3416 7957 9.592720 GTGGATTTTACATTTTTAATGTGCAAC 57.407 29.630 13.72 3.81 33.76 4.17
3467 8008 5.701290 ACAGGTTAGTTCAAATCTAGTGCAC 59.299 40.000 9.40 9.40 0.00 4.57
3468 8009 5.700832 CAGGTTAGTTCAAATCTAGTGCACA 59.299 40.000 21.04 4.13 0.00 4.57
3469 8010 5.701290 AGGTTAGTTCAAATCTAGTGCACAC 59.299 40.000 21.04 4.76 0.00 3.82
3475 8016 4.460263 TCAAATCTAGTGCACACCAAAGT 58.540 39.130 21.04 0.00 0.00 2.66
3485 8026 0.396811 ACACCAAAGTTCCTCCGGAG 59.603 55.000 25.36 25.36 31.21 4.63
3536 8077 2.658285 GCATCAATAATTGCTGCCGAG 58.342 47.619 0.00 0.00 44.59 4.63
3544 8085 3.782889 AATTGCTGCCGAGGAATTAAC 57.217 42.857 2.25 0.00 45.51 2.01
3548 8089 2.290008 TGCTGCCGAGGAATTAACTGAA 60.290 45.455 0.00 0.00 0.00 3.02
3549 8090 2.945668 GCTGCCGAGGAATTAACTGAAT 59.054 45.455 0.00 0.00 0.00 2.57
3561 8102 6.377327 AATTAACTGAATTGGATGCTACCG 57.623 37.500 0.00 0.00 36.35 4.02
3565 8106 4.331968 ACTGAATTGGATGCTACCGAAAA 58.668 39.130 0.00 0.00 0.00 2.29
3566 8107 4.396166 ACTGAATTGGATGCTACCGAAAAG 59.604 41.667 0.00 0.00 0.00 2.27
3590 8131 3.589988 CAGTTGGAACAGAGCTCGTTAT 58.410 45.455 19.19 4.36 42.39 1.89
3616 8157 3.743911 CGACATGCACAGTTAACCAACTA 59.256 43.478 0.88 0.00 43.30 2.24
3619 8160 5.070001 ACATGCACAGTTAACCAACTACAT 58.930 37.500 0.88 0.00 43.30 2.29
3624 8165 6.937465 TGCACAGTTAACCAACTACATGAATA 59.063 34.615 0.00 0.00 43.30 1.75
3651 8192 7.416964 TCTGAGGTTTTCAAAAATCTTCCAA 57.583 32.000 2.70 0.00 39.34 3.53
3657 8198 6.538381 GGTTTTCAAAAATCTTCCAAGCAAGA 59.462 34.615 0.00 0.00 36.82 3.02
3688 8229 6.515512 CCTCCATTTTAGGGATTTAGGAGA 57.484 41.667 0.00 0.00 43.07 3.71
3691 8232 5.431731 TCCATTTTAGGGATTTAGGAGAGCA 59.568 40.000 0.00 0.00 0.00 4.26
3692 8233 6.069088 TCCATTTTAGGGATTTAGGAGAGCAA 60.069 38.462 0.00 0.00 0.00 3.91
3701 8242 4.724262 GGAGAGCAACAACTCCCC 57.276 61.111 0.00 0.00 44.70 4.81
3702 8243 1.376037 GGAGAGCAACAACTCCCCG 60.376 63.158 0.00 0.00 44.70 5.73
3703 8244 1.376037 GAGAGCAACAACTCCCCGG 60.376 63.158 0.00 0.00 37.39 5.73
3753 8294 1.975680 GTGTCTTGGACCTAAGTGGGA 59.024 52.381 0.00 0.00 41.11 4.37
3754 8295 2.028020 GTGTCTTGGACCTAAGTGGGAG 60.028 54.545 0.00 0.00 41.11 4.30
3758 8299 1.263356 TGGACCTAAGTGGGAGTTCG 58.737 55.000 0.00 0.00 41.11 3.95
3760 8301 1.553706 GACCTAAGTGGGAGTTCGGA 58.446 55.000 0.00 0.00 41.11 4.55
3767 8308 1.838077 AGTGGGAGTTCGGATAAAGGG 59.162 52.381 0.00 0.00 0.00 3.95
3771 8312 2.014857 GGAGTTCGGATAAAGGGCAAC 58.985 52.381 0.00 0.00 0.00 4.17
3772 8313 2.355818 GGAGTTCGGATAAAGGGCAACT 60.356 50.000 0.00 0.00 0.00 3.16
3782 8323 2.653115 GGGCAACTTGCTCCAAGC 59.347 61.111 13.43 0.00 44.43 4.01
3806 8347 6.493116 CAACATTGTTCTGCCATCTTCTATC 58.507 40.000 0.00 0.00 0.00 2.08
3813 8354 6.317140 TGTTCTGCCATCTTCTATCAATCAAC 59.683 38.462 0.00 0.00 0.00 3.18
3815 8356 6.656902 TCTGCCATCTTCTATCAATCAACTT 58.343 36.000 0.00 0.00 0.00 2.66
3837 8378 8.826293 ACTTAAGCTACTTAGGTATCTTGACT 57.174 34.615 10.42 0.00 35.12 3.41
3842 8383 5.221283 GCTACTTAGGTATCTTGACTCCACC 60.221 48.000 0.00 0.00 0.00 4.61
3854 8395 1.978617 CTCCACCGGCTTGCCAATT 60.979 57.895 12.45 0.00 0.00 2.32
3858 8399 0.600557 CACCGGCTTGCCAATTACAA 59.399 50.000 12.45 0.00 0.00 2.41
3871 8412 4.982295 GCCAATTACAACACTTCCAAAGTC 59.018 41.667 0.00 0.00 40.46 3.01
3885 8426 8.499162 CACTTCCAAAGTCTTTTCATACACTAG 58.501 37.037 0.00 0.00 40.46 2.57
3916 8457 7.928307 TGGAAACTCTTATTCTCTCCAAATG 57.072 36.000 0.00 0.00 0.00 2.32
3919 8460 7.201688 GGAAACTCTTATTCTCTCCAAATGCTC 60.202 40.741 0.00 0.00 0.00 4.26
3943 8484 4.798574 CTTGAAACCTTGCCTGACAATAC 58.201 43.478 0.00 0.00 37.72 1.89
3950 8491 3.569701 CCTTGCCTGACAATACTTGTTGT 59.430 43.478 0.00 0.00 45.52 3.32
3963 8504 7.012989 ACAATACTTGTTGTCTGGGTAAACTTC 59.987 37.037 0.00 0.00 42.22 3.01
3964 8505 5.112129 ACTTGTTGTCTGGGTAAACTTCT 57.888 39.130 0.00 0.00 0.00 2.85
3971 8512 7.996644 TGTTGTCTGGGTAAACTTCTCTATTTT 59.003 33.333 0.00 0.00 0.00 1.82
3987 8528 9.967346 TTCTCTATTTTGACCTATCTCATAACG 57.033 33.333 0.00 0.00 0.00 3.18
3995 8536 4.481072 ACCTATCTCATAACGGTAGCCTT 58.519 43.478 0.00 0.00 0.00 4.35
3997 8538 6.073314 ACCTATCTCATAACGGTAGCCTTAA 58.927 40.000 0.00 0.00 0.00 1.85
4029 8570 5.136828 CAGAATCACTAGGGAAGCTCTCTA 58.863 45.833 0.00 0.00 0.00 2.43
4045 8586 5.418840 AGCTCTCTAAACTCTCTTTCCTCAG 59.581 44.000 0.00 0.00 0.00 3.35
4062 8603 3.131933 CCTCAGTCTATCTGGGTGTTCTG 59.868 52.174 0.00 0.00 42.75 3.02
4092 8633 4.260170 AGAGTTGCCTGAATCAATCTGTC 58.740 43.478 0.00 0.00 0.00 3.51
4093 8634 4.019501 AGAGTTGCCTGAATCAATCTGTCT 60.020 41.667 0.00 0.00 0.00 3.41
4107 8648 6.351711 TCAATCTGTCTGCTTACATGCTTAT 58.648 36.000 0.00 0.00 0.00 1.73
4112 8653 7.674120 TCTGTCTGCTTACATGCTTATATCAT 58.326 34.615 0.00 0.00 0.00 2.45
4143 8684 4.818534 TCAGATTGTTGTGCTCTTCAAC 57.181 40.909 0.00 0.00 43.48 3.18
4160 8701 3.614092 TCAACAGCTCCCTGATGAATTC 58.386 45.455 0.00 0.00 44.66 2.17
4165 8706 2.018644 GCTCCCTGATGAATTCGGCAA 61.019 52.381 0.04 0.00 0.00 4.52
4172 8713 1.405463 GATGAATTCGGCAACCTTCCC 59.595 52.381 0.04 0.00 0.00 3.97
4175 8716 1.202348 GAATTCGGCAACCTTCCCAAG 59.798 52.381 0.00 0.00 0.00 3.61
4180 8721 0.540597 GGCAACCTTCCCAAGCTCTT 60.541 55.000 0.00 0.00 0.00 2.85
4181 8722 0.600057 GCAACCTTCCCAAGCTCTTG 59.400 55.000 2.74 2.74 40.13 3.02
4189 8730 4.457257 CCTTCCCAAGCTCTTGTTCTTAAG 59.543 45.833 8.60 0.00 38.85 1.85
4191 8732 3.149196 CCCAAGCTCTTGTTCTTAAGCA 58.851 45.455 8.60 0.00 38.85 3.91
4205 8746 4.072131 TCTTAAGCATGTCAGGTTGTTCC 58.928 43.478 0.00 0.00 0.00 3.62
4220 8761 2.023673 TGTTCCAAGCTCACCAAACTG 58.976 47.619 0.00 0.00 0.00 3.16
4274 8815 5.449177 GCATCTGAACCTATTAAGTTGCCAC 60.449 44.000 0.00 0.00 36.53 5.01
4275 8816 5.235850 TCTGAACCTATTAAGTTGCCACA 57.764 39.130 0.00 0.00 0.00 4.17
4277 8818 6.065374 TCTGAACCTATTAAGTTGCCACAAA 58.935 36.000 0.00 0.00 0.00 2.83
4334 8875 6.180472 TCAGAAACTTGAGTTCTTGAACCTT 58.820 36.000 9.58 0.00 37.25 3.50
4361 8902 4.501400 GGTTGCTACAAGGTTTCAATGCTT 60.501 41.667 0.00 0.00 0.00 3.91
4382 8923 2.109128 TCCAGGGTCATTTTGCCAACTA 59.891 45.455 0.00 0.00 0.00 2.24
4383 8924 2.493278 CCAGGGTCATTTTGCCAACTAG 59.507 50.000 0.00 0.00 0.00 2.57
4393 8934 7.487189 GTCATTTTGCCAACTAGATCATTTGAG 59.513 37.037 0.00 0.00 0.00 3.02
4400 8941 6.426328 GCCAACTAGATCATTTGAGATACCTG 59.574 42.308 0.00 0.00 0.00 4.00
4412 8953 5.860941 TGAGATACCTGGATCTTTCAGAC 57.139 43.478 0.00 0.00 36.27 3.51
4482 9023 7.064609 TCGAGCTTGAATATTTGAACCTAACAG 59.935 37.037 0.00 0.00 0.00 3.16
4500 9041 1.003580 CAGGCTGTCCTAAGCTCCAAA 59.996 52.381 6.28 0.00 41.93 3.28
4502 9043 2.019984 GGCTGTCCTAAGCTCCAAATG 58.980 52.381 0.00 0.00 43.06 2.32
4515 9056 3.087031 CTCCAAATGTTGCCTGAGTCAT 58.913 45.455 0.00 0.00 0.00 3.06
4525 9066 3.011818 TGCCTGAGTCATTATGCAAGTG 58.988 45.455 0.00 0.00 0.00 3.16
4526 9067 3.012518 GCCTGAGTCATTATGCAAGTGT 58.987 45.455 0.00 0.00 0.00 3.55
4569 9110 1.745653 TGTCATACTGTCTGAGGCTCG 59.254 52.381 10.42 5.04 0.00 5.03
4574 9115 0.827925 ACTGTCTGAGGCTCGGTGAA 60.828 55.000 22.18 8.84 0.00 3.18
4617 9158 5.316987 ACCTTAAGCTTCAAATACTGCACT 58.683 37.500 0.00 0.00 0.00 4.40
4630 9171 1.250328 CTGCACTTGAATGGCCTTCA 58.750 50.000 3.32 8.94 42.15 3.02
4631 9172 1.822990 CTGCACTTGAATGGCCTTCAT 59.177 47.619 15.50 2.91 43.30 2.57
4633 9174 1.738030 GCACTTGAATGGCCTTCATGC 60.738 52.381 18.95 18.95 43.30 4.06
4638 9179 3.581265 TGAATGGCCTTCATGCTATGA 57.419 42.857 3.32 0.00 38.97 2.15
4698 9239 5.144100 TCACCCAGTTTGTGGTTGATTATT 58.856 37.500 0.00 0.00 42.63 1.40
4700 9241 4.217550 ACCCAGTTTGTGGTTGATTATTCG 59.782 41.667 0.00 0.00 46.37 3.34
4704 9245 6.307155 CAGTTTGTGGTTGATTATTCGACTC 58.693 40.000 5.25 1.39 36.61 3.36
4712 9253 7.010275 GTGGTTGATTATTCGACTCCTAGTTTC 59.990 40.741 5.25 0.00 36.61 2.78
4713 9254 7.093465 TGGTTGATTATTCGACTCCTAGTTTCT 60.093 37.037 5.25 0.00 36.61 2.52
4738 9279 8.744568 TTTGAAAAGGTTGAAGCCATTAAAAT 57.255 26.923 0.00 0.00 0.00 1.82
4759 9300 1.398390 GCGTCTAAATCTTGTGGGCAG 59.602 52.381 0.00 0.00 0.00 4.85
4781 9322 6.765989 GCAGGGTAAGACATTATGTACATGAA 59.234 38.462 18.81 9.03 0.00 2.57
4784 9325 9.920946 AGGGTAAGACATTATGTACATGAAATT 57.079 29.630 18.81 8.05 0.00 1.82
4843 9387 5.059833 AGGATTGACTTGTTCAGAACTGAC 58.940 41.667 14.51 8.21 39.66 3.51
4907 9451 3.990469 ACAGAGTCAAACTGCGTGATAAG 59.010 43.478 0.00 0.00 38.74 1.73
4908 9452 4.237724 CAGAGTCAAACTGCGTGATAAGA 58.762 43.478 0.00 0.00 0.00 2.10
5006 9574 4.363138 GGACTCTTGAAAACTTTTGGCTG 58.637 43.478 0.00 0.00 0.00 4.85
5015 9583 1.687563 ACTTTTGGCTGTGTGGGTAC 58.312 50.000 0.00 0.00 0.00 3.34
5079 9647 1.002544 ACCTCCCTTTTCTCAGCGAAG 59.997 52.381 0.00 0.00 32.21 3.79
5092 9660 2.558359 TCAGCGAAGTGACTCTTGATGA 59.442 45.455 0.00 0.00 36.40 2.92
5206 9774 4.561734 CGGTAAGGAATTCTATGGAGAGGC 60.562 50.000 5.23 0.00 31.77 4.70
5242 9810 6.552629 TGAAACTACGAGTACTGCTATTGAG 58.447 40.000 0.00 0.00 0.00 3.02
5321 9889 8.650143 AAGAGTTTCTAATCCCTAATTTGCAA 57.350 30.769 0.00 0.00 0.00 4.08
5329 9897 8.367156 TCTAATCCCTAATTTGCAATATTTGGC 58.633 33.333 19.33 0.00 29.87 4.52
5335 9903 5.590530 AATTTGCAATATTTGGCGGTAGA 57.409 34.783 0.00 0.00 0.00 2.59
5358 9926 2.687935 GACTGCCCAAAGTTGAAGTTCA 59.312 45.455 0.08 0.08 0.00 3.18
5366 9934 6.625081 GCCCAAAGTTGAAGTTCATACCATAC 60.625 42.308 6.36 0.56 0.00 2.39
5395 9963 4.721132 AGAAGTACGGATTGGGTTTTGAA 58.279 39.130 0.00 0.00 0.00 2.69
5457 10025 3.516615 CTCTCGTCTTCCATTTGTCCTC 58.483 50.000 0.00 0.00 0.00 3.71
5466 10034 5.824624 TCTTCCATTTGTCCTCTTGATATGC 59.175 40.000 0.00 0.00 0.00 3.14
5467 10035 5.114764 TCCATTTGTCCTCTTGATATGCA 57.885 39.130 0.00 0.00 0.00 3.96
5468 10036 5.128205 TCCATTTGTCCTCTTGATATGCAG 58.872 41.667 0.00 0.00 0.00 4.41
5469 10037 4.277672 CCATTTGTCCTCTTGATATGCAGG 59.722 45.833 0.00 0.00 0.00 4.85
5504 10072 3.753294 TTCTCTCAAGACAAGTGGGAC 57.247 47.619 0.00 0.00 0.00 4.46
5520 10088 3.065371 GTGGGACAGACTTCAACACTTTG 59.935 47.826 0.00 0.00 41.80 2.77
5526 10094 1.748493 GACTTCAACACTTTGCCACCA 59.252 47.619 0.00 0.00 32.17 4.17
5539 10107 5.070847 ACTTTGCCACCATTGAGAAATTTCT 59.929 36.000 20.60 20.60 41.00 2.52
5579 10147 1.140312 TGAGGACTTTGCCAGAGGTT 58.860 50.000 0.00 0.00 0.00 3.50
5610 10178 4.574828 GCTTCACCTCTCTCACTAGACTAG 59.425 50.000 8.00 8.00 0.00 2.57
5636 10204 3.849574 TGGTATCATTGAAGGACCTGGAA 59.150 43.478 0.00 0.00 0.00 3.53
5642 10210 3.662759 TTGAAGGACCTGGAAACACTT 57.337 42.857 0.00 0.00 35.60 3.16
5708 10276 0.188342 ACAATTGCCCCAACCTGACT 59.812 50.000 5.05 0.00 0.00 3.41
5710 10278 2.158385 ACAATTGCCCCAACCTGACTTA 60.158 45.455 5.05 0.00 0.00 2.24
5717 10285 2.557452 CCCCAACCTGACTTATTTGCCT 60.557 50.000 0.00 0.00 0.00 4.75
5737 10305 3.439476 CCTGAAAGCATGAAGAACCTCAG 59.561 47.826 0.00 0.00 0.00 3.35
5739 10307 2.574006 AAGCATGAAGAACCTCAGCA 57.426 45.000 0.00 0.00 0.00 4.41
5747 10315 3.259374 TGAAGAACCTCAGCACTCTTAGG 59.741 47.826 0.00 0.00 39.18 2.69
5750 10318 3.513515 AGAACCTCAGCACTCTTAGGAAG 59.486 47.826 0.00 0.00 36.07 3.46
5756 10324 4.281657 TCAGCACTCTTAGGAAGCTGATA 58.718 43.478 20.71 6.82 45.78 2.15
5757 10325 4.898265 TCAGCACTCTTAGGAAGCTGATAT 59.102 41.667 20.71 0.00 45.78 1.63
5758 10326 5.365025 TCAGCACTCTTAGGAAGCTGATATT 59.635 40.000 20.71 0.00 45.78 1.28
5759 10327 5.466058 CAGCACTCTTAGGAAGCTGATATTG 59.534 44.000 18.54 0.00 45.45 1.90
5760 10328 4.754114 GCACTCTTAGGAAGCTGATATTGG 59.246 45.833 0.00 0.00 0.00 3.16
5761 10329 5.686124 GCACTCTTAGGAAGCTGATATTGGT 60.686 44.000 0.00 0.00 0.00 3.67
5762 10330 6.463049 GCACTCTTAGGAAGCTGATATTGGTA 60.463 42.308 0.00 0.00 0.00 3.25
5763 10331 7.151308 CACTCTTAGGAAGCTGATATTGGTAG 58.849 42.308 0.00 0.00 0.00 3.18
5764 10332 7.014711 CACTCTTAGGAAGCTGATATTGGTAGA 59.985 40.741 0.00 0.00 0.00 2.59
5765 10333 7.232534 ACTCTTAGGAAGCTGATATTGGTAGAG 59.767 40.741 0.00 0.00 0.00 2.43
5766 10334 7.069986 TCTTAGGAAGCTGATATTGGTAGAGT 58.930 38.462 0.00 0.00 0.00 3.24
5767 10335 5.543507 AGGAAGCTGATATTGGTAGAGTG 57.456 43.478 0.00 0.00 0.00 3.51
5768 10336 4.061596 GGAAGCTGATATTGGTAGAGTGC 58.938 47.826 0.00 0.00 0.00 4.40
5769 10337 3.760580 AGCTGATATTGGTAGAGTGCC 57.239 47.619 0.00 0.00 0.00 5.01
5770 10338 3.041211 AGCTGATATTGGTAGAGTGCCA 58.959 45.455 0.00 0.00 0.00 4.92
5775 10343 1.378762 TTGGTAGAGTGCCAAGGCC 59.621 57.895 8.89 0.00 40.69 5.19
5776 10344 1.133809 TTGGTAGAGTGCCAAGGCCT 61.134 55.000 0.00 0.00 40.69 5.19
5777 10345 1.078143 GGTAGAGTGCCAAGGCCTG 60.078 63.158 5.69 0.00 41.09 4.85
5788 10356 2.044123 CAAGGCCTGGAGACATTACC 57.956 55.000 5.69 0.00 41.51 2.85
5789 10357 1.561542 CAAGGCCTGGAGACATTACCT 59.438 52.381 5.69 0.00 41.51 3.08
5790 10358 1.207791 AGGCCTGGAGACATTACCTG 58.792 55.000 3.11 0.00 41.51 4.00
5791 10359 1.204146 GGCCTGGAGACATTACCTGA 58.796 55.000 0.00 0.00 41.51 3.86
5792 10360 1.139853 GGCCTGGAGACATTACCTGAG 59.860 57.143 0.00 0.00 41.51 3.35
5793 10361 1.834263 GCCTGGAGACATTACCTGAGT 59.166 52.381 0.00 0.00 41.51 3.41
5794 10362 2.419297 GCCTGGAGACATTACCTGAGTG 60.419 54.545 0.00 0.00 41.51 3.51
5795 10363 2.169352 CCTGGAGACATTACCTGAGTGG 59.831 54.545 0.00 0.00 41.51 4.00
5796 10364 2.834549 CTGGAGACATTACCTGAGTGGT 59.165 50.000 0.00 0.00 46.78 4.16
5797 10365 3.248024 TGGAGACATTACCTGAGTGGTT 58.752 45.455 0.00 0.00 40.68 3.67
5798 10366 3.007940 TGGAGACATTACCTGAGTGGTTG 59.992 47.826 0.00 0.00 40.68 3.77
5799 10367 6.086081 TGGAGACATTACCTGAGTGGTTGG 62.086 50.000 0.00 0.00 40.68 3.77
5805 10373 2.145865 CCTGAGTGGTTGGGACAGT 58.854 57.895 0.00 0.00 42.39 3.55
5806 10374 0.474184 CCTGAGTGGTTGGGACAGTT 59.526 55.000 0.00 0.00 42.39 3.16
5807 10375 1.597742 CTGAGTGGTTGGGACAGTTG 58.402 55.000 0.00 0.00 42.39 3.16
5808 10376 1.140852 CTGAGTGGTTGGGACAGTTGA 59.859 52.381 0.00 0.00 42.39 3.18
5809 10377 1.134220 TGAGTGGTTGGGACAGTTGAC 60.134 52.381 0.00 0.00 42.39 3.18
5810 10378 0.182775 AGTGGTTGGGACAGTTGACC 59.817 55.000 0.00 0.00 42.39 4.02
5811 10379 0.182775 GTGGTTGGGACAGTTGACCT 59.817 55.000 0.96 0.00 42.39 3.85
5812 10380 0.472471 TGGTTGGGACAGTTGACCTC 59.528 55.000 0.96 0.00 42.39 3.85
5813 10381 0.765510 GGTTGGGACAGTTGACCTCT 59.234 55.000 0.96 0.00 42.39 3.69
5814 10382 1.270893 GGTTGGGACAGTTGACCTCTC 60.271 57.143 0.96 0.00 42.39 3.20
5815 10383 1.694696 GTTGGGACAGTTGACCTCTCT 59.305 52.381 0.96 0.00 42.39 3.10
5816 10384 2.897969 GTTGGGACAGTTGACCTCTCTA 59.102 50.000 0.96 0.00 42.39 2.43
5817 10385 2.808919 TGGGACAGTTGACCTCTCTAG 58.191 52.381 0.96 0.00 0.00 2.43
5818 10386 2.378886 TGGGACAGTTGACCTCTCTAGA 59.621 50.000 0.00 0.00 0.00 2.43
5819 10387 3.181422 TGGGACAGTTGACCTCTCTAGAA 60.181 47.826 0.00 0.00 0.00 2.10
5820 10388 3.445805 GGGACAGTTGACCTCTCTAGAAG 59.554 52.174 0.00 0.00 0.00 2.85
5821 10389 4.337145 GGACAGTTGACCTCTCTAGAAGA 58.663 47.826 0.00 0.00 0.00 2.87
5822 10390 4.767928 GGACAGTTGACCTCTCTAGAAGAA 59.232 45.833 0.00 0.00 32.23 2.52
5823 10391 5.244178 GGACAGTTGACCTCTCTAGAAGAAA 59.756 44.000 0.00 0.00 32.23 2.52
5824 10392 6.071051 GGACAGTTGACCTCTCTAGAAGAAAT 60.071 42.308 0.00 0.00 32.23 2.17
5825 10393 7.309770 ACAGTTGACCTCTCTAGAAGAAATT 57.690 36.000 0.00 0.00 32.23 1.82
5826 10394 8.423906 ACAGTTGACCTCTCTAGAAGAAATTA 57.576 34.615 0.00 0.00 32.23 1.40
5827 10395 9.041354 ACAGTTGACCTCTCTAGAAGAAATTAT 57.959 33.333 0.00 0.00 32.23 1.28
5828 10396 9.883142 CAGTTGACCTCTCTAGAAGAAATTATT 57.117 33.333 0.00 0.00 32.23 1.40
5847 10415 8.721133 AATTATTATCAGGATTTACCCCAACC 57.279 34.615 0.00 0.00 40.05 3.77
5848 10416 7.474474 TTATTATCAGGATTTACCCCAACCT 57.526 36.000 0.00 0.00 40.05 3.50
5849 10417 3.669939 ATCAGGATTTACCCCAACCTG 57.330 47.619 0.00 0.00 46.33 4.00
5852 10420 2.354328 AGGATTTACCCCAACCTGACA 58.646 47.619 0.00 0.00 40.05 3.58
5853 10421 2.926329 AGGATTTACCCCAACCTGACAT 59.074 45.455 0.00 0.00 40.05 3.06
5854 10422 3.023832 GGATTTACCCCAACCTGACATG 58.976 50.000 0.00 0.00 0.00 3.21
5855 10423 3.563479 GGATTTACCCCAACCTGACATGT 60.563 47.826 0.00 0.00 0.00 3.21
5856 10424 3.603965 TTTACCCCAACCTGACATGTT 57.396 42.857 0.00 0.00 0.00 2.71
5857 10425 3.603965 TTACCCCAACCTGACATGTTT 57.396 42.857 0.00 0.00 0.00 2.83
5858 10426 1.703411 ACCCCAACCTGACATGTTTG 58.297 50.000 0.00 0.00 0.00 2.93
5859 10427 1.063266 ACCCCAACCTGACATGTTTGT 60.063 47.619 0.00 0.00 39.32 2.83
5871 10439 5.112220 GACATGTTTGTCTGAAAGCATGA 57.888 39.130 22.64 0.00 46.04 3.07
5872 10440 5.518848 ACATGTTTGTCTGAAAGCATGAA 57.481 34.783 22.64 0.00 46.04 2.57
5873 10441 5.526115 ACATGTTTGTCTGAAAGCATGAAG 58.474 37.500 22.64 8.56 46.04 3.02
5874 10442 5.300034 ACATGTTTGTCTGAAAGCATGAAGA 59.700 36.000 22.64 0.00 46.04 2.87
5875 10443 5.833406 TGTTTGTCTGAAAGCATGAAGAA 57.167 34.783 0.00 0.00 0.00 2.52
5876 10444 5.581605 TGTTTGTCTGAAAGCATGAAGAAC 58.418 37.500 0.00 0.00 0.00 3.01
5877 10445 4.836125 TTGTCTGAAAGCATGAAGAACC 57.164 40.909 0.00 0.00 0.00 3.62
5878 10446 4.090761 TGTCTGAAAGCATGAAGAACCT 57.909 40.909 0.00 0.00 0.00 3.50
5879 10447 4.067896 TGTCTGAAAGCATGAAGAACCTC 58.932 43.478 0.00 0.00 0.00 3.85
5880 10448 4.067896 GTCTGAAAGCATGAAGAACCTCA 58.932 43.478 0.00 0.00 0.00 3.86
5881 10449 4.067896 TCTGAAAGCATGAAGAACCTCAC 58.932 43.478 0.00 0.00 0.00 3.51
5882 10450 3.149196 TGAAAGCATGAAGAACCTCACC 58.851 45.455 0.00 0.00 0.00 4.02
5883 10451 1.813513 AAGCATGAAGAACCTCACCG 58.186 50.000 0.00 0.00 0.00 4.94
5884 10452 0.674895 AGCATGAAGAACCTCACCGC 60.675 55.000 0.00 0.00 0.00 5.68
5885 10453 0.674895 GCATGAAGAACCTCACCGCT 60.675 55.000 0.00 0.00 0.00 5.52
5886 10454 1.363744 CATGAAGAACCTCACCGCTC 58.636 55.000 0.00 0.00 0.00 5.03
5887 10455 1.066573 CATGAAGAACCTCACCGCTCT 60.067 52.381 0.00 0.00 0.00 4.09
5888 10456 1.048601 TGAAGAACCTCACCGCTCTT 58.951 50.000 0.00 0.00 0.00 2.85
5889 10457 2.244695 TGAAGAACCTCACCGCTCTTA 58.755 47.619 0.00 0.00 0.00 2.10
5890 10458 2.231478 TGAAGAACCTCACCGCTCTTAG 59.769 50.000 0.00 0.00 0.00 2.18
5891 10459 2.217510 AGAACCTCACCGCTCTTAGA 57.782 50.000 0.00 0.00 0.00 2.10
5892 10460 2.096248 AGAACCTCACCGCTCTTAGAG 58.904 52.381 4.63 4.63 0.00 2.43
5893 10461 2.093106 GAACCTCACCGCTCTTAGAGA 58.907 52.381 14.14 0.00 0.00 3.10
5894 10462 1.757682 ACCTCACCGCTCTTAGAGAG 58.242 55.000 14.14 9.89 45.04 3.20
5908 10476 5.510430 TCTTAGAGAGCTGACATTGGTAGA 58.490 41.667 0.00 0.00 0.00 2.59
5913 10481 1.065854 AGCTGACATTGGTAGAGTGCC 60.066 52.381 0.00 0.00 0.00 5.01
5933 10501 1.561542 CAAGGCCTGGAGACATTACCT 59.438 52.381 5.69 0.00 41.51 3.08
5936 10504 1.134371 GGCCTGGAGACATTACCTGAC 60.134 57.143 0.00 0.00 41.51 3.51
5942 10510 3.650942 TGGAGACATTACCTGACTGGTTT 59.349 43.478 9.54 0.00 40.68 3.27
5980 10548 8.792830 TCTCTAGAAGAAATTGTTATTGTGGG 57.207 34.615 0.00 0.00 0.00 4.61
5981 10549 8.383175 TCTCTAGAAGAAATTGTTATTGTGGGT 58.617 33.333 0.00 0.00 0.00 4.51
5982 10550 8.934023 TCTAGAAGAAATTGTTATTGTGGGTT 57.066 30.769 0.00 0.00 0.00 4.11
5983 10551 9.010029 TCTAGAAGAAATTGTTATTGTGGGTTC 57.990 33.333 0.00 0.00 0.00 3.62
5984 10552 7.595819 AGAAGAAATTGTTATTGTGGGTTCA 57.404 32.000 0.00 0.00 0.00 3.18
5985 10553 7.433680 AGAAGAAATTGTTATTGTGGGTTCAC 58.566 34.615 0.00 0.00 43.87 3.18
5986 10554 6.096673 AGAAATTGTTATTGTGGGTTCACC 57.903 37.500 0.00 0.00 42.98 4.02
5999 10567 2.306847 GGTTCACCCAACTTGACATGT 58.693 47.619 0.00 0.00 35.06 3.21
6000 10568 2.693074 GGTTCACCCAACTTGACATGTT 59.307 45.455 0.00 1.02 35.06 2.71
6001 10569 3.132111 GGTTCACCCAACTTGACATGTTT 59.868 43.478 0.00 0.00 35.06 2.83
6002 10570 4.111916 GTTCACCCAACTTGACATGTTTG 58.888 43.478 0.00 0.00 31.50 2.93
6003 10571 2.100584 TCACCCAACTTGACATGTTTGC 59.899 45.455 0.00 0.00 0.00 3.68
6004 10572 1.412343 ACCCAACTTGACATGTTTGCC 59.588 47.619 0.00 0.00 0.00 4.52
6005 10573 1.688197 CCCAACTTGACATGTTTGCCT 59.312 47.619 0.00 0.00 0.00 4.75
6006 10574 2.546373 CCCAACTTGACATGTTTGCCTG 60.546 50.000 0.00 0.00 0.00 4.85
6007 10575 2.361757 CCAACTTGACATGTTTGCCTGA 59.638 45.455 0.00 0.00 0.00 3.86
6008 10576 3.181477 CCAACTTGACATGTTTGCCTGAA 60.181 43.478 0.00 0.00 0.00 3.02
6009 10577 4.431809 CAACTTGACATGTTTGCCTGAAA 58.568 39.130 0.00 0.00 0.00 2.69
6010 10578 4.311816 ACTTGACATGTTTGCCTGAAAG 57.688 40.909 0.00 0.00 0.00 2.62
6011 10579 2.798976 TGACATGTTTGCCTGAAAGC 57.201 45.000 0.00 0.00 0.00 3.51
6012 10580 2.030371 TGACATGTTTGCCTGAAAGCA 58.970 42.857 0.00 0.00 42.17 3.91
6013 10581 2.629137 TGACATGTTTGCCTGAAAGCAT 59.371 40.909 0.00 0.00 43.64 3.79
6014 10582 2.991190 GACATGTTTGCCTGAAAGCATG 59.009 45.455 11.78 11.78 43.64 4.06
6015 10583 2.629137 ACATGTTTGCCTGAAAGCATGA 59.371 40.909 18.24 0.00 43.64 3.07
6016 10584 3.069872 ACATGTTTGCCTGAAAGCATGAA 59.930 39.130 18.24 0.00 43.64 2.57
6017 10585 3.374220 TGTTTGCCTGAAAGCATGAAG 57.626 42.857 0.00 0.00 43.64 3.02
6018 10586 2.957680 TGTTTGCCTGAAAGCATGAAGA 59.042 40.909 0.00 0.00 43.64 2.87
6019 10587 3.384146 TGTTTGCCTGAAAGCATGAAGAA 59.616 39.130 0.00 0.00 43.64 2.52
6020 10588 3.648339 TTGCCTGAAAGCATGAAGAAC 57.352 42.857 0.00 0.00 43.64 3.01
6021 10589 1.888512 TGCCTGAAAGCATGAAGAACC 59.111 47.619 0.00 0.00 38.00 3.62
6022 10590 2.165998 GCCTGAAAGCATGAAGAACCT 58.834 47.619 0.00 0.00 0.00 3.50
6023 10591 2.163211 GCCTGAAAGCATGAAGAACCTC 59.837 50.000 0.00 0.00 0.00 3.85
6024 10592 3.415212 CCTGAAAGCATGAAGAACCTCA 58.585 45.455 0.00 0.00 0.00 3.86
6025 10593 4.015084 CCTGAAAGCATGAAGAACCTCAT 58.985 43.478 0.00 0.00 36.45 2.90
6026 10594 4.096081 CCTGAAAGCATGAAGAACCTCATC 59.904 45.833 0.00 0.00 33.66 2.92
6027 10595 4.914983 TGAAAGCATGAAGAACCTCATCT 58.085 39.130 0.00 0.00 33.66 2.90
6028 10596 4.940046 TGAAAGCATGAAGAACCTCATCTC 59.060 41.667 0.00 0.00 33.66 2.75
6029 10597 4.840716 AAGCATGAAGAACCTCATCTCT 57.159 40.909 0.00 0.00 33.66 3.10
6030 10598 4.405116 AGCATGAAGAACCTCATCTCTC 57.595 45.455 0.00 0.00 33.66 3.20
6031 10599 4.032310 AGCATGAAGAACCTCATCTCTCT 58.968 43.478 0.00 0.00 33.66 3.10
6032 10600 4.470664 AGCATGAAGAACCTCATCTCTCTT 59.529 41.667 0.00 0.00 33.66 2.85
6033 10601 5.660417 AGCATGAAGAACCTCATCTCTCTTA 59.340 40.000 0.00 0.00 33.66 2.10
6034 10602 5.984926 GCATGAAGAACCTCATCTCTCTTAG 59.015 44.000 0.00 0.00 33.66 2.18
6035 10603 6.183360 GCATGAAGAACCTCATCTCTCTTAGA 60.183 42.308 0.00 0.00 39.02 2.10
6036 10604 7.632462 GCATGAAGAACCTCATCTCTCTTAGAA 60.632 40.741 0.00 0.00 37.89 2.10
6037 10605 7.782897 TGAAGAACCTCATCTCTCTTAGAAA 57.217 36.000 0.00 0.00 37.89 2.52
6038 10606 8.195165 TGAAGAACCTCATCTCTCTTAGAAAA 57.805 34.615 0.00 0.00 37.89 2.29
6039 10607 8.091449 TGAAGAACCTCATCTCTCTTAGAAAAC 58.909 37.037 0.00 0.00 37.89 2.43
6040 10608 7.790782 AGAACCTCATCTCTCTTAGAAAACT 57.209 36.000 0.00 0.00 37.89 2.66
6041 10609 7.610865 AGAACCTCATCTCTCTTAGAAAACTG 58.389 38.462 0.00 0.00 37.89 3.16
6042 10610 7.453126 AGAACCTCATCTCTCTTAGAAAACTGA 59.547 37.037 0.00 0.00 37.89 3.41
6043 10611 6.930731 ACCTCATCTCTCTTAGAAAACTGAC 58.069 40.000 0.00 0.00 37.89 3.51
6044 10612 6.495181 ACCTCATCTCTCTTAGAAAACTGACA 59.505 38.462 0.00 0.00 37.89 3.58
6045 10613 7.180051 ACCTCATCTCTCTTAGAAAACTGACAT 59.820 37.037 0.00 0.00 37.89 3.06
6046 10614 8.040132 CCTCATCTCTCTTAGAAAACTGACATT 58.960 37.037 0.00 0.00 37.89 2.71
6049 10617 9.868277 CATCTCTCTTAGAAAACTGACATTAGT 57.132 33.333 0.00 0.00 37.89 2.24
6057 10625 7.617041 AGAAAACTGACATTAGTAGATTGCC 57.383 36.000 0.00 0.00 0.00 4.52
6058 10626 7.168219 AGAAAACTGACATTAGTAGATTGCCA 58.832 34.615 0.00 0.00 0.00 4.92
6059 10627 7.665559 AGAAAACTGACATTAGTAGATTGCCAA 59.334 33.333 0.00 0.00 0.00 4.52
6060 10628 6.992063 AACTGACATTAGTAGATTGCCAAG 57.008 37.500 0.00 0.00 0.00 3.61
6077 10645 1.561542 CAAGGCCTGGAGACATTACCT 59.438 52.381 5.69 0.00 41.51 3.08
6079 10647 1.204146 GGCCTGGAGACATTACCTGA 58.796 55.000 0.00 0.00 41.51 3.86
6080 10648 1.139853 GGCCTGGAGACATTACCTGAG 59.860 57.143 0.00 0.00 41.51 3.35
6085 10653 2.567169 TGGAGACATTACCTGAGTGGTG 59.433 50.000 0.00 0.00 42.78 4.17
6180 11036 2.096248 AGAACCTCACCGCTCTTAGAG 58.904 52.381 4.63 4.63 0.00 2.43
6182 11038 1.757682 ACCTCACCGCTCTTAGAGAG 58.242 55.000 14.14 9.89 45.04 3.20
6192 11048 3.781079 CTCTTAGAGAGCTGACACTGG 57.219 52.381 2.53 0.00 35.30 4.00
6221 11221 0.117340 AAGGCCTGGAGACACTACCT 59.883 55.000 5.69 0.00 34.21 3.08
6224 11224 0.820871 GCCTGGAGACACTACCTGAG 59.179 60.000 0.00 0.00 35.60 3.35
6241 11241 1.562008 TGAGTGGTTGGGACAGTTGAA 59.438 47.619 0.00 0.00 42.39 2.69
6254 11254 6.071108 TGGGACAGTTGAATTCTCTAGAAGAG 60.071 42.308 7.05 0.00 43.64 2.85
6286 12482 4.192429 GGAATTTTCCCAACCTGACATG 57.808 45.455 0.00 0.00 41.62 3.21
6332 12567 3.069016 TCACCGCTCTTAGAAAACTGACA 59.931 43.478 0.00 0.00 0.00 3.58
6333 12568 3.184581 CACCGCTCTTAGAAAACTGACAC 59.815 47.826 0.00 0.00 0.00 3.67
6338 12678 5.406780 CGCTCTTAGAAAACTGACACTGAAT 59.593 40.000 0.00 0.00 0.00 2.57
6343 12683 7.987458 TCTTAGAAAACTGACACTGAATGAGTT 59.013 33.333 0.00 0.00 29.75 3.01
6350 12690 3.136443 TGACACTGAATGAGTTCCAAGGT 59.864 43.478 0.00 0.00 33.26 3.50
6431 12915 0.409092 ATTGCCCCAACCTGACATCA 59.591 50.000 0.00 0.00 0.00 3.07
6484 12968 5.489792 TTGAAGCTACTCAGAATTGGTCT 57.510 39.130 0.00 0.00 36.88 3.85
6499 12983 4.537135 TTGGTCTATGTCCAAGTCTGAC 57.463 45.455 0.00 0.00 39.62 3.51
6555 13049 2.289195 TGTCACATCCCCAAAGTCGTAC 60.289 50.000 0.00 0.00 0.00 3.67
6567 13061 1.091537 AGTCGTACTCTGCTGAGCTC 58.908 55.000 19.49 6.82 43.85 4.09
6621 13239 0.248825 CTTCTCTGAGGCCATCGTCG 60.249 60.000 5.01 0.00 0.00 5.12
6636 13254 4.704103 TCGCCCAGCCACCTCTCT 62.704 66.667 0.00 0.00 0.00 3.10
6649 13267 2.103941 CACCTCTCTATCTTTGCTCCCC 59.896 54.545 0.00 0.00 0.00 4.81
6653 13271 0.830648 TCTATCTTTGCTCCCCGTGG 59.169 55.000 0.00 0.00 0.00 4.94
6654 13272 0.815615 CTATCTTTGCTCCCCGTGGC 60.816 60.000 0.00 0.00 0.00 5.01
6655 13273 1.271840 TATCTTTGCTCCCCGTGGCT 61.272 55.000 0.00 0.00 0.00 4.75
6656 13274 1.271840 ATCTTTGCTCCCCGTGGCTA 61.272 55.000 0.00 0.00 0.00 3.93
6657 13275 1.745489 CTTTGCTCCCCGTGGCTAC 60.745 63.158 0.00 0.00 0.00 3.58
6659 13277 1.774894 TTTGCTCCCCGTGGCTACTT 61.775 55.000 0.00 0.00 0.00 2.24
6660 13278 0.905809 TTGCTCCCCGTGGCTACTTA 60.906 55.000 0.00 0.00 0.00 2.24
6661 13279 1.143401 GCTCCCCGTGGCTACTTAC 59.857 63.158 0.00 0.00 0.00 2.34
6662 13280 1.610554 GCTCCCCGTGGCTACTTACA 61.611 60.000 0.00 0.00 0.00 2.41
6663 13281 1.120530 CTCCCCGTGGCTACTTACAT 58.879 55.000 0.00 0.00 0.00 2.29
6664 13282 0.828022 TCCCCGTGGCTACTTACATG 59.172 55.000 0.00 0.00 0.00 3.21
6665 13283 0.179056 CCCCGTGGCTACTTACATGG 60.179 60.000 0.00 0.00 42.20 3.66
6666 13284 0.828022 CCCGTGGCTACTTACATGGA 59.172 55.000 4.57 0.00 44.69 3.41
6667 13285 1.472728 CCCGTGGCTACTTACATGGAC 60.473 57.143 4.57 0.00 44.69 4.02
6672 13290 1.206371 GGCTACTTACATGGACGTGGT 59.794 52.381 0.00 0.00 0.00 4.16
6676 13294 0.321210 CTTACATGGACGTGGTGGCA 60.321 55.000 0.00 0.00 0.00 4.92
6689 13307 0.462759 GGTGGCATGGTGCTCTACTC 60.463 60.000 1.64 0.00 44.28 2.59
6690 13308 0.807667 GTGGCATGGTGCTCTACTCG 60.808 60.000 1.64 0.00 44.28 4.18
6691 13309 1.257750 TGGCATGGTGCTCTACTCGT 61.258 55.000 1.64 0.00 44.28 4.18
6693 13311 1.002366 GCATGGTGCTCTACTCGTTG 58.998 55.000 0.00 0.00 40.96 4.10
6711 13348 4.025858 GGTCCCAGCTGCTGCAGA 62.026 66.667 32.30 18.53 42.74 4.26
6712 13349 2.436292 GTCCCAGCTGCTGCAGAG 60.436 66.667 32.30 21.93 42.74 3.35
6728 13365 0.338120 AGAGGAGGAGGTAAGCAGCT 59.662 55.000 0.00 0.00 34.43 4.24
6750 13388 2.958355 TGGAGCCTTCTTTTTCAAGTGG 59.042 45.455 0.00 0.00 0.00 4.00
6753 13391 3.631250 AGCCTTCTTTTTCAAGTGGTGA 58.369 40.909 0.00 0.00 31.61 4.02
6758 13396 6.348868 GCCTTCTTTTTCAAGTGGTGATCTAG 60.349 42.308 0.00 0.00 35.70 2.43
6770 13408 5.309020 AGTGGTGATCTAGTCCATGCATTAT 59.691 40.000 0.00 0.00 33.68 1.28
6771 13409 5.641209 GTGGTGATCTAGTCCATGCATTATC 59.359 44.000 0.00 0.00 33.68 1.75
6772 13410 5.545335 TGGTGATCTAGTCCATGCATTATCT 59.455 40.000 0.00 0.00 0.00 1.98
6778 13416 9.282569 GATCTAGTCCATGCATTATCTCTTTTT 57.717 33.333 0.00 0.00 0.00 1.94
6779 13417 8.668510 TCTAGTCCATGCATTATCTCTTTTTC 57.331 34.615 0.00 0.00 0.00 2.29
6818 13456 6.366877 CAGTTTTTCAAGGGCAGAAACATATG 59.633 38.462 0.00 0.00 34.94 1.78
6831 13469 7.750903 GGCAGAAACATATGTAGTTGTTTTCTC 59.249 37.037 9.21 6.86 43.95 2.87
6848 13486 7.781056 TGTTTTCTCATAAGTTCAGCCTTTTT 58.219 30.769 0.00 0.00 0.00 1.94
6886 13524 5.235401 GCAGGCTTAGTTGTAGCTAATCTTC 59.765 44.000 0.00 0.00 38.67 2.87
6907 13545 7.820648 TCTTCTGAACATTTAGAAATTGAGCC 58.179 34.615 1.13 0.00 32.96 4.70
6908 13546 7.448161 TCTTCTGAACATTTAGAAATTGAGCCA 59.552 33.333 1.13 0.00 32.96 4.75
6910 13548 6.151648 TCTGAACATTTAGAAATTGAGCCAGG 59.848 38.462 0.00 0.00 0.00 4.45
6912 13550 6.493115 TGAACATTTAGAAATTGAGCCAGGAA 59.507 34.615 0.00 0.00 0.00 3.36
6914 13552 5.185828 ACATTTAGAAATTGAGCCAGGAACC 59.814 40.000 0.00 0.00 0.00 3.62
6918 13556 2.683211 AATTGAGCCAGGAACCAACT 57.317 45.000 0.00 0.00 0.00 3.16
6919 13557 2.683211 ATTGAGCCAGGAACCAACTT 57.317 45.000 0.00 0.00 0.00 2.66
6920 13558 2.452600 TTGAGCCAGGAACCAACTTT 57.547 45.000 0.00 0.00 0.00 2.66
6922 13560 2.745968 TGAGCCAGGAACCAACTTTTT 58.254 42.857 0.00 0.00 0.00 1.94
6954 13592 9.582431 AACTTGAAAAATATCTCATCAAGCATG 57.418 29.630 12.34 0.00 46.81 4.06
6955 13593 7.705325 ACTTGAAAAATATCTCATCAAGCATGC 59.295 33.333 10.51 10.51 46.81 4.06
6956 13594 7.102847 TGAAAAATATCTCATCAAGCATGCA 57.897 32.000 21.98 0.00 31.70 3.96
6957 13595 7.200455 TGAAAAATATCTCATCAAGCATGCAG 58.800 34.615 21.98 12.28 31.70 4.41
6959 13597 6.710597 AAATATCTCATCAAGCATGCAGTT 57.289 33.333 21.98 2.93 31.70 3.16
6960 13598 7.812690 AAATATCTCATCAAGCATGCAGTTA 57.187 32.000 21.98 7.05 31.70 2.24
6961 13599 7.812690 AATATCTCATCAAGCATGCAGTTAA 57.187 32.000 21.98 0.24 31.70 2.01
6966 13631 8.229253 TCTCATCAAGCATGCAGTTAATTAAT 57.771 30.769 21.98 0.00 31.70 1.40
6975 13640 7.884877 AGCATGCAGTTAATTAATATCCAGCTA 59.115 33.333 21.98 0.00 0.00 3.32
6990 13655 3.264193 TCCAGCTAACATCCACATGACTT 59.736 43.478 0.00 0.00 33.72 3.01
6992 13657 4.142534 CCAGCTAACATCCACATGACTTTG 60.143 45.833 0.00 0.00 33.72 2.77
6995 13660 5.356190 AGCTAACATCCACATGACTTTGATG 59.644 40.000 0.00 6.44 38.94 3.07
6996 13661 5.449588 GCTAACATCCACATGACTTTGATGG 60.450 44.000 0.00 0.00 37.67 3.51
6997 13662 4.038271 ACATCCACATGACTTTGATGGT 57.962 40.909 0.00 0.00 37.67 3.55
6998 13663 4.410099 ACATCCACATGACTTTGATGGTT 58.590 39.130 0.00 0.00 37.67 3.67
6999 13664 4.219070 ACATCCACATGACTTTGATGGTTG 59.781 41.667 0.00 2.82 37.67 3.77
7000 13665 3.156293 TCCACATGACTTTGATGGTTGG 58.844 45.455 0.00 0.00 0.00 3.77
7001 13666 2.353011 CCACATGACTTTGATGGTTGGC 60.353 50.000 0.00 0.00 0.00 4.52
7002 13667 2.559668 CACATGACTTTGATGGTTGGCT 59.440 45.455 0.00 0.00 0.00 4.75
7003 13668 2.559668 ACATGACTTTGATGGTTGGCTG 59.440 45.455 0.00 0.00 0.00 4.85
7004 13669 0.961019 TGACTTTGATGGTTGGCTGC 59.039 50.000 0.00 0.00 0.00 5.25
7005 13670 0.961019 GACTTTGATGGTTGGCTGCA 59.039 50.000 0.50 0.00 0.00 4.41
7006 13671 0.675633 ACTTTGATGGTTGGCTGCAC 59.324 50.000 0.50 0.00 0.00 4.57
7007 13672 0.675083 CTTTGATGGTTGGCTGCACA 59.325 50.000 0.50 0.00 0.00 4.57
7008 13673 0.675083 TTTGATGGTTGGCTGCACAG 59.325 50.000 0.50 0.00 0.00 3.66
7018 13683 4.162592 CTGCACAGCCAACTTGGA 57.837 55.556 12.37 0.00 40.96 3.53
7019 13684 2.417978 CTGCACAGCCAACTTGGAA 58.582 52.632 12.37 0.00 40.96 3.53
7020 13685 0.746063 CTGCACAGCCAACTTGGAAA 59.254 50.000 12.37 0.00 40.96 3.13
7040 13705 9.793259 TTGGAAAGAATGAGTACAACTTCTTAT 57.207 29.630 13.56 7.30 35.57 1.73
7041 13706 9.793259 TGGAAAGAATGAGTACAACTTCTTATT 57.207 29.630 13.56 3.78 35.57 1.40
7043 13708 9.548208 GAAAGAATGAGTACAACTTCTTATTGC 57.452 33.333 13.56 4.83 35.57 3.56
7044 13709 8.854614 AAGAATGAGTACAACTTCTTATTGCT 57.145 30.769 12.25 0.00 35.16 3.91
7045 13710 8.854614 AGAATGAGTACAACTTCTTATTGCTT 57.145 30.769 0.00 0.00 0.00 3.91
7046 13711 8.940952 AGAATGAGTACAACTTCTTATTGCTTC 58.059 33.333 0.00 0.00 0.00 3.86
7047 13712 8.854614 AATGAGTACAACTTCTTATTGCTTCT 57.145 30.769 0.00 0.00 0.00 2.85
7048 13713 7.891183 TGAGTACAACTTCTTATTGCTTCTC 57.109 36.000 0.00 0.00 0.00 2.87
7049 13714 7.671302 TGAGTACAACTTCTTATTGCTTCTCT 58.329 34.615 0.00 0.00 0.00 3.10
7050 13715 8.150945 TGAGTACAACTTCTTATTGCTTCTCTT 58.849 33.333 0.00 0.00 0.00 2.85
7051 13716 8.316640 AGTACAACTTCTTATTGCTTCTCTTG 57.683 34.615 0.00 0.00 0.00 3.02
7052 13717 7.934120 AGTACAACTTCTTATTGCTTCTCTTGT 59.066 33.333 0.00 0.00 0.00 3.16
7053 13718 7.195839 ACAACTTCTTATTGCTTCTCTTGTC 57.804 36.000 0.00 0.00 0.00 3.18
7054 13719 6.995091 ACAACTTCTTATTGCTTCTCTTGTCT 59.005 34.615 0.00 0.00 0.00 3.41
7055 13720 7.041508 ACAACTTCTTATTGCTTCTCTTGTCTG 60.042 37.037 0.00 0.00 0.00 3.51
7056 13721 6.529220 ACTTCTTATTGCTTCTCTTGTCTGT 58.471 36.000 0.00 0.00 0.00 3.41
7057 13722 6.995091 ACTTCTTATTGCTTCTCTTGTCTGTT 59.005 34.615 0.00 0.00 0.00 3.16
7058 13723 7.500559 ACTTCTTATTGCTTCTCTTGTCTGTTT 59.499 33.333 0.00 0.00 0.00 2.83
7059 13724 7.426929 TCTTATTGCTTCTCTTGTCTGTTTC 57.573 36.000 0.00 0.00 0.00 2.78
7060 13725 7.220030 TCTTATTGCTTCTCTTGTCTGTTTCT 58.780 34.615 0.00 0.00 0.00 2.52
7061 13726 8.367911 TCTTATTGCTTCTCTTGTCTGTTTCTA 58.632 33.333 0.00 0.00 0.00 2.10
7062 13727 8.539770 TTATTGCTTCTCTTGTCTGTTTCTAG 57.460 34.615 0.00 0.00 0.00 2.43
7063 13728 5.537300 TGCTTCTCTTGTCTGTTTCTAGT 57.463 39.130 0.00 0.00 0.00 2.57
7064 13729 6.650427 TGCTTCTCTTGTCTGTTTCTAGTA 57.350 37.500 0.00 0.00 0.00 1.82
7065 13730 6.448006 TGCTTCTCTTGTCTGTTTCTAGTAC 58.552 40.000 0.00 0.00 0.00 2.73
7066 13731 5.569823 GCTTCTCTTGTCTGTTTCTAGTACG 59.430 44.000 0.00 0.00 0.00 3.67
7067 13732 6.630444 TTCTCTTGTCTGTTTCTAGTACGT 57.370 37.500 0.00 0.00 0.00 3.57
7068 13733 7.572724 GCTTCTCTTGTCTGTTTCTAGTACGTA 60.573 40.741 0.00 0.00 0.00 3.57
7069 13734 7.126726 TCTCTTGTCTGTTTCTAGTACGTAC 57.873 40.000 18.10 18.10 0.00 3.67
7070 13735 6.933521 TCTCTTGTCTGTTTCTAGTACGTACT 59.066 38.462 29.62 29.62 40.24 2.73
7071 13736 7.443575 TCTCTTGTCTGTTTCTAGTACGTACTT 59.556 37.037 31.58 16.48 37.73 2.24
7072 13737 7.358066 TCTTGTCTGTTTCTAGTACGTACTTG 58.642 38.462 31.58 28.11 37.73 3.16
7073 13738 5.455392 TGTCTGTTTCTAGTACGTACTTGC 58.545 41.667 31.58 17.30 37.73 4.01
7074 13739 5.240183 TGTCTGTTTCTAGTACGTACTTGCT 59.760 40.000 31.58 11.74 37.73 3.91
7075 13740 6.148264 GTCTGTTTCTAGTACGTACTTGCTT 58.852 40.000 31.58 11.36 37.73 3.91
7076 13741 7.041167 TGTCTGTTTCTAGTACGTACTTGCTTA 60.041 37.037 31.58 13.67 37.73 3.09
7077 13742 7.805071 GTCTGTTTCTAGTACGTACTTGCTTAA 59.195 37.037 31.58 19.58 37.73 1.85
7078 13743 7.805071 TCTGTTTCTAGTACGTACTTGCTTAAC 59.195 37.037 31.58 26.92 37.73 2.01
7079 13744 7.424803 TGTTTCTAGTACGTACTTGCTTAACA 58.575 34.615 31.58 28.54 37.73 2.41
7080 13745 8.084073 TGTTTCTAGTACGTACTTGCTTAACAT 58.916 33.333 31.58 7.71 37.73 2.71
7081 13746 8.919661 GTTTCTAGTACGTACTTGCTTAACATT 58.080 33.333 31.58 7.20 37.73 2.71
7082 13747 8.456904 TTCTAGTACGTACTTGCTTAACATTG 57.543 34.615 31.58 6.48 37.73 2.82
7083 13748 7.819644 TCTAGTACGTACTTGCTTAACATTGA 58.180 34.615 31.58 9.40 37.73 2.57
7084 13749 8.298854 TCTAGTACGTACTTGCTTAACATTGAA 58.701 33.333 31.58 8.98 37.73 2.69
7085 13750 7.718272 AGTACGTACTTGCTTAACATTGAAA 57.282 32.000 22.45 0.00 31.13 2.69
7086 13751 8.145316 AGTACGTACTTGCTTAACATTGAAAA 57.855 30.769 22.45 0.00 31.13 2.29
7087 13752 8.280497 AGTACGTACTTGCTTAACATTGAAAAG 58.720 33.333 22.45 0.00 31.13 2.27
7088 13753 7.254227 ACGTACTTGCTTAACATTGAAAAGA 57.746 32.000 0.00 0.00 0.00 2.52
7089 13754 7.699566 ACGTACTTGCTTAACATTGAAAAGAA 58.300 30.769 0.00 0.00 0.00 2.52
7090 13755 8.349983 ACGTACTTGCTTAACATTGAAAAGAAT 58.650 29.630 0.00 0.00 0.00 2.40
7091 13756 9.820229 CGTACTTGCTTAACATTGAAAAGAATA 57.180 29.630 6.85 0.00 0.00 1.75
7108 13773 9.513727 GAAAAGAATAAATCTCTTCAATCAGGC 57.486 33.333 0.00 0.00 35.55 4.85
7109 13774 8.585471 AAAGAATAAATCTCTTCAATCAGGCA 57.415 30.769 0.00 0.00 37.42 4.75
7110 13775 8.585471 AAGAATAAATCTCTTCAATCAGGCAA 57.415 30.769 0.00 0.00 37.42 4.52
7111 13776 8.763984 AGAATAAATCTCTTCAATCAGGCAAT 57.236 30.769 0.00 0.00 30.46 3.56
7112 13777 9.198475 AGAATAAATCTCTTCAATCAGGCAATT 57.802 29.630 0.00 0.00 30.46 2.32
7113 13778 9.813446 GAATAAATCTCTTCAATCAGGCAATTT 57.187 29.630 0.00 0.00 0.00 1.82
7117 13782 7.951347 ATCTCTTCAATCAGGCAATTTTAGT 57.049 32.000 0.00 0.00 0.00 2.24
7118 13783 7.383102 TCTCTTCAATCAGGCAATTTTAGTC 57.617 36.000 0.00 0.00 0.00 2.59
7119 13784 6.942005 TCTCTTCAATCAGGCAATTTTAGTCA 59.058 34.615 0.00 0.00 0.00 3.41
7120 13785 6.913170 TCTTCAATCAGGCAATTTTAGTCAC 58.087 36.000 0.00 0.00 0.00 3.67
7121 13786 5.295431 TCAATCAGGCAATTTTAGTCACG 57.705 39.130 0.00 0.00 0.00 4.35
7122 13787 3.764885 ATCAGGCAATTTTAGTCACGC 57.235 42.857 0.00 0.00 0.00 5.34
7123 13788 1.810151 TCAGGCAATTTTAGTCACGCC 59.190 47.619 0.00 0.00 39.90 5.68
7124 13789 2.200373 AGGCAATTTTAGTCACGCCT 57.800 45.000 0.00 0.00 44.89 5.52
7127 13792 4.428615 GGCAATTTTAGTCACGCCTTAA 57.571 40.909 0.00 0.00 36.58 1.85
7128 13793 4.163552 GGCAATTTTAGTCACGCCTTAAC 58.836 43.478 0.00 0.00 36.58 2.01
7129 13794 4.320641 GGCAATTTTAGTCACGCCTTAACA 60.321 41.667 0.00 0.00 36.58 2.41
7130 13795 5.399013 GCAATTTTAGTCACGCCTTAACAT 58.601 37.500 0.00 0.00 0.00 2.71
7131 13796 5.511729 GCAATTTTAGTCACGCCTTAACATC 59.488 40.000 0.00 0.00 0.00 3.06
7132 13797 5.813080 ATTTTAGTCACGCCTTAACATCC 57.187 39.130 0.00 0.00 0.00 3.51
7133 13798 3.965379 TTAGTCACGCCTTAACATCCA 57.035 42.857 0.00 0.00 0.00 3.41
7134 13799 2.386661 AGTCACGCCTTAACATCCAG 57.613 50.000 0.00 0.00 0.00 3.86
7135 13800 0.727398 GTCACGCCTTAACATCCAGC 59.273 55.000 0.00 0.00 0.00 4.85
7136 13801 0.613260 TCACGCCTTAACATCCAGCT 59.387 50.000 0.00 0.00 0.00 4.24
7137 13802 1.009829 CACGCCTTAACATCCAGCTC 58.990 55.000 0.00 0.00 0.00 4.09
7138 13803 0.613260 ACGCCTTAACATCCAGCTCA 59.387 50.000 0.00 0.00 0.00 4.26
7139 13804 1.210478 ACGCCTTAACATCCAGCTCAT 59.790 47.619 0.00 0.00 0.00 2.90
7140 13805 1.600957 CGCCTTAACATCCAGCTCATG 59.399 52.381 1.23 1.23 0.00 3.07
7151 13816 1.001641 AGCTCATGGCCTGGTCAAC 60.002 57.895 4.49 0.00 43.05 3.18
7180 13845 0.905357 AGGCTTACATCGCTGTTCCT 59.095 50.000 0.00 0.00 36.79 3.36
7183 13848 1.009829 CTTACATCGCTGTTCCTGGC 58.990 55.000 0.00 0.00 36.79 4.85
7185 13850 0.613260 TACATCGCTGTTCCTGGCTT 59.387 50.000 0.00 0.00 36.79 4.35
7186 13851 0.957395 ACATCGCTGTTCCTGGCTTG 60.957 55.000 0.00 0.00 28.70 4.01
7188 13853 0.674895 ATCGCTGTTCCTGGCTTGTC 60.675 55.000 0.00 0.00 0.00 3.18
7189 13854 1.302033 CGCTGTTCCTGGCTTGTCT 60.302 57.895 0.00 0.00 0.00 3.41
7190 13855 1.294659 CGCTGTTCCTGGCTTGTCTC 61.295 60.000 0.00 0.00 0.00 3.36
7191 13856 1.294659 GCTGTTCCTGGCTTGTCTCG 61.295 60.000 0.00 0.00 0.00 4.04
7193 13858 1.301716 GTTCCTGGCTTGTCTCGCA 60.302 57.895 0.00 0.00 0.00 5.10
7196 13861 1.078918 CCTGGCTTGTCTCGCATGA 60.079 57.895 0.00 0.00 0.00 3.07
7197 13862 1.088340 CCTGGCTTGTCTCGCATGAG 61.088 60.000 0.00 0.00 43.99 2.90
7209 13874 4.506758 TCTCGCATGAGATGAATTTCACA 58.493 39.130 0.15 0.00 46.25 3.58
7210 13875 4.937015 TCTCGCATGAGATGAATTTCACAA 59.063 37.500 0.15 0.00 46.25 3.33
7211 13876 5.587443 TCTCGCATGAGATGAATTTCACAAT 59.413 36.000 0.15 0.00 46.25 2.71
7212 13877 6.094464 TCTCGCATGAGATGAATTTCACAATT 59.906 34.615 0.15 0.00 46.25 2.32
7213 13878 6.260377 TCGCATGAGATGAATTTCACAATTC 58.740 36.000 0.15 1.42 46.08 2.17
7214 13879 8.655976 CTCGCATGAGATGAATTTCACAATTCG 61.656 40.741 0.15 0.78 45.93 3.34
7231 13896 3.685139 TTCGAAAAGATGAGGCAGAGT 57.315 42.857 0.00 0.00 0.00 3.24
7233 13898 3.589988 TCGAAAAGATGAGGCAGAGTTC 58.410 45.455 0.00 0.00 0.00 3.01
7240 13905 3.328931 AGATGAGGCAGAGTTCAAGGAAA 59.671 43.478 0.00 0.00 0.00 3.13
7241 13906 2.851195 TGAGGCAGAGTTCAAGGAAAC 58.149 47.619 0.00 0.00 0.00 2.78
7244 13909 0.238553 GCAGAGTTCAAGGAAACGGC 59.761 55.000 0.00 0.00 34.27 5.68
7248 13913 1.266989 GAGTTCAAGGAAACGGCCAAG 59.733 52.381 2.24 0.00 34.27 3.61
7250 13915 1.028905 TTCAAGGAAACGGCCAAGTG 58.971 50.000 2.24 0.00 0.00 3.16
7283 13948 1.027357 CTTGCAGACCAAGCTGTTGT 58.973 50.000 0.00 0.00 43.98 3.32
7286 13951 0.740737 GCAGACCAAGCTGTTGTTGT 59.259 50.000 0.00 0.00 38.17 3.32
7295 13960 4.022589 CCAAGCTGTTGTTGTGATTCTCAT 60.023 41.667 0.00 0.00 30.95 2.90
7301 13966 3.421919 TGTTGTGATTCTCATGGAGCA 57.578 42.857 0.00 0.00 0.00 4.26
7305 13970 6.829849 TGTTGTGATTCTCATGGAGCATATA 58.170 36.000 0.00 0.00 0.00 0.86
7306 13971 7.455891 TGTTGTGATTCTCATGGAGCATATAT 58.544 34.615 0.00 0.00 0.00 0.86
7307 13972 8.596293 TGTTGTGATTCTCATGGAGCATATATA 58.404 33.333 0.00 0.00 0.00 0.86
7308 13973 9.610705 GTTGTGATTCTCATGGAGCATATATAT 57.389 33.333 0.00 0.00 0.00 0.86
7316 13981 9.623000 TCTCATGGAGCATATATATTTTGATGG 57.377 33.333 0.00 0.00 0.00 3.51
7317 13982 9.404848 CTCATGGAGCATATATATTTTGATGGT 57.595 33.333 0.00 0.00 32.94 3.55
7318 13983 9.181061 TCATGGAGCATATATATTTTGATGGTG 57.819 33.333 3.27 0.00 30.54 4.17
7319 13984 7.943079 TGGAGCATATATATTTTGATGGTGG 57.057 36.000 3.27 0.00 30.54 4.61
7320 13985 7.697946 TGGAGCATATATATTTTGATGGTGGA 58.302 34.615 3.27 0.00 30.54 4.02
7321 13986 8.169393 TGGAGCATATATATTTTGATGGTGGAA 58.831 33.333 3.27 0.00 30.54 3.53
7322 13987 8.680903 GGAGCATATATATTTTGATGGTGGAAG 58.319 37.037 3.27 0.00 30.54 3.46
7323 13988 9.453572 GAGCATATATATTTTGATGGTGGAAGA 57.546 33.333 3.27 0.00 30.54 2.87
7324 13989 9.458727 AGCATATATATTTTGATGGTGGAAGAG 57.541 33.333 0.00 0.00 0.00 2.85
7325 13990 8.186821 GCATATATATTTTGATGGTGGAAGAGC 58.813 37.037 0.00 0.00 0.00 4.09
7326 13991 9.234827 CATATATATTTTGATGGTGGAAGAGCA 57.765 33.333 0.00 0.00 36.23 4.26
7327 13992 5.841957 ATATTTTGATGGTGGAAGAGCAC 57.158 39.130 0.00 0.00 34.04 4.40
7328 13993 2.957402 TTTGATGGTGGAAGAGCACT 57.043 45.000 0.00 0.00 34.04 4.40
7329 13994 4.365514 TTTTGATGGTGGAAGAGCACTA 57.634 40.909 0.00 0.00 34.04 2.74
7330 13995 3.616956 TTGATGGTGGAAGAGCACTAG 57.383 47.619 0.00 0.00 34.04 2.57
7331 13996 2.820178 TGATGGTGGAAGAGCACTAGA 58.180 47.619 0.00 0.00 34.04 2.43
7332 13997 3.173151 TGATGGTGGAAGAGCACTAGAA 58.827 45.455 0.00 0.00 34.04 2.10
7333 13998 3.196469 TGATGGTGGAAGAGCACTAGAAG 59.804 47.826 0.00 0.00 34.04 2.85
7334 13999 2.609747 TGGTGGAAGAGCACTAGAAGT 58.390 47.619 0.00 0.00 0.00 3.01
7335 14000 2.563179 TGGTGGAAGAGCACTAGAAGTC 59.437 50.000 0.00 0.00 0.00 3.01
7336 14001 2.093921 GGTGGAAGAGCACTAGAAGTCC 60.094 54.545 0.00 0.00 0.00 3.85
7337 14002 2.829120 GTGGAAGAGCACTAGAAGTCCT 59.171 50.000 0.00 0.00 0.00 3.85
7338 14003 2.828520 TGGAAGAGCACTAGAAGTCCTG 59.171 50.000 0.00 0.00 0.00 3.86
7339 14004 3.093057 GGAAGAGCACTAGAAGTCCTGA 58.907 50.000 0.00 0.00 0.00 3.86
7340 14005 3.119280 GGAAGAGCACTAGAAGTCCTGAC 60.119 52.174 0.00 0.00 0.00 3.51
7341 14006 3.449746 AGAGCACTAGAAGTCCTGACT 57.550 47.619 0.00 0.00 44.94 3.41
7342 14007 3.088532 AGAGCACTAGAAGTCCTGACTG 58.911 50.000 0.00 0.00 41.58 3.51
7343 14008 3.085533 GAGCACTAGAAGTCCTGACTGA 58.914 50.000 0.00 0.00 41.58 3.41
7344 14009 2.823154 AGCACTAGAAGTCCTGACTGAC 59.177 50.000 0.00 0.00 41.58 3.51
7345 14010 2.094442 GCACTAGAAGTCCTGACTGACC 60.094 54.545 0.00 0.00 41.58 4.02
7346 14011 2.494073 CACTAGAAGTCCTGACTGACCC 59.506 54.545 0.00 0.00 41.58 4.46
7347 14012 2.110188 ACTAGAAGTCCTGACTGACCCA 59.890 50.000 0.00 0.00 41.58 4.51
7348 14013 2.334006 AGAAGTCCTGACTGACCCAT 57.666 50.000 0.00 0.00 41.58 4.00
7349 14014 3.474798 AGAAGTCCTGACTGACCCATA 57.525 47.619 0.00 0.00 41.58 2.74
7350 14015 3.791320 AGAAGTCCTGACTGACCCATAA 58.209 45.455 0.00 0.00 41.58 1.90
7351 14016 3.772025 AGAAGTCCTGACTGACCCATAAG 59.228 47.826 0.00 0.00 41.58 1.73
7352 14017 2.472029 AGTCCTGACTGACCCATAAGG 58.528 52.381 0.00 0.00 40.75 2.69
7353 14018 2.225650 AGTCCTGACTGACCCATAAGGT 60.226 50.000 0.00 0.00 43.04 3.50
7354 14019 3.762128 AGTCCTGACTGACCCATAAGGTT 60.762 47.826 0.00 0.00 43.44 3.50
7355 14020 4.512207 AGTCCTGACTGACCCATAAGGTTA 60.512 45.833 0.00 0.00 43.44 2.85
7356 14021 5.818097 AGTCCTGACTGACCCATAAGGTTAT 60.818 44.000 0.00 0.00 43.44 1.89
7357 14022 7.270629 AGTCCTGACTGACCCATAAGGTTATT 61.271 42.308 0.00 0.00 43.44 1.40
7358 14023 8.029475 AGTCCTGACTGACCCATAAGGTTATTA 61.029 40.741 0.00 0.00 43.44 0.98
7400 14065 4.527509 TTTTTGGCTATTGCGAAATCCA 57.472 36.364 9.77 0.00 44.13 3.41
7401 14066 3.502191 TTTGGCTATTGCGAAATCCAC 57.498 42.857 5.31 0.00 40.90 4.02
7402 14067 2.121291 TGGCTATTGCGAAATCCACA 57.879 45.000 0.00 0.00 40.82 4.17
7403 14068 2.653726 TGGCTATTGCGAAATCCACAT 58.346 42.857 0.00 0.00 40.82 3.21
7404 14069 2.358582 TGGCTATTGCGAAATCCACATG 59.641 45.455 0.00 0.00 40.82 3.21
7405 14070 2.618241 GGCTATTGCGAAATCCACATGA 59.382 45.455 0.00 0.00 40.82 3.07
7406 14071 3.548818 GGCTATTGCGAAATCCACATGAC 60.549 47.826 0.00 0.00 40.82 3.06
7407 14072 3.548818 GCTATTGCGAAATCCACATGACC 60.549 47.826 0.00 0.00 0.00 4.02
7408 14073 2.198827 TTGCGAAATCCACATGACCT 57.801 45.000 0.00 0.00 0.00 3.85
7409 14074 1.452110 TGCGAAATCCACATGACCTG 58.548 50.000 0.00 0.00 0.00 4.00
7410 14075 0.099436 GCGAAATCCACATGACCTGC 59.901 55.000 0.00 0.00 0.00 4.85
7411 14076 1.742761 CGAAATCCACATGACCTGCT 58.257 50.000 0.00 0.00 0.00 4.24
7412 14077 2.905075 CGAAATCCACATGACCTGCTA 58.095 47.619 0.00 0.00 0.00 3.49
7413 14078 3.470709 CGAAATCCACATGACCTGCTAT 58.529 45.455 0.00 0.00 0.00 2.97
7414 14079 3.879295 CGAAATCCACATGACCTGCTATT 59.121 43.478 0.00 0.00 0.00 1.73
7415 14080 4.024556 CGAAATCCACATGACCTGCTATTC 60.025 45.833 0.00 0.00 0.00 1.75
7416 14081 3.498774 ATCCACATGACCTGCTATTCC 57.501 47.619 0.00 0.00 0.00 3.01
7417 14082 2.195727 TCCACATGACCTGCTATTCCA 58.804 47.619 0.00 0.00 0.00 3.53
7418 14083 2.779430 TCCACATGACCTGCTATTCCAT 59.221 45.455 0.00 0.00 0.00 3.41
7419 14084 2.882761 CCACATGACCTGCTATTCCATG 59.117 50.000 0.00 0.00 40.12 3.66
7420 14085 2.292569 CACATGACCTGCTATTCCATGC 59.707 50.000 0.00 0.00 38.43 4.06
7421 14086 2.174210 ACATGACCTGCTATTCCATGCT 59.826 45.455 0.00 0.00 38.43 3.79
7422 14087 2.627515 TGACCTGCTATTCCATGCTC 57.372 50.000 0.00 0.00 0.00 4.26
7423 14088 1.141657 TGACCTGCTATTCCATGCTCC 59.858 52.381 0.00 0.00 0.00 4.70
7424 14089 1.141657 GACCTGCTATTCCATGCTCCA 59.858 52.381 0.00 0.00 0.00 3.86
7425 14090 1.565759 ACCTGCTATTCCATGCTCCAA 59.434 47.619 0.00 0.00 0.00 3.53
7426 14091 2.176364 ACCTGCTATTCCATGCTCCAAT 59.824 45.455 0.00 0.00 0.00 3.16
7427 14092 2.557056 CCTGCTATTCCATGCTCCAATG 59.443 50.000 0.00 0.00 0.00 2.82
7428 14093 3.220110 CTGCTATTCCATGCTCCAATGT 58.780 45.455 0.00 0.00 0.00 2.71
7429 14094 3.634504 TGCTATTCCATGCTCCAATGTT 58.365 40.909 0.00 0.00 0.00 2.71
7430 14095 4.025360 TGCTATTCCATGCTCCAATGTTT 58.975 39.130 0.00 0.00 0.00 2.83
7431 14096 4.467082 TGCTATTCCATGCTCCAATGTTTT 59.533 37.500 0.00 0.00 0.00 2.43
7432 14097 5.045872 GCTATTCCATGCTCCAATGTTTTC 58.954 41.667 0.00 0.00 0.00 2.29
7433 14098 5.394443 GCTATTCCATGCTCCAATGTTTTCA 60.394 40.000 0.00 0.00 0.00 2.69
7434 14099 5.687166 ATTCCATGCTCCAATGTTTTCAT 57.313 34.783 0.00 0.00 43.05 2.57
7436 14101 5.486735 TCCATGCTCCAATGTTTTCATTT 57.513 34.783 0.00 0.00 46.94 2.32
7437 14102 6.602410 TCCATGCTCCAATGTTTTCATTTA 57.398 33.333 0.00 0.00 46.94 1.40
7438 14103 7.185318 TCCATGCTCCAATGTTTTCATTTAT 57.815 32.000 0.00 0.00 46.94 1.40
7439 14104 7.042950 TCCATGCTCCAATGTTTTCATTTATG 58.957 34.615 0.00 0.00 46.94 1.90
7440 14105 6.819649 CCATGCTCCAATGTTTTCATTTATGT 59.180 34.615 0.00 0.00 46.94 2.29
7441 14106 7.980662 CCATGCTCCAATGTTTTCATTTATGTA 59.019 33.333 0.00 0.00 46.94 2.29
7442 14107 9.368674 CATGCTCCAATGTTTTCATTTATGTAA 57.631 29.630 0.00 0.00 46.94 2.41
7444 14109 9.941325 TGCTCCAATGTTTTCATTTATGTAATT 57.059 25.926 0.00 0.00 46.94 1.40
7462 14127 6.539324 TGTAATTTGTCTATTGCGTTACTGC 58.461 36.000 0.00 0.00 0.00 4.40
7463 14128 5.880054 AATTTGTCTATTGCGTTACTGCT 57.120 34.783 1.68 0.00 35.36 4.24
7464 14129 5.880054 ATTTGTCTATTGCGTTACTGCTT 57.120 34.783 1.68 0.00 35.36 3.91
7465 14130 4.661993 TTGTCTATTGCGTTACTGCTTG 57.338 40.909 1.68 0.00 35.36 4.01
7466 14131 3.659786 TGTCTATTGCGTTACTGCTTGT 58.340 40.909 1.68 0.00 35.36 3.16
7467 14132 4.811908 TGTCTATTGCGTTACTGCTTGTA 58.188 39.130 1.68 0.00 35.36 2.41
7468 14133 4.624024 TGTCTATTGCGTTACTGCTTGTAC 59.376 41.667 0.00 0.00 35.36 2.90
7469 14134 4.863131 GTCTATTGCGTTACTGCTTGTACT 59.137 41.667 0.00 0.00 35.36 2.73
7470 14135 5.004535 GTCTATTGCGTTACTGCTTGTACTC 59.995 44.000 0.00 0.00 35.36 2.59
7471 14136 3.380479 TTGCGTTACTGCTTGTACTCT 57.620 42.857 0.00 0.00 35.36 3.24
7472 14137 2.942710 TGCGTTACTGCTTGTACTCTC 58.057 47.619 0.00 0.00 35.36 3.20
7473 14138 2.557056 TGCGTTACTGCTTGTACTCTCT 59.443 45.455 0.00 0.00 35.36 3.10
7474 14139 3.754850 TGCGTTACTGCTTGTACTCTCTA 59.245 43.478 0.00 0.00 35.36 2.43
7475 14140 4.398358 TGCGTTACTGCTTGTACTCTCTAT 59.602 41.667 0.00 0.00 35.36 1.98
7476 14141 5.587443 TGCGTTACTGCTTGTACTCTCTATA 59.413 40.000 0.00 0.00 35.36 1.31
7477 14142 5.908499 GCGTTACTGCTTGTACTCTCTATAC 59.092 44.000 0.00 0.00 0.00 1.47
7478 14143 6.428799 CGTTACTGCTTGTACTCTCTATACC 58.571 44.000 0.00 0.00 0.00 2.73
7479 14144 6.260493 CGTTACTGCTTGTACTCTCTATACCT 59.740 42.308 0.00 0.00 0.00 3.08
7480 14145 7.419204 GTTACTGCTTGTACTCTCTATACCTG 58.581 42.308 0.00 0.00 0.00 4.00
7481 14146 4.339814 ACTGCTTGTACTCTCTATACCTGC 59.660 45.833 0.00 0.00 0.00 4.85
7482 14147 4.537751 TGCTTGTACTCTCTATACCTGCT 58.462 43.478 0.00 0.00 0.00 4.24
7483 14148 5.691896 TGCTTGTACTCTCTATACCTGCTA 58.308 41.667 0.00 0.00 0.00 3.49
7484 14149 6.127101 TGCTTGTACTCTCTATACCTGCTAA 58.873 40.000 0.00 0.00 0.00 3.09
7485 14150 6.778069 TGCTTGTACTCTCTATACCTGCTAAT 59.222 38.462 0.00 0.00 0.00 1.73
7486 14151 7.087639 GCTTGTACTCTCTATACCTGCTAATG 58.912 42.308 0.00 0.00 0.00 1.90
7487 14152 7.255660 GCTTGTACTCTCTATACCTGCTAATGT 60.256 40.741 0.00 0.00 0.00 2.71
7488 14153 7.511959 TGTACTCTCTATACCTGCTAATGTG 57.488 40.000 0.00 0.00 0.00 3.21
7489 14154 6.490381 TGTACTCTCTATACCTGCTAATGTGG 59.510 42.308 0.00 0.00 0.00 4.17
7490 14155 4.282195 ACTCTCTATACCTGCTAATGTGGC 59.718 45.833 0.00 0.00 0.00 5.01
7491 14156 4.483950 TCTCTATACCTGCTAATGTGGCT 58.516 43.478 0.00 0.00 0.00 4.75
7492 14157 5.641155 TCTCTATACCTGCTAATGTGGCTA 58.359 41.667 0.00 0.00 0.00 3.93
7493 14158 5.477291 TCTCTATACCTGCTAATGTGGCTAC 59.523 44.000 0.00 0.00 0.00 3.58
7494 14159 5.394738 TCTATACCTGCTAATGTGGCTACT 58.605 41.667 0.64 0.00 0.00 2.57
7495 14160 2.698855 ACCTGCTAATGTGGCTACTG 57.301 50.000 0.64 0.00 0.00 2.74
7496 14161 1.909302 ACCTGCTAATGTGGCTACTGT 59.091 47.619 0.64 0.00 0.00 3.55
7497 14162 2.093447 ACCTGCTAATGTGGCTACTGTC 60.093 50.000 0.64 0.00 0.00 3.51
7498 14163 2.169352 CCTGCTAATGTGGCTACTGTCT 59.831 50.000 0.64 0.00 0.00 3.41
7499 14164 3.369892 CCTGCTAATGTGGCTACTGTCTT 60.370 47.826 0.64 0.00 0.00 3.01
7500 14165 3.861840 TGCTAATGTGGCTACTGTCTTC 58.138 45.455 0.64 0.00 0.00 2.87
7501 14166 3.198872 GCTAATGTGGCTACTGTCTTCC 58.801 50.000 0.64 0.00 0.00 3.46
7502 14167 3.369471 GCTAATGTGGCTACTGTCTTCCA 60.369 47.826 0.64 0.00 0.00 3.53
7513 14178 3.591196 CTGTCTTCCAGTTCCAGAGAG 57.409 52.381 0.00 0.00 36.37 3.20
7514 14179 2.233431 CTGTCTTCCAGTTCCAGAGAGG 59.767 54.545 0.00 0.00 36.37 3.69
7515 14180 4.069145 CTGTCTTCCAGTTCCAGAGAGGA 61.069 52.174 0.00 0.00 39.25 3.71
7516 14181 5.539204 CTGTCTTCCAGTTCCAGAGAGGAA 61.539 50.000 0.00 0.00 46.61 3.36
7522 14187 4.191243 TCCAGAGAGGAACGCACA 57.809 55.556 0.00 0.00 45.65 4.57
7523 14188 2.671145 TCCAGAGAGGAACGCACAT 58.329 52.632 0.00 0.00 45.65 3.21
7524 14189 0.532573 TCCAGAGAGGAACGCACATC 59.467 55.000 0.00 0.00 45.65 3.06
7525 14190 0.534412 CCAGAGAGGAACGCACATCT 59.466 55.000 0.00 0.00 41.22 2.90
7526 14191 1.066573 CCAGAGAGGAACGCACATCTT 60.067 52.381 0.00 0.00 41.22 2.40
7527 14192 2.266554 CAGAGAGGAACGCACATCTTC 58.733 52.381 0.00 0.00 31.03 2.87
7528 14193 1.895798 AGAGAGGAACGCACATCTTCA 59.104 47.619 0.00 0.00 31.03 3.02
7529 14194 2.094286 AGAGAGGAACGCACATCTTCAG 60.094 50.000 0.00 0.00 31.03 3.02
7530 14195 0.723981 GAGGAACGCACATCTTCAGC 59.276 55.000 0.00 0.00 0.00 4.26
7531 14196 0.674895 AGGAACGCACATCTTCAGCC 60.675 55.000 0.00 0.00 0.00 4.85
7532 14197 0.674895 GGAACGCACATCTTCAGCCT 60.675 55.000 0.00 0.00 0.00 4.58
7533 14198 0.445436 GAACGCACATCTTCAGCCTG 59.555 55.000 0.00 0.00 0.00 4.85
7534 14199 1.580845 AACGCACATCTTCAGCCTGC 61.581 55.000 0.00 0.00 0.00 4.85
7535 14200 2.758089 CGCACATCTTCAGCCTGCC 61.758 63.158 0.00 0.00 0.00 4.85
7536 14201 1.378250 GCACATCTTCAGCCTGCCT 60.378 57.895 0.00 0.00 0.00 4.75
7537 14202 1.654954 GCACATCTTCAGCCTGCCTG 61.655 60.000 0.00 0.00 43.17 4.85
7538 14203 0.322277 CACATCTTCAGCCTGCCTGT 60.322 55.000 0.00 0.00 42.38 4.00
7539 14204 0.322277 ACATCTTCAGCCTGCCTGTG 60.322 55.000 0.00 0.00 42.38 3.66
7540 14205 1.378250 ATCTTCAGCCTGCCTGTGC 60.378 57.895 0.00 0.00 42.38 4.57
7541 14206 1.849975 ATCTTCAGCCTGCCTGTGCT 61.850 55.000 0.00 0.00 42.38 4.40
7547 14212 3.362797 CCTGCCTGTGCTGTGCTG 61.363 66.667 0.00 0.00 38.71 4.41
7548 14213 2.593725 CTGCCTGTGCTGTGCTGT 60.594 61.111 0.00 0.00 38.71 4.40
7549 14214 2.903350 TGCCTGTGCTGTGCTGTG 60.903 61.111 0.00 0.00 38.71 3.66
7550 14215 4.338539 GCCTGTGCTGTGCTGTGC 62.339 66.667 0.00 0.00 33.53 4.57
7551 14216 2.593725 CCTGTGCTGTGCTGTGCT 60.594 61.111 0.00 0.00 0.00 4.40
7552 14217 2.637589 CTGTGCTGTGCTGTGCTG 59.362 61.111 0.00 0.00 0.00 4.41
7553 14218 3.538028 CTGTGCTGTGCTGTGCTGC 62.538 63.158 0.00 0.00 0.00 5.25
7554 14219 4.338539 GTGCTGTGCTGTGCTGCC 62.339 66.667 0.00 0.00 0.00 4.85
7555 14220 4.574271 TGCTGTGCTGTGCTGCCT 62.574 61.111 0.00 0.00 0.00 4.75
7556 14221 3.735029 GCTGTGCTGTGCTGCCTC 61.735 66.667 0.00 0.00 0.00 4.70
7557 14222 3.420606 CTGTGCTGTGCTGCCTCG 61.421 66.667 0.00 0.00 0.00 4.63
7558 14223 4.994471 TGTGCTGTGCTGCCTCGG 62.994 66.667 0.00 0.00 0.00 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1 2 3.292460 TGAAAATCAAACCCTTGGTCGT 58.708 40.909 0.00 0.00 33.12 4.34
3 4 3.006859 CCCTGAAAATCAAACCCTTGGTC 59.993 47.826 0.00 0.00 33.12 4.02
4 5 2.972021 CCCTGAAAATCAAACCCTTGGT 59.028 45.455 0.00 0.00 37.65 3.67
5 6 2.972021 ACCCTGAAAATCAAACCCTTGG 59.028 45.455 0.00 0.00 33.01 3.61
6 7 3.640967 TCACCCTGAAAATCAAACCCTTG 59.359 43.478 0.00 0.00 0.00 3.61
7 8 3.897505 CTCACCCTGAAAATCAAACCCTT 59.102 43.478 0.00 0.00 0.00 3.95
8 9 3.140144 TCTCACCCTGAAAATCAAACCCT 59.860 43.478 0.00 0.00 0.00 4.34
9 10 3.496331 TCTCACCCTGAAAATCAAACCC 58.504 45.455 0.00 0.00 0.00 4.11
12 13 6.323482 TCAACATTCTCACCCTGAAAATCAAA 59.677 34.615 0.00 0.00 0.00 2.69
14 15 5.384336 TCAACATTCTCACCCTGAAAATCA 58.616 37.500 0.00 0.00 0.00 2.57
15 16 5.620879 GCTCAACATTCTCACCCTGAAAATC 60.621 44.000 0.00 0.00 0.00 2.17
17 18 3.569701 GCTCAACATTCTCACCCTGAAAA 59.430 43.478 0.00 0.00 0.00 2.29
19 20 2.553028 GGCTCAACATTCTCACCCTGAA 60.553 50.000 0.00 0.00 0.00 3.02
20 21 1.003580 GGCTCAACATTCTCACCCTGA 59.996 52.381 0.00 0.00 0.00 3.86
22 23 1.004044 CAGGCTCAACATTCTCACCCT 59.996 52.381 0.00 0.00 0.00 4.34
23 24 1.003580 TCAGGCTCAACATTCTCACCC 59.996 52.381 0.00 0.00 0.00 4.61
24 25 2.354259 CTCAGGCTCAACATTCTCACC 58.646 52.381 0.00 0.00 0.00 4.02
25 26 1.736681 GCTCAGGCTCAACATTCTCAC 59.263 52.381 0.00 0.00 35.22 3.51
26 27 1.348696 TGCTCAGGCTCAACATTCTCA 59.651 47.619 0.00 0.00 39.59 3.27
27 28 1.736681 GTGCTCAGGCTCAACATTCTC 59.263 52.381 0.00 0.00 39.59 2.87
28 29 1.612726 GGTGCTCAGGCTCAACATTCT 60.613 52.381 0.00 0.00 39.59 2.40
29 30 0.807496 GGTGCTCAGGCTCAACATTC 59.193 55.000 0.00 0.00 39.59 2.67
30 31 0.610232 GGGTGCTCAGGCTCAACATT 60.610 55.000 0.00 0.00 39.59 2.71
31 32 1.001641 GGGTGCTCAGGCTCAACAT 60.002 57.895 0.00 0.00 39.59 2.71
32 33 2.431683 GGGTGCTCAGGCTCAACA 59.568 61.111 0.00 0.00 39.59 3.33
33 34 1.968540 GTGGGTGCTCAGGCTCAAC 60.969 63.158 0.00 0.00 39.59 3.18
34 35 2.431683 GTGGGTGCTCAGGCTCAA 59.568 61.111 0.00 0.00 39.59 3.02
35 36 3.640407 GGTGGGTGCTCAGGCTCA 61.640 66.667 0.00 0.00 39.59 4.26
36 37 3.322318 GAGGTGGGTGCTCAGGCTC 62.322 68.421 0.00 0.00 39.59 4.70
37 38 3.325753 GAGGTGGGTGCTCAGGCT 61.326 66.667 0.00 0.00 39.59 4.58
38 39 4.416738 GGAGGTGGGTGCTCAGGC 62.417 72.222 0.00 0.00 39.26 4.85
39 40 2.608988 AGGAGGTGGGTGCTCAGG 60.609 66.667 0.00 0.00 0.00 3.86
40 41 2.667418 CAGGAGGTGGGTGCTCAG 59.333 66.667 0.00 0.00 0.00 3.35
41 42 3.640407 GCAGGAGGTGGGTGCTCA 61.640 66.667 0.00 0.00 34.23 4.26
42 43 3.196207 TTGCAGGAGGTGGGTGCTC 62.196 63.158 0.00 0.00 38.09 4.26
43 44 3.177884 TTGCAGGAGGTGGGTGCT 61.178 61.111 0.00 0.00 38.09 4.40
44 45 2.985847 GTTGCAGGAGGTGGGTGC 60.986 66.667 0.00 0.00 37.73 5.01
45 46 2.282462 GGTTGCAGGAGGTGGGTG 60.282 66.667 0.00 0.00 0.00 4.61
46 47 1.655114 AAAGGTTGCAGGAGGTGGGT 61.655 55.000 0.00 0.00 0.00 4.51
47 48 1.153756 AAAGGTTGCAGGAGGTGGG 59.846 57.895 0.00 0.00 0.00 4.61
48 49 0.178992 TCAAAGGTTGCAGGAGGTGG 60.179 55.000 0.00 0.00 0.00 4.61
49 50 1.691196 TTCAAAGGTTGCAGGAGGTG 58.309 50.000 0.00 0.00 0.00 4.00
50 51 2.683211 ATTCAAAGGTTGCAGGAGGT 57.317 45.000 0.00 0.00 0.00 3.85
51 52 3.690460 ACTATTCAAAGGTTGCAGGAGG 58.310 45.455 0.00 0.00 0.00 4.30
52 53 5.010012 ACAAACTATTCAAAGGTTGCAGGAG 59.990 40.000 1.67 0.00 46.16 3.69
53 54 4.892934 ACAAACTATTCAAAGGTTGCAGGA 59.107 37.500 1.67 0.00 46.16 3.86
54 55 5.200368 ACAAACTATTCAAAGGTTGCAGG 57.800 39.130 1.67 0.00 46.16 4.85
55 56 5.221224 TGGACAAACTATTCAAAGGTTGCAG 60.221 40.000 1.67 0.00 46.16 4.41
56 57 4.646945 TGGACAAACTATTCAAAGGTTGCA 59.353 37.500 1.67 0.00 46.16 4.08
57 58 5.195001 TGGACAAACTATTCAAAGGTTGC 57.805 39.130 1.67 0.00 46.16 4.17
64 65 9.619316 CACGATAAAATTGGACAAACTATTCAA 57.381 29.630 0.00 0.00 0.00 2.69
65 66 9.004717 TCACGATAAAATTGGACAAACTATTCA 57.995 29.630 0.00 0.00 0.00 2.57
66 67 9.490663 CTCACGATAAAATTGGACAAACTATTC 57.509 33.333 0.00 0.00 0.00 1.75
67 68 9.010029 ACTCACGATAAAATTGGACAAACTATT 57.990 29.630 0.00 0.00 0.00 1.73
68 69 8.561738 ACTCACGATAAAATTGGACAAACTAT 57.438 30.769 0.00 0.00 0.00 2.12
69 70 7.972832 ACTCACGATAAAATTGGACAAACTA 57.027 32.000 0.00 0.00 0.00 2.24
70 71 6.877611 ACTCACGATAAAATTGGACAAACT 57.122 33.333 0.00 0.00 0.00 2.66
71 72 6.129194 GCAACTCACGATAAAATTGGACAAAC 60.129 38.462 0.00 0.00 0.00 2.93
72 73 5.918011 GCAACTCACGATAAAATTGGACAAA 59.082 36.000 0.00 0.00 0.00 2.83
73 74 5.457140 GCAACTCACGATAAAATTGGACAA 58.543 37.500 0.00 0.00 0.00 3.18
74 75 4.377943 CGCAACTCACGATAAAATTGGACA 60.378 41.667 0.00 0.00 0.00 4.02
75 76 4.088648 CGCAACTCACGATAAAATTGGAC 58.911 43.478 0.00 0.00 0.00 4.02
76 77 3.749088 ACGCAACTCACGATAAAATTGGA 59.251 39.130 0.00 0.00 0.00 3.53
77 78 3.845775 CACGCAACTCACGATAAAATTGG 59.154 43.478 0.00 0.00 0.00 3.16
78 79 4.707563 TCACGCAACTCACGATAAAATTG 58.292 39.130 0.00 0.00 0.00 2.32
79 80 5.545658 ATCACGCAACTCACGATAAAATT 57.454 34.783 0.00 0.00 0.00 1.82
80 81 4.259810 CGATCACGCAACTCACGATAAAAT 60.260 41.667 0.00 0.00 0.00 1.82
81 82 3.060230 CGATCACGCAACTCACGATAAAA 59.940 43.478 0.00 0.00 0.00 1.52
82 83 2.596862 CGATCACGCAACTCACGATAAA 59.403 45.455 0.00 0.00 0.00 1.40
83 84 2.159490 TCGATCACGCAACTCACGATAA 60.159 45.455 0.00 0.00 39.58 1.75
84 85 1.399089 TCGATCACGCAACTCACGATA 59.601 47.619 0.00 0.00 39.58 2.92
85 86 0.170339 TCGATCACGCAACTCACGAT 59.830 50.000 0.00 0.00 39.58 3.73
86 87 0.039888 TTCGATCACGCAACTCACGA 60.040 50.000 0.00 0.00 39.58 4.35
87 88 0.781787 TTTCGATCACGCAACTCACG 59.218 50.000 0.00 0.00 39.58 4.35
88 89 1.525197 TGTTTCGATCACGCAACTCAC 59.475 47.619 0.00 0.00 43.54 3.51
89 90 1.525197 GTGTTTCGATCACGCAACTCA 59.475 47.619 0.00 0.00 43.54 3.41
90 91 1.792949 AGTGTTTCGATCACGCAACTC 59.207 47.619 13.08 0.00 43.54 3.01
91 92 1.792949 GAGTGTTTCGATCACGCAACT 59.207 47.619 15.71 4.14 43.54 3.16
92 93 1.525197 TGAGTGTTTCGATCACGCAAC 59.475 47.619 19.07 6.80 43.48 4.17
93 94 1.859383 TGAGTGTTTCGATCACGCAA 58.141 45.000 19.07 8.24 41.10 4.85
94 95 2.078849 ATGAGTGTTTCGATCACGCA 57.921 45.000 21.81 21.81 45.85 5.24
95 96 2.035674 CGTATGAGTGTTTCGATCACGC 60.036 50.000 14.44 14.44 40.28 5.34
96 97 2.035674 GCGTATGAGTGTTTCGATCACG 60.036 50.000 13.08 4.33 40.28 4.35
97 98 2.921121 TGCGTATGAGTGTTTCGATCAC 59.079 45.455 11.63 11.63 36.22 3.06
98 99 3.179048 CTGCGTATGAGTGTTTCGATCA 58.821 45.455 0.00 0.00 0.00 2.92
99 100 2.034507 GCTGCGTATGAGTGTTTCGATC 60.035 50.000 0.00 0.00 0.00 3.69
100 101 1.927174 GCTGCGTATGAGTGTTTCGAT 59.073 47.619 0.00 0.00 0.00 3.59
101 102 1.067846 AGCTGCGTATGAGTGTTTCGA 60.068 47.619 0.00 0.00 0.00 3.71
102 103 1.059692 CAGCTGCGTATGAGTGTTTCG 59.940 52.381 0.00 0.00 0.00 3.46
103 104 1.201965 GCAGCTGCGTATGAGTGTTTC 60.202 52.381 25.23 0.00 0.00 2.78
104 105 0.798776 GCAGCTGCGTATGAGTGTTT 59.201 50.000 25.23 0.00 0.00 2.83
105 106 0.320683 TGCAGCTGCGTATGAGTGTT 60.321 50.000 32.11 0.00 45.83 3.32
106 107 0.320683 TTGCAGCTGCGTATGAGTGT 60.321 50.000 32.11 0.00 45.83 3.55
107 108 0.372679 CTTGCAGCTGCGTATGAGTG 59.627 55.000 32.11 12.38 45.83 3.51
108 109 0.247460 TCTTGCAGCTGCGTATGAGT 59.753 50.000 32.11 0.00 45.83 3.41
109 110 1.260825 CATCTTGCAGCTGCGTATGAG 59.739 52.381 32.11 22.47 45.83 2.90
110 111 1.134729 TCATCTTGCAGCTGCGTATGA 60.135 47.619 30.80 30.80 45.83 2.15
111 112 1.292992 TCATCTTGCAGCTGCGTATG 58.707 50.000 32.11 29.87 45.83 2.39
112 113 2.251409 ATCATCTTGCAGCTGCGTAT 57.749 45.000 32.11 21.79 45.83 3.06
113 114 2.028420 AATCATCTTGCAGCTGCGTA 57.972 45.000 32.11 21.69 45.83 4.42
114 115 1.135489 CAAATCATCTTGCAGCTGCGT 60.135 47.619 32.11 16.11 45.83 5.24
115 116 1.545759 CAAATCATCTTGCAGCTGCG 58.454 50.000 32.11 19.83 45.83 5.18
116 117 1.203994 ACCAAATCATCTTGCAGCTGC 59.796 47.619 31.89 31.89 42.50 5.25
117 118 3.057104 TCAACCAAATCATCTTGCAGCTG 60.057 43.478 10.11 10.11 0.00 4.24
118 119 3.159472 TCAACCAAATCATCTTGCAGCT 58.841 40.909 0.00 0.00 0.00 4.24
119 120 3.508762 CTCAACCAAATCATCTTGCAGC 58.491 45.455 0.00 0.00 0.00 5.25
120 121 3.057104 TGCTCAACCAAATCATCTTGCAG 60.057 43.478 0.00 0.00 0.00 4.41
121 122 2.892215 TGCTCAACCAAATCATCTTGCA 59.108 40.909 0.00 0.00 0.00 4.08
122 123 3.248266 GTGCTCAACCAAATCATCTTGC 58.752 45.455 0.00 0.00 0.00 4.01
123 124 4.508461 TGTGCTCAACCAAATCATCTTG 57.492 40.909 0.00 0.00 0.00 3.02
124 125 5.475719 CAATGTGCTCAACCAAATCATCTT 58.524 37.500 0.00 0.00 0.00 2.40
125 126 4.081862 CCAATGTGCTCAACCAAATCATCT 60.082 41.667 0.00 0.00 0.00 2.90
126 127 4.178540 CCAATGTGCTCAACCAAATCATC 58.821 43.478 0.00 0.00 0.00 2.92
127 128 3.618019 GCCAATGTGCTCAACCAAATCAT 60.618 43.478 0.00 0.00 0.00 2.45
128 129 2.288948 GCCAATGTGCTCAACCAAATCA 60.289 45.455 0.00 0.00 0.00 2.57
129 130 2.288948 TGCCAATGTGCTCAACCAAATC 60.289 45.455 0.00 0.00 0.00 2.17
130 131 1.693062 TGCCAATGTGCTCAACCAAAT 59.307 42.857 0.00 0.00 0.00 2.32
131 132 1.117994 TGCCAATGTGCTCAACCAAA 58.882 45.000 0.00 0.00 0.00 3.28
132 133 1.117994 TTGCCAATGTGCTCAACCAA 58.882 45.000 0.00 0.00 0.00 3.67
133 134 1.273048 GATTGCCAATGTGCTCAACCA 59.727 47.619 0.00 0.00 0.00 3.67
134 135 1.273048 TGATTGCCAATGTGCTCAACC 59.727 47.619 0.00 0.00 0.00 3.77
135 136 2.029649 ACTGATTGCCAATGTGCTCAAC 60.030 45.455 0.00 0.00 0.00 3.18
136 137 2.241160 ACTGATTGCCAATGTGCTCAA 58.759 42.857 0.00 0.00 0.00 3.02
137 138 1.913778 ACTGATTGCCAATGTGCTCA 58.086 45.000 0.00 0.00 0.00 4.26
138 139 3.273434 TCTACTGATTGCCAATGTGCTC 58.727 45.455 0.00 0.00 0.00 4.26
139 140 3.354948 TCTACTGATTGCCAATGTGCT 57.645 42.857 0.00 0.00 0.00 4.40
140 141 3.881688 AGATCTACTGATTGCCAATGTGC 59.118 43.478 0.00 0.00 32.19 4.57
141 142 6.932960 TGATAGATCTACTGATTGCCAATGTG 59.067 38.462 4.10 0.00 32.19 3.21
142 143 7.071069 TGATAGATCTACTGATTGCCAATGT 57.929 36.000 4.10 0.00 32.19 2.71
143 144 7.160049 ACTGATAGATCTACTGATTGCCAATG 58.840 38.462 4.10 0.00 32.19 2.82
144 145 7.313740 ACTGATAGATCTACTGATTGCCAAT 57.686 36.000 4.10 0.00 32.19 3.16
145 146 6.737720 ACTGATAGATCTACTGATTGCCAA 57.262 37.500 4.10 0.00 32.19 4.52
146 147 6.737720 AACTGATAGATCTACTGATTGCCA 57.262 37.500 4.10 0.00 32.19 4.92
147 148 9.717942 ATTAAACTGATAGATCTACTGATTGCC 57.282 33.333 4.10 0.00 32.19 4.52
161 162 9.334693 GCACACAAAAAGAGATTAAACTGATAG 57.665 33.333 0.00 0.00 0.00 2.08
162 163 8.845227 TGCACACAAAAAGAGATTAAACTGATA 58.155 29.630 0.00 0.00 0.00 2.15
163 164 7.649306 GTGCACACAAAAAGAGATTAAACTGAT 59.351 33.333 13.17 0.00 0.00 2.90
164 165 6.972328 GTGCACACAAAAAGAGATTAAACTGA 59.028 34.615 13.17 0.00 0.00 3.41
165 166 6.751425 TGTGCACACAAAAAGAGATTAAACTG 59.249 34.615 17.42 0.00 38.56 3.16
166 167 6.862209 TGTGCACACAAAAAGAGATTAAACT 58.138 32.000 17.42 0.00 38.56 2.66
181 182 2.106477 TCACTCAGTTTGTGCACACA 57.894 45.000 21.56 11.11 39.98 3.72
182 183 3.698029 AATCACTCAGTTTGTGCACAC 57.302 42.857 21.56 9.45 35.58 3.82
183 184 3.443329 ACAAATCACTCAGTTTGTGCACA 59.557 39.130 17.42 17.42 44.36 4.57
184 185 4.032703 ACAAATCACTCAGTTTGTGCAC 57.967 40.909 10.75 10.75 44.36 4.57
185 186 5.588246 TCTTACAAATCACTCAGTTTGTGCA 59.412 36.000 12.27 0.00 45.28 4.57
186 187 5.909610 GTCTTACAAATCACTCAGTTTGTGC 59.090 40.000 12.27 0.00 45.28 4.57
187 188 7.251704 AGTCTTACAAATCACTCAGTTTGTG 57.748 36.000 12.27 0.00 45.28 3.33
188 189 9.561069 AATAGTCTTACAAATCACTCAGTTTGT 57.439 29.630 8.32 8.32 46.74 2.83
191 192 9.778741 TCAAATAGTCTTACAAATCACTCAGTT 57.221 29.630 0.00 0.00 0.00 3.16
192 193 9.950496 ATCAAATAGTCTTACAAATCACTCAGT 57.050 29.630 0.00 0.00 0.00 3.41
235 236 9.878667 TCGAAATAGTCTTGTATTACAATCCAA 57.121 29.630 9.59 0.00 37.48 3.53
236 237 9.878667 TTCGAAATAGTCTTGTATTACAATCCA 57.121 29.630 9.59 0.00 37.48 3.41
286 287 9.891828 CAAGTACAACAAAATGAAGCATAGTAA 57.108 29.630 0.00 0.00 0.00 2.24
287 288 8.511321 CCAAGTACAACAAAATGAAGCATAGTA 58.489 33.333 0.00 0.00 0.00 1.82
288 289 7.014230 ACCAAGTACAACAAAATGAAGCATAGT 59.986 33.333 0.00 0.00 0.00 2.12
289 290 7.370383 ACCAAGTACAACAAAATGAAGCATAG 58.630 34.615 0.00 0.00 0.00 2.23
290 291 7.230510 AGACCAAGTACAACAAAATGAAGCATA 59.769 33.333 0.00 0.00 0.00 3.14
291 292 6.040842 AGACCAAGTACAACAAAATGAAGCAT 59.959 34.615 0.00 0.00 0.00 3.79
292 293 5.359576 AGACCAAGTACAACAAAATGAAGCA 59.640 36.000 0.00 0.00 0.00 3.91
293 294 5.831997 AGACCAAGTACAACAAAATGAAGC 58.168 37.500 0.00 0.00 0.00 3.86
294 295 6.438763 GGAGACCAAGTACAACAAAATGAAG 58.561 40.000 0.00 0.00 0.00 3.02
295 296 5.008217 CGGAGACCAAGTACAACAAAATGAA 59.992 40.000 0.00 0.00 0.00 2.57
296 297 4.513692 CGGAGACCAAGTACAACAAAATGA 59.486 41.667 0.00 0.00 0.00 2.57
297 298 4.320202 CCGGAGACCAAGTACAACAAAATG 60.320 45.833 0.00 0.00 0.00 2.32
298 299 3.818773 CCGGAGACCAAGTACAACAAAAT 59.181 43.478 0.00 0.00 0.00 1.82
299 300 3.207778 CCGGAGACCAAGTACAACAAAA 58.792 45.455 0.00 0.00 0.00 2.44
300 301 2.841215 CCGGAGACCAAGTACAACAAA 58.159 47.619 0.00 0.00 0.00 2.83
301 302 1.541670 GCCGGAGACCAAGTACAACAA 60.542 52.381 5.05 0.00 0.00 2.83
302 303 0.034337 GCCGGAGACCAAGTACAACA 59.966 55.000 5.05 0.00 0.00 3.33
303 304 0.034337 TGCCGGAGACCAAGTACAAC 59.966 55.000 5.05 0.00 0.00 3.32
304 305 0.320374 CTGCCGGAGACCAAGTACAA 59.680 55.000 5.05 0.00 0.00 2.41
305 306 0.541063 TCTGCCGGAGACCAAGTACA 60.541 55.000 5.05 0.00 0.00 2.90
306 307 0.824759 ATCTGCCGGAGACCAAGTAC 59.175 55.000 5.05 0.00 31.75 2.73
307 308 0.824109 CATCTGCCGGAGACCAAGTA 59.176 55.000 5.05 0.00 31.75 2.24
308 309 1.599047 CATCTGCCGGAGACCAAGT 59.401 57.895 5.05 0.00 31.75 3.16
309 310 1.153289 CCATCTGCCGGAGACCAAG 60.153 63.158 5.05 0.00 31.75 3.61
310 311 2.669133 CCCATCTGCCGGAGACCAA 61.669 63.158 5.05 0.00 31.75 3.67
311 312 2.896677 ATCCCATCTGCCGGAGACCA 62.897 60.000 5.05 0.00 31.75 4.02
312 313 2.143419 ATCCCATCTGCCGGAGACC 61.143 63.158 5.05 0.00 31.75 3.85
313 314 1.070445 CATCCCATCTGCCGGAGAC 59.930 63.158 5.05 0.00 31.75 3.36
314 315 2.142761 CCATCCCATCTGCCGGAGA 61.143 63.158 5.05 5.76 34.25 3.71
315 316 2.429058 CCATCCCATCTGCCGGAG 59.571 66.667 5.05 0.00 0.00 4.63
316 317 3.170672 CCCATCCCATCTGCCGGA 61.171 66.667 5.05 0.00 0.00 5.14
317 318 4.275508 CCCCATCCCATCTGCCGG 62.276 72.222 0.00 0.00 0.00 6.13
318 319 4.962836 GCCCCATCCCATCTGCCG 62.963 72.222 0.00 0.00 0.00 5.69
319 320 4.610526 GGCCCCATCCCATCTGCC 62.611 72.222 0.00 0.00 0.00 4.85
320 321 4.962836 CGGCCCCATCCCATCTGC 62.963 72.222 0.00 0.00 0.00 4.26
321 322 2.687418 CTTCGGCCCCATCCCATCTG 62.687 65.000 0.00 0.00 0.00 2.90
322 323 2.368192 TTCGGCCCCATCCCATCT 60.368 61.111 0.00 0.00 0.00 2.90
323 324 1.994885 TTCTTCGGCCCCATCCCATC 61.995 60.000 0.00 0.00 0.00 3.51
324 325 1.999634 CTTCTTCGGCCCCATCCCAT 62.000 60.000 0.00 0.00 0.00 4.00
325 326 2.612430 TTCTTCGGCCCCATCCCA 60.612 61.111 0.00 0.00 0.00 4.37
326 327 2.193248 CTTCTTCGGCCCCATCCC 59.807 66.667 0.00 0.00 0.00 3.85
327 328 2.517166 GCTTCTTCGGCCCCATCC 60.517 66.667 0.00 0.00 0.00 3.51
328 329 2.897350 CGCTTCTTCGGCCCCATC 60.897 66.667 0.00 0.00 0.00 3.51
329 330 4.489771 CCGCTTCTTCGGCCCCAT 62.490 66.667 0.00 0.00 43.18 4.00
361 362 4.944372 GGGTATGCGTCGGCCGAG 62.944 72.222 31.97 22.97 39.56 4.63
363 364 4.823419 TTGGGTATGCGTCGGCCG 62.823 66.667 22.12 22.12 38.85 6.13
364 365 2.041686 TTTTGGGTATGCGTCGGCC 61.042 57.895 0.00 0.00 38.85 6.13
365 366 1.135939 GTTTTGGGTATGCGTCGGC 59.864 57.895 0.00 0.00 40.52 5.54
366 367 1.798087 GGTTTTGGGTATGCGTCGG 59.202 57.895 0.00 0.00 0.00 4.79
367 368 1.422269 CGGTTTTGGGTATGCGTCG 59.578 57.895 0.00 0.00 0.00 5.12
368 369 0.674269 TCCGGTTTTGGGTATGCGTC 60.674 55.000 0.00 0.00 0.00 5.19
369 370 0.956902 GTCCGGTTTTGGGTATGCGT 60.957 55.000 0.00 0.00 0.00 5.24
370 371 1.798087 GTCCGGTTTTGGGTATGCG 59.202 57.895 0.00 0.00 0.00 4.73
371 372 1.650314 CCGTCCGGTTTTGGGTATGC 61.650 60.000 0.00 0.00 0.00 3.14
372 373 0.036199 TCCGTCCGGTTTTGGGTATG 60.036 55.000 0.00 0.00 36.47 2.39
373 374 0.036105 GTCCGTCCGGTTTTGGGTAT 60.036 55.000 0.00 0.00 36.47 2.73
374 375 1.370810 GTCCGTCCGGTTTTGGGTA 59.629 57.895 0.00 0.00 36.47 3.69
375 376 2.111669 GTCCGTCCGGTTTTGGGT 59.888 61.111 0.00 0.00 36.47 4.51
376 377 2.111460 TGTCCGTCCGGTTTTGGG 59.889 61.111 0.00 0.00 36.47 4.12
377 378 2.600475 CGTGTCCGTCCGGTTTTGG 61.600 63.158 0.00 0.00 36.47 3.28
378 379 2.600475 CCGTGTCCGTCCGGTTTTG 61.600 63.158 0.00 0.00 39.38 2.44
379 380 2.280321 CCGTGTCCGTCCGGTTTT 60.280 61.111 0.00 0.00 39.38 2.43
384 385 2.209064 AATGAGACCGTGTCCGTCCG 62.209 60.000 0.00 0.00 32.18 4.79
385 386 0.458025 GAATGAGACCGTGTCCGTCC 60.458 60.000 0.00 0.00 32.18 4.79
386 387 0.458025 GGAATGAGACCGTGTCCGTC 60.458 60.000 0.00 0.00 32.18 4.79
387 388 0.898789 AGGAATGAGACCGTGTCCGT 60.899 55.000 0.00 0.00 32.18 4.69
388 389 0.458543 CAGGAATGAGACCGTGTCCG 60.459 60.000 0.00 0.00 32.18 4.79
389 390 0.608640 ACAGGAATGAGACCGTGTCC 59.391 55.000 0.00 0.00 32.18 4.02
390 391 1.404315 GGACAGGAATGAGACCGTGTC 60.404 57.143 0.00 0.00 36.18 3.67
391 392 0.608640 GGACAGGAATGAGACCGTGT 59.391 55.000 0.00 0.00 0.00 4.49
392 393 0.608130 TGGACAGGAATGAGACCGTG 59.392 55.000 0.00 0.00 0.00 4.94
393 394 1.348064 TTGGACAGGAATGAGACCGT 58.652 50.000 0.00 0.00 0.00 4.83
394 395 2.076863 GTTTGGACAGGAATGAGACCG 58.923 52.381 0.00 0.00 0.00 4.79
395 396 2.076863 CGTTTGGACAGGAATGAGACC 58.923 52.381 0.00 0.00 0.00 3.85
396 397 2.076863 CCGTTTGGACAGGAATGAGAC 58.923 52.381 0.00 0.00 37.49 3.36
397 398 1.974957 TCCGTTTGGACAGGAATGAGA 59.025 47.619 0.00 0.00 40.17 3.27
398 399 2.472695 TCCGTTTGGACAGGAATGAG 57.527 50.000 0.00 0.00 40.17 2.90
409 410 6.442952 TGTTTTGTCTGAATAATCCGTTTGG 58.557 36.000 0.00 0.00 0.00 3.28
410 411 7.359595 TCTGTTTTGTCTGAATAATCCGTTTG 58.640 34.615 0.00 0.00 0.00 2.93
411 412 7.504924 TCTGTTTTGTCTGAATAATCCGTTT 57.495 32.000 0.00 0.00 0.00 3.60
412 413 7.174946 ACATCTGTTTTGTCTGAATAATCCGTT 59.825 33.333 0.00 0.00 0.00 4.44
413 414 6.655003 ACATCTGTTTTGTCTGAATAATCCGT 59.345 34.615 0.00 0.00 0.00 4.69
414 415 7.076842 ACATCTGTTTTGTCTGAATAATCCG 57.923 36.000 0.00 0.00 0.00 4.18
415 416 9.132521 CAAACATCTGTTTTGTCTGAATAATCC 57.867 33.333 5.59 0.00 45.07 3.01
416 417 9.683069 ACAAACATCTGTTTTGTCTGAATAATC 57.317 29.630 5.59 0.00 45.07 1.75
418 419 9.868277 AAACAAACATCTGTTTTGTCTGAATAA 57.132 25.926 5.59 0.00 45.10 1.40
419 420 9.299963 CAAACAAACATCTGTTTTGTCTGAATA 57.700 29.630 5.59 0.00 45.10 1.75
420 421 7.278424 CCAAACAAACATCTGTTTTGTCTGAAT 59.722 33.333 5.59 0.00 45.10 2.57
421 422 6.589523 CCAAACAAACATCTGTTTTGTCTGAA 59.410 34.615 5.59 0.00 45.10 3.02
422 423 6.098679 CCAAACAAACATCTGTTTTGTCTGA 58.901 36.000 5.59 0.00 45.10 3.27
423 424 5.291614 CCCAAACAAACATCTGTTTTGTCTG 59.708 40.000 5.59 5.52 45.10 3.51
424 425 5.418676 CCCAAACAAACATCTGTTTTGTCT 58.581 37.500 5.59 0.00 45.10 3.41
425 426 4.570369 CCCCAAACAAACATCTGTTTTGTC 59.430 41.667 5.59 0.00 45.10 3.18
426 427 4.019771 ACCCCAAACAAACATCTGTTTTGT 60.020 37.500 5.59 5.58 45.10 2.83
427 428 4.512484 ACCCCAAACAAACATCTGTTTTG 58.488 39.130 5.59 2.94 45.10 2.44
428 429 4.223923 TGACCCCAAACAAACATCTGTTTT 59.776 37.500 5.59 0.00 45.10 2.43
430 431 3.370104 TGACCCCAAACAAACATCTGTT 58.630 40.909 0.00 0.00 41.31 3.16
431 432 3.025322 TGACCCCAAACAAACATCTGT 57.975 42.857 0.00 0.00 0.00 3.41
432 433 3.861886 GCATGACCCCAAACAAACATCTG 60.862 47.826 0.00 0.00 0.00 2.90
433 434 2.299867 GCATGACCCCAAACAAACATCT 59.700 45.455 0.00 0.00 0.00 2.90
434 435 2.687370 GCATGACCCCAAACAAACATC 58.313 47.619 0.00 0.00 0.00 3.06
435 436 1.000731 CGCATGACCCCAAACAAACAT 59.999 47.619 0.00 0.00 0.00 2.71
436 437 0.387202 CGCATGACCCCAAACAAACA 59.613 50.000 0.00 0.00 0.00 2.83
437 438 0.387565 ACGCATGACCCCAAACAAAC 59.612 50.000 0.00 0.00 0.00 2.93
438 439 1.115467 AACGCATGACCCCAAACAAA 58.885 45.000 0.00 0.00 0.00 2.83
439 440 0.387202 CAACGCATGACCCCAAACAA 59.613 50.000 0.00 0.00 0.00 2.83
440 441 1.459455 CCAACGCATGACCCCAAACA 61.459 55.000 0.00 0.00 0.00 2.83
441 442 1.175983 TCCAACGCATGACCCCAAAC 61.176 55.000 0.00 0.00 0.00 2.93
442 443 0.893270 CTCCAACGCATGACCCCAAA 60.893 55.000 0.00 0.00 0.00 3.28
443 444 1.303236 CTCCAACGCATGACCCCAA 60.303 57.895 0.00 0.00 0.00 4.12
444 445 2.063015 AACTCCAACGCATGACCCCA 62.063 55.000 0.00 0.00 0.00 4.96
445 446 0.035820 TAACTCCAACGCATGACCCC 60.036 55.000 0.00 0.00 0.00 4.95
446 447 1.369625 CTAACTCCAACGCATGACCC 58.630 55.000 0.00 0.00 0.00 4.46
447 448 0.727398 GCTAACTCCAACGCATGACC 59.273 55.000 0.00 0.00 0.00 4.02
448 449 0.727398 GGCTAACTCCAACGCATGAC 59.273 55.000 0.00 0.00 0.00 3.06
449 450 0.613260 AGGCTAACTCCAACGCATGA 59.387 50.000 0.00 0.00 0.00 3.07
450 451 0.729116 CAGGCTAACTCCAACGCATG 59.271 55.000 0.00 0.00 0.00 4.06
451 452 0.613260 TCAGGCTAACTCCAACGCAT 59.387 50.000 0.00 0.00 0.00 4.73
452 453 0.037326 CTCAGGCTAACTCCAACGCA 60.037 55.000 0.00 0.00 0.00 5.24
453 454 0.741221 CCTCAGGCTAACTCCAACGC 60.741 60.000 0.00 0.00 0.00 4.84
454 455 0.108138 CCCTCAGGCTAACTCCAACG 60.108 60.000 0.00 0.00 0.00 4.10
455 456 0.253327 CCCCTCAGGCTAACTCCAAC 59.747 60.000 0.00 0.00 0.00 3.77
456 457 0.914417 CCCCCTCAGGCTAACTCCAA 60.914 60.000 0.00 0.00 0.00 3.53
457 458 1.306997 CCCCCTCAGGCTAACTCCA 60.307 63.158 0.00 0.00 0.00 3.86
458 459 0.620700 TTCCCCCTCAGGCTAACTCC 60.621 60.000 0.00 0.00 0.00 3.85
459 460 1.286248 TTTCCCCCTCAGGCTAACTC 58.714 55.000 0.00 0.00 0.00 3.01
460 461 1.566231 CATTTCCCCCTCAGGCTAACT 59.434 52.381 0.00 0.00 0.00 2.24
461 462 1.410224 CCATTTCCCCCTCAGGCTAAC 60.410 57.143 0.00 0.00 0.00 2.34
462 463 0.926293 CCATTTCCCCCTCAGGCTAA 59.074 55.000 0.00 0.00 0.00 3.09
463 464 1.645402 GCCATTTCCCCCTCAGGCTA 61.645 60.000 0.00 0.00 39.02 3.93
464 465 3.001358 GCCATTTCCCCCTCAGGCT 62.001 63.158 0.00 0.00 39.02 4.58
465 466 2.442830 GCCATTTCCCCCTCAGGC 60.443 66.667 0.00 0.00 34.71 4.85
466 467 2.280079 GGCCATTTCCCCCTCAGG 59.720 66.667 0.00 0.00 0.00 3.86
467 468 2.280079 GGGCCATTTCCCCCTCAG 59.720 66.667 4.39 0.00 40.51 3.35
473 474 2.280079 CCCAGAGGGCCATTTCCC 59.720 66.667 6.18 0.00 46.93 3.97
474 475 3.162832 ATGACCCAGAGGGCCATTTCC 62.163 57.143 6.18 0.00 43.43 3.13
475 476 0.259938 ATGACCCAGAGGGCCATTTC 59.740 55.000 6.18 0.00 43.43 2.17
476 477 1.607225 TATGACCCAGAGGGCCATTT 58.393 50.000 9.21 0.00 43.43 2.32
477 478 1.838611 ATATGACCCAGAGGGCCATT 58.161 50.000 9.21 0.00 43.43 3.16
483 484 3.784511 ATGCAGAATATGACCCAGAGG 57.215 47.619 0.00 0.00 40.04 3.69
484 485 3.744942 CGAATGCAGAATATGACCCAGAG 59.255 47.826 0.00 0.00 0.00 3.35
485 486 3.134623 ACGAATGCAGAATATGACCCAGA 59.865 43.478 0.00 0.00 0.00 3.86
486 487 3.470709 ACGAATGCAGAATATGACCCAG 58.529 45.455 0.00 0.00 0.00 4.45
487 488 3.134623 AGACGAATGCAGAATATGACCCA 59.865 43.478 0.00 0.00 0.00 4.51
488 489 3.496130 CAGACGAATGCAGAATATGACCC 59.504 47.826 0.00 0.00 0.00 4.46
489 490 3.059325 GCAGACGAATGCAGAATATGACC 60.059 47.826 10.91 0.00 45.77 4.02
490 491 4.125912 GCAGACGAATGCAGAATATGAC 57.874 45.455 10.91 0.00 45.77 3.06
500 501 2.203070 ATCCGGGCAGACGAATGC 60.203 61.111 0.00 7.88 45.74 3.56
501 502 1.889105 CCATCCGGGCAGACGAATG 60.889 63.158 0.00 0.00 35.47 2.67
502 503 2.505982 CCATCCGGGCAGACGAAT 59.494 61.111 0.00 0.00 35.47 3.34
512 513 1.746517 GTAGCAGGTACCCATCCGG 59.253 63.158 8.74 0.00 37.81 5.14
513 514 1.362717 CGTAGCAGGTACCCATCCG 59.637 63.158 8.74 1.04 0.00 4.18
514 515 0.104304 CACGTAGCAGGTACCCATCC 59.896 60.000 8.74 0.00 0.00 3.51
515 516 0.529992 GCACGTAGCAGGTACCCATC 60.530 60.000 8.74 0.00 44.79 3.51
516 517 1.520666 GCACGTAGCAGGTACCCAT 59.479 57.895 8.74 0.00 44.79 4.00
517 518 2.975536 GCACGTAGCAGGTACCCA 59.024 61.111 8.74 0.00 44.79 4.51
534 535 4.088762 AACAAGATGCCGCGCGTG 62.089 61.111 29.95 21.01 0.00 5.34
535 536 4.088762 CAACAAGATGCCGCGCGT 62.089 61.111 29.95 10.71 0.00 6.01
536 537 2.582202 ATTCAACAAGATGCCGCGCG 62.582 55.000 25.67 25.67 0.00 6.86
537 538 0.456653 AATTCAACAAGATGCCGCGC 60.457 50.000 0.00 0.00 0.00 6.86
538 539 2.823196 TAATTCAACAAGATGCCGCG 57.177 45.000 0.00 0.00 0.00 6.46
539 540 4.044426 GGATTAATTCAACAAGATGCCGC 58.956 43.478 0.00 0.00 0.00 6.53
540 541 4.035091 TCGGATTAATTCAACAAGATGCCG 59.965 41.667 0.00 0.00 35.53 5.69
541 542 5.499139 TCGGATTAATTCAACAAGATGCC 57.501 39.130 0.00 0.00 0.00 4.40
542 543 4.972440 GCTCGGATTAATTCAACAAGATGC 59.028 41.667 0.00 0.00 0.00 3.91
543 544 5.066375 TGGCTCGGATTAATTCAACAAGATG 59.934 40.000 0.00 0.00 0.00 2.90
544 545 5.192927 TGGCTCGGATTAATTCAACAAGAT 58.807 37.500 0.00 0.00 0.00 2.40
545 546 4.584874 TGGCTCGGATTAATTCAACAAGA 58.415 39.130 0.00 0.00 0.00 3.02
546 547 4.963276 TGGCTCGGATTAATTCAACAAG 57.037 40.909 0.00 0.00 0.00 3.16
547 548 5.913137 AATGGCTCGGATTAATTCAACAA 57.087 34.783 0.00 0.00 0.00 2.83
548 549 6.601613 ACTTAATGGCTCGGATTAATTCAACA 59.398 34.615 0.00 0.00 0.00 3.33
549 550 6.912591 CACTTAATGGCTCGGATTAATTCAAC 59.087 38.462 0.00 0.00 0.00 3.18
550 551 6.039270 CCACTTAATGGCTCGGATTAATTCAA 59.961 38.462 0.00 0.00 43.24 2.69
551 552 5.530915 CCACTTAATGGCTCGGATTAATTCA 59.469 40.000 0.00 0.00 43.24 2.57
552 553 6.002062 CCACTTAATGGCTCGGATTAATTC 57.998 41.667 0.00 0.00 43.24 2.17
566 567 5.611374 ACCGTCAGATTATCCCACTTAATG 58.389 41.667 0.00 0.00 0.00 1.90
567 568 5.888982 ACCGTCAGATTATCCCACTTAAT 57.111 39.130 0.00 0.00 0.00 1.40
568 569 5.895534 ACTACCGTCAGATTATCCCACTTAA 59.104 40.000 0.00 0.00 0.00 1.85
569 570 5.452255 ACTACCGTCAGATTATCCCACTTA 58.548 41.667 0.00 0.00 0.00 2.24
570 571 4.287552 ACTACCGTCAGATTATCCCACTT 58.712 43.478 0.00 0.00 0.00 3.16
571 572 3.912248 ACTACCGTCAGATTATCCCACT 58.088 45.455 0.00 0.00 0.00 4.00
572 573 5.779529 TTACTACCGTCAGATTATCCCAC 57.220 43.478 0.00 0.00 0.00 4.61
573 574 6.072649 TGATTACTACCGTCAGATTATCCCA 58.927 40.000 0.00 0.00 0.00 4.37
574 575 6.433404 TCTGATTACTACCGTCAGATTATCCC 59.567 42.308 0.51 0.00 42.36 3.85
575 576 7.175293 AGTCTGATTACTACCGTCAGATTATCC 59.825 40.741 7.47 0.00 46.92 2.59
576 577 8.101654 AGTCTGATTACTACCGTCAGATTATC 57.898 38.462 7.47 0.00 46.92 1.75
577 578 8.353684 CAAGTCTGATTACTACCGTCAGATTAT 58.646 37.037 7.47 0.00 46.92 1.28
578 579 7.201794 CCAAGTCTGATTACTACCGTCAGATTA 60.202 40.741 7.47 0.00 46.92 1.75
579 580 6.405953 CCAAGTCTGATTACTACCGTCAGATT 60.406 42.308 7.47 1.34 46.92 2.40
580 581 5.067936 CCAAGTCTGATTACTACCGTCAGAT 59.932 44.000 7.47 0.00 46.92 2.90
581 582 4.398358 CCAAGTCTGATTACTACCGTCAGA 59.602 45.833 0.51 0.51 44.32 3.27
582 583 4.158025 ACCAAGTCTGATTACTACCGTCAG 59.842 45.833 0.00 0.00 40.48 3.51
583 584 4.084287 ACCAAGTCTGATTACTACCGTCA 58.916 43.478 0.00 0.00 0.00 4.35
584 585 4.715527 ACCAAGTCTGATTACTACCGTC 57.284 45.455 0.00 0.00 0.00 4.79
585 586 4.400567 GGTACCAAGTCTGATTACTACCGT 59.599 45.833 7.15 0.00 0.00 4.83
586 587 4.929781 GGTACCAAGTCTGATTACTACCG 58.070 47.826 7.15 0.00 0.00 4.02
608 609 7.486802 TTCTTTCTTTAAACCACTCGTAAGG 57.513 36.000 0.00 0.00 38.47 2.69
609 610 9.946165 ATTTTCTTTCTTTAAACCACTCGTAAG 57.054 29.630 0.00 0.00 0.00 2.34
610 611 9.724839 CATTTTCTTTCTTTAAACCACTCGTAA 57.275 29.630 0.00 0.00 0.00 3.18
611 612 8.895737 ACATTTTCTTTCTTTAAACCACTCGTA 58.104 29.630 0.00 0.00 0.00 3.43
612 613 7.768240 ACATTTTCTTTCTTTAAACCACTCGT 58.232 30.769 0.00 0.00 0.00 4.18
613 614 8.628882 AACATTTTCTTTCTTTAAACCACTCG 57.371 30.769 0.00 0.00 0.00 4.18
615 616 8.664798 GCAAACATTTTCTTTCTTTAAACCACT 58.335 29.630 0.00 0.00 0.00 4.00
616 617 7.908082 GGCAAACATTTTCTTTCTTTAAACCAC 59.092 33.333 0.00 0.00 0.00 4.16
617 618 7.826744 AGGCAAACATTTTCTTTCTTTAAACCA 59.173 29.630 0.00 0.00 0.00 3.67
618 619 8.208718 AGGCAAACATTTTCTTTCTTTAAACC 57.791 30.769 0.00 0.00 0.00 3.27
647 648 5.549742 AGGGCAAACATTGATCTCAAAAA 57.450 34.783 0.00 0.00 39.55 1.94
648 649 5.549742 AAGGGCAAACATTGATCTCAAAA 57.450 34.783 0.00 0.00 39.55 2.44
649 650 5.549742 AAAGGGCAAACATTGATCTCAAA 57.450 34.783 0.00 0.00 39.55 2.69
650 651 5.549742 AAAAGGGCAAACATTGATCTCAA 57.450 34.783 0.00 0.00 40.51 3.02
651 652 6.662865 TTAAAAGGGCAAACATTGATCTCA 57.337 33.333 0.00 0.00 0.00 3.27
652 653 8.470002 ACTATTAAAAGGGCAAACATTGATCTC 58.530 33.333 0.00 0.00 0.00 2.75
653 654 8.366359 ACTATTAAAAGGGCAAACATTGATCT 57.634 30.769 0.00 0.00 0.00 2.75
654 655 9.736023 CTACTATTAAAAGGGCAAACATTGATC 57.264 33.333 0.00 0.00 0.00 2.92
655 656 9.255029 ACTACTATTAAAAGGGCAAACATTGAT 57.745 29.630 0.00 0.00 0.00 2.57
656 657 8.519526 CACTACTATTAAAAGGGCAAACATTGA 58.480 33.333 0.00 0.00 0.00 2.57
657 658 8.303876 ACACTACTATTAAAAGGGCAAACATTG 58.696 33.333 0.00 0.00 0.00 2.82
658 659 8.417273 ACACTACTATTAAAAGGGCAAACATT 57.583 30.769 0.00 0.00 0.00 2.71
659 660 8.953313 GTACACTACTATTAAAAGGGCAAACAT 58.047 33.333 0.00 0.00 0.00 2.71
660 661 8.158789 AGTACACTACTATTAAAAGGGCAAACA 58.841 33.333 0.00 0.00 37.23 2.83
661 662 8.557592 AGTACACTACTATTAAAAGGGCAAAC 57.442 34.615 0.00 0.00 37.23 2.93
662 663 7.825761 GGAGTACACTACTATTAAAAGGGCAAA 59.174 37.037 0.00 0.00 39.59 3.68
663 664 7.038160 TGGAGTACACTACTATTAAAAGGGCAA 60.038 37.037 0.00 0.00 39.59 4.52
664 665 6.441284 TGGAGTACACTACTATTAAAAGGGCA 59.559 38.462 0.00 0.00 39.59 5.36
665 666 6.881570 TGGAGTACACTACTATTAAAAGGGC 58.118 40.000 0.00 0.00 39.59 5.19
666 667 7.418712 CCCTGGAGTACACTACTATTAAAAGGG 60.419 44.444 0.00 0.00 39.59 3.95
667 668 7.418712 CCCCTGGAGTACACTACTATTAAAAGG 60.419 44.444 0.00 0.00 39.59 3.11
668 669 7.498443 CCCCTGGAGTACACTACTATTAAAAG 58.502 42.308 0.00 0.00 39.59 2.27
669 670 6.126968 GCCCCTGGAGTACACTACTATTAAAA 60.127 42.308 0.00 0.00 39.59 1.52
670 671 5.364735 GCCCCTGGAGTACACTACTATTAAA 59.635 44.000 0.00 0.00 39.59 1.52
671 672 4.897670 GCCCCTGGAGTACACTACTATTAA 59.102 45.833 0.00 0.00 39.59 1.40
672 673 4.079038 TGCCCCTGGAGTACACTACTATTA 60.079 45.833 0.00 0.00 39.59 0.98
673 674 3.306613 GCCCCTGGAGTACACTACTATT 58.693 50.000 0.00 0.00 39.59 1.73
674 675 2.246588 TGCCCCTGGAGTACACTACTAT 59.753 50.000 0.00 0.00 39.59 2.12
675 676 1.642238 TGCCCCTGGAGTACACTACTA 59.358 52.381 0.00 0.00 39.59 1.82
676 677 0.412244 TGCCCCTGGAGTACACTACT 59.588 55.000 0.00 0.00 42.86 2.57
677 678 0.535797 GTGCCCCTGGAGTACACTAC 59.464 60.000 0.00 0.00 0.00 2.73
678 679 0.412244 AGTGCCCCTGGAGTACACTA 59.588 55.000 0.00 0.00 39.69 2.74
679 680 0.473886 AAGTGCCCCTGGAGTACACT 60.474 55.000 0.00 2.63 43.14 3.55
680 681 0.036294 GAAGTGCCCCTGGAGTACAC 60.036 60.000 0.00 0.38 0.00 2.90
681 682 0.178903 AGAAGTGCCCCTGGAGTACA 60.179 55.000 0.00 0.00 0.00 2.90
682 683 1.481363 GTAGAAGTGCCCCTGGAGTAC 59.519 57.143 0.00 0.00 0.00 2.73
683 684 1.361543 AGTAGAAGTGCCCCTGGAGTA 59.638 52.381 0.00 0.00 0.00 2.59
684 685 0.117340 AGTAGAAGTGCCCCTGGAGT 59.883 55.000 0.00 0.00 0.00 3.85
685 686 1.208293 GAAGTAGAAGTGCCCCTGGAG 59.792 57.143 0.00 0.00 0.00 3.86
686 687 1.203313 AGAAGTAGAAGTGCCCCTGGA 60.203 52.381 0.00 0.00 0.00 3.86
687 688 1.280457 AGAAGTAGAAGTGCCCCTGG 58.720 55.000 0.00 0.00 0.00 4.45
688 689 3.100671 AGTAGAAGTAGAAGTGCCCCTG 58.899 50.000 0.00 0.00 0.00 4.45
689 690 3.100671 CAGTAGAAGTAGAAGTGCCCCT 58.899 50.000 0.00 0.00 0.00 4.79
690 691 2.418884 GCAGTAGAAGTAGAAGTGCCCC 60.419 54.545 0.00 0.00 34.23 5.80
691 692 2.233922 TGCAGTAGAAGTAGAAGTGCCC 59.766 50.000 0.00 0.00 38.52 5.36
692 693 3.516615 CTGCAGTAGAAGTAGAAGTGCC 58.483 50.000 5.25 0.00 38.52 5.01
693 694 3.516615 CCTGCAGTAGAAGTAGAAGTGC 58.483 50.000 13.81 0.00 39.50 4.40
694 695 3.516615 GCCTGCAGTAGAAGTAGAAGTG 58.483 50.000 13.81 0.00 0.00 3.16
695 696 2.164624 CGCCTGCAGTAGAAGTAGAAGT 59.835 50.000 13.81 0.00 0.00 3.01
696 697 2.423892 TCGCCTGCAGTAGAAGTAGAAG 59.576 50.000 13.81 0.00 0.00 2.85
697 698 2.163815 GTCGCCTGCAGTAGAAGTAGAA 59.836 50.000 13.81 0.00 0.00 2.10
698 699 1.743958 GTCGCCTGCAGTAGAAGTAGA 59.256 52.381 13.81 0.00 0.00 2.59
699 700 1.472878 TGTCGCCTGCAGTAGAAGTAG 59.527 52.381 13.81 0.00 0.00 2.57
700 701 1.472878 CTGTCGCCTGCAGTAGAAGTA 59.527 52.381 13.81 1.53 0.00 2.24
701 702 0.244994 CTGTCGCCTGCAGTAGAAGT 59.755 55.000 13.81 0.00 0.00 3.01
702 703 0.528017 TCTGTCGCCTGCAGTAGAAG 59.472 55.000 13.81 10.91 35.60 2.85
703 704 1.186200 ATCTGTCGCCTGCAGTAGAA 58.814 50.000 13.81 0.00 35.60 2.10
704 705 2.052782 TATCTGTCGCCTGCAGTAGA 57.947 50.000 13.81 8.63 35.60 2.59
705 706 2.352225 GGATATCTGTCGCCTGCAGTAG 60.352 54.545 13.81 6.14 35.60 2.57
706 707 1.613925 GGATATCTGTCGCCTGCAGTA 59.386 52.381 13.81 0.00 35.60 2.74
707 708 0.390860 GGATATCTGTCGCCTGCAGT 59.609 55.000 13.81 0.00 35.60 4.40
708 709 0.390492 TGGATATCTGTCGCCTGCAG 59.610 55.000 6.78 6.78 35.43 4.41
709 710 0.390492 CTGGATATCTGTCGCCTGCA 59.610 55.000 2.05 0.00 0.00 4.41
710 711 0.320247 CCTGGATATCTGTCGCCTGC 60.320 60.000 2.05 0.00 0.00 4.85
711 712 0.319728 CCCTGGATATCTGTCGCCTG 59.680 60.000 2.05 0.00 0.00 4.85
712 713 0.833834 CCCCTGGATATCTGTCGCCT 60.834 60.000 2.05 0.00 0.00 5.52
713 714 1.674057 CCCCTGGATATCTGTCGCC 59.326 63.158 2.05 0.00 0.00 5.54
714 715 1.004440 GCCCCTGGATATCTGTCGC 60.004 63.158 2.05 0.00 0.00 5.19
715 716 0.034059 GTGCCCCTGGATATCTGTCG 59.966 60.000 2.05 0.00 0.00 4.35
716 717 1.131638 TGTGCCCCTGGATATCTGTC 58.868 55.000 2.05 0.00 0.00 3.51
717 718 0.839946 GTGTGCCCCTGGATATCTGT 59.160 55.000 2.05 0.00 0.00 3.41
718 719 0.109342 GGTGTGCCCCTGGATATCTG 59.891 60.000 2.05 0.00 0.00 2.90
719 720 0.029681 AGGTGTGCCCCTGGATATCT 60.030 55.000 2.05 0.00 32.11 1.98
720 721 0.398318 GAGGTGTGCCCCTGGATATC 59.602 60.000 0.00 0.00 34.03 1.63
721 722 1.062488 GGAGGTGTGCCCCTGGATAT 61.062 60.000 0.00 0.00 34.03 1.63
722 723 1.692749 GGAGGTGTGCCCCTGGATA 60.693 63.158 0.00 0.00 34.03 2.59
723 724 3.017581 GGAGGTGTGCCCCTGGAT 61.018 66.667 0.00 0.00 34.03 3.41
730 731 0.608130 GAAAAATGGGGAGGTGTGCC 59.392 55.000 0.00 0.00 0.00 5.01
731 732 0.243636 CGAAAAATGGGGAGGTGTGC 59.756 55.000 0.00 0.00 0.00 4.57
732 733 1.904287 TCGAAAAATGGGGAGGTGTG 58.096 50.000 0.00 0.00 0.00 3.82
733 734 2.620627 GGATCGAAAAATGGGGAGGTGT 60.621 50.000 0.00 0.00 0.00 4.16
734 735 2.024414 GGATCGAAAAATGGGGAGGTG 58.976 52.381 0.00 0.00 0.00 4.00
735 736 1.408266 CGGATCGAAAAATGGGGAGGT 60.408 52.381 0.00 0.00 0.00 3.85
736 737 1.308998 CGGATCGAAAAATGGGGAGG 58.691 55.000 0.00 0.00 0.00 4.30
737 738 1.670811 CACGGATCGAAAAATGGGGAG 59.329 52.381 0.00 0.00 0.00 4.30
738 739 1.680555 CCACGGATCGAAAAATGGGGA 60.681 52.381 0.00 0.00 0.00 4.81
739 740 0.738389 CCACGGATCGAAAAATGGGG 59.262 55.000 0.00 0.00 0.00 4.96
740 741 1.670811 CTCCACGGATCGAAAAATGGG 59.329 52.381 8.70 0.00 0.00 4.00
741 742 1.064060 GCTCCACGGATCGAAAAATGG 59.936 52.381 0.00 0.00 0.00 3.16
742 743 1.064060 GGCTCCACGGATCGAAAAATG 59.936 52.381 0.00 0.00 0.00 2.32
743 744 1.379527 GGCTCCACGGATCGAAAAAT 58.620 50.000 0.00 0.00 0.00 1.82
744 745 1.017177 CGGCTCCACGGATCGAAAAA 61.017 55.000 0.00 0.00 0.00 1.94
745 746 1.447140 CGGCTCCACGGATCGAAAA 60.447 57.895 0.00 0.00 0.00 2.29
746 747 2.183300 CGGCTCCACGGATCGAAA 59.817 61.111 0.00 0.00 0.00 3.46
747 748 4.508128 GCGGCTCCACGGATCGAA 62.508 66.667 11.55 0.00 0.00 3.71
755 756 2.624674 ATATGGTTGGGCGGCTCCAC 62.625 60.000 18.72 2.54 36.38 4.02
756 757 1.932156 AATATGGTTGGGCGGCTCCA 61.932 55.000 18.66 18.66 36.21 3.86
757 758 0.755327 AAATATGGTTGGGCGGCTCC 60.755 55.000 9.56 10.01 0.00 4.70
758 759 1.111277 AAAATATGGTTGGGCGGCTC 58.889 50.000 9.56 0.00 0.00 4.70
759 760 2.445682 TAAAATATGGTTGGGCGGCT 57.554 45.000 9.56 0.00 0.00 5.52
760 761 3.744238 ATTAAAATATGGTTGGGCGGC 57.256 42.857 0.00 0.00 0.00 6.53
761 762 4.742659 CGAAATTAAAATATGGTTGGGCGG 59.257 41.667 0.00 0.00 0.00 6.13
762 763 5.344884 ACGAAATTAAAATATGGTTGGGCG 58.655 37.500 0.00 0.00 0.00 6.13
763 764 5.751509 GGACGAAATTAAAATATGGTTGGGC 59.248 40.000 0.00 0.00 0.00 5.36
764 765 7.107639 AGGACGAAATTAAAATATGGTTGGG 57.892 36.000 0.00 0.00 0.00 4.12
765 766 6.910433 CGAGGACGAAATTAAAATATGGTTGG 59.090 38.462 0.00 0.00 42.66 3.77
766 767 7.690228 TCGAGGACGAAATTAAAATATGGTTG 58.310 34.615 0.00 0.00 45.74 3.77
767 768 7.852971 TCGAGGACGAAATTAAAATATGGTT 57.147 32.000 0.00 0.00 45.74 3.67
787 788 1.212616 GCATCCCTCATTCGTTCGAG 58.787 55.000 0.00 0.00 0.00 4.04
788 789 0.534873 TGCATCCCTCATTCGTTCGA 59.465 50.000 0.00 0.00 0.00 3.71
789 790 0.652592 GTGCATCCCTCATTCGTTCG 59.347 55.000 0.00 0.00 0.00 3.95
790 791 1.017387 GGTGCATCCCTCATTCGTTC 58.983 55.000 0.00 0.00 0.00 3.95
791 792 3.175133 GGTGCATCCCTCATTCGTT 57.825 52.632 0.00 0.00 0.00 3.85
792 793 4.963878 GGTGCATCCCTCATTCGT 57.036 55.556 0.00 0.00 0.00 3.85
801 802 6.491403 AGACAGATTAAAATATGGGTGCATCC 59.509 38.462 9.82 9.82 32.12 3.51
802 803 7.013655 ACAGACAGATTAAAATATGGGTGCATC 59.986 37.037 0.00 0.00 32.12 3.91
803 804 6.835488 ACAGACAGATTAAAATATGGGTGCAT 59.165 34.615 0.00 0.00 32.12 3.96
804 805 6.186957 ACAGACAGATTAAAATATGGGTGCA 58.813 36.000 2.71 0.00 32.12 4.57
805 806 6.543831 AGACAGACAGATTAAAATATGGGTGC 59.456 38.462 2.71 0.00 32.12 5.01
806 807 7.989741 AGAGACAGACAGATTAAAATATGGGTG 59.010 37.037 2.71 2.16 32.12 4.61
807 808 8.095452 AGAGACAGACAGATTAAAATATGGGT 57.905 34.615 2.71 0.00 32.12 4.51
808 809 8.834465 CAAGAGACAGACAGATTAAAATATGGG 58.166 37.037 2.71 0.00 32.12 4.00
809 810 9.388506 ACAAGAGACAGACAGATTAAAATATGG 57.611 33.333 2.71 0.00 32.12 2.74
812 813 8.721478 GCAACAAGAGACAGACAGATTAAAATA 58.279 33.333 0.00 0.00 0.00 1.40
813 814 7.308830 GGCAACAAGAGACAGACAGATTAAAAT 60.309 37.037 0.00 0.00 0.00 1.82
814 815 6.017109 GGCAACAAGAGACAGACAGATTAAAA 60.017 38.462 0.00 0.00 0.00 1.52
815 816 5.470098 GGCAACAAGAGACAGACAGATTAAA 59.530 40.000 0.00 0.00 0.00 1.52
816 817 4.997395 GGCAACAAGAGACAGACAGATTAA 59.003 41.667 0.00 0.00 0.00 1.40
817 818 4.284490 AGGCAACAAGAGACAGACAGATTA 59.716 41.667 0.00 0.00 41.41 1.75
818 819 3.072184 AGGCAACAAGAGACAGACAGATT 59.928 43.478 0.00 0.00 41.41 2.40
819 820 2.636893 AGGCAACAAGAGACAGACAGAT 59.363 45.455 0.00 0.00 41.41 2.90
820 821 2.042464 AGGCAACAAGAGACAGACAGA 58.958 47.619 0.00 0.00 41.41 3.41
821 822 2.540265 AGGCAACAAGAGACAGACAG 57.460 50.000 0.00 0.00 41.41 3.51
822 823 2.965831 AGTAGGCAACAAGAGACAGACA 59.034 45.455 0.00 0.00 41.41 3.41
823 824 3.669251 AGTAGGCAACAAGAGACAGAC 57.331 47.619 0.00 0.00 41.41 3.51
824 825 3.244215 CCAAGTAGGCAACAAGAGACAGA 60.244 47.826 0.00 0.00 41.41 3.41
825 826 3.070018 CCAAGTAGGCAACAAGAGACAG 58.930 50.000 0.00 0.00 41.41 3.51
826 827 2.703536 TCCAAGTAGGCAACAAGAGACA 59.296 45.455 0.00 0.00 41.41 3.41
827 828 3.402628 TCCAAGTAGGCAACAAGAGAC 57.597 47.619 0.00 0.00 41.41 3.36
828 829 3.869912 GCATCCAAGTAGGCAACAAGAGA 60.870 47.826 0.00 0.00 41.41 3.10
829 830 2.421424 GCATCCAAGTAGGCAACAAGAG 59.579 50.000 0.00 0.00 41.41 2.85
830 831 2.224744 TGCATCCAAGTAGGCAACAAGA 60.225 45.455 0.00 0.00 41.41 3.02
831 832 2.095059 GTGCATCCAAGTAGGCAACAAG 60.095 50.000 0.00 0.00 38.10 3.16
832 833 1.885887 GTGCATCCAAGTAGGCAACAA 59.114 47.619 0.00 0.00 38.10 2.83
833 834 1.073763 AGTGCATCCAAGTAGGCAACA 59.926 47.619 0.00 0.00 38.10 3.33
834 835 1.740025 GAGTGCATCCAAGTAGGCAAC 59.260 52.381 0.00 0.00 38.10 4.17
835 836 1.630369 AGAGTGCATCCAAGTAGGCAA 59.370 47.619 0.00 0.00 38.10 4.52
836 837 1.279496 AGAGTGCATCCAAGTAGGCA 58.721 50.000 0.00 0.00 37.29 4.75
837 838 2.012673 CAAGAGTGCATCCAAGTAGGC 58.987 52.381 0.00 0.00 37.29 3.93
838 839 3.340814 ACAAGAGTGCATCCAAGTAGG 57.659 47.619 0.00 0.00 39.47 3.18
839 840 4.327357 CGTAACAAGAGTGCATCCAAGTAG 59.673 45.833 0.00 0.00 0.00 2.57
840 841 4.021807 TCGTAACAAGAGTGCATCCAAGTA 60.022 41.667 0.00 0.00 0.00 2.24
841 842 3.067106 CGTAACAAGAGTGCATCCAAGT 58.933 45.455 0.00 0.00 0.00 3.16
842 843 3.325870 TCGTAACAAGAGTGCATCCAAG 58.674 45.455 0.00 0.00 0.00 3.61
843 844 3.394674 TCGTAACAAGAGTGCATCCAA 57.605 42.857 0.00 0.00 0.00 3.53
844 845 3.610040 ATCGTAACAAGAGTGCATCCA 57.390 42.857 0.00 0.00 0.00 3.41
845 846 3.932710 TGAATCGTAACAAGAGTGCATCC 59.067 43.478 0.00 0.00 0.00 3.51
846 847 4.864806 TCTGAATCGTAACAAGAGTGCATC 59.135 41.667 0.00 0.00 0.00 3.91
847 848 4.820897 TCTGAATCGTAACAAGAGTGCAT 58.179 39.130 0.00 0.00 0.00 3.96
848 849 4.022329 TCTCTGAATCGTAACAAGAGTGCA 60.022 41.667 0.00 0.00 0.00 4.57
849 850 4.486090 TCTCTGAATCGTAACAAGAGTGC 58.514 43.478 0.00 0.00 0.00 4.40
850 851 4.560819 GCTCTCTGAATCGTAACAAGAGTG 59.439 45.833 0.00 0.00 33.10 3.51
851 852 4.218635 TGCTCTCTGAATCGTAACAAGAGT 59.781 41.667 0.00 0.00 33.10 3.24
852 853 4.560819 GTGCTCTCTGAATCGTAACAAGAG 59.439 45.833 0.00 0.00 33.55 2.85
853 854 4.218635 AGTGCTCTCTGAATCGTAACAAGA 59.781 41.667 0.00 0.00 0.00 3.02
854 855 4.489810 AGTGCTCTCTGAATCGTAACAAG 58.510 43.478 0.00 0.00 0.00 3.16
855 856 4.521130 AGTGCTCTCTGAATCGTAACAA 57.479 40.909 0.00 0.00 0.00 2.83
905 910 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
916 921 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
917 922 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
918 923 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
919 924 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
920 925 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
921 926 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
922 927 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
923 928 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
924 929 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
925 930 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
926 931 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
927 932 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
928 933 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
929 934 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
930 935 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
931 936 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
932 937 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
933 938 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
934 939 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
935 940 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
936 941 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
937 942 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
938 943 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
939 944 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
940 945 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
941 946 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00