Multiple sequence alignment - TraesCS5B01G565600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G565600 chr5B 100.000 8899 0 0 1 8899 710476210 710485108 0.000000e+00 16434
1 TraesCS5B01G565600 chr5B 95.067 750 35 2 8149 8897 63677168 63676420 0.000000e+00 1179
2 TraesCS5B01G565600 chr5B 78.089 1036 190 23 1922 2942 696017509 696018522 9.810000e-174 621
3 TraesCS5B01G565600 chr5B 80.202 793 114 31 1901 2679 696127747 696128510 1.010000e-153 555
4 TraesCS5B01G565600 chr5B 77.416 952 168 27 1896 2829 696088761 696089683 2.850000e-144 523
5 TraesCS5B01G565600 chr5B 77.183 710 147 11 7432 8133 696022617 696023319 5.010000e-107 399
6 TraesCS5B01G565600 chr5B 92.073 164 8 3 558 716 16279244 16279407 8.990000e-55 226
7 TraesCS5B01G565600 chr5B 92.025 163 8 3 559 716 659736275 659736437 3.230000e-54 224
8 TraesCS5B01G565600 chr5B 87.065 201 14 9 546 740 29623739 29623545 5.410000e-52 217
9 TraesCS5B01G565600 chr5B 90.909 165 10 3 557 716 646470165 646470329 5.410000e-52 217
10 TraesCS5B01G565600 chr5B 80.077 261 30 16 1387 1638 297970482 297970235 3.300000e-39 174
11 TraesCS5B01G565600 chr5D 82.478 2300 321 43 3124 5396 560038248 560040492 0.000000e+00 1940
12 TraesCS5B01G565600 chr5D 85.906 1270 154 17 1848 3105 560036470 560037726 0.000000e+00 1330
13 TraesCS5B01G565600 chr5D 87.284 637 68 8 7446 8081 560049385 560050009 0.000000e+00 715
14 TraesCS5B01G565600 chr5D 75.881 1107 215 31 1854 2938 554929239 554928163 1.320000e-142 518
15 TraesCS5B01G565600 chr5D 89.124 331 17 3 220 550 560035040 560035351 2.330000e-105 394
16 TraesCS5B01G565600 chr5D 77.539 512 106 8 7440 7945 554816839 554817347 5.220000e-77 300
17 TraesCS5B01G565600 chr5D 87.218 266 31 3 949 1213 560035569 560035832 5.220000e-77 300
18 TraesCS5B01G565600 chr5D 83.871 155 24 1 226 380 560063436 560063589 7.200000e-31 147
19 TraesCS5B01G565600 chr2B 95.995 749 29 1 8149 8897 637960971 637961718 0.000000e+00 1216
20 TraesCS5B01G565600 chr2B 93.897 213 13 0 1 213 711322794 711323006 1.110000e-83 322
21 TraesCS5B01G565600 chr2B 93.897 213 13 0 1 213 723425997 723426209 1.110000e-83 322
22 TraesCS5B01G565600 chr2B 94.595 148 7 1 574 720 796156673 796156820 2.500000e-55 228
23 TraesCS5B01G565600 chr2B 89.535 172 11 5 555 720 58887138 58887308 2.520000e-50 211
24 TraesCS5B01G565600 chr2B 78.545 275 32 16 1387 1640 683587220 683587488 1.200000e-33 156
25 TraesCS5B01G565600 chr1B 95.722 748 31 1 8150 8897 260055589 260056335 0.000000e+00 1203
26 TraesCS5B01G565600 chr1B 93.897 213 13 0 1 213 11133544 11133332 1.110000e-83 322
27 TraesCS5B01G565600 chr1B 90.964 166 10 3 556 716 488128897 488129062 1.500000e-52 219
28 TraesCS5B01G565600 chr1B 88.136 177 17 3 555 727 486821278 486821102 3.260000e-49 207
29 TraesCS5B01G565600 chr4B 95.200 750 34 2 8149 8897 589138218 589138966 0.000000e+00 1184
30 TraesCS5B01G565600 chr4B 93.342 751 49 1 8148 8897 481260602 481261352 0.000000e+00 1109
31 TraesCS5B01G565600 chr7B 94.940 751 37 1 8147 8897 542015466 542014717 0.000000e+00 1175
32 TraesCS5B01G565600 chr7B 89.714 175 12 4 552 720 583122914 583122740 1.500000e-52 219
33 TraesCS5B01G565600 chr7B 90.476 168 11 4 558 720 726772924 726773091 5.410000e-52 217
34 TraesCS5B01G565600 chr3B 94.674 751 39 1 8147 8897 443812633 443813382 0.000000e+00 1164
35 TraesCS5B01G565600 chr3B 91.358 162 10 3 559 716 70263332 70263493 1.500000e-52 219
36 TraesCS5B01G565600 chr4A 94.133 750 42 2 8148 8897 644565587 644566334 0.000000e+00 1140
37 TraesCS5B01G565600 chr4A 78.689 1037 187 22 1922 2942 613807184 613808202 0.000000e+00 660
38 TraesCS5B01G565600 chr4A 76.891 952 172 28 1896 2829 613857507 613858428 6.210000e-136 496
39 TraesCS5B01G565600 chr4A 83.991 431 60 6 4632 5059 613701890 613702314 1.080000e-108 405
40 TraesCS5B01G565600 chr4A 77.083 720 148 11 7425 8133 613812284 613812997 5.010000e-107 399
41 TraesCS5B01G565600 chr4A 75.692 650 140 14 7502 8140 613980024 613980666 8.680000e-80 309
42 TraesCS5B01G565600 chr4A 89.474 171 12 4 555 720 634843452 634843283 2.520000e-50 211
43 TraesCS5B01G565600 chr6B 93.351 752 44 4 8146 8897 651964153 651964898 0.000000e+00 1107
44 TraesCS5B01G565600 chr6B 93.897 213 13 0 1 213 674951687 674951475 1.110000e-83 322
45 TraesCS5B01G565600 chrUn 93.897 213 13 0 1 213 331004695 331004907 1.110000e-83 322
46 TraesCS5B01G565600 chrUn 93.897 213 13 0 1 213 369408743 369408531 1.110000e-83 322
47 TraesCS5B01G565600 chrUn 93.897 213 13 0 1 213 469305724 469305936 1.110000e-83 322
48 TraesCS5B01G565600 chr7D 92.694 219 16 0 1 219 321045673 321045455 5.190000e-82 316
49 TraesCS5B01G565600 chr7D 89.474 171 12 4 554 719 573953280 573953111 2.520000e-50 211
50 TraesCS5B01G565600 chr2D 92.308 221 15 2 1 220 582187417 582187636 6.710000e-81 313
51 TraesCS5B01G565600 chr6D 89.385 179 14 3 543 716 90890266 90890444 4.180000e-53 220
52 TraesCS5B01G565600 chr1D 87.611 113 11 2 1529 1640 345056386 345056276 2.610000e-25 128


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G565600 chr5B 710476210 710485108 8898 False 16434 16434 100.0000 1 8899 1 chr5B.!!$F8 8898
1 TraesCS5B01G565600 chr5B 63676420 63677168 748 True 1179 1179 95.0670 8149 8897 1 chr5B.!!$R2 748
2 TraesCS5B01G565600 chr5B 696017509 696018522 1013 False 621 621 78.0890 1922 2942 1 chr5B.!!$F4 1020
3 TraesCS5B01G565600 chr5B 696127747 696128510 763 False 555 555 80.2020 1901 2679 1 chr5B.!!$F7 778
4 TraesCS5B01G565600 chr5B 696088761 696089683 922 False 523 523 77.4160 1896 2829 1 chr5B.!!$F6 933
5 TraesCS5B01G565600 chr5B 696022617 696023319 702 False 399 399 77.1830 7432 8133 1 chr5B.!!$F5 701
6 TraesCS5B01G565600 chr5D 560035040 560040492 5452 False 991 1940 86.1815 220 5396 4 chr5D.!!$F4 5176
7 TraesCS5B01G565600 chr5D 560049385 560050009 624 False 715 715 87.2840 7446 8081 1 chr5D.!!$F2 635
8 TraesCS5B01G565600 chr5D 554928163 554929239 1076 True 518 518 75.8810 1854 2938 1 chr5D.!!$R1 1084
9 TraesCS5B01G565600 chr5D 554816839 554817347 508 False 300 300 77.5390 7440 7945 1 chr5D.!!$F1 505
10 TraesCS5B01G565600 chr2B 637960971 637961718 747 False 1216 1216 95.9950 8149 8897 1 chr2B.!!$F2 748
11 TraesCS5B01G565600 chr1B 260055589 260056335 746 False 1203 1203 95.7220 8150 8897 1 chr1B.!!$F1 747
12 TraesCS5B01G565600 chr4B 589138218 589138966 748 False 1184 1184 95.2000 8149 8897 1 chr4B.!!$F2 748
13 TraesCS5B01G565600 chr4B 481260602 481261352 750 False 1109 1109 93.3420 8148 8897 1 chr4B.!!$F1 749
14 TraesCS5B01G565600 chr7B 542014717 542015466 749 True 1175 1175 94.9400 8147 8897 1 chr7B.!!$R1 750
15 TraesCS5B01G565600 chr3B 443812633 443813382 749 False 1164 1164 94.6740 8147 8897 1 chr3B.!!$F2 750
16 TraesCS5B01G565600 chr4A 644565587 644566334 747 False 1140 1140 94.1330 8148 8897 1 chr4A.!!$F6 749
17 TraesCS5B01G565600 chr4A 613807184 613808202 1018 False 660 660 78.6890 1922 2942 1 chr4A.!!$F2 1020
18 TraesCS5B01G565600 chr4A 613857507 613858428 921 False 496 496 76.8910 1896 2829 1 chr4A.!!$F4 933
19 TraesCS5B01G565600 chr4A 613812284 613812997 713 False 399 399 77.0830 7425 8133 1 chr4A.!!$F3 708
20 TraesCS5B01G565600 chr4A 613980024 613980666 642 False 309 309 75.6920 7502 8140 1 chr4A.!!$F5 638
21 TraesCS5B01G565600 chr6B 651964153 651964898 745 False 1107 1107 93.3510 8146 8897 1 chr6B.!!$F1 751


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
946 947 0.032267 CGCCCAAGCTAGCTACTACC 59.968 60.0 19.70 5.03 36.60 3.18 F
1268 1322 0.029300 GCTTGTGCTGAGCGACAAAA 59.971 50.0 18.13 3.69 32.61 2.44 F
1272 1326 0.040958 GTGCTGAGCGACAAAACCAG 60.041 55.0 0.00 0.00 0.00 4.00 F
1645 1699 0.107410 AGAGTCAAAACACCACGGCA 60.107 50.0 0.00 0.00 0.00 5.69 F
2194 2347 0.110295 CCATCGCACCCCATCCAATA 59.890 55.0 0.00 0.00 0.00 1.90 F
2679 2837 0.321996 GGTCAGTCCACAGAGGGAAC 59.678 60.0 0.00 0.00 39.05 3.62 F
4133 4820 0.680061 CGTGGATTAGGGAGGTAGGC 59.320 60.0 0.00 0.00 0.00 3.93 F
4679 5373 0.181114 TCATTGAGGCTAATGGCGCT 59.819 50.0 7.64 0.00 44.18 5.92 F
5971 6668 0.035598 TAGCGCTGGTGCTTTGGTAA 59.964 50.0 22.90 0.00 44.46 2.85 F
6558 7255 0.032416 GGCAGAGGGGGTAGTAGTGA 60.032 60.0 0.00 0.00 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2175 2328 0.110295 TATTGGATGGGGTGCGATGG 59.890 55.000 0.00 0.0 0.00 3.51 R
3179 3851 0.320374 CGAACCTGCCTGTTCCACTA 59.680 55.000 9.18 0.0 41.24 2.74 R
3222 3894 0.677731 CATGGTGGCATGAGTTCGGT 60.678 55.000 0.00 0.0 34.66 4.69 R
3342 4015 1.001068 TGCATGCAAGGTTTGATGGTG 59.999 47.619 20.30 0.0 0.00 4.17 R
3792 4479 1.524002 CCAGCCGTCCATCATGACT 59.476 57.895 0.00 0.0 32.97 3.41 R
4276 4967 0.392336 TGTCCCTTTGGCATTTGTGC 59.608 50.000 0.00 0.0 0.00 4.57 R
5568 6265 0.036952 AGGACGATCTTGTGGTGCAG 60.037 55.000 0.00 0.0 29.24 4.41 R
6539 7236 0.032416 TCACTACTACCCCCTCTGCC 60.032 60.000 0.00 0.0 0.00 4.85 R
7703 8409 0.178964 CCTTGCCAAACCCTTCCTCA 60.179 55.000 0.00 0.0 0.00 3.86 R
8467 9178 0.038159 CCGACGCTTTCTCCACTCTT 60.038 55.000 0.00 0.0 0.00 2.85 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 4.778415 CGTCGAGCTCGGGTGTGG 62.778 72.222 33.98 14.07 40.29 4.17
33 34 3.371063 GTCGAGCTCGGGTGTGGA 61.371 66.667 33.98 11.88 40.29 4.02
34 35 3.062466 TCGAGCTCGGGTGTGGAG 61.062 66.667 33.98 4.66 40.29 3.86
35 36 4.135153 CGAGCTCGGGTGTGGAGG 62.135 72.222 28.40 0.00 35.37 4.30
36 37 2.997897 GAGCTCGGGTGTGGAGGT 60.998 66.667 0.00 0.00 44.31 3.85
37 38 3.302347 GAGCTCGGGTGTGGAGGTG 62.302 68.421 0.00 0.00 41.91 4.00
38 39 3.311110 GCTCGGGTGTGGAGGTGA 61.311 66.667 0.00 0.00 32.10 4.02
39 40 2.660064 GCTCGGGTGTGGAGGTGAT 61.660 63.158 0.00 0.00 32.10 3.06
40 41 1.983224 CTCGGGTGTGGAGGTGATT 59.017 57.895 0.00 0.00 0.00 2.57
41 42 0.108138 CTCGGGTGTGGAGGTGATTC 60.108 60.000 0.00 0.00 0.00 2.52
42 43 1.447838 CGGGTGTGGAGGTGATTCG 60.448 63.158 0.00 0.00 0.00 3.34
43 44 1.745489 GGGTGTGGAGGTGATTCGC 60.745 63.158 0.00 0.00 0.00 4.70
44 45 1.745489 GGTGTGGAGGTGATTCGCC 60.745 63.158 8.26 8.26 0.00 5.54
45 46 1.003839 GTGTGGAGGTGATTCGCCA 60.004 57.895 18.18 1.56 36.32 5.69
46 47 0.392998 GTGTGGAGGTGATTCGCCAT 60.393 55.000 18.18 3.72 36.32 4.40
47 48 0.327924 TGTGGAGGTGATTCGCCATT 59.672 50.000 18.18 0.00 36.32 3.16
48 49 1.017387 GTGGAGGTGATTCGCCATTC 58.983 55.000 18.18 7.85 36.32 2.67
49 50 0.911769 TGGAGGTGATTCGCCATTCT 59.088 50.000 18.18 0.00 36.32 2.40
50 51 1.281867 TGGAGGTGATTCGCCATTCTT 59.718 47.619 18.18 0.00 36.32 2.52
51 52 2.290896 TGGAGGTGATTCGCCATTCTTT 60.291 45.455 18.18 0.00 36.32 2.52
52 53 2.755103 GGAGGTGATTCGCCATTCTTTT 59.245 45.455 18.18 0.00 36.32 2.27
53 54 3.181496 GGAGGTGATTCGCCATTCTTTTC 60.181 47.826 18.18 5.14 36.32 2.29
54 55 3.690460 AGGTGATTCGCCATTCTTTTCT 58.310 40.909 18.18 0.00 36.32 2.52
55 56 4.082125 AGGTGATTCGCCATTCTTTTCTT 58.918 39.130 18.18 0.00 36.32 2.52
56 57 4.156739 AGGTGATTCGCCATTCTTTTCTTC 59.843 41.667 18.18 0.00 36.32 2.87
57 58 4.091424 GTGATTCGCCATTCTTTTCTTCG 58.909 43.478 0.00 0.00 0.00 3.79
58 59 3.126858 TGATTCGCCATTCTTTTCTTCGG 59.873 43.478 0.00 0.00 0.00 4.30
59 60 2.178912 TCGCCATTCTTTTCTTCGGT 57.821 45.000 0.00 0.00 0.00 4.69
60 61 1.804151 TCGCCATTCTTTTCTTCGGTG 59.196 47.619 0.00 0.00 0.00 4.94
61 62 1.135689 CGCCATTCTTTTCTTCGGTGG 60.136 52.381 0.00 0.00 0.00 4.61
62 63 1.402852 GCCATTCTTTTCTTCGGTGGC 60.403 52.381 0.00 0.00 43.09 5.01
63 64 2.162681 CCATTCTTTTCTTCGGTGGCT 58.837 47.619 0.00 0.00 0.00 4.75
64 65 3.343617 CCATTCTTTTCTTCGGTGGCTA 58.656 45.455 0.00 0.00 0.00 3.93
65 66 3.127030 CCATTCTTTTCTTCGGTGGCTAC 59.873 47.826 0.00 0.00 0.00 3.58
66 67 3.764237 TTCTTTTCTTCGGTGGCTACT 57.236 42.857 0.00 0.00 0.00 2.57
67 68 3.040147 TCTTTTCTTCGGTGGCTACTG 57.960 47.619 1.91 1.91 34.36 2.74
68 69 2.631062 TCTTTTCTTCGGTGGCTACTGA 59.369 45.455 7.79 7.79 40.39 3.41
69 70 2.743636 TTTCTTCGGTGGCTACTGAG 57.256 50.000 11.89 6.94 42.84 3.35
70 71 0.895530 TTCTTCGGTGGCTACTGAGG 59.104 55.000 14.13 14.13 42.84 3.86
71 72 0.251653 TCTTCGGTGGCTACTGAGGT 60.252 55.000 18.62 0.00 42.84 3.85
72 73 0.108615 CTTCGGTGGCTACTGAGGTG 60.109 60.000 11.89 3.51 42.84 4.00
73 74 1.541310 TTCGGTGGCTACTGAGGTGG 61.541 60.000 11.89 0.00 42.84 4.61
74 75 2.283529 CGGTGGCTACTGAGGTGGT 61.284 63.158 2.19 0.00 35.05 4.16
75 76 1.296715 GGTGGCTACTGAGGTGGTG 59.703 63.158 0.00 0.00 0.00 4.17
76 77 1.376037 GTGGCTACTGAGGTGGTGC 60.376 63.158 0.00 0.00 0.00 5.01
77 78 2.269241 GGCTACTGAGGTGGTGCC 59.731 66.667 0.00 0.00 33.41 5.01
78 79 2.125512 GCTACTGAGGTGGTGCCG 60.126 66.667 0.00 0.00 43.70 5.69
79 80 2.646175 GCTACTGAGGTGGTGCCGA 61.646 63.158 0.00 0.00 43.70 5.54
80 81 1.972198 CTACTGAGGTGGTGCCGAA 59.028 57.895 0.00 0.00 43.70 4.30
81 82 0.108615 CTACTGAGGTGGTGCCGAAG 60.109 60.000 0.00 0.00 43.70 3.79
93 94 3.691342 CCGAAGGCAGGTGACGGA 61.691 66.667 0.00 0.00 46.14 4.69
94 95 2.432628 CGAAGGCAGGTGACGGAC 60.433 66.667 0.00 0.00 0.00 4.79
95 96 2.432628 GAAGGCAGGTGACGGACG 60.433 66.667 0.00 0.00 39.28 4.79
96 97 3.222354 GAAGGCAGGTGACGGACGT 62.222 63.158 0.00 0.00 39.28 4.34
97 98 2.710724 GAAGGCAGGTGACGGACGTT 62.711 60.000 0.00 0.00 39.28 3.99
98 99 2.989055 AAGGCAGGTGACGGACGTTG 62.989 60.000 0.00 0.00 39.28 4.10
99 100 3.041940 GCAGGTGACGGACGTTGG 61.042 66.667 0.00 0.00 0.00 3.77
100 101 2.420043 CAGGTGACGGACGTTGGT 59.580 61.111 0.00 0.00 0.00 3.67
101 102 1.954146 CAGGTGACGGACGTTGGTG 60.954 63.158 0.00 0.00 0.00 4.17
102 103 2.107546 GGTGACGGACGTTGGTGT 59.892 61.111 0.00 0.00 0.00 4.16
103 104 1.952635 GGTGACGGACGTTGGTGTC 60.953 63.158 0.00 0.00 38.17 3.67
104 105 1.227031 GTGACGGACGTTGGTGTCA 60.227 57.895 0.00 8.43 40.72 3.58
105 106 0.806884 GTGACGGACGTTGGTGTCAA 60.807 55.000 12.55 0.00 42.43 3.18
106 107 0.528901 TGACGGACGTTGGTGTCAAG 60.529 55.000 9.64 0.00 40.72 3.02
107 108 1.828331 GACGGACGTTGGTGTCAAGC 61.828 60.000 0.00 0.00 40.72 4.01
108 109 1.594293 CGGACGTTGGTGTCAAGCT 60.594 57.895 0.00 0.00 40.72 3.74
109 110 1.557443 CGGACGTTGGTGTCAAGCTC 61.557 60.000 0.00 0.00 40.72 4.09
110 111 0.531974 GGACGTTGGTGTCAAGCTCA 60.532 55.000 0.00 0.00 40.72 4.26
111 112 0.861837 GACGTTGGTGTCAAGCTCAG 59.138 55.000 0.00 0.00 38.75 3.35
112 113 0.464036 ACGTTGGTGTCAAGCTCAGA 59.536 50.000 0.00 0.00 32.92 3.27
113 114 1.143305 CGTTGGTGTCAAGCTCAGAG 58.857 55.000 0.00 0.00 32.92 3.35
114 115 1.269778 CGTTGGTGTCAAGCTCAGAGA 60.270 52.381 0.00 0.00 32.92 3.10
115 116 2.611473 CGTTGGTGTCAAGCTCAGAGAT 60.611 50.000 0.00 0.00 32.92 2.75
116 117 2.740981 GTTGGTGTCAAGCTCAGAGATG 59.259 50.000 0.00 0.00 32.92 2.90
117 118 1.973515 TGGTGTCAAGCTCAGAGATGT 59.026 47.619 0.00 0.00 0.00 3.06
118 119 2.369860 TGGTGTCAAGCTCAGAGATGTT 59.630 45.455 0.00 0.00 0.00 2.71
119 120 2.999355 GGTGTCAAGCTCAGAGATGTTC 59.001 50.000 0.00 0.00 0.00 3.18
120 121 3.306641 GGTGTCAAGCTCAGAGATGTTCT 60.307 47.826 0.00 0.00 36.25 3.01
134 135 7.660112 CAGAGATGTTCTGCTATCTATTCAGT 58.340 38.462 0.00 0.00 46.30 3.41
135 136 8.143193 CAGAGATGTTCTGCTATCTATTCAGTT 58.857 37.037 0.00 0.00 46.30 3.16
136 137 8.703743 AGAGATGTTCTGCTATCTATTCAGTTT 58.296 33.333 0.00 0.00 33.97 2.66
137 138 8.885494 AGATGTTCTGCTATCTATTCAGTTTC 57.115 34.615 0.00 0.00 32.13 2.78
138 139 7.651304 AGATGTTCTGCTATCTATTCAGTTTCG 59.349 37.037 0.00 0.00 32.13 3.46
139 140 6.631016 TGTTCTGCTATCTATTCAGTTTCGT 58.369 36.000 0.00 0.00 0.00 3.85
140 141 6.752351 TGTTCTGCTATCTATTCAGTTTCGTC 59.248 38.462 0.00 0.00 0.00 4.20
141 142 6.451064 TCTGCTATCTATTCAGTTTCGTCA 57.549 37.500 0.00 0.00 0.00 4.35
142 143 7.043961 TCTGCTATCTATTCAGTTTCGTCAT 57.956 36.000 0.00 0.00 0.00 3.06
143 144 6.920210 TCTGCTATCTATTCAGTTTCGTCATG 59.080 38.462 0.00 0.00 0.00 3.07
144 145 6.573434 TGCTATCTATTCAGTTTCGTCATGT 58.427 36.000 0.00 0.00 0.00 3.21
145 146 6.697455 TGCTATCTATTCAGTTTCGTCATGTC 59.303 38.462 0.00 0.00 0.00 3.06
146 147 6.129326 GCTATCTATTCAGTTTCGTCATGTCG 60.129 42.308 5.98 5.98 0.00 4.35
147 148 4.421058 TCTATTCAGTTTCGTCATGTCGG 58.579 43.478 12.31 0.00 0.00 4.79
148 149 2.519377 TTCAGTTTCGTCATGTCGGT 57.481 45.000 12.31 0.00 0.00 4.69
149 150 2.060326 TCAGTTTCGTCATGTCGGTC 57.940 50.000 12.31 3.92 0.00 4.79
150 151 1.611977 TCAGTTTCGTCATGTCGGTCT 59.388 47.619 12.31 5.93 0.00 3.85
151 152 2.035449 TCAGTTTCGTCATGTCGGTCTT 59.965 45.455 12.31 0.00 0.00 3.01
152 153 2.800544 CAGTTTCGTCATGTCGGTCTTT 59.199 45.455 12.31 0.00 0.00 2.52
153 154 3.985279 CAGTTTCGTCATGTCGGTCTTTA 59.015 43.478 12.31 0.00 0.00 1.85
154 155 3.985925 AGTTTCGTCATGTCGGTCTTTAC 59.014 43.478 12.31 2.91 0.00 2.01
155 156 2.251869 TCGTCATGTCGGTCTTTACG 57.748 50.000 12.31 2.17 0.00 3.18
156 157 1.536766 TCGTCATGTCGGTCTTTACGT 59.463 47.619 12.31 0.00 0.00 3.57
157 158 1.647213 CGTCATGTCGGTCTTTACGTG 59.353 52.381 4.33 0.00 34.57 4.49
158 159 2.666344 CGTCATGTCGGTCTTTACGTGA 60.666 50.000 4.33 0.00 38.87 4.35
159 160 2.937591 TCATGTCGGTCTTTACGTGAC 58.062 47.619 0.00 0.00 36.86 3.67
160 161 2.555325 TCATGTCGGTCTTTACGTGACT 59.445 45.455 0.00 0.00 36.86 3.41
161 162 3.005050 TCATGTCGGTCTTTACGTGACTT 59.995 43.478 0.00 0.00 36.86 3.01
162 163 2.734670 TGTCGGTCTTTACGTGACTTG 58.265 47.619 0.00 0.00 34.50 3.16
163 164 2.099592 TGTCGGTCTTTACGTGACTTGT 59.900 45.455 0.00 0.00 34.50 3.16
164 165 3.314913 TGTCGGTCTTTACGTGACTTGTA 59.685 43.478 0.00 0.00 34.50 2.41
165 166 4.022935 TGTCGGTCTTTACGTGACTTGTAT 60.023 41.667 0.00 0.00 34.50 2.29
166 167 4.919754 GTCGGTCTTTACGTGACTTGTATT 59.080 41.667 0.00 0.00 35.04 1.89
167 168 5.403466 GTCGGTCTTTACGTGACTTGTATTT 59.597 40.000 0.00 0.00 35.04 1.40
168 169 5.984926 TCGGTCTTTACGTGACTTGTATTTT 59.015 36.000 0.00 0.00 35.04 1.82
169 170 6.068931 CGGTCTTTACGTGACTTGTATTTTG 58.931 40.000 0.00 0.00 35.04 2.44
170 171 6.292488 CGGTCTTTACGTGACTTGTATTTTGT 60.292 38.462 0.00 0.00 35.04 2.83
171 172 7.412063 GGTCTTTACGTGACTTGTATTTTGTT 58.588 34.615 0.00 0.00 35.04 2.83
172 173 7.585210 GGTCTTTACGTGACTTGTATTTTGTTC 59.415 37.037 0.00 0.00 35.04 3.18
173 174 8.333186 GTCTTTACGTGACTTGTATTTTGTTCT 58.667 33.333 0.00 0.00 0.00 3.01
174 175 8.885722 TCTTTACGTGACTTGTATTTTGTTCTT 58.114 29.630 0.00 0.00 0.00 2.52
175 176 9.498307 CTTTACGTGACTTGTATTTTGTTCTTT 57.502 29.630 0.00 0.00 0.00 2.52
179 180 8.832521 ACGTGACTTGTATTTTGTTCTTTATGA 58.167 29.630 0.00 0.00 0.00 2.15
180 181 9.825972 CGTGACTTGTATTTTGTTCTTTATGAT 57.174 29.630 0.00 0.00 0.00 2.45
208 209 9.850198 TGAATGAGACATGTATTATCATGGAAA 57.150 29.630 13.15 0.00 46.39 3.13
259 260 3.475494 TGTCACACGGTGGCCACT 61.475 61.111 33.91 14.25 37.35 4.00
275 276 0.992072 CACTAGTGCATCGTCAACCG 59.008 55.000 10.54 0.00 38.13 4.44
309 310 4.856801 ACGGCGGGCCAAGCATAG 62.857 66.667 21.55 14.75 36.08 2.23
334 335 2.858344 CACAGTTAAACGGAGCTATCGG 59.142 50.000 12.59 0.00 0.00 4.18
353 354 4.344865 GGAACCTTGGCCCGAGCA 62.345 66.667 0.00 0.00 42.56 4.26
374 375 0.034896 CACGGTTTCTACAGGCCAGT 59.965 55.000 5.01 5.51 0.00 4.00
386 387 2.029964 GCCAGTCCGAACGGTCAA 59.970 61.111 12.93 0.00 36.47 3.18
445 446 8.514594 CCAGATTTTTCAACTAGACTTATGCAA 58.485 33.333 0.00 0.00 0.00 4.08
450 451 2.604046 ACTAGACTTATGCAAGGCGG 57.396 50.000 0.00 0.00 45.31 6.13
468 469 0.242017 GGGAACATGCACTGCACTTC 59.758 55.000 5.67 9.89 43.04 3.01
479 480 1.081892 CTGCACTTCTCATGGAACCG 58.918 55.000 0.00 0.00 0.00 4.44
480 481 0.321564 TGCACTTCTCATGGAACCGG 60.322 55.000 0.00 0.00 0.00 5.28
481 482 0.036388 GCACTTCTCATGGAACCGGA 60.036 55.000 9.46 0.00 0.00 5.14
513 514 0.663568 CTACGTATACGCCAGCTGCC 60.664 60.000 24.64 0.00 44.43 4.85
518 519 1.043116 TATACGCCAGCTGCCTCTGT 61.043 55.000 8.66 4.07 36.24 3.41
519 520 1.043116 ATACGCCAGCTGCCTCTGTA 61.043 55.000 8.66 6.23 36.24 2.74
520 521 1.254975 TACGCCAGCTGCCTCTGTAA 61.255 55.000 8.66 0.00 36.24 2.41
550 551 1.647545 AATTGGACGCGGACATGCAG 61.648 55.000 12.47 0.00 34.15 4.41
551 552 2.803155 ATTGGACGCGGACATGCAGT 62.803 55.000 12.47 0.00 34.15 4.40
564 565 4.372656 GACATGCAGTCAATAGTACTCCC 58.627 47.826 0.00 0.00 46.77 4.30
565 566 4.033709 ACATGCAGTCAATAGTACTCCCT 58.966 43.478 0.00 0.00 0.00 4.20
566 567 4.100189 ACATGCAGTCAATAGTACTCCCTC 59.900 45.833 0.00 0.00 0.00 4.30
567 568 3.031736 TGCAGTCAATAGTACTCCCTCC 58.968 50.000 0.00 0.00 0.00 4.30
568 569 3.031736 GCAGTCAATAGTACTCCCTCCA 58.968 50.000 0.00 0.00 0.00 3.86
569 570 3.643792 GCAGTCAATAGTACTCCCTCCAT 59.356 47.826 0.00 0.00 0.00 3.41
570 571 4.101741 GCAGTCAATAGTACTCCCTCCATT 59.898 45.833 0.00 0.00 0.00 3.16
571 572 5.396884 GCAGTCAATAGTACTCCCTCCATTT 60.397 44.000 0.00 0.00 0.00 2.32
572 573 6.653989 CAGTCAATAGTACTCCCTCCATTTT 58.346 40.000 0.00 0.00 0.00 1.82
573 574 7.112779 CAGTCAATAGTACTCCCTCCATTTTT 58.887 38.462 0.00 0.00 0.00 1.94
574 575 8.265055 CAGTCAATAGTACTCCCTCCATTTTTA 58.735 37.037 0.00 0.00 0.00 1.52
575 576 9.004231 AGTCAATAGTACTCCCTCCATTTTTAT 57.996 33.333 0.00 0.00 0.00 1.40
581 582 8.625467 AGTACTCCCTCCATTTTTATAAGTCT 57.375 34.615 0.00 0.00 0.00 3.24
582 583 9.059023 AGTACTCCCTCCATTTTTATAAGTCTT 57.941 33.333 0.00 0.00 0.00 3.01
583 584 9.682465 GTACTCCCTCCATTTTTATAAGTCTTT 57.318 33.333 0.00 0.00 0.00 2.52
584 585 8.581253 ACTCCCTCCATTTTTATAAGTCTTTG 57.419 34.615 0.00 0.00 0.00 2.77
585 586 8.170730 ACTCCCTCCATTTTTATAAGTCTTTGT 58.829 33.333 0.00 0.00 0.00 2.83
586 587 9.681062 CTCCCTCCATTTTTATAAGTCTTTGTA 57.319 33.333 0.00 0.00 0.00 2.41
587 588 9.681062 TCCCTCCATTTTTATAAGTCTTTGTAG 57.319 33.333 0.00 0.00 0.00 2.74
588 589 9.681062 CCCTCCATTTTTATAAGTCTTTGTAGA 57.319 33.333 0.00 0.00 0.00 2.59
597 598 9.944376 TTTATAAGTCTTTGTAGAGATTGCACT 57.056 29.630 0.00 0.00 0.00 4.40
600 601 7.840342 AAGTCTTTGTAGAGATTGCACTATG 57.160 36.000 0.00 0.00 0.00 2.23
601 602 6.940739 AGTCTTTGTAGAGATTGCACTATGT 58.059 36.000 0.00 0.00 0.00 2.29
602 603 6.815641 AGTCTTTGTAGAGATTGCACTATGTG 59.184 38.462 0.00 0.00 36.51 3.21
603 604 6.813649 GTCTTTGTAGAGATTGCACTATGTGA 59.186 38.462 1.52 0.00 35.23 3.58
604 605 7.331934 GTCTTTGTAGAGATTGCACTATGTGAA 59.668 37.037 1.52 0.00 35.23 3.18
605 606 8.043113 TCTTTGTAGAGATTGCACTATGTGAAT 58.957 33.333 1.52 0.00 35.23 2.57
606 607 8.565896 TTTGTAGAGATTGCACTATGTGAATT 57.434 30.769 1.52 0.00 35.23 2.17
607 608 9.665719 TTTGTAGAGATTGCACTATGTGAATTA 57.334 29.630 1.52 0.00 35.23 1.40
608 609 8.648557 TGTAGAGATTGCACTATGTGAATTAC 57.351 34.615 1.52 1.32 35.23 1.89
609 610 8.257306 TGTAGAGATTGCACTATGTGAATTACA 58.743 33.333 1.52 0.00 44.87 2.41
622 623 6.751514 TGTGAATTACATACGGAGCAAAAT 57.248 33.333 0.00 0.00 33.42 1.82
623 624 6.550843 TGTGAATTACATACGGAGCAAAATG 58.449 36.000 0.00 0.00 33.42 2.32
624 625 6.372937 TGTGAATTACATACGGAGCAAAATGA 59.627 34.615 0.00 0.00 33.42 2.57
625 626 7.094592 TGTGAATTACATACGGAGCAAAATGAA 60.095 33.333 0.00 0.00 33.42 2.57
626 627 7.915397 GTGAATTACATACGGAGCAAAATGAAT 59.085 33.333 0.00 0.00 0.00 2.57
627 628 7.914871 TGAATTACATACGGAGCAAAATGAATG 59.085 33.333 0.00 0.00 0.00 2.67
628 629 6.993786 TTACATACGGAGCAAAATGAATGA 57.006 33.333 0.00 0.00 0.00 2.57
629 630 5.895636 ACATACGGAGCAAAATGAATGAA 57.104 34.783 0.00 0.00 0.00 2.57
630 631 6.455360 ACATACGGAGCAAAATGAATGAAT 57.545 33.333 0.00 0.00 0.00 2.57
631 632 6.498304 ACATACGGAGCAAAATGAATGAATC 58.502 36.000 0.00 0.00 0.00 2.52
632 633 6.319658 ACATACGGAGCAAAATGAATGAATCT 59.680 34.615 0.00 0.00 0.00 2.40
633 634 7.498900 ACATACGGAGCAAAATGAATGAATCTA 59.501 33.333 0.00 0.00 0.00 1.98
634 635 6.757897 ACGGAGCAAAATGAATGAATCTAA 57.242 33.333 0.00 0.00 0.00 2.10
635 636 7.156876 ACGGAGCAAAATGAATGAATCTAAA 57.843 32.000 0.00 0.00 0.00 1.85
636 637 7.029563 ACGGAGCAAAATGAATGAATCTAAAC 58.970 34.615 0.00 0.00 0.00 2.01
637 638 7.094205 ACGGAGCAAAATGAATGAATCTAAACT 60.094 33.333 0.00 0.00 0.00 2.66
638 639 7.756722 CGGAGCAAAATGAATGAATCTAAACTT 59.243 33.333 0.00 0.00 0.00 2.66
660 661 9.944376 AACTTAAATGCATCTATATACATCCGT 57.056 29.630 0.00 0.00 0.00 4.69
664 665 7.953158 AATGCATCTATATACATCCGTATGC 57.047 36.000 0.00 0.00 38.79 3.14
665 666 5.519722 TGCATCTATATACATCCGTATGCG 58.480 41.667 0.00 0.00 38.79 4.73
681 682 6.764877 CGTATGCGGTTTATAGTGAAATCT 57.235 37.500 0.00 0.00 0.00 2.40
682 683 6.808264 CGTATGCGGTTTATAGTGAAATCTC 58.192 40.000 0.00 0.00 0.00 2.75
683 684 6.641314 CGTATGCGGTTTATAGTGAAATCTCT 59.359 38.462 0.00 0.00 0.00 3.10
684 685 7.806487 CGTATGCGGTTTATAGTGAAATCTCTA 59.194 37.037 0.00 0.00 0.00 2.43
685 686 7.948278 ATGCGGTTTATAGTGAAATCTCTAC 57.052 36.000 0.00 0.00 0.00 2.59
686 687 6.869695 TGCGGTTTATAGTGAAATCTCTACA 58.130 36.000 0.00 0.00 0.00 2.74
687 688 7.324935 TGCGGTTTATAGTGAAATCTCTACAA 58.675 34.615 0.00 0.00 0.00 2.41
688 689 7.820386 TGCGGTTTATAGTGAAATCTCTACAAA 59.180 33.333 0.00 0.00 0.00 2.83
689 690 8.328864 GCGGTTTATAGTGAAATCTCTACAAAG 58.671 37.037 0.00 0.00 0.00 2.77
690 691 9.582431 CGGTTTATAGTGAAATCTCTACAAAGA 57.418 33.333 0.00 0.00 0.00 2.52
707 708 9.970395 TCTACAAAGACTTACATTTAGAAACGA 57.030 29.630 0.00 0.00 0.00 3.85
710 711 8.557029 ACAAAGACTTACATTTAGAAACGAAGG 58.443 33.333 0.00 0.00 0.00 3.46
711 712 7.668525 AAGACTTACATTTAGAAACGAAGGG 57.331 36.000 0.00 0.00 0.00 3.95
712 713 7.001099 AGACTTACATTTAGAAACGAAGGGA 57.999 36.000 0.00 0.00 0.00 4.20
713 714 7.097834 AGACTTACATTTAGAAACGAAGGGAG 58.902 38.462 0.00 0.00 0.00 4.30
714 715 6.766429 ACTTACATTTAGAAACGAAGGGAGT 58.234 36.000 0.00 0.00 0.00 3.85
715 716 7.899973 ACTTACATTTAGAAACGAAGGGAGTA 58.100 34.615 0.00 0.00 0.00 2.59
716 717 7.816513 ACTTACATTTAGAAACGAAGGGAGTAC 59.183 37.037 0.00 0.00 0.00 2.73
717 718 6.356186 ACATTTAGAAACGAAGGGAGTACT 57.644 37.500 0.00 0.00 0.00 2.73
718 719 7.472334 ACATTTAGAAACGAAGGGAGTACTA 57.528 36.000 0.00 0.00 0.00 1.82
719 720 8.075761 ACATTTAGAAACGAAGGGAGTACTAT 57.924 34.615 0.00 0.00 0.00 2.12
720 721 7.980099 ACATTTAGAAACGAAGGGAGTACTATG 59.020 37.037 0.00 0.00 0.00 2.23
721 722 7.472334 TTTAGAAACGAAGGGAGTACTATGT 57.528 36.000 0.00 0.00 0.00 2.29
722 723 8.579850 TTTAGAAACGAAGGGAGTACTATGTA 57.420 34.615 0.00 0.00 0.00 2.29
723 724 8.757982 TTAGAAACGAAGGGAGTACTATGTAT 57.242 34.615 0.00 0.00 0.00 2.29
724 725 9.851686 TTAGAAACGAAGGGAGTACTATGTATA 57.148 33.333 0.00 0.00 0.00 1.47
725 726 8.393671 AGAAACGAAGGGAGTACTATGTATAG 57.606 38.462 0.00 0.00 36.46 1.31
726 727 8.216423 AGAAACGAAGGGAGTACTATGTATAGA 58.784 37.037 0.00 0.00 34.50 1.98
727 728 7.742556 AACGAAGGGAGTACTATGTATAGAC 57.257 40.000 0.00 1.02 34.50 2.59
728 729 6.237154 ACGAAGGGAGTACTATGTATAGACC 58.763 44.000 0.00 0.00 34.50 3.85
729 730 6.183361 ACGAAGGGAGTACTATGTATAGACCA 60.183 42.308 0.00 0.00 34.50 4.02
730 731 6.372103 CGAAGGGAGTACTATGTATAGACCAG 59.628 46.154 0.00 0.00 34.50 4.00
731 732 5.572252 AGGGAGTACTATGTATAGACCAGC 58.428 45.833 0.00 0.00 34.50 4.85
732 733 5.313772 AGGGAGTACTATGTATAGACCAGCT 59.686 44.000 0.00 0.00 34.50 4.24
733 734 5.416326 GGGAGTACTATGTATAGACCAGCTG 59.584 48.000 6.78 6.78 34.50 4.24
734 735 5.106078 GGAGTACTATGTATAGACCAGCTGC 60.106 48.000 8.66 0.00 34.50 5.25
735 736 5.636123 AGTACTATGTATAGACCAGCTGCT 58.364 41.667 8.66 3.34 34.50 4.24
736 737 6.071984 AGTACTATGTATAGACCAGCTGCTT 58.928 40.000 8.66 0.00 34.50 3.91
737 738 5.461032 ACTATGTATAGACCAGCTGCTTC 57.539 43.478 8.66 6.83 34.50 3.86
738 739 5.144100 ACTATGTATAGACCAGCTGCTTCT 58.856 41.667 17.43 17.43 34.50 2.85
739 740 3.808466 TGTATAGACCAGCTGCTTCTG 57.192 47.619 20.81 5.95 0.00 3.02
740 741 3.099905 TGTATAGACCAGCTGCTTCTGT 58.900 45.455 20.81 17.59 32.32 3.41
741 742 4.278310 TGTATAGACCAGCTGCTTCTGTA 58.722 43.478 20.81 16.79 32.32 2.74
742 743 4.709886 TGTATAGACCAGCTGCTTCTGTAA 59.290 41.667 20.81 6.65 32.32 2.41
743 744 2.758736 AGACCAGCTGCTTCTGTAAG 57.241 50.000 8.66 0.00 35.68 2.34
744 745 2.251818 AGACCAGCTGCTTCTGTAAGA 58.748 47.619 8.66 0.00 44.68 2.10
759 760 5.607477 TCTGTAAGAACTTCAATTGGACGT 58.393 37.500 5.42 0.00 42.31 4.34
760 761 5.694910 TCTGTAAGAACTTCAATTGGACGTC 59.305 40.000 7.13 7.13 42.31 4.34
761 762 4.753107 TGTAAGAACTTCAATTGGACGTCC 59.247 41.667 28.17 28.17 0.00 4.79
762 763 3.485463 AGAACTTCAATTGGACGTCCA 57.515 42.857 33.23 33.23 45.94 4.02
763 764 9.359217 CTGTAAGAACTTCAATTGGACGTCCAC 62.359 44.444 36.40 20.85 41.15 4.02
770 771 3.147132 TGGACGTCCACATGCAGT 58.853 55.556 33.23 0.00 42.01 4.40
771 772 1.005037 TGGACGTCCACATGCAGTC 60.005 57.895 33.23 3.57 42.01 3.51
772 773 1.741770 GGACGTCCACATGCAGTCC 60.742 63.158 29.75 3.57 43.55 3.85
773 774 1.005037 GACGTCCACATGCAGTCCA 60.005 57.895 3.51 0.00 0.00 4.02
774 775 0.602638 GACGTCCACATGCAGTCCAA 60.603 55.000 3.51 0.00 0.00 3.53
775 776 0.036732 ACGTCCACATGCAGTCCAAT 59.963 50.000 0.00 0.00 0.00 3.16
776 777 1.277842 ACGTCCACATGCAGTCCAATA 59.722 47.619 0.00 0.00 0.00 1.90
777 778 1.665679 CGTCCACATGCAGTCCAATAC 59.334 52.381 0.00 0.00 0.00 1.89
778 779 2.677902 CGTCCACATGCAGTCCAATACT 60.678 50.000 0.00 0.00 39.81 2.12
779 780 3.430236 CGTCCACATGCAGTCCAATACTA 60.430 47.826 0.00 0.00 35.76 1.82
780 781 4.122776 GTCCACATGCAGTCCAATACTAG 58.877 47.826 0.00 0.00 35.76 2.57
781 782 3.774766 TCCACATGCAGTCCAATACTAGT 59.225 43.478 0.00 0.00 35.76 2.57
782 783 4.122776 CCACATGCAGTCCAATACTAGTC 58.877 47.826 0.00 0.00 35.76 2.59
783 784 4.122776 CACATGCAGTCCAATACTAGTCC 58.877 47.826 0.00 0.00 35.76 3.85
784 785 3.774766 ACATGCAGTCCAATACTAGTCCA 59.225 43.478 0.00 0.00 35.76 4.02
785 786 4.141846 ACATGCAGTCCAATACTAGTCCAG 60.142 45.833 0.00 0.00 35.76 3.86
786 787 3.441101 TGCAGTCCAATACTAGTCCAGT 58.559 45.455 0.00 0.00 41.62 4.00
787 788 4.606210 TGCAGTCCAATACTAGTCCAGTA 58.394 43.478 0.00 0.00 43.89 2.74
788 789 4.401519 TGCAGTCCAATACTAGTCCAGTAC 59.598 45.833 0.00 0.00 42.56 2.73
816 817 1.669760 CGCCACCTGCTTCCGTAAA 60.670 57.895 0.00 0.00 38.05 2.01
839 840 6.684897 AAAATTCATTTCACTTGGATGGGA 57.315 33.333 0.00 0.00 0.00 4.37
856 857 1.221414 GGAACATGCTGTCCGATAGC 58.779 55.000 10.05 10.05 41.49 2.97
861 862 3.441244 TGCTGTCCGATAGCACTTG 57.559 52.632 15.21 0.00 45.52 3.16
862 863 0.608130 TGCTGTCCGATAGCACTTGT 59.392 50.000 15.21 0.00 45.52 3.16
863 864 1.822371 TGCTGTCCGATAGCACTTGTA 59.178 47.619 15.21 0.00 45.52 2.41
864 865 2.194271 GCTGTCCGATAGCACTTGTAC 58.806 52.381 11.93 0.00 40.81 2.90
865 866 2.159226 GCTGTCCGATAGCACTTGTACT 60.159 50.000 11.93 0.00 40.81 2.73
866 867 3.696898 CTGTCCGATAGCACTTGTACTC 58.303 50.000 0.00 0.00 0.00 2.59
867 868 2.426024 TGTCCGATAGCACTTGTACTCC 59.574 50.000 0.00 0.00 0.00 3.85
868 869 2.688958 GTCCGATAGCACTTGTACTCCT 59.311 50.000 0.00 0.00 0.00 3.69
869 870 3.881688 GTCCGATAGCACTTGTACTCCTA 59.118 47.826 0.00 0.00 0.00 2.94
873 874 5.472478 CCGATAGCACTTGTACTCCTATACA 59.528 44.000 0.00 0.00 33.18 2.29
896 897 1.345741 TCTGCTTGCTTGCTGACTAGT 59.654 47.619 0.00 0.00 36.30 2.57
910 911 4.142945 GCTGACTAGTCAAGAATGCACAAG 60.143 45.833 25.14 10.81 39.39 3.16
914 915 6.017934 TGACTAGTCAAGAATGCACAAGTTTC 60.018 38.462 23.24 0.00 36.53 2.78
915 916 5.822519 ACTAGTCAAGAATGCACAAGTTTCA 59.177 36.000 0.00 0.00 0.00 2.69
916 917 5.179045 AGTCAAGAATGCACAAGTTTCAG 57.821 39.130 0.00 0.00 0.00 3.02
930 931 4.696899 AGTTTCAGCCTTATAAAACGCC 57.303 40.909 0.00 0.00 36.86 5.68
934 935 3.013921 TCAGCCTTATAAAACGCCCAAG 58.986 45.455 0.00 0.00 0.00 3.61
938 939 3.003378 GCCTTATAAAACGCCCAAGCTAG 59.997 47.826 0.00 0.00 36.60 3.42
939 940 3.003378 CCTTATAAAACGCCCAAGCTAGC 59.997 47.826 6.62 6.62 36.60 3.42
940 941 2.420058 ATAAAACGCCCAAGCTAGCT 57.580 45.000 12.68 12.68 36.60 3.32
942 943 1.450025 AAAACGCCCAAGCTAGCTAC 58.550 50.000 19.70 7.27 36.60 3.58
943 944 0.613777 AAACGCCCAAGCTAGCTACT 59.386 50.000 19.70 0.00 36.60 2.57
944 945 1.481871 AACGCCCAAGCTAGCTACTA 58.518 50.000 19.70 0.00 36.60 1.82
946 947 0.032267 CGCCCAAGCTAGCTACTACC 59.968 60.000 19.70 5.03 36.60 3.18
947 948 0.393448 GCCCAAGCTAGCTACTACCC 59.607 60.000 19.70 0.95 35.50 3.69
948 949 1.789523 CCCAAGCTAGCTACTACCCA 58.210 55.000 19.70 0.00 0.00 4.51
949 950 2.116238 CCCAAGCTAGCTACTACCCAA 58.884 52.381 19.70 0.00 0.00 4.12
950 951 2.706190 CCCAAGCTAGCTACTACCCAAT 59.294 50.000 19.70 0.00 0.00 3.16
951 952 3.901844 CCCAAGCTAGCTACTACCCAATA 59.098 47.826 19.70 0.00 0.00 1.90
952 953 4.021016 CCCAAGCTAGCTACTACCCAATAG 60.021 50.000 19.70 0.00 36.89 1.73
953 954 4.561105 CAAGCTAGCTACTACCCAATAGC 58.439 47.826 19.70 0.00 43.49 2.97
1047 1101 4.056125 CTCGCGGTGGCTCTGTCA 62.056 66.667 6.13 0.00 36.88 3.58
1112 1166 1.469335 AAGACCGCGGAGAGTTTGGA 61.469 55.000 35.90 0.00 0.00 3.53
1120 1174 2.359230 AGAGTTTGGAGCAGCGGC 60.359 61.111 0.00 0.00 41.61 6.53
1155 1209 2.125350 CTCCTCAGGCGGCTCAAC 60.125 66.667 9.32 0.00 0.00 3.18
1174 1228 2.888447 AAGCCTCCTGTCGCAAGCT 61.888 57.895 0.00 0.00 37.18 3.74
1178 1232 0.603707 CCTCCTGTCGCAAGCTTTCA 60.604 55.000 0.00 0.00 37.18 2.69
1186 1240 2.076100 TCGCAAGCTTTCAGGTACATG 58.924 47.619 0.00 0.00 37.18 3.21
1191 1245 4.142403 GCAAGCTTTCAGGTACATGCATAA 60.142 41.667 1.79 0.00 30.02 1.90
1192 1246 5.575957 CAAGCTTTCAGGTACATGCATAAG 58.424 41.667 1.79 7.43 0.00 1.73
1193 1247 3.629398 AGCTTTCAGGTACATGCATAAGC 59.371 43.478 22.63 22.63 42.57 3.09
1213 1267 1.867233 CATATGTACGTTCAGCCTGCC 59.133 52.381 0.00 0.00 0.00 4.85
1215 1269 1.836999 ATGTACGTTCAGCCTGCCCA 61.837 55.000 0.00 0.00 0.00 5.36
1216 1270 1.302192 GTACGTTCAGCCTGCCCAA 60.302 57.895 0.00 0.00 0.00 4.12
1217 1271 0.676782 GTACGTTCAGCCTGCCCAAT 60.677 55.000 0.00 0.00 0.00 3.16
1218 1272 0.906066 TACGTTCAGCCTGCCCAATA 59.094 50.000 0.00 0.00 0.00 1.90
1221 1275 1.673168 GTTCAGCCTGCCCAATAGAG 58.327 55.000 0.00 0.00 0.00 2.43
1222 1276 0.548031 TTCAGCCTGCCCAATAGAGG 59.452 55.000 0.00 0.00 0.00 3.69
1223 1277 0.326522 TCAGCCTGCCCAATAGAGGA 60.327 55.000 0.00 0.00 0.00 3.71
1224 1278 0.108207 CAGCCTGCCCAATAGAGGAG 59.892 60.000 0.00 0.00 0.00 3.69
1226 1280 0.839946 GCCTGCCCAATAGAGGAGAA 59.160 55.000 0.00 0.00 0.00 2.87
1227 1281 1.202746 GCCTGCCCAATAGAGGAGAAG 60.203 57.143 0.00 0.00 0.00 2.85
1229 1283 2.158842 CCTGCCCAATAGAGGAGAAGTG 60.159 54.545 0.00 0.00 0.00 3.16
1230 1284 2.768527 CTGCCCAATAGAGGAGAAGTGA 59.231 50.000 0.00 0.00 0.00 3.41
1231 1285 3.387962 TGCCCAATAGAGGAGAAGTGAT 58.612 45.455 0.00 0.00 0.00 3.06
1232 1286 3.135348 TGCCCAATAGAGGAGAAGTGATG 59.865 47.826 0.00 0.00 0.00 3.07
1233 1287 3.737850 CCCAATAGAGGAGAAGTGATGC 58.262 50.000 0.00 0.00 0.00 3.91
1234 1288 3.388308 CCAATAGAGGAGAAGTGATGCG 58.612 50.000 0.00 0.00 0.00 4.73
1235 1289 3.181471 CCAATAGAGGAGAAGTGATGCGT 60.181 47.826 0.00 0.00 0.00 5.24
1236 1290 4.437239 CAATAGAGGAGAAGTGATGCGTT 58.563 43.478 0.00 0.00 0.00 4.84
1237 1291 2.376808 AGAGGAGAAGTGATGCGTTG 57.623 50.000 0.00 0.00 0.00 4.10
1238 1292 0.723981 GAGGAGAAGTGATGCGTTGC 59.276 55.000 0.00 0.00 0.00 4.17
1239 1293 0.035317 AGGAGAAGTGATGCGTTGCA 59.965 50.000 0.00 0.00 44.86 4.08
1240 1294 0.874390 GGAGAAGTGATGCGTTGCAA 59.126 50.000 0.00 0.00 43.62 4.08
1241 1295 1.266718 GGAGAAGTGATGCGTTGCAAA 59.733 47.619 0.00 0.00 43.62 3.68
1242 1296 2.095059 GGAGAAGTGATGCGTTGCAAAT 60.095 45.455 0.00 0.00 43.62 2.32
1243 1297 3.166657 GAGAAGTGATGCGTTGCAAATC 58.833 45.455 0.00 1.11 43.62 2.17
1244 1298 2.553602 AGAAGTGATGCGTTGCAAATCA 59.446 40.909 0.00 4.23 43.62 2.57
1245 1299 3.004629 AGAAGTGATGCGTTGCAAATCAA 59.995 39.130 12.67 0.00 43.62 2.57
1256 1310 2.136728 TGCAAATCAACATGCTTGTGC 58.863 42.857 5.94 4.98 42.97 4.57
1257 1311 2.224090 TGCAAATCAACATGCTTGTGCT 60.224 40.909 5.94 0.00 42.97 4.40
1258 1312 2.156891 GCAAATCAACATGCTTGTGCTG 59.843 45.455 5.94 2.19 39.46 4.41
1259 1313 3.644823 CAAATCAACATGCTTGTGCTGA 58.355 40.909 5.94 7.70 40.48 4.26
1260 1314 3.570926 AATCAACATGCTTGTGCTGAG 57.429 42.857 5.94 0.00 40.48 3.35
1261 1315 0.594602 TCAACATGCTTGTGCTGAGC 59.405 50.000 5.94 0.00 40.48 4.26
1263 1317 0.886043 AACATGCTTGTGCTGAGCGA 60.886 50.000 5.94 0.00 43.02 4.93
1264 1318 1.134075 CATGCTTGTGCTGAGCGAC 59.866 57.895 0.00 0.00 43.02 5.19
1265 1319 1.301953 ATGCTTGTGCTGAGCGACA 60.302 52.632 0.00 2.66 43.02 4.35
1266 1320 0.886043 ATGCTTGTGCTGAGCGACAA 60.886 50.000 17.11 17.11 43.02 3.18
1268 1322 0.029300 GCTTGTGCTGAGCGACAAAA 59.971 50.000 18.13 3.69 32.61 2.44
1269 1323 1.746760 CTTGTGCTGAGCGACAAAAC 58.253 50.000 18.13 4.14 32.61 2.43
1271 1325 0.746204 TGTGCTGAGCGACAAAACCA 60.746 50.000 0.00 0.00 0.00 3.67
1272 1326 0.040958 GTGCTGAGCGACAAAACCAG 60.041 55.000 0.00 0.00 0.00 4.00
1273 1327 0.179059 TGCTGAGCGACAAAACCAGA 60.179 50.000 0.00 0.00 0.00 3.86
1274 1328 0.514691 GCTGAGCGACAAAACCAGAG 59.485 55.000 0.00 0.00 0.00 3.35
1275 1329 1.873903 GCTGAGCGACAAAACCAGAGA 60.874 52.381 0.00 0.00 0.00 3.10
1276 1330 2.064762 CTGAGCGACAAAACCAGAGAG 58.935 52.381 0.00 0.00 0.00 3.20
1277 1331 1.686587 TGAGCGACAAAACCAGAGAGA 59.313 47.619 0.00 0.00 0.00 3.10
1278 1332 2.102420 TGAGCGACAAAACCAGAGAGAA 59.898 45.455 0.00 0.00 0.00 2.87
1279 1333 2.734079 GAGCGACAAAACCAGAGAGAAG 59.266 50.000 0.00 0.00 0.00 2.85
1280 1334 2.365617 AGCGACAAAACCAGAGAGAAGA 59.634 45.455 0.00 0.00 0.00 2.87
1281 1335 3.131396 GCGACAAAACCAGAGAGAAGAA 58.869 45.455 0.00 0.00 0.00 2.52
1282 1336 3.185391 GCGACAAAACCAGAGAGAAGAAG 59.815 47.826 0.00 0.00 0.00 2.85
1283 1337 4.372656 CGACAAAACCAGAGAGAAGAAGT 58.627 43.478 0.00 0.00 0.00 3.01
1284 1338 4.446051 CGACAAAACCAGAGAGAAGAAGTC 59.554 45.833 0.00 0.00 0.00 3.01
1285 1339 5.606505 GACAAAACCAGAGAGAAGAAGTCT 58.393 41.667 0.00 0.00 40.25 3.24
1286 1340 6.515200 CGACAAAACCAGAGAGAAGAAGTCTA 60.515 42.308 0.00 0.00 36.41 2.59
1287 1341 7.309770 ACAAAACCAGAGAGAAGAAGTCTAT 57.690 36.000 0.00 0.00 36.41 1.98
1288 1342 7.382898 ACAAAACCAGAGAGAAGAAGTCTATC 58.617 38.462 0.00 0.00 43.75 2.08
1319 1373 8.936070 ATAAACATGTTTAGTCGTATGTGCTA 57.064 30.769 29.25 9.54 38.30 3.49
1321 1375 7.843490 AACATGTTTAGTCGTATGTGCTATT 57.157 32.000 4.92 0.00 34.28 1.73
1331 1385 8.263940 AGTCGTATGTGCTATTAATTGTTTGT 57.736 30.769 0.00 0.00 0.00 2.83
1373 1427 4.143305 GCATAAGCATAAGCAGTACTACGC 60.143 45.833 0.00 0.00 45.49 4.42
1374 1428 3.520290 AAGCATAAGCAGTACTACGCA 57.480 42.857 7.83 0.00 45.49 5.24
1377 1431 5.196341 AGCATAAGCAGTACTACGCATTA 57.804 39.130 7.83 4.49 45.49 1.90
1379 1433 6.223852 AGCATAAGCAGTACTACGCATTATT 58.776 36.000 7.83 0.00 45.49 1.40
1380 1434 7.375834 AGCATAAGCAGTACTACGCATTATTA 58.624 34.615 7.83 0.00 45.49 0.98
1381 1435 7.328737 AGCATAAGCAGTACTACGCATTATTAC 59.671 37.037 7.83 4.62 45.49 1.89
1382 1436 7.115805 GCATAAGCAGTACTACGCATTATTACA 59.884 37.037 7.83 0.00 41.58 2.41
1383 1437 9.140286 CATAAGCAGTACTACGCATTATTACAT 57.860 33.333 7.83 0.00 0.00 2.29
1385 1439 6.513180 AGCAGTACTACGCATTATTACATGT 58.487 36.000 2.69 2.69 0.00 3.21
1386 1440 6.641314 AGCAGTACTACGCATTATTACATGTC 59.359 38.462 0.00 0.00 0.00 3.06
1387 1441 6.419710 GCAGTACTACGCATTATTACATGTCA 59.580 38.462 0.00 0.00 0.00 3.58
1389 1443 8.813282 CAGTACTACGCATTATTACATGTCAAA 58.187 33.333 0.00 0.00 0.00 2.69
1390 1444 9.542462 AGTACTACGCATTATTACATGTCAAAT 57.458 29.630 0.00 0.00 0.00 2.32
1393 1447 9.716507 ACTACGCATTATTACATGTCAAATTTC 57.283 29.630 0.00 0.00 0.00 2.17
1394 1448 9.715123 CTACGCATTATTACATGTCAAATTTCA 57.285 29.630 0.00 0.00 0.00 2.69
1395 1449 8.619146 ACGCATTATTACATGTCAAATTTCAG 57.381 30.769 0.00 0.00 0.00 3.02
1396 1450 7.220683 ACGCATTATTACATGTCAAATTTCAGC 59.779 33.333 0.00 0.45 0.00 4.26
1397 1451 7.433131 CGCATTATTACATGTCAAATTTCAGCT 59.567 33.333 0.00 0.00 0.00 4.24
1398 1452 9.090692 GCATTATTACATGTCAAATTTCAGCTT 57.909 29.630 0.00 0.00 0.00 3.74
1402 1456 4.874970 ACATGTCAAATTTCAGCTTGTCC 58.125 39.130 0.00 0.00 0.00 4.02
1403 1457 3.624326 TGTCAAATTTCAGCTTGTCCG 57.376 42.857 0.00 0.00 0.00 4.79
1405 1459 2.552315 GTCAAATTTCAGCTTGTCCGGA 59.448 45.455 0.00 0.00 0.00 5.14
1406 1460 2.552315 TCAAATTTCAGCTTGTCCGGAC 59.448 45.455 28.17 28.17 0.00 4.79
1408 1462 2.496899 ATTTCAGCTTGTCCGGACAT 57.503 45.000 36.52 20.56 41.52 3.06
1409 1463 1.808411 TTTCAGCTTGTCCGGACATC 58.192 50.000 36.52 28.57 41.52 3.06
1410 1464 0.976641 TTCAGCTTGTCCGGACATCT 59.023 50.000 36.52 30.13 41.52 2.90
1413 1467 0.534412 AGCTTGTCCGGACATCTGAG 59.466 55.000 36.52 29.45 41.52 3.35
1414 1468 0.460987 GCTTGTCCGGACATCTGAGG 60.461 60.000 36.52 21.42 41.52 3.86
1415 1469 1.186200 CTTGTCCGGACATCTGAGGA 58.814 55.000 36.52 19.44 41.52 3.71
1417 1471 1.323271 TGTCCGGACATCTGAGGAGC 61.323 60.000 33.23 2.99 36.21 4.70
1418 1472 1.040339 GTCCGGACATCTGAGGAGCT 61.040 60.000 29.75 0.00 32.82 4.09
1419 1473 0.753479 TCCGGACATCTGAGGAGCTC 60.753 60.000 4.71 4.71 0.00 4.09
1450 1504 6.401955 AAAACACAAAATCGGTCAAAACAG 57.598 33.333 0.00 0.00 0.00 3.16
1451 1505 4.712122 ACACAAAATCGGTCAAAACAGT 57.288 36.364 0.00 0.00 0.00 3.55
1452 1506 5.821516 ACACAAAATCGGTCAAAACAGTA 57.178 34.783 0.00 0.00 0.00 2.74
1453 1507 6.385649 ACACAAAATCGGTCAAAACAGTAT 57.614 33.333 0.00 0.00 0.00 2.12
1454 1508 6.205784 ACACAAAATCGGTCAAAACAGTATG 58.794 36.000 0.00 0.00 46.00 2.39
1469 1523 2.026262 CAGTATGTACAGCCCCCAACTT 60.026 50.000 0.33 0.00 0.00 2.66
1470 1524 2.647802 AGTATGTACAGCCCCCAACTTT 59.352 45.455 0.33 0.00 0.00 2.66
1471 1525 2.694616 ATGTACAGCCCCCAACTTTT 57.305 45.000 0.33 0.00 0.00 2.27
1496 1550 6.633500 TTTTGCTGACAGCTACTAAAATGT 57.367 33.333 26.94 0.00 42.97 2.71
1497 1551 5.862924 TTGCTGACAGCTACTAAAATGTC 57.137 39.130 26.94 0.00 42.97 3.06
1498 1552 3.926527 TGCTGACAGCTACTAAAATGTCG 59.073 43.478 26.94 0.00 43.94 4.35
1499 1553 4.174009 GCTGACAGCTACTAAAATGTCGA 58.826 43.478 20.41 0.00 43.94 4.20
1501 1555 5.120208 GCTGACAGCTACTAAAATGTCGAAA 59.880 40.000 20.41 0.00 43.94 3.46
1502 1556 6.462073 TGACAGCTACTAAAATGTCGAAAC 57.538 37.500 0.00 0.00 43.94 2.78
1503 1557 6.220930 TGACAGCTACTAAAATGTCGAAACT 58.779 36.000 0.00 0.00 43.94 2.66
1504 1558 6.365247 TGACAGCTACTAAAATGTCGAAACTC 59.635 38.462 0.00 0.00 43.94 3.01
1505 1559 5.638234 ACAGCTACTAAAATGTCGAAACTCC 59.362 40.000 0.00 0.00 0.00 3.85
1506 1560 5.637810 CAGCTACTAAAATGTCGAAACTCCA 59.362 40.000 0.00 0.00 0.00 3.86
1507 1561 5.638234 AGCTACTAAAATGTCGAAACTCCAC 59.362 40.000 0.00 0.00 0.00 4.02
1508 1562 4.985044 ACTAAAATGTCGAAACTCCACG 57.015 40.909 0.00 0.00 0.00 4.94
1509 1563 4.624015 ACTAAAATGTCGAAACTCCACGA 58.376 39.130 0.00 0.00 36.18 4.35
1510 1564 5.051816 ACTAAAATGTCGAAACTCCACGAA 58.948 37.500 0.00 0.00 40.12 3.85
1511 1565 4.886247 AAAATGTCGAAACTCCACGAAA 57.114 36.364 0.00 0.00 40.12 3.46
1512 1566 5.432885 AAAATGTCGAAACTCCACGAAAT 57.567 34.783 0.00 0.00 40.12 2.17
1513 1567 5.432885 AAATGTCGAAACTCCACGAAATT 57.567 34.783 0.00 0.00 44.70 1.82
1514 1568 5.432885 AATGTCGAAACTCCACGAAATTT 57.567 34.783 0.00 0.00 41.61 1.82
1515 1569 4.203950 TGTCGAAACTCCACGAAATTTG 57.796 40.909 0.00 0.00 40.12 2.32
1516 1570 3.002862 TGTCGAAACTCCACGAAATTTGG 59.997 43.478 0.00 0.00 40.12 3.28
1517 1571 2.031508 TCGAAACTCCACGAAATTTGGC 60.032 45.455 0.00 0.00 35.62 4.52
1518 1572 2.287308 CGAAACTCCACGAAATTTGGCA 60.287 45.455 0.00 0.00 33.71 4.92
1519 1573 3.611530 CGAAACTCCACGAAATTTGGCAT 60.612 43.478 0.00 0.00 33.71 4.40
1520 1574 3.302365 AACTCCACGAAATTTGGCATG 57.698 42.857 0.00 0.00 33.71 4.06
1521 1575 1.545582 ACTCCACGAAATTTGGCATGG 59.454 47.619 0.00 0.00 33.71 3.66
1522 1576 1.818060 CTCCACGAAATTTGGCATGGA 59.182 47.619 10.71 10.71 35.04 3.41
1523 1577 1.543802 TCCACGAAATTTGGCATGGAC 59.456 47.619 8.03 0.00 33.71 4.02
1524 1578 1.545582 CCACGAAATTTGGCATGGACT 59.454 47.619 0.00 0.00 0.00 3.85
1525 1579 2.029110 CCACGAAATTTGGCATGGACTT 60.029 45.455 0.00 0.00 0.00 3.01
1526 1580 3.192422 CCACGAAATTTGGCATGGACTTA 59.808 43.478 0.00 0.00 0.00 2.24
1527 1581 4.165779 CACGAAATTTGGCATGGACTTAC 58.834 43.478 0.00 0.00 0.00 2.34
1528 1582 3.823873 ACGAAATTTGGCATGGACTTACA 59.176 39.130 0.00 0.00 0.00 2.41
1529 1583 4.165779 CGAAATTTGGCATGGACTTACAC 58.834 43.478 0.00 0.00 0.00 2.90
1530 1584 4.320861 CGAAATTTGGCATGGACTTACACA 60.321 41.667 0.00 0.00 0.00 3.72
1531 1585 5.622007 CGAAATTTGGCATGGACTTACACAT 60.622 40.000 0.00 0.00 0.00 3.21
1532 1586 6.404184 CGAAATTTGGCATGGACTTACACATA 60.404 38.462 0.00 0.00 0.00 2.29
1533 1587 7.422465 AAATTTGGCATGGACTTACACATAT 57.578 32.000 0.00 0.00 0.00 1.78
1534 1588 5.833406 TTTGGCATGGACTTACACATATG 57.167 39.130 0.00 0.00 0.00 1.78
1535 1589 4.769345 TGGCATGGACTTACACATATGA 57.231 40.909 10.38 0.00 0.00 2.15
1536 1590 4.707105 TGGCATGGACTTACACATATGAG 58.293 43.478 10.38 3.79 0.00 2.90
1537 1591 3.499918 GGCATGGACTTACACATATGAGC 59.500 47.826 10.38 0.00 0.00 4.26
1538 1592 4.129380 GCATGGACTTACACATATGAGCA 58.871 43.478 10.38 0.00 0.00 4.26
1539 1593 4.758674 GCATGGACTTACACATATGAGCAT 59.241 41.667 10.38 0.00 0.00 3.79
1540 1594 5.106791 GCATGGACTTACACATATGAGCATC 60.107 44.000 10.38 0.00 0.00 3.91
1541 1595 5.876651 TGGACTTACACATATGAGCATCT 57.123 39.130 10.38 0.00 34.92 2.90
1542 1596 6.976934 TGGACTTACACATATGAGCATCTA 57.023 37.500 10.38 0.00 34.92 1.98
1543 1597 6.986250 TGGACTTACACATATGAGCATCTAG 58.014 40.000 10.38 0.28 34.92 2.43
1544 1598 5.866633 GGACTTACACATATGAGCATCTAGC 59.133 44.000 10.38 0.00 46.19 3.42
1606 1660 7.924103 ATTTCAAACGAATTTACTGTTCACC 57.076 32.000 0.00 0.00 0.00 4.02
1609 1663 5.818336 TCAAACGAATTTACTGTTCACCTCA 59.182 36.000 0.00 0.00 0.00 3.86
1610 1664 5.924475 AACGAATTTACTGTTCACCTCAG 57.076 39.130 0.00 0.00 38.68 3.35
1611 1665 4.315803 ACGAATTTACTGTTCACCTCAGG 58.684 43.478 0.00 0.00 37.25 3.86
1612 1666 4.202326 ACGAATTTACTGTTCACCTCAGGT 60.202 41.667 0.00 0.00 37.25 4.00
1630 1684 2.581354 GCAGATGCACCCGAGAGT 59.419 61.111 0.00 0.00 41.59 3.24
1631 1685 1.520342 GCAGATGCACCCGAGAGTC 60.520 63.158 0.00 0.00 41.59 3.36
1632 1686 1.893062 CAGATGCACCCGAGAGTCA 59.107 57.895 0.00 0.00 0.00 3.41
1633 1687 0.247460 CAGATGCACCCGAGAGTCAA 59.753 55.000 0.00 0.00 0.00 3.18
1634 1688 0.976641 AGATGCACCCGAGAGTCAAA 59.023 50.000 0.00 0.00 0.00 2.69
1635 1689 1.347707 AGATGCACCCGAGAGTCAAAA 59.652 47.619 0.00 0.00 0.00 2.44
1639 1693 1.226746 CACCCGAGAGTCAAAACACC 58.773 55.000 0.00 0.00 0.00 4.16
1640 1694 0.834612 ACCCGAGAGTCAAAACACCA 59.165 50.000 0.00 0.00 0.00 4.17
1641 1695 1.226746 CCCGAGAGTCAAAACACCAC 58.773 55.000 0.00 0.00 0.00 4.16
1642 1696 0.859232 CCGAGAGTCAAAACACCACG 59.141 55.000 0.00 0.00 0.00 4.94
1643 1697 0.859232 CGAGAGTCAAAACACCACGG 59.141 55.000 0.00 0.00 0.00 4.94
1644 1698 0.586802 GAGAGTCAAAACACCACGGC 59.413 55.000 0.00 0.00 0.00 5.68
1645 1699 0.107410 AGAGTCAAAACACCACGGCA 60.107 50.000 0.00 0.00 0.00 5.69
1648 1702 2.550606 GAGTCAAAACACCACGGCAATA 59.449 45.455 0.00 0.00 0.00 1.90
1649 1703 2.952978 AGTCAAAACACCACGGCAATAA 59.047 40.909 0.00 0.00 0.00 1.40
1650 1704 3.572255 AGTCAAAACACCACGGCAATAAT 59.428 39.130 0.00 0.00 0.00 1.28
1651 1705 3.917985 GTCAAAACACCACGGCAATAATC 59.082 43.478 0.00 0.00 0.00 1.75
1653 1723 2.507407 AACACCACGGCAATAATCCT 57.493 45.000 0.00 0.00 0.00 3.24
1654 1724 2.507407 ACACCACGGCAATAATCCTT 57.493 45.000 0.00 0.00 0.00 3.36
1658 1728 4.196193 CACCACGGCAATAATCCTTCTAA 58.804 43.478 0.00 0.00 0.00 2.10
1660 1730 4.821805 ACCACGGCAATAATCCTTCTAATG 59.178 41.667 0.00 0.00 0.00 1.90
1661 1731 4.821805 CCACGGCAATAATCCTTCTAATGT 59.178 41.667 0.00 0.00 0.00 2.71
1662 1732 5.995282 CCACGGCAATAATCCTTCTAATGTA 59.005 40.000 0.00 0.00 0.00 2.29
1666 1736 8.403236 ACGGCAATAATCCTTCTAATGTAAAAC 58.597 33.333 0.00 0.00 0.00 2.43
1667 1737 8.402472 CGGCAATAATCCTTCTAATGTAAAACA 58.598 33.333 0.00 0.00 0.00 2.83
1682 1752 8.452989 AATGTAAAACATCAAAAGCTTCGATC 57.547 30.769 0.00 0.00 37.97 3.69
1687 1757 4.326826 ACATCAAAAGCTTCGATCCAGAA 58.673 39.130 0.00 0.00 0.00 3.02
1688 1758 4.946157 ACATCAAAAGCTTCGATCCAGAAT 59.054 37.500 0.00 0.00 0.00 2.40
1695 1774 2.611292 GCTTCGATCCAGAATGACCAAG 59.389 50.000 0.00 0.00 39.69 3.61
1702 1781 5.292101 CGATCCAGAATGACCAAGAGTTAAC 59.708 44.000 0.00 0.00 39.69 2.01
1703 1782 5.560722 TCCAGAATGACCAAGAGTTAACA 57.439 39.130 8.61 0.00 39.69 2.41
1741 1821 5.649782 AAAGATCAGTGCCAATTAACCAG 57.350 39.130 0.00 0.00 0.00 4.00
1750 1830 3.568007 TGCCAATTAACCAGCGGATATTC 59.432 43.478 1.50 0.00 0.00 1.75
1791 1882 3.242413 GCTACAGTTGTATGCAATCACCG 60.242 47.826 0.00 0.00 36.92 4.94
1792 1883 3.052455 ACAGTTGTATGCAATCACCGA 57.948 42.857 0.00 0.00 36.92 4.69
1795 1886 4.277174 ACAGTTGTATGCAATCACCGAAAA 59.723 37.500 0.00 0.00 36.92 2.29
1796 1887 5.048083 ACAGTTGTATGCAATCACCGAAAAT 60.048 36.000 0.00 0.00 36.92 1.82
1801 1892 5.877564 TGTATGCAATCACCGAAAATAGACA 59.122 36.000 0.00 0.00 0.00 3.41
1811 1902 8.050778 TCACCGAAAATAGACAGCATTAAATT 57.949 30.769 0.00 0.00 0.00 1.82
1812 1903 9.168451 TCACCGAAAATAGACAGCATTAAATTA 57.832 29.630 0.00 0.00 0.00 1.40
1825 1916 9.502145 ACAGCATTAAATTAATTATGTGTGACG 57.498 29.630 15.35 0.00 0.00 4.35
1826 1917 8.471457 CAGCATTAAATTAATTATGTGTGACGC 58.529 33.333 0.01 0.00 0.00 5.19
1827 1918 7.375808 AGCATTAAATTAATTATGTGTGACGCG 59.624 33.333 3.53 3.53 0.00 6.01
1845 1936 3.618594 ACGCGTCGTCTAGAAGTAACATA 59.381 43.478 5.58 0.00 33.69 2.29
1850 1989 6.572989 GCGTCGTCTAGAAGTAACATATGTAC 59.427 42.308 9.21 7.90 0.00 2.90
1871 2010 9.725019 ATGTACAGAAGATCTAACATTTGTCAA 57.275 29.630 0.33 0.00 31.92 3.18
1915 2061 6.038492 CCTTTTCTTGTTGCAACCAATGATTT 59.962 34.615 26.14 0.00 32.75 2.17
1919 2065 2.038295 TGTTGCAACCAATGATTTCCCC 59.962 45.455 26.14 0.00 32.75 4.81
2001 2147 2.231716 TCGACCATCCTCTCCTCAAA 57.768 50.000 0.00 0.00 0.00 2.69
2024 2170 9.621629 CAAAAACCATACTATCCAGGTAATACA 57.378 33.333 0.00 0.00 33.15 2.29
2040 2186 6.210385 AGGTAATACATTGCAACACCATTTCA 59.790 34.615 0.00 0.00 0.00 2.69
2053 2199 7.546667 GCAACACCATTTCACTTTTCATATCAT 59.453 33.333 0.00 0.00 0.00 2.45
2055 2201 8.991243 ACACCATTTCACTTTTCATATCATTG 57.009 30.769 0.00 0.00 0.00 2.82
2084 2233 1.687563 AACAAGTTGTAGTGCCCCAC 58.312 50.000 9.37 0.00 34.10 4.61
2118 2270 8.493547 CACACACATATCATGATATCACTCAAC 58.506 37.037 22.76 0.00 31.98 3.18
2119 2271 7.658982 ACACACATATCATGATATCACTCAACC 59.341 37.037 22.76 0.00 31.98 3.77
2124 2276 5.337578 TCATGATATCACTCAACCGTCAA 57.662 39.130 7.78 0.00 0.00 3.18
2171 2324 3.261897 CCCAGGAGGTATGTATCATGACC 59.738 52.174 0.00 0.00 28.88 4.02
2175 2328 3.008049 GGAGGTATGTATCATGACCCCAC 59.992 52.174 0.00 0.00 31.93 4.61
2194 2347 0.110295 CCATCGCACCCCATCCAATA 59.890 55.000 0.00 0.00 0.00 1.90
2200 2353 2.028996 GCACCCCATCCAATAACCCAG 61.029 57.143 0.00 0.00 0.00 4.45
2227 2380 2.418609 GCATCAAAATGGTAAGTGCCCC 60.419 50.000 0.00 0.00 33.19 5.80
2254 2407 2.505407 CACCATACCAATCCAGAGGACA 59.495 50.000 0.00 0.00 32.98 4.02
2261 2414 2.363683 CAATCCAGAGGACAAAGGAGC 58.636 52.381 0.00 0.00 32.98 4.70
2269 2422 1.707427 AGGACAAAGGAGCAGGATGTT 59.293 47.619 0.00 0.00 39.31 2.71
2272 2425 3.055094 GGACAAAGGAGCAGGATGTTCTA 60.055 47.826 0.00 0.00 46.35 2.10
2278 2431 1.488393 GAGCAGGATGTTCTAAGGGCT 59.512 52.381 0.00 0.00 43.55 5.19
2392 2546 2.291282 CCACCAGGTACAAAGGCCATTA 60.291 50.000 5.01 0.00 0.00 1.90
2401 2555 6.897413 AGGTACAAAGGCCATTAAAGAATCAT 59.103 34.615 5.01 0.00 0.00 2.45
2546 2704 2.104622 CCATGGAACCAAAGCCACTTTT 59.895 45.455 5.56 0.00 36.92 2.27
2606 2764 1.197812 GCTTGGCCCAATTCTGGATT 58.802 50.000 0.00 0.00 46.92 3.01
2621 2779 3.050564 TCTGGATTAGTGGGGGTTCCTAT 60.051 47.826 0.00 0.00 36.20 2.57
2622 2780 3.323775 TGGATTAGTGGGGGTTCCTATC 58.676 50.000 0.00 0.00 36.20 2.08
2624 2782 3.328050 GGATTAGTGGGGGTTCCTATCAG 59.672 52.174 0.00 0.00 36.20 2.90
2627 2785 0.327191 GTGGGGGTTCCTATCAGGGA 60.327 60.000 0.00 0.00 35.59 4.20
2666 2824 1.834263 GAAGTAGGATGGCAGGTCAGT 59.166 52.381 0.00 0.00 0.00 3.41
2679 2837 0.321996 GGTCAGTCCACAGAGGGAAC 59.678 60.000 0.00 0.00 39.05 3.62
2803 2969 8.164070 AGTCTATGTTCTCCATTGGTAAAAACT 58.836 33.333 1.86 0.00 34.86 2.66
2808 2974 8.710835 TGTTCTCCATTGGTAAAAACTTTTTC 57.289 30.769 1.86 0.00 0.00 2.29
2831 2997 7.062749 TCTTTCTTTCCTAAGTTGTGCTAGA 57.937 36.000 0.00 0.00 32.98 2.43
2952 3120 5.391312 GGCAACTTTCATAGTGGATTGTT 57.609 39.130 0.00 0.00 37.12 2.83
2975 3143 9.832445 TGTTTTTCAATCTAGAAGACTTGTAGT 57.168 29.630 16.58 4.55 0.00 2.73
2980 3148 8.526667 TCAATCTAGAAGACTTGTAGTAGCAT 57.473 34.615 16.58 3.20 0.00 3.79
2981 3149 8.972127 TCAATCTAGAAGACTTGTAGTAGCATT 58.028 33.333 16.58 8.20 0.00 3.56
3078 3247 1.035139 AGCTTGAGGCAACAAACCTG 58.965 50.000 0.00 0.00 44.79 4.00
3079 3248 1.032014 GCTTGAGGCAACAAACCTGA 58.968 50.000 0.00 0.00 37.77 3.86
3083 3252 4.696455 CTTGAGGCAACAAACCTGAAAAT 58.304 39.130 0.00 0.00 37.77 1.82
3089 3258 4.441792 GCAACAAACCTGAAAATGGAACT 58.558 39.130 0.00 0.00 0.00 3.01
3093 3262 7.254421 GCAACAAACCTGAAAATGGAACTAAAG 60.254 37.037 0.00 0.00 0.00 1.85
3098 3267 5.221441 ACCTGAAAATGGAACTAAAGCAACC 60.221 40.000 0.00 0.00 0.00 3.77
3105 3274 3.181434 TGGAACTAAAGCAACCACTCCAT 60.181 43.478 0.00 0.00 0.00 3.41
3106 3275 3.826729 GGAACTAAAGCAACCACTCCATT 59.173 43.478 0.00 0.00 0.00 3.16
3107 3276 5.007682 GGAACTAAAGCAACCACTCCATTA 58.992 41.667 0.00 0.00 0.00 1.90
3108 3277 5.652452 GGAACTAAAGCAACCACTCCATTAT 59.348 40.000 0.00 0.00 0.00 1.28
3109 3278 6.826741 GGAACTAAAGCAACCACTCCATTATA 59.173 38.462 0.00 0.00 0.00 0.98
3110 3279 7.338449 GGAACTAAAGCAACCACTCCATTATAA 59.662 37.037 0.00 0.00 0.00 0.98
3111 3280 8.644374 AACTAAAGCAACCACTCCATTATAAA 57.356 30.769 0.00 0.00 0.00 1.40
3112 3281 8.281212 ACTAAAGCAACCACTCCATTATAAAG 57.719 34.615 0.00 0.00 0.00 1.85
3114 3283 7.775053 AAAGCAACCACTCCATTATAAAGAA 57.225 32.000 0.00 0.00 0.00 2.52
3116 3285 7.396540 AGCAACCACTCCATTATAAAGAAAG 57.603 36.000 0.00 0.00 0.00 2.62
3118 3287 7.669722 AGCAACCACTCCATTATAAAGAAAGAA 59.330 33.333 0.00 0.00 0.00 2.52
3119 3288 8.303876 GCAACCACTCCATTATAAAGAAAGAAA 58.696 33.333 0.00 0.00 0.00 2.52
3165 3837 8.974060 TCTTCCAAACTCAAAGTATACTTGTT 57.026 30.769 18.70 14.79 36.12 2.83
3168 3840 8.740123 TCCAAACTCAAAGTATACTTGTTTGA 57.260 30.769 34.42 26.11 43.04 2.69
3169 3841 8.617809 TCCAAACTCAAAGTATACTTGTTTGAC 58.382 33.333 34.42 5.33 43.04 3.18
3176 3848 8.898761 TCAAAGTATACTTGTTTGACATGTGTT 58.101 29.630 18.70 0.00 37.13 3.32
3177 3849 8.957028 CAAAGTATACTTGTTTGACATGTGTTG 58.043 33.333 18.70 4.59 37.13 3.33
3178 3850 7.801716 AGTATACTTGTTTGACATGTGTTGT 57.198 32.000 1.15 0.00 42.79 3.32
3179 3851 8.220755 AGTATACTTGTTTGACATGTGTTGTT 57.779 30.769 1.15 0.00 39.18 2.83
3195 3867 1.136828 TGTTAGTGGAACAGGCAGGT 58.863 50.000 0.00 0.00 43.30 4.00
3196 3868 1.493022 TGTTAGTGGAACAGGCAGGTT 59.507 47.619 0.00 0.00 43.30 3.50
3197 3869 2.152016 GTTAGTGGAACAGGCAGGTTC 58.848 52.381 12.08 12.08 45.01 3.62
3201 3873 2.747686 GAACAGGCAGGTTCGGGA 59.252 61.111 6.35 0.00 37.96 5.14
3216 3888 3.656697 GGACGGGCCCTAGGAAAT 58.343 61.111 22.43 0.00 0.00 2.17
3222 3894 0.697854 GGGCCCTAGGAAATCCCAGA 60.698 60.000 17.04 0.00 36.96 3.86
3235 3907 1.450312 CCCAGACCGAACTCATGCC 60.450 63.158 0.00 0.00 0.00 4.40
3236 3908 1.296392 CCAGACCGAACTCATGCCA 59.704 57.895 0.00 0.00 0.00 4.92
3239 3911 1.003839 GACCGAACTCATGCCACCA 60.004 57.895 0.00 0.00 0.00 4.17
3258 3930 6.128580 GCCACCATGTCAAATAATGTCAAAAC 60.129 38.462 0.00 0.00 30.91 2.43
3259 3931 7.153985 CCACCATGTCAAATAATGTCAAAACT 58.846 34.615 0.00 0.00 30.91 2.66
3306 3979 2.890808 TCATGAACTAGGATGCGACC 57.109 50.000 0.00 0.00 0.00 4.79
3307 3980 1.412710 TCATGAACTAGGATGCGACCC 59.587 52.381 0.00 0.00 0.00 4.46
3313 3986 1.971505 CTAGGATGCGACCCAGGCAA 61.972 60.000 0.00 0.00 44.66 4.52
3315 3988 3.134127 GATGCGACCCAGGCAACC 61.134 66.667 0.00 0.00 44.66 3.77
3322 3995 3.579302 CCCAGGCAACCCAGGTCA 61.579 66.667 0.00 0.00 36.08 4.02
3323 3996 2.765969 CCAGGCAACCCAGGTCAT 59.234 61.111 0.00 0.00 33.27 3.06
3328 4001 1.526575 GGCAACCCAGGTCATGTGTG 61.527 60.000 0.00 0.00 0.00 3.82
3334 4007 1.973281 CAGGTCATGTGTGTGCCCC 60.973 63.158 0.00 0.00 0.00 5.80
3335 4008 2.676471 GGTCATGTGTGTGCCCCC 60.676 66.667 0.00 0.00 0.00 5.40
3336 4009 2.436109 GTCATGTGTGTGCCCCCT 59.564 61.111 0.00 0.00 0.00 4.79
3370 4047 4.955450 TCAAACCTTGCATGCATATAGGTT 59.045 37.500 34.49 34.49 42.89 3.50
3383 4060 7.822161 TGCATATAGGTTGCATGAAGTTATT 57.178 32.000 0.00 0.00 44.73 1.40
3386 4063 8.454106 GCATATAGGTTGCATGAAGTTATTAGG 58.546 37.037 0.00 0.00 39.90 2.69
3429 4114 5.221682 TGGCAATCACAAAAGATGTTTCCAT 60.222 36.000 0.00 0.00 41.46 3.41
3451 4136 1.307355 TGAGTCACATGGCAATGGCG 61.307 55.000 5.94 0.00 42.47 5.69
3452 4137 1.002257 AGTCACATGGCAATGGCGA 60.002 52.632 5.94 0.00 42.47 5.54
3500 4185 6.620678 TGATACTTTATGGCAAGAAAGTTGC 58.379 36.000 26.23 20.26 43.58 4.17
3506 4191 7.447238 ACTTTATGGCAAGAAAGTTGCTACTTA 59.553 33.333 19.54 0.00 43.58 2.24
3510 4195 7.049799 TGGCAAGAAAGTTGCTACTTAAAAT 57.950 32.000 13.95 0.00 43.74 1.82
3513 4198 9.471084 GGCAAGAAAGTTGCTACTTAAAATAAA 57.529 29.630 13.95 0.00 43.74 1.40
3579 4264 4.213482 ACGCACTCCAACTTCAAATAGTTC 59.787 41.667 0.00 0.00 36.24 3.01
3586 4271 8.630037 ACTCCAACTTCAAATAGTTCGAAAATT 58.370 29.630 0.00 0.00 36.24 1.82
3598 4283 4.335315 AGTTCGAAAATTCAACTGCACTCA 59.665 37.500 0.00 0.00 31.85 3.41
3607 4292 4.556942 TCAACTGCACTCATTGTCTTTG 57.443 40.909 0.00 0.00 0.00 2.77
3617 4302 6.036953 GCACTCATTGTCTTTGATAGAGGAAG 59.963 42.308 0.00 0.00 32.23 3.46
3619 4304 7.277539 CACTCATTGTCTTTGATAGAGGAAGTC 59.722 40.741 0.00 0.00 32.23 3.01
3623 4308 5.794894 TGTCTTTGATAGAGGAAGTCCAAC 58.205 41.667 0.00 0.00 38.89 3.77
3624 4309 5.306937 TGTCTTTGATAGAGGAAGTCCAACA 59.693 40.000 0.00 0.00 38.89 3.33
3628 4313 5.860941 TGATAGAGGAAGTCCAACATCTC 57.139 43.478 0.00 0.00 38.89 2.75
3631 4316 2.235898 AGAGGAAGTCCAACATCTCTGC 59.764 50.000 0.00 0.00 38.89 4.26
3633 4318 2.079925 GGAAGTCCAACATCTCTGCAC 58.920 52.381 0.00 0.00 35.64 4.57
3635 4320 3.406764 GAAGTCCAACATCTCTGCACTT 58.593 45.455 0.00 0.00 0.00 3.16
3637 4322 3.825328 AGTCCAACATCTCTGCACTTTT 58.175 40.909 0.00 0.00 0.00 2.27
3638 4323 3.567164 AGTCCAACATCTCTGCACTTTTG 59.433 43.478 0.00 0.00 0.00 2.44
3655 4340 3.889196 TTTGTGTAGGCTAAAGCGTTG 57.111 42.857 2.11 0.00 43.26 4.10
3656 4341 2.536761 TGTGTAGGCTAAAGCGTTGT 57.463 45.000 2.11 0.00 43.26 3.32
3660 4345 4.216731 GTGTAGGCTAAAGCGTTGTTTTC 58.783 43.478 2.11 0.00 43.26 2.29
3661 4346 3.878103 TGTAGGCTAAAGCGTTGTTTTCA 59.122 39.130 2.11 0.00 43.26 2.69
3662 4347 3.626028 AGGCTAAAGCGTTGTTTTCAG 57.374 42.857 0.00 0.00 43.26 3.02
3673 4359 4.260456 GCGTTGTTTTCAGCACTGTACTAA 60.260 41.667 0.00 0.00 0.00 2.24
3685 4371 5.416326 AGCACTGTACTAACTAAGAGTGGAG 59.584 44.000 0.00 0.00 33.04 3.86
3689 4375 8.790718 CACTGTACTAACTAAGAGTGGAGTTTA 58.209 37.037 0.00 0.00 37.16 2.01
3749 4435 5.351740 TGACATAATGCGTGGACGAATAAAA 59.648 36.000 2.73 0.00 36.41 1.52
3752 4438 6.910433 ACATAATGCGTGGACGAATAAAATTC 59.090 34.615 2.73 0.00 36.41 2.17
3759 4445 6.193959 GCGTGGACGAATAAAATTCATACAAC 59.806 38.462 2.73 0.00 43.02 3.32
3797 4484 9.324008 AGATCATACTAGGATTGATGAAGTCAT 57.676 33.333 8.51 0.00 36.54 3.06
3804 4491 5.374921 AGGATTGATGAAGTCATGATGGAC 58.625 41.667 0.00 0.00 36.54 4.02
3811 4498 1.524621 GTCATGATGGACGGCTGGG 60.525 63.158 0.00 0.00 0.00 4.45
3821 4508 2.746277 CGGCTGGGTGGCTACAAC 60.746 66.667 1.52 0.00 39.32 3.32
3823 4510 1.000896 GGCTGGGTGGCTACAACAT 60.001 57.895 1.52 0.00 35.45 2.71
3831 4518 2.275318 GTGGCTACAACATGAGCTCTC 58.725 52.381 16.19 0.00 38.79 3.20
3833 4520 2.275318 GGCTACAACATGAGCTCTCAC 58.725 52.381 16.19 0.00 43.11 3.51
3835 4522 3.329386 GCTACAACATGAGCTCTCACAA 58.671 45.455 16.19 0.00 43.11 3.33
3851 4538 6.348050 GCTCTCACAACTCAATCTAAGGTTTG 60.348 42.308 0.00 0.00 0.00 2.93
3855 4542 7.054124 TCACAACTCAATCTAAGGTTTGAACT 58.946 34.615 0.00 0.00 32.77 3.01
3859 4546 9.665264 CAACTCAATCTAAGGTTTGAACTAAAC 57.335 33.333 0.00 0.00 46.30 2.01
3876 4563 5.938322 ACTAAACACAAGTCAAACACACAG 58.062 37.500 0.00 0.00 0.00 3.66
3878 4565 3.066291 ACACAAGTCAAACACACAGGA 57.934 42.857 0.00 0.00 0.00 3.86
3908 4595 8.415553 CAATGCAAATGGGAAGAACTATGAATA 58.584 33.333 0.00 0.00 0.00 1.75
3917 4604 8.055181 TGGGAAGAACTATGAATAAAGATGCTT 58.945 33.333 0.00 0.00 0.00 3.91
3958 4645 6.319141 TGTGAAGGACGTCTATCATATCAG 57.681 41.667 20.98 0.00 0.00 2.90
3961 4648 5.473846 TGAAGGACGTCTATCATATCAGGAC 59.526 44.000 16.46 0.00 0.00 3.85
3970 4657 7.041848 CGTCTATCATATCAGGACAAAATTGCA 60.042 37.037 0.00 0.00 0.00 4.08
3979 4666 6.422333 TCAGGACAAAATTGCATAGTATCCA 58.578 36.000 0.00 0.00 0.00 3.41
4006 4693 9.236006 CATATGTATATGAAAAAGGAGGAAGGG 57.764 37.037 6.08 0.00 42.05 3.95
4008 4695 6.659824 TGTATATGAAAAAGGAGGAAGGGTC 58.340 40.000 0.00 0.00 0.00 4.46
4013 4700 4.079443 TGAAAAAGGAGGAAGGGTCAGAAA 60.079 41.667 0.00 0.00 0.00 2.52
4016 4703 4.749048 AAGGAGGAAGGGTCAGAAATTT 57.251 40.909 0.00 0.00 0.00 1.82
4025 4712 7.730332 AGGAAGGGTCAGAAATTTTGATTAGTT 59.270 33.333 0.00 0.00 0.00 2.24
4046 4733 3.955471 TGAGGACCTCAAAATCATCCAC 58.045 45.455 22.30 0.00 37.57 4.02
4049 4736 3.009033 AGGACCTCAAAATCATCCACGAA 59.991 43.478 0.00 0.00 31.41 3.85
4059 4746 7.174080 TCAAAATCATCCACGAACATCAAGTTA 59.826 33.333 0.00 0.00 41.51 2.24
4070 4757 9.516314 CACGAACATCAAGTTATTATGTCTCTA 57.484 33.333 0.00 0.00 41.51 2.43
4106 4793 3.833070 GTCTTCCTTGTTCCTGTAGGAGA 59.167 47.826 0.26 0.00 46.36 3.71
4115 4802 2.108168 TCCTGTAGGAGAATGGGTTCG 58.892 52.381 0.00 0.00 39.78 3.95
4118 4805 1.553248 TGTAGGAGAATGGGTTCGTGG 59.447 52.381 0.00 0.00 39.38 4.94
4124 4811 3.467803 GAGAATGGGTTCGTGGATTAGG 58.532 50.000 0.00 0.00 39.38 2.69
4130 4817 2.391678 GGTTCGTGGATTAGGGAGGTA 58.608 52.381 0.00 0.00 0.00 3.08
4131 4818 2.364647 GGTTCGTGGATTAGGGAGGTAG 59.635 54.545 0.00 0.00 0.00 3.18
4132 4819 2.364647 GTTCGTGGATTAGGGAGGTAGG 59.635 54.545 0.00 0.00 0.00 3.18
4133 4820 0.680061 CGTGGATTAGGGAGGTAGGC 59.320 60.000 0.00 0.00 0.00 3.93
4136 4823 2.039084 GTGGATTAGGGAGGTAGGCATG 59.961 54.545 0.00 0.00 0.00 4.06
4149 4836 6.547510 GGAGGTAGGCATGTGAAATTATTCTT 59.452 38.462 0.00 0.00 36.48 2.52
4152 4839 7.781693 AGGTAGGCATGTGAAATTATTCTTGAT 59.218 33.333 0.00 0.00 36.48 2.57
4171 4858 9.990360 TTCTTGATAATATTCCGTGCTATACAA 57.010 29.630 0.00 0.00 0.00 2.41
4235 4926 5.835819 TGGATTTTGTGTACATCAAAAGGGA 59.164 36.000 25.85 16.32 44.27 4.20
4243 4934 7.377398 TGTGTACATCAAAAGGGAATCAAATG 58.623 34.615 0.00 0.00 0.00 2.32
4249 4940 7.658575 ACATCAAAAGGGAATCAAATGAACAAG 59.341 33.333 0.00 0.00 0.00 3.16
4250 4941 7.358770 TCAAAAGGGAATCAAATGAACAAGA 57.641 32.000 0.00 0.00 0.00 3.02
4257 4948 7.928167 AGGGAATCAAATGAACAAGAAAGAAAC 59.072 33.333 0.00 0.00 0.00 2.78
4264 4955 8.881743 CAAATGAACAAGAAAGAAACATCCAAA 58.118 29.630 0.00 0.00 0.00 3.28
4265 4956 9.617523 AAATGAACAAGAAAGAAACATCCAAAT 57.382 25.926 0.00 0.00 0.00 2.32
4267 4958 8.422973 TGAACAAGAAAGAAACATCCAAATTG 57.577 30.769 0.00 0.00 0.00 2.32
4268 4959 8.256605 TGAACAAGAAAGAAACATCCAAATTGA 58.743 29.630 0.00 0.00 0.00 2.57
4269 4960 9.264719 GAACAAGAAAGAAACATCCAAATTGAT 57.735 29.630 0.00 0.00 0.00 2.57
4270 4961 8.597662 ACAAGAAAGAAACATCCAAATTGATG 57.402 30.769 0.00 4.62 46.10 3.07
4279 4970 5.773239 CATCCAAATTGATGTTCAAGCAC 57.227 39.130 0.00 0.00 40.05 4.40
4281 4972 5.273674 TCCAAATTGATGTTCAAGCACAA 57.726 34.783 0.00 0.00 40.05 3.33
4282 4973 5.668471 TCCAAATTGATGTTCAAGCACAAA 58.332 33.333 0.00 0.00 40.05 2.83
4283 4974 6.289834 TCCAAATTGATGTTCAAGCACAAAT 58.710 32.000 0.00 0.00 40.05 2.32
4284 4975 6.203145 TCCAAATTGATGTTCAAGCACAAATG 59.797 34.615 0.00 0.00 40.05 2.32
4297 4988 2.744494 GCACAAATGCCAAAGGGACAAA 60.744 45.455 0.00 0.00 46.97 2.83
4302 4993 4.436113 AATGCCAAAGGGACAAAACATT 57.564 36.364 0.00 0.00 35.59 2.71
4309 5000 6.293353 GCCAAAGGGACAAAACATTATTGTTG 60.293 38.462 3.86 0.00 40.04 3.33
4315 5006 5.925969 GGACAAAACATTATTGTTGGGTGAG 59.074 40.000 3.86 0.00 45.30 3.51
4316 5007 5.296748 ACAAAACATTATTGTTGGGTGAGC 58.703 37.500 3.86 0.00 45.30 4.26
4318 5009 2.790433 ACATTATTGTTGGGTGAGCGT 58.210 42.857 0.00 0.00 29.55 5.07
4325 5016 2.422597 TGTTGGGTGAGCGTAATCAAG 58.577 47.619 0.00 0.00 0.00 3.02
4328 5019 1.009829 GGGTGAGCGTAATCAAGCTG 58.990 55.000 0.00 0.00 44.69 4.24
4329 5020 1.009829 GGTGAGCGTAATCAAGCTGG 58.990 55.000 0.00 0.00 44.69 4.85
4332 5023 1.275010 TGAGCGTAATCAAGCTGGTGA 59.725 47.619 0.00 0.00 44.69 4.02
4374 5066 7.230108 AGGGATGCATGAGTATTTCTTATGTTG 59.770 37.037 2.46 0.00 40.73 3.33
4388 5080 5.537188 TCTTATGTTGGTTCATTTGTTGGC 58.463 37.500 0.00 0.00 0.00 4.52
4393 5085 2.114616 TGGTTCATTTGTTGGCAAGGT 58.885 42.857 0.00 0.00 35.82 3.50
4395 5087 2.102252 GGTTCATTTGTTGGCAAGGTGA 59.898 45.455 0.00 0.00 35.82 4.02
4398 5090 2.100584 TCATTTGTTGGCAAGGTGACAC 59.899 45.455 0.00 0.00 33.32 3.67
4399 5091 1.550327 TTTGTTGGCAAGGTGACACA 58.450 45.000 8.08 0.00 33.32 3.72
4408 5100 3.119849 GGCAAGGTGACACATTGTATGTC 60.120 47.826 27.95 14.53 41.45 3.06
4426 5118 4.046938 TGTCGATAGTCTCAATGGAAGC 57.953 45.455 0.00 0.00 37.40 3.86
4435 5127 2.644299 TCTCAATGGAAGCAAGGGAGAA 59.356 45.455 0.00 0.00 0.00 2.87
4442 5134 1.956477 GAAGCAAGGGAGAAACAAGCA 59.044 47.619 0.00 0.00 0.00 3.91
4444 5136 1.143684 AGCAAGGGAGAAACAAGCAGA 59.856 47.619 0.00 0.00 0.00 4.26
4448 5140 2.050144 AGGGAGAAACAAGCAGACTGA 58.950 47.619 6.65 0.00 0.00 3.41
4457 5149 6.823689 AGAAACAAGCAGACTGAAAAGACTTA 59.176 34.615 6.65 0.00 0.00 2.24
4458 5150 6.610741 AACAAGCAGACTGAAAAGACTTAG 57.389 37.500 6.65 0.00 0.00 2.18
4468 5160 7.825270 AGACTGAAAAGACTTAGAGATCGTCTA 59.175 37.037 1.29 0.40 37.04 2.59
4517 5211 5.664908 ACAATCTCTCTCTCTCTCTCTCTCT 59.335 44.000 0.00 0.00 0.00 3.10
4523 5217 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4524 5218 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
4525 5219 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4526 5220 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
4527 5221 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4528 5222 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
4529 5223 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4530 5224 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
4531 5225 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4532 5226 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
4533 5227 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4534 5228 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
4535 5229 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4536 5230 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
4537 5231 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
4560 5254 6.547880 TCTCTCTCTCTCTCTCTCTCTCTAAC 59.452 46.154 0.00 0.00 0.00 2.34
4563 5257 6.878317 TCTCTCTCTCTCTCTCTCTAACAAG 58.122 44.000 0.00 0.00 0.00 3.16
4567 5261 5.647658 TCTCTCTCTCTCTCTAACAAGCAAG 59.352 44.000 0.00 0.00 0.00 4.01
4572 5266 4.219507 TCTCTCTCTAACAAGCAAGTCCTG 59.780 45.833 0.00 0.00 0.00 3.86
4584 5278 3.278668 CAAGTCCTGCATCTCCATTCT 57.721 47.619 0.00 0.00 0.00 2.40
4593 5287 8.196771 GTCCTGCATCTCCATTCTTATAGATAG 58.803 40.741 0.00 0.00 0.00 2.08
4650 5344 4.502171 TGTCATGGTGCATTAAGTTGTG 57.498 40.909 0.00 0.00 0.00 3.33
4666 5360 6.395426 AAGTTGTGCAATCTCTTTCATTGA 57.605 33.333 0.00 0.00 33.69 2.57
4667 5361 6.010294 AGTTGTGCAATCTCTTTCATTGAG 57.990 37.500 0.00 0.00 33.69 3.02
4668 5362 5.048224 AGTTGTGCAATCTCTTTCATTGAGG 60.048 40.000 0.00 0.00 33.69 3.86
4676 5370 4.202441 TCTCTTTCATTGAGGCTAATGGC 58.798 43.478 13.22 0.00 38.33 4.40
4679 5373 0.181114 TCATTGAGGCTAATGGCGCT 59.819 50.000 7.64 0.00 44.18 5.92
4685 5379 2.289072 TGAGGCTAATGGCGCTATTCTC 60.289 50.000 23.04 21.23 44.18 2.87
4713 5407 4.762289 AAAATTGCAGGTTTACCCACAA 57.238 36.364 6.65 6.65 36.27 3.33
4748 5442 8.481314 TGATAACAATGCTAGACTCTTCATCTT 58.519 33.333 0.00 0.00 0.00 2.40
4751 5445 6.572519 ACAATGCTAGACTCTTCATCTTCTC 58.427 40.000 0.00 0.00 0.00 2.87
4755 5449 4.574828 GCTAGACTCTTCATCTTCTCGACT 59.425 45.833 0.00 0.00 0.00 4.18
4768 5462 7.968956 TCATCTTCTCGACTGTAAGATAAACAC 59.031 37.037 3.85 0.00 37.76 3.32
4769 5463 6.618811 TCTTCTCGACTGTAAGATAAACACC 58.381 40.000 0.00 0.00 37.43 4.16
4770 5464 6.433404 TCTTCTCGACTGTAAGATAAACACCT 59.567 38.462 0.00 0.00 37.43 4.00
4832 5526 9.653516 TCCATCTTTTATTAATGCTGGGAATAA 57.346 29.630 0.00 0.00 30.02 1.40
4921 5618 1.002087 ACCTAAAGTGCTCAGGGTTCG 59.998 52.381 0.00 0.00 33.48 3.95
4942 5639 5.083136 CGTCCAAACGGATAATCAGATTG 57.917 43.478 5.85 0.00 45.21 2.67
4949 5646 2.816087 CGGATAATCAGATTGCCCTTGG 59.184 50.000 5.85 0.00 0.00 3.61
4953 5650 0.706433 ATCAGATTGCCCTTGGTGGT 59.294 50.000 0.00 0.00 0.00 4.16
4955 5652 1.004277 TCAGATTGCCCTTGGTGGTAC 59.996 52.381 0.00 0.00 0.00 3.34
4965 5662 2.842994 TGGTGGTACCATATCCCCG 58.157 57.895 19.72 0.00 44.79 5.73
4971 5668 1.264295 GTACCATATCCCCGGTCTCC 58.736 60.000 0.00 0.00 36.69 3.71
4973 5670 0.763223 ACCATATCCCCGGTCTCCAC 60.763 60.000 0.00 0.00 0.00 4.02
5006 5703 7.342799 AGGCACACAATATGACTTGGATATTTT 59.657 33.333 0.00 0.00 27.74 1.82
5030 5727 9.575868 TTTAGTTTGGAAGGTAATATGACACAA 57.424 29.630 0.00 0.00 0.00 3.33
5065 5762 3.565482 TCCGTAGTATTTAGTAGGGTGCG 59.435 47.826 9.76 0.00 37.99 5.34
5067 5764 3.243168 CGTAGTATTTAGTAGGGTGCGCA 60.243 47.826 5.66 5.66 0.00 6.09
5068 5765 3.454371 AGTATTTAGTAGGGTGCGCAG 57.546 47.619 12.22 0.00 0.00 5.18
5076 5773 2.167398 TAGGGTGCGCAGACCACTTC 62.167 60.000 27.23 7.73 37.80 3.01
5082 5779 0.880278 GCGCAGACCACTTCAACTCA 60.880 55.000 0.30 0.00 0.00 3.41
5083 5780 1.581934 CGCAGACCACTTCAACTCAA 58.418 50.000 0.00 0.00 0.00 3.02
5097 5794 7.754924 CACTTCAACTCAAAAGCTTAAAAGTGA 59.245 33.333 0.00 0.00 41.29 3.41
5101 5798 6.959639 ACTCAAAAGCTTAAAAGTGATGGA 57.040 33.333 0.00 0.00 0.00 3.41
5102 5799 6.974965 ACTCAAAAGCTTAAAAGTGATGGAG 58.025 36.000 0.00 0.00 0.00 3.86
5110 5807 5.473504 GCTTAAAAGTGATGGAGAAAGGTGA 59.526 40.000 0.00 0.00 0.00 4.02
5112 5809 4.713792 AAAGTGATGGAGAAAGGTGAGT 57.286 40.909 0.00 0.00 0.00 3.41
5114 5811 5.413309 AAGTGATGGAGAAAGGTGAGTAG 57.587 43.478 0.00 0.00 0.00 2.57
5116 5813 3.196685 GTGATGGAGAAAGGTGAGTAGCT 59.803 47.826 0.00 0.00 35.86 3.32
5118 5815 2.889512 TGGAGAAAGGTGAGTAGCTCA 58.110 47.619 0.00 0.00 38.25 4.26
5133 5830 8.665643 TGAGTAGCTCACTTATACTCTAACTC 57.334 38.462 10.93 4.75 43.73 3.01
5134 5831 7.716123 TGAGTAGCTCACTTATACTCTAACTCC 59.284 40.741 10.93 0.00 43.73 3.85
5135 5832 6.999871 AGTAGCTCACTTATACTCTAACTCCC 59.000 42.308 0.00 0.00 31.59 4.30
5136 5833 5.767670 AGCTCACTTATACTCTAACTCCCA 58.232 41.667 0.00 0.00 0.00 4.37
5137 5834 6.377912 AGCTCACTTATACTCTAACTCCCAT 58.622 40.000 0.00 0.00 0.00 4.00
5138 5835 6.266558 AGCTCACTTATACTCTAACTCCCATG 59.733 42.308 0.00 0.00 0.00 3.66
5139 5836 6.406692 TCACTTATACTCTAACTCCCATGC 57.593 41.667 0.00 0.00 0.00 4.06
5148 5845 1.941403 AACTCCCATGCCCCCTCATG 61.941 60.000 0.00 0.00 42.53 3.07
5151 5848 2.685366 CCATGCCCCCTCATGTGT 59.315 61.111 0.00 0.00 41.60 3.72
5155 5852 0.327480 ATGCCCCCTCATGTGTAGGA 60.327 55.000 0.47 0.00 36.08 2.94
5163 5860 3.580458 CCCTCATGTGTAGGATCCCTTAG 59.420 52.174 8.55 0.00 36.08 2.18
5174 5871 2.175715 GGATCCCTTAGGCCTCAAACAT 59.824 50.000 9.68 0.00 0.00 2.71
5180 5877 4.026052 CCTTAGGCCTCAAACATGGAAAT 58.974 43.478 9.68 0.00 0.00 2.17
5181 5878 5.200483 CCTTAGGCCTCAAACATGGAAATA 58.800 41.667 9.68 0.00 0.00 1.40
5193 5890 3.904339 ACATGGAAATAGGAGTCGGCTAT 59.096 43.478 0.00 0.00 0.00 2.97
5199 5896 6.269077 TGGAAATAGGAGTCGGCTATAATCAA 59.731 38.462 0.00 0.00 0.00 2.57
5231 5928 8.575736 TTTATTCCACCCTCTAGGATTTCATA 57.424 34.615 0.00 0.00 39.89 2.15
5232 5929 8.757307 TTATTCCACCCTCTAGGATTTCATAT 57.243 34.615 0.00 0.00 39.89 1.78
5233 5930 6.688073 TTCCACCCTCTAGGATTTCATATC 57.312 41.667 0.00 0.00 39.89 1.63
5252 5949 8.615878 TCATATCGTTTTATTGGACCCATTAG 57.384 34.615 0.00 0.00 0.00 1.73
5255 5952 6.008696 TCGTTTTATTGGACCCATTAGGAT 57.991 37.500 0.00 0.00 39.89 3.24
5257 5954 7.575505 TCGTTTTATTGGACCCATTAGGATTA 58.424 34.615 0.00 0.00 39.89 1.75
5266 5963 7.514721 TGGACCCATTAGGATTATAACTCAAC 58.485 38.462 0.00 0.00 39.89 3.18
5274 5971 9.838339 ATTAGGATTATAACTCAACACTTCTGG 57.162 33.333 0.00 0.00 0.00 3.86
5276 5973 6.069963 AGGATTATAACTCAACACTTCTGGCT 60.070 38.462 0.00 0.00 0.00 4.75
5280 5977 3.281727 ACTCAACACTTCTGGCTTTCA 57.718 42.857 0.00 0.00 0.00 2.69
5298 5995 0.240145 CAGTTGCATGCACTGACCAG 59.760 55.000 30.33 16.28 33.65 4.00
5305 6002 0.681733 ATGCACTGACCAGTTCGACT 59.318 50.000 0.00 0.00 40.20 4.18
5310 6007 2.540101 CACTGACCAGTTCGACTCAAAC 59.460 50.000 0.00 0.00 40.20 2.93
5319 6016 4.025979 CAGTTCGACTCAAACGCTTAAACT 60.026 41.667 0.00 0.00 0.00 2.66
5320 6017 4.025979 AGTTCGACTCAAACGCTTAAACTG 60.026 41.667 0.00 0.00 0.00 3.16
5326 6023 4.024048 ACTCAAACGCTTAAACTGATGTGG 60.024 41.667 0.00 0.00 0.00 4.17
5335 6032 5.738909 CTTAAACTGATGTGGAGGAGTGAT 58.261 41.667 0.00 0.00 0.00 3.06
5396 6093 5.628797 AATTCTTGAAGGGGCAAAAAGAA 57.371 34.783 0.00 0.00 40.17 2.52
5397 6094 5.830799 ATTCTTGAAGGGGCAAAAAGAAT 57.169 34.783 3.70 3.70 40.82 2.40
5398 6095 4.871933 TCTTGAAGGGGCAAAAAGAATC 57.128 40.909 0.00 0.00 0.00 2.52
5399 6096 3.578282 TCTTGAAGGGGCAAAAAGAATCC 59.422 43.478 0.00 0.00 0.00 3.01
5400 6097 2.969628 TGAAGGGGCAAAAAGAATCCA 58.030 42.857 0.00 0.00 0.00 3.41
5401 6098 3.519667 TGAAGGGGCAAAAAGAATCCAT 58.480 40.909 0.00 0.00 0.00 3.41
5402 6099 3.261390 TGAAGGGGCAAAAAGAATCCATG 59.739 43.478 0.00 0.00 0.00 3.66
5403 6100 2.906568 AGGGGCAAAAAGAATCCATGT 58.093 42.857 0.00 0.00 0.00 3.21
5404 6101 2.833943 AGGGGCAAAAAGAATCCATGTC 59.166 45.455 0.00 0.00 0.00 3.06
5405 6102 2.566724 GGGGCAAAAAGAATCCATGTCA 59.433 45.455 0.00 0.00 0.00 3.58
5406 6103 3.368739 GGGGCAAAAAGAATCCATGTCAG 60.369 47.826 0.00 0.00 0.00 3.51
5407 6104 3.256558 GGCAAAAAGAATCCATGTCAGC 58.743 45.455 0.00 0.00 0.00 4.26
5408 6105 3.256558 GCAAAAAGAATCCATGTCAGCC 58.743 45.455 0.00 0.00 0.00 4.85
5409 6106 3.306225 GCAAAAAGAATCCATGTCAGCCA 60.306 43.478 0.00 0.00 0.00 4.75
5410 6107 4.622220 GCAAAAAGAATCCATGTCAGCCAT 60.622 41.667 0.00 0.00 0.00 4.40
5411 6108 5.484715 CAAAAAGAATCCATGTCAGCCATT 58.515 37.500 0.00 0.00 0.00 3.16
5412 6109 4.730949 AAAGAATCCATGTCAGCCATTG 57.269 40.909 0.00 0.00 0.00 2.82
5413 6110 3.657398 AGAATCCATGTCAGCCATTGA 57.343 42.857 0.00 0.00 30.49 2.57
5414 6111 3.972133 AGAATCCATGTCAGCCATTGAA 58.028 40.909 0.00 0.00 37.61 2.69
5415 6112 3.698040 AGAATCCATGTCAGCCATTGAAC 59.302 43.478 0.00 0.00 37.61 3.18
5416 6113 2.583024 TCCATGTCAGCCATTGAACA 57.417 45.000 0.00 0.00 37.61 3.18
5417 6114 2.439409 TCCATGTCAGCCATTGAACAG 58.561 47.619 0.00 0.00 37.61 3.16
5418 6115 1.475280 CCATGTCAGCCATTGAACAGG 59.525 52.381 0.00 0.00 37.61 4.00
5419 6116 2.165167 CATGTCAGCCATTGAACAGGT 58.835 47.619 0.00 0.00 37.61 4.00
5420 6117 2.363306 TGTCAGCCATTGAACAGGTT 57.637 45.000 0.00 0.00 37.61 3.50
5421 6118 2.665165 TGTCAGCCATTGAACAGGTTT 58.335 42.857 0.00 0.00 37.61 3.27
5422 6119 2.622942 TGTCAGCCATTGAACAGGTTTC 59.377 45.455 0.00 0.00 37.61 2.78
5423 6120 2.887152 GTCAGCCATTGAACAGGTTTCT 59.113 45.455 0.00 0.00 37.61 2.52
5424 6121 4.072131 GTCAGCCATTGAACAGGTTTCTA 58.928 43.478 0.00 0.00 37.61 2.10
5425 6122 4.518970 GTCAGCCATTGAACAGGTTTCTAA 59.481 41.667 0.00 0.00 37.61 2.10
5426 6123 5.183904 GTCAGCCATTGAACAGGTTTCTAAT 59.816 40.000 0.00 0.00 37.61 1.73
5427 6124 6.374333 GTCAGCCATTGAACAGGTTTCTAATA 59.626 38.462 0.00 0.00 37.61 0.98
5428 6125 6.945435 TCAGCCATTGAACAGGTTTCTAATAA 59.055 34.615 0.00 0.00 31.34 1.40
5429 6126 7.121168 TCAGCCATTGAACAGGTTTCTAATAAG 59.879 37.037 0.00 0.00 31.34 1.73
5430 6127 6.948309 AGCCATTGAACAGGTTTCTAATAAGT 59.052 34.615 0.00 0.00 0.00 2.24
5431 6128 7.451566 AGCCATTGAACAGGTTTCTAATAAGTT 59.548 33.333 0.00 0.00 0.00 2.66
5432 6129 8.736244 GCCATTGAACAGGTTTCTAATAAGTTA 58.264 33.333 0.00 0.00 0.00 2.24
5436 6133 9.498176 TTGAACAGGTTTCTAATAAGTTACTCC 57.502 33.333 0.00 0.00 0.00 3.85
5437 6134 8.877195 TGAACAGGTTTCTAATAAGTTACTCCT 58.123 33.333 0.00 0.00 0.00 3.69
5438 6135 9.368674 GAACAGGTTTCTAATAAGTTACTCCTC 57.631 37.037 0.00 0.00 0.00 3.71
5439 6136 7.849160 ACAGGTTTCTAATAAGTTACTCCTCC 58.151 38.462 0.00 0.00 0.00 4.30
5440 6137 7.679025 ACAGGTTTCTAATAAGTTACTCCTCCT 59.321 37.037 0.00 0.00 0.00 3.69
5441 6138 8.541234 CAGGTTTCTAATAAGTTACTCCTCCTT 58.459 37.037 0.00 0.00 0.00 3.36
5442 6139 9.779951 AGGTTTCTAATAAGTTACTCCTCCTTA 57.220 33.333 0.00 0.00 0.00 2.69
5443 6140 9.814899 GGTTTCTAATAAGTTACTCCTCCTTAC 57.185 37.037 0.00 0.00 0.00 2.34
5444 6141 9.814899 GTTTCTAATAAGTTACTCCTCCTTACC 57.185 37.037 0.00 0.00 0.00 2.85
5445 6142 9.779951 TTTCTAATAAGTTACTCCTCCTTACCT 57.220 33.333 0.00 0.00 0.00 3.08
5448 6145 9.865152 CTAATAAGTTACTCCTCCTTACCTAGT 57.135 37.037 0.00 0.00 0.00 2.57
5451 6148 9.865152 ATAAGTTACTCCTCCTTACCTAGTTAG 57.135 37.037 0.00 0.00 0.00 2.34
5452 6149 7.522249 AGTTACTCCTCCTTACCTAGTTAGA 57.478 40.000 0.00 0.00 0.00 2.10
5453 6150 7.576403 AGTTACTCCTCCTTACCTAGTTAGAG 58.424 42.308 0.00 0.00 0.00 2.43
5454 6151 7.184387 AGTTACTCCTCCTTACCTAGTTAGAGT 59.816 40.741 0.00 0.00 0.00 3.24
5455 6152 6.405872 ACTCCTCCTTACCTAGTTAGAGTT 57.594 41.667 0.00 0.00 0.00 3.01
5456 6153 6.189133 ACTCCTCCTTACCTAGTTAGAGTTG 58.811 44.000 0.00 0.00 0.00 3.16
5457 6154 6.011805 ACTCCTCCTTACCTAGTTAGAGTTGA 60.012 42.308 0.00 0.00 0.00 3.18
5458 6155 6.797707 TCCTCCTTACCTAGTTAGAGTTGAA 58.202 40.000 0.00 0.00 0.00 2.69
5459 6156 7.243824 TCCTCCTTACCTAGTTAGAGTTGAAA 58.756 38.462 0.00 0.00 0.00 2.69
5460 6157 7.731688 TCCTCCTTACCTAGTTAGAGTTGAAAA 59.268 37.037 0.00 0.00 0.00 2.29
5461 6158 8.373220 CCTCCTTACCTAGTTAGAGTTGAAAAA 58.627 37.037 0.00 0.00 0.00 1.94
5504 6201 9.296400 TGTTTTTAAGTCATGTCAAGTTTAAGC 57.704 29.630 0.00 0.00 0.00 3.09
5505 6202 8.752254 GTTTTTAAGTCATGTCAAGTTTAAGCC 58.248 33.333 0.00 0.00 0.00 4.35
5506 6203 7.575414 TTTAAGTCATGTCAAGTTTAAGCCA 57.425 32.000 0.00 0.00 0.00 4.75
5507 6204 7.759489 TTAAGTCATGTCAAGTTTAAGCCAT 57.241 32.000 0.00 0.00 0.00 4.40
5508 6205 6.655078 AAGTCATGTCAAGTTTAAGCCATT 57.345 33.333 0.00 0.00 0.00 3.16
5509 6206 6.655078 AGTCATGTCAAGTTTAAGCCATTT 57.345 33.333 0.00 0.00 0.00 2.32
5510 6207 7.054491 AGTCATGTCAAGTTTAAGCCATTTT 57.946 32.000 0.00 0.00 0.00 1.82
5511 6208 8.177119 AGTCATGTCAAGTTTAAGCCATTTTA 57.823 30.769 0.00 0.00 0.00 1.52
5512 6209 8.299570 AGTCATGTCAAGTTTAAGCCATTTTAG 58.700 33.333 0.00 0.00 0.00 1.85
5513 6210 8.082242 GTCATGTCAAGTTTAAGCCATTTTAGT 58.918 33.333 0.00 0.00 0.00 2.24
5514 6211 9.290988 TCATGTCAAGTTTAAGCCATTTTAGTA 57.709 29.630 0.00 0.00 0.00 1.82
5515 6212 9.906660 CATGTCAAGTTTAAGCCATTTTAGTAA 57.093 29.630 0.00 0.00 0.00 2.24
5527 6224 8.682936 AGCCATTTTAGTAATAGATTGACTGG 57.317 34.615 0.00 0.00 0.00 4.00
5528 6225 7.229506 AGCCATTTTAGTAATAGATTGACTGGC 59.770 37.037 0.00 0.00 30.98 4.85
5529 6226 7.229506 GCCATTTTAGTAATAGATTGACTGGCT 59.770 37.037 0.00 0.00 29.25 4.75
5530 6227 9.778741 CCATTTTAGTAATAGATTGACTGGCTA 57.221 33.333 0.00 0.00 0.00 3.93
5543 6240 9.765795 AGATTGACTGGCTAATAATAGTTACAC 57.234 33.333 0.00 0.00 0.00 2.90
5544 6241 7.997107 TTGACTGGCTAATAATAGTTACACG 57.003 36.000 0.00 0.00 0.00 4.49
5545 6242 7.104043 TGACTGGCTAATAATAGTTACACGT 57.896 36.000 0.00 0.00 0.00 4.49
5546 6243 7.198390 TGACTGGCTAATAATAGTTACACGTC 58.802 38.462 0.00 0.00 0.00 4.34
5547 6244 6.204359 ACTGGCTAATAATAGTTACACGTCG 58.796 40.000 0.00 0.00 0.00 5.12
5548 6245 6.135290 TGGCTAATAATAGTTACACGTCGT 57.865 37.500 0.00 0.00 0.00 4.34
5549 6246 5.972973 TGGCTAATAATAGTTACACGTCGTG 59.027 40.000 23.40 23.40 39.75 4.35
5561 6258 3.433709 CACGTCGTGTGGACTTTTATG 57.566 47.619 17.30 0.00 45.21 1.90
5562 6259 2.798283 CACGTCGTGTGGACTTTTATGT 59.202 45.455 17.30 0.00 45.21 2.29
5563 6260 3.982701 CACGTCGTGTGGACTTTTATGTA 59.017 43.478 17.30 0.00 45.21 2.29
5564 6261 4.445052 CACGTCGTGTGGACTTTTATGTAA 59.555 41.667 17.30 0.00 45.21 2.41
5565 6262 4.445385 ACGTCGTGTGGACTTTTATGTAAC 59.555 41.667 0.00 0.00 43.79 2.50
5566 6263 4.431986 CGTCGTGTGGACTTTTATGTAACG 60.432 45.833 0.00 0.00 43.79 3.18
5567 6264 4.445385 GTCGTGTGGACTTTTATGTAACGT 59.555 41.667 0.00 0.00 42.62 3.99
5568 6265 4.681025 TCGTGTGGACTTTTATGTAACGTC 59.319 41.667 0.00 0.00 35.02 4.34
5569 6266 4.682860 CGTGTGGACTTTTATGTAACGTCT 59.317 41.667 0.00 0.00 35.82 4.18
5570 6267 5.388061 CGTGTGGACTTTTATGTAACGTCTG 60.388 44.000 0.00 0.00 35.82 3.51
5571 6268 4.449743 TGTGGACTTTTATGTAACGTCTGC 59.550 41.667 0.00 0.00 35.82 4.26
5572 6269 4.449743 GTGGACTTTTATGTAACGTCTGCA 59.550 41.667 0.00 0.00 35.82 4.41
5573 6270 4.449743 TGGACTTTTATGTAACGTCTGCAC 59.550 41.667 0.00 0.00 35.82 4.57
5574 6271 4.142966 GGACTTTTATGTAACGTCTGCACC 60.143 45.833 0.00 0.00 35.82 5.01
5575 6272 4.382291 ACTTTTATGTAACGTCTGCACCA 58.618 39.130 0.00 0.00 0.00 4.17
5576 6273 4.212636 ACTTTTATGTAACGTCTGCACCAC 59.787 41.667 0.00 0.00 0.00 4.16
5577 6274 3.388345 TTATGTAACGTCTGCACCACA 57.612 42.857 0.00 0.00 0.00 4.17
5578 6275 2.248280 ATGTAACGTCTGCACCACAA 57.752 45.000 0.00 0.00 0.00 3.33
5579 6276 1.577468 TGTAACGTCTGCACCACAAG 58.423 50.000 0.00 0.00 0.00 3.16
5580 6277 1.137282 TGTAACGTCTGCACCACAAGA 59.863 47.619 0.00 0.00 0.00 3.02
5581 6278 2.224185 TGTAACGTCTGCACCACAAGAT 60.224 45.455 0.00 0.00 0.00 2.40
5582 6279 1.512926 AACGTCTGCACCACAAGATC 58.487 50.000 0.00 0.00 0.00 2.75
5583 6280 0.667487 ACGTCTGCACCACAAGATCG 60.667 55.000 0.00 0.00 0.00 3.69
5584 6281 0.667487 CGTCTGCACCACAAGATCGT 60.667 55.000 0.00 0.00 0.00 3.73
5585 6282 1.071605 GTCTGCACCACAAGATCGTC 58.928 55.000 0.00 0.00 0.00 4.20
5586 6283 0.037326 TCTGCACCACAAGATCGTCC 60.037 55.000 0.00 0.00 0.00 4.79
5587 6284 0.036952 CTGCACCACAAGATCGTCCT 60.037 55.000 0.00 0.00 0.00 3.85
5588 6285 0.037326 TGCACCACAAGATCGTCCTC 60.037 55.000 0.00 0.00 0.00 3.71
5589 6286 0.247736 GCACCACAAGATCGTCCTCT 59.752 55.000 0.00 0.00 0.00 3.69
5590 6287 1.737363 GCACCACAAGATCGTCCTCTC 60.737 57.143 0.00 0.00 0.00 3.20
5591 6288 1.546029 CACCACAAGATCGTCCTCTCA 59.454 52.381 0.00 0.00 0.00 3.27
5592 6289 2.167281 CACCACAAGATCGTCCTCTCAT 59.833 50.000 0.00 0.00 0.00 2.90
5593 6290 3.381590 CACCACAAGATCGTCCTCTCATA 59.618 47.826 0.00 0.00 0.00 2.15
5594 6291 3.634448 ACCACAAGATCGTCCTCTCATAG 59.366 47.826 0.00 0.00 0.00 2.23
5595 6292 3.551863 CCACAAGATCGTCCTCTCATAGC 60.552 52.174 0.00 0.00 0.00 2.97
5596 6293 3.067320 CACAAGATCGTCCTCTCATAGCA 59.933 47.826 0.00 0.00 0.00 3.49
5597 6294 3.894427 ACAAGATCGTCCTCTCATAGCAT 59.106 43.478 0.00 0.00 0.00 3.79
5598 6295 5.048434 CACAAGATCGTCCTCTCATAGCATA 60.048 44.000 0.00 0.00 0.00 3.14
5599 6296 5.182950 ACAAGATCGTCCTCTCATAGCATAG 59.817 44.000 0.00 0.00 0.00 2.23
5600 6297 4.269183 AGATCGTCCTCTCATAGCATAGG 58.731 47.826 0.00 0.00 0.00 2.57
5601 6298 3.790089 TCGTCCTCTCATAGCATAGGA 57.210 47.619 0.00 0.00 35.77 2.94
5610 6307 5.798125 CTCATAGCATAGGAGTCCTTTCA 57.202 43.478 19.06 0.00 43.96 2.69
5611 6308 5.537188 CTCATAGCATAGGAGTCCTTTCAC 58.463 45.833 19.06 5.04 43.96 3.18
5612 6309 4.345257 TCATAGCATAGGAGTCCTTTCACC 59.655 45.833 19.06 2.07 34.61 4.02
5613 6310 1.840635 AGCATAGGAGTCCTTTCACCC 59.159 52.381 19.06 0.61 34.61 4.61
5614 6311 1.840635 GCATAGGAGTCCTTTCACCCT 59.159 52.381 19.06 0.00 34.61 4.34
5615 6312 3.039011 GCATAGGAGTCCTTTCACCCTA 58.961 50.000 19.06 0.00 34.61 3.53
5616 6313 3.070302 GCATAGGAGTCCTTTCACCCTAG 59.930 52.174 19.06 0.00 34.61 3.02
5617 6314 4.547671 CATAGGAGTCCTTTCACCCTAGA 58.452 47.826 19.06 0.00 34.61 2.43
5618 6315 3.786213 AGGAGTCCTTTCACCCTAGAT 57.214 47.619 5.62 0.00 0.00 1.98
5619 6316 3.379452 AGGAGTCCTTTCACCCTAGATG 58.621 50.000 5.62 0.00 0.00 2.90
5620 6317 2.158885 GGAGTCCTTTCACCCTAGATGC 60.159 54.545 0.41 0.00 0.00 3.91
5621 6318 2.501723 GAGTCCTTTCACCCTAGATGCA 59.498 50.000 0.00 0.00 0.00 3.96
5622 6319 3.118531 AGTCCTTTCACCCTAGATGCAT 58.881 45.455 0.00 0.00 0.00 3.96
5623 6320 3.118112 AGTCCTTTCACCCTAGATGCATG 60.118 47.826 2.46 0.00 0.00 4.06
5624 6321 1.952296 CCTTTCACCCTAGATGCATGC 59.048 52.381 11.82 11.82 0.00 4.06
5625 6322 2.422519 CCTTTCACCCTAGATGCATGCT 60.423 50.000 20.33 4.11 0.00 3.79
5626 6323 3.285484 CTTTCACCCTAGATGCATGCTT 58.715 45.455 20.33 13.23 0.00 3.91
5627 6324 4.454678 CTTTCACCCTAGATGCATGCTTA 58.545 43.478 20.33 7.99 0.00 3.09
5628 6325 3.475566 TCACCCTAGATGCATGCTTAC 57.524 47.619 20.33 10.00 0.00 2.34
5629 6326 2.771372 TCACCCTAGATGCATGCTTACA 59.229 45.455 20.33 0.00 0.00 2.41
5630 6327 3.392285 TCACCCTAGATGCATGCTTACAT 59.608 43.478 20.33 3.20 36.79 2.29
5644 6341 4.313282 TGCTTACATGCATCATCTAGAGC 58.687 43.478 0.00 0.65 38.12 4.09
5645 6342 4.202284 TGCTTACATGCATCATCTAGAGCA 60.202 41.667 6.83 6.83 41.73 4.26
5650 6347 3.832615 TGCATCATCTAGAGCATGTGT 57.167 42.857 12.92 0.00 31.05 3.72
5651 6348 3.463944 TGCATCATCTAGAGCATGTGTG 58.536 45.455 12.92 5.91 31.05 3.82
5652 6349 2.806818 GCATCATCTAGAGCATGTGTGG 59.193 50.000 12.92 0.00 0.00 4.17
5653 6350 3.743584 GCATCATCTAGAGCATGTGTGGT 60.744 47.826 12.92 0.00 39.13 4.16
5654 6351 4.449131 CATCATCTAGAGCATGTGTGGTT 58.551 43.478 0.00 0.00 35.91 3.67
5655 6352 3.865446 TCATCTAGAGCATGTGTGGTTG 58.135 45.455 0.00 0.00 35.91 3.77
5656 6353 3.261643 TCATCTAGAGCATGTGTGGTTGT 59.738 43.478 0.00 0.00 35.91 3.32
5657 6354 3.769739 TCTAGAGCATGTGTGGTTGTT 57.230 42.857 0.00 0.00 35.91 2.83
5658 6355 3.402110 TCTAGAGCATGTGTGGTTGTTG 58.598 45.455 0.00 0.00 35.91 3.33
5659 6356 2.057137 AGAGCATGTGTGGTTGTTGT 57.943 45.000 0.00 0.00 35.91 3.32
5660 6357 3.207265 AGAGCATGTGTGGTTGTTGTA 57.793 42.857 0.00 0.00 35.91 2.41
5661 6358 3.754965 AGAGCATGTGTGGTTGTTGTAT 58.245 40.909 0.00 0.00 35.91 2.29
5662 6359 4.905429 AGAGCATGTGTGGTTGTTGTATA 58.095 39.130 0.00 0.00 35.91 1.47
5663 6360 5.500234 AGAGCATGTGTGGTTGTTGTATAT 58.500 37.500 0.00 0.00 35.91 0.86
5664 6361 5.355071 AGAGCATGTGTGGTTGTTGTATATG 59.645 40.000 0.00 0.00 35.91 1.78
5665 6362 5.252547 AGCATGTGTGGTTGTTGTATATGA 58.747 37.500 0.00 0.00 30.39 2.15
5666 6363 5.355071 AGCATGTGTGGTTGTTGTATATGAG 59.645 40.000 0.00 0.00 30.39 2.90
5667 6364 5.353956 GCATGTGTGGTTGTTGTATATGAGA 59.646 40.000 0.00 0.00 0.00 3.27
5668 6365 6.128035 GCATGTGTGGTTGTTGTATATGAGAA 60.128 38.462 0.00 0.00 0.00 2.87
5669 6366 7.574779 GCATGTGTGGTTGTTGTATATGAGAAA 60.575 37.037 0.00 0.00 0.00 2.52
5670 6367 7.433708 TGTGTGGTTGTTGTATATGAGAAAG 57.566 36.000 0.00 0.00 0.00 2.62
5671 6368 6.995686 TGTGTGGTTGTTGTATATGAGAAAGT 59.004 34.615 0.00 0.00 0.00 2.66
5672 6369 8.151596 TGTGTGGTTGTTGTATATGAGAAAGTA 58.848 33.333 0.00 0.00 0.00 2.24
5673 6370 8.995220 GTGTGGTTGTTGTATATGAGAAAGTAA 58.005 33.333 0.00 0.00 0.00 2.24
5674 6371 9.733556 TGTGGTTGTTGTATATGAGAAAGTAAT 57.266 29.630 0.00 0.00 0.00 1.89
5688 6385 7.974504 TGAGAAAGTAATTTAGGAGGTTGAGT 58.025 34.615 0.00 0.00 0.00 3.41
5689 6386 7.878127 TGAGAAAGTAATTTAGGAGGTTGAGTG 59.122 37.037 0.00 0.00 0.00 3.51
5690 6387 7.746703 AGAAAGTAATTTAGGAGGTTGAGTGT 58.253 34.615 0.00 0.00 0.00 3.55
5691 6388 7.661847 AGAAAGTAATTTAGGAGGTTGAGTGTG 59.338 37.037 0.00 0.00 0.00 3.82
5692 6389 6.435292 AGTAATTTAGGAGGTTGAGTGTGT 57.565 37.500 0.00 0.00 0.00 3.72
5693 6390 6.465084 AGTAATTTAGGAGGTTGAGTGTGTC 58.535 40.000 0.00 0.00 0.00 3.67
5694 6391 4.974645 ATTTAGGAGGTTGAGTGTGTCA 57.025 40.909 0.00 0.00 0.00 3.58
5695 6392 4.974645 TTTAGGAGGTTGAGTGTGTCAT 57.025 40.909 0.00 0.00 34.17 3.06
5696 6393 4.974645 TTAGGAGGTTGAGTGTGTCATT 57.025 40.909 0.00 0.00 34.17 2.57
5697 6394 3.131709 AGGAGGTTGAGTGTGTCATTG 57.868 47.619 0.00 0.00 34.17 2.82
5698 6395 2.439507 AGGAGGTTGAGTGTGTCATTGT 59.560 45.455 0.00 0.00 34.17 2.71
5699 6396 2.808543 GGAGGTTGAGTGTGTCATTGTC 59.191 50.000 0.00 0.00 34.17 3.18
5700 6397 3.495100 GGAGGTTGAGTGTGTCATTGTCT 60.495 47.826 0.00 0.00 34.17 3.41
5701 6398 4.130118 GAGGTTGAGTGTGTCATTGTCTT 58.870 43.478 0.00 0.00 34.17 3.01
5702 6399 3.879295 AGGTTGAGTGTGTCATTGTCTTG 59.121 43.478 0.00 0.00 34.17 3.02
5703 6400 3.627577 GGTTGAGTGTGTCATTGTCTTGT 59.372 43.478 0.00 0.00 34.17 3.16
5704 6401 4.096382 GGTTGAGTGTGTCATTGTCTTGTT 59.904 41.667 0.00 0.00 34.17 2.83
5705 6402 5.393027 GGTTGAGTGTGTCATTGTCTTGTTT 60.393 40.000 0.00 0.00 34.17 2.83
5706 6403 5.233957 TGAGTGTGTCATTGTCTTGTTTG 57.766 39.130 0.00 0.00 0.00 2.93
5707 6404 4.940654 TGAGTGTGTCATTGTCTTGTTTGA 59.059 37.500 0.00 0.00 0.00 2.69
5708 6405 5.163764 TGAGTGTGTCATTGTCTTGTTTGAC 60.164 40.000 0.00 0.00 39.11 3.18
5709 6406 4.943705 AGTGTGTCATTGTCTTGTTTGACT 59.056 37.500 0.00 0.00 39.33 3.41
5710 6407 5.030295 GTGTGTCATTGTCTTGTTTGACTG 58.970 41.667 0.00 0.00 39.33 3.51
5711 6408 4.940654 TGTGTCATTGTCTTGTTTGACTGA 59.059 37.500 0.00 0.00 39.33 3.41
5712 6409 5.163764 TGTGTCATTGTCTTGTTTGACTGAC 60.164 40.000 8.91 8.91 39.99 3.51
5713 6410 5.065218 GTGTCATTGTCTTGTTTGACTGACT 59.935 40.000 13.91 0.00 40.12 3.41
5714 6411 5.065090 TGTCATTGTCTTGTTTGACTGACTG 59.935 40.000 13.91 0.00 40.12 3.51
5715 6412 5.294306 GTCATTGTCTTGTTTGACTGACTGA 59.706 40.000 0.00 0.00 38.25 3.41
5716 6413 5.525012 TCATTGTCTTGTTTGACTGACTGAG 59.475 40.000 0.00 0.00 37.79 3.35
5717 6414 4.471904 TGTCTTGTTTGACTGACTGAGT 57.528 40.909 0.00 0.00 37.79 3.41
5726 6423 2.576406 GACTGACTGAGTCGACTTTCG 58.424 52.381 21.08 13.17 41.91 3.46
5727 6424 1.948145 ACTGACTGAGTCGACTTTCGT 59.052 47.619 21.08 16.28 41.35 3.85
5728 6425 2.358267 ACTGACTGAGTCGACTTTCGTT 59.642 45.455 21.08 2.60 41.35 3.85
5729 6426 3.562973 ACTGACTGAGTCGACTTTCGTTA 59.437 43.478 21.08 12.28 41.35 3.18
5730 6427 3.881795 TGACTGAGTCGACTTTCGTTAC 58.118 45.455 21.08 5.33 41.35 2.50
5731 6428 3.313249 TGACTGAGTCGACTTTCGTTACA 59.687 43.478 21.08 10.01 41.35 2.41
5732 6429 4.201940 TGACTGAGTCGACTTTCGTTACAA 60.202 41.667 21.08 2.83 41.35 2.41
5733 6430 4.868067 ACTGAGTCGACTTTCGTTACAAT 58.132 39.130 21.08 0.00 41.35 2.71
5734 6431 4.680110 ACTGAGTCGACTTTCGTTACAATG 59.320 41.667 21.08 3.02 41.35 2.82
5735 6432 4.613944 TGAGTCGACTTTCGTTACAATGT 58.386 39.130 21.08 0.00 41.35 2.71
5736 6433 4.678287 TGAGTCGACTTTCGTTACAATGTC 59.322 41.667 21.08 2.04 41.35 3.06
5737 6434 4.868067 AGTCGACTTTCGTTACAATGTCT 58.132 39.130 13.58 0.00 41.35 3.41
5738 6435 4.916249 AGTCGACTTTCGTTACAATGTCTC 59.084 41.667 13.58 0.00 41.35 3.36
5739 6436 4.678287 GTCGACTTTCGTTACAATGTCTCA 59.322 41.667 8.70 0.00 41.35 3.27
5740 6437 5.174398 GTCGACTTTCGTTACAATGTCTCAA 59.826 40.000 8.70 0.00 41.35 3.02
5741 6438 5.401376 TCGACTTTCGTTACAATGTCTCAAG 59.599 40.000 0.00 0.00 41.35 3.02
5742 6439 5.388475 CGACTTTCGTTACAATGTCTCAAGG 60.388 44.000 0.00 0.00 34.72 3.61
5743 6440 5.365619 ACTTTCGTTACAATGTCTCAAGGT 58.634 37.500 0.00 0.00 0.00 3.50
5744 6441 5.820947 ACTTTCGTTACAATGTCTCAAGGTT 59.179 36.000 0.00 0.00 0.00 3.50
5745 6442 6.987992 ACTTTCGTTACAATGTCTCAAGGTTA 59.012 34.615 0.00 0.00 0.00 2.85
5746 6443 7.660208 ACTTTCGTTACAATGTCTCAAGGTTAT 59.340 33.333 0.00 0.00 0.00 1.89
5747 6444 9.146984 CTTTCGTTACAATGTCTCAAGGTTATA 57.853 33.333 0.00 0.00 0.00 0.98
5748 6445 9.661563 TTTCGTTACAATGTCTCAAGGTTATAT 57.338 29.630 0.00 0.00 0.00 0.86
5749 6446 8.642908 TCGTTACAATGTCTCAAGGTTATATG 57.357 34.615 0.00 0.00 0.00 1.78
5750 6447 8.255206 TCGTTACAATGTCTCAAGGTTATATGT 58.745 33.333 0.00 0.00 0.00 2.29
5751 6448 9.524106 CGTTACAATGTCTCAAGGTTATATGTA 57.476 33.333 0.00 0.00 0.00 2.29
5787 6484 8.824159 ATGTGCATGTCTTTACATATAGACTC 57.176 34.615 9.85 2.57 44.70 3.36
5788 6485 7.210174 TGTGCATGTCTTTACATATAGACTCC 58.790 38.462 9.85 1.74 44.70 3.85
5789 6486 7.147742 TGTGCATGTCTTTACATATAGACTCCA 60.148 37.037 9.85 3.63 44.70 3.86
5790 6487 7.875041 GTGCATGTCTTTACATATAGACTCCAT 59.125 37.037 9.85 0.00 44.70 3.41
5791 6488 8.432013 TGCATGTCTTTACATATAGACTCCATT 58.568 33.333 9.85 0.00 44.70 3.16
5792 6489 9.929180 GCATGTCTTTACATATAGACTCCATTA 57.071 33.333 9.85 0.00 44.70 1.90
5801 6498 8.319057 ACATATAGACTCCATTACTTTCCACA 57.681 34.615 0.00 0.00 0.00 4.17
5802 6499 8.938883 ACATATAGACTCCATTACTTTCCACAT 58.061 33.333 0.00 0.00 0.00 3.21
5803 6500 9.784531 CATATAGACTCCATTACTTTCCACATT 57.215 33.333 0.00 0.00 0.00 2.71
5833 6530 7.807977 AAGCAATATCTAATTTCACATCGGT 57.192 32.000 0.00 0.00 0.00 4.69
5834 6531 8.902540 AAGCAATATCTAATTTCACATCGGTA 57.097 30.769 0.00 0.00 0.00 4.02
5835 6532 8.311650 AGCAATATCTAATTTCACATCGGTAC 57.688 34.615 0.00 0.00 0.00 3.34
5836 6533 8.150945 AGCAATATCTAATTTCACATCGGTACT 58.849 33.333 0.00 0.00 0.00 2.73
5837 6534 9.419297 GCAATATCTAATTTCACATCGGTACTA 57.581 33.333 0.00 0.00 0.00 1.82
5859 6556 3.515602 AAAAACTCATCCCTGTCAGCT 57.484 42.857 0.00 0.00 0.00 4.24
5860 6557 2.777832 AAACTCATCCCTGTCAGCTC 57.222 50.000 0.00 0.00 0.00 4.09
5861 6558 0.908198 AACTCATCCCTGTCAGCTCC 59.092 55.000 0.00 0.00 0.00 4.70
5862 6559 0.980231 ACTCATCCCTGTCAGCTCCC 60.980 60.000 0.00 0.00 0.00 4.30
5863 6560 0.979709 CTCATCCCTGTCAGCTCCCA 60.980 60.000 0.00 0.00 0.00 4.37
5864 6561 0.326904 TCATCCCTGTCAGCTCCCAT 60.327 55.000 0.00 0.00 0.00 4.00
5865 6562 0.179026 CATCCCTGTCAGCTCCCATG 60.179 60.000 0.00 0.00 0.00 3.66
5866 6563 0.622738 ATCCCTGTCAGCTCCCATGT 60.623 55.000 0.00 0.00 0.00 3.21
5867 6564 0.042581 TCCCTGTCAGCTCCCATGTA 59.957 55.000 0.00 0.00 0.00 2.29
5868 6565 0.179000 CCCTGTCAGCTCCCATGTAC 59.821 60.000 0.00 0.00 0.00 2.90
5869 6566 0.179000 CCTGTCAGCTCCCATGTACC 59.821 60.000 0.00 0.00 0.00 3.34
5870 6567 0.179100 CTGTCAGCTCCCATGTACCG 60.179 60.000 0.00 0.00 0.00 4.02
5871 6568 0.613572 TGTCAGCTCCCATGTACCGA 60.614 55.000 0.00 0.00 0.00 4.69
5872 6569 0.753262 GTCAGCTCCCATGTACCGAT 59.247 55.000 0.00 0.00 0.00 4.18
5873 6570 1.961394 GTCAGCTCCCATGTACCGATA 59.039 52.381 0.00 0.00 0.00 2.92
5874 6571 2.364324 GTCAGCTCCCATGTACCGATAA 59.636 50.000 0.00 0.00 0.00 1.75
5875 6572 3.035363 TCAGCTCCCATGTACCGATAAA 58.965 45.455 0.00 0.00 0.00 1.40
5876 6573 3.646162 TCAGCTCCCATGTACCGATAAAT 59.354 43.478 0.00 0.00 0.00 1.40
5877 6574 3.997021 CAGCTCCCATGTACCGATAAATC 59.003 47.826 0.00 0.00 0.00 2.17
5899 6596 6.525121 TCGGAATCGATACTAAAGCATTTG 57.475 37.500 0.00 0.00 38.68 2.32
5900 6597 6.046593 TCGGAATCGATACTAAAGCATTTGT 58.953 36.000 0.00 0.00 38.68 2.83
5901 6598 6.019075 TCGGAATCGATACTAAAGCATTTGTG 60.019 38.462 0.00 0.00 38.68 3.33
5902 6599 6.238103 CGGAATCGATACTAAAGCATTTGTGT 60.238 38.462 0.00 0.00 37.47 3.72
5903 6600 7.472543 GGAATCGATACTAAAGCATTTGTGTT 58.527 34.615 0.00 0.00 39.63 3.32
5904 6601 7.429340 GGAATCGATACTAAAGCATTTGTGTTG 59.571 37.037 0.00 0.00 39.63 3.33
5905 6602 7.609760 ATCGATACTAAAGCATTTGTGTTGA 57.390 32.000 0.00 5.68 39.63 3.18
5906 6603 7.609760 TCGATACTAAAGCATTTGTGTTGAT 57.390 32.000 0.00 0.00 39.63 2.57
5907 6604 7.463544 TCGATACTAAAGCATTTGTGTTGATG 58.536 34.615 0.00 0.00 39.63 3.07
5908 6605 6.195244 CGATACTAAAGCATTTGTGTTGATGC 59.805 38.462 0.00 0.29 46.88 3.91
5913 6610 3.984018 GCATTTGTGTTGATGCATCAC 57.016 42.857 28.72 21.92 46.03 3.06
5914 6611 3.318886 GCATTTGTGTTGATGCATCACA 58.681 40.909 28.72 24.00 46.03 3.58
5915 6612 3.741856 GCATTTGTGTTGATGCATCACAA 59.258 39.130 28.72 24.75 45.89 3.33
5916 6613 4.390603 GCATTTGTGTTGATGCATCACAAT 59.609 37.500 28.72 17.21 46.39 2.71
5917 6614 5.577554 GCATTTGTGTTGATGCATCACAATA 59.422 36.000 28.72 18.33 46.39 1.90
5918 6615 6.237728 GCATTTGTGTTGATGCATCACAATAG 60.238 38.462 28.72 21.77 46.39 1.73
5919 6616 5.963176 TTGTGTTGATGCATCACAATAGT 57.037 34.783 28.72 0.00 44.09 2.12
5920 6617 5.963176 TGTGTTGATGCATCACAATAGTT 57.037 34.783 28.72 0.00 39.91 2.24
5921 6618 5.701855 TGTGTTGATGCATCACAATAGTTG 58.298 37.500 28.72 0.00 39.91 3.16
5922 6619 5.097529 GTGTTGATGCATCACAATAGTTGG 58.902 41.667 28.72 0.00 36.36 3.77
5923 6620 4.766373 TGTTGATGCATCACAATAGTTGGT 59.234 37.500 28.72 0.00 36.36 3.67
5924 6621 5.942826 TGTTGATGCATCACAATAGTTGGTA 59.057 36.000 28.72 7.04 36.36 3.25
5925 6622 6.093909 TGTTGATGCATCACAATAGTTGGTAG 59.906 38.462 28.72 0.00 36.36 3.18
5926 6623 4.576053 TGATGCATCACAATAGTTGGTAGC 59.424 41.667 25.42 0.00 34.12 3.58
5927 6624 3.949132 TGCATCACAATAGTTGGTAGCA 58.051 40.909 0.00 0.00 34.12 3.49
5928 6625 4.331108 TGCATCACAATAGTTGGTAGCAA 58.669 39.130 2.54 2.54 34.12 3.91
5929 6626 4.949238 TGCATCACAATAGTTGGTAGCAAT 59.051 37.500 11.06 3.06 34.12 3.56
5930 6627 6.118852 TGCATCACAATAGTTGGTAGCAATA 58.881 36.000 11.06 5.14 34.12 1.90
5931 6628 6.601217 TGCATCACAATAGTTGGTAGCAATAA 59.399 34.615 11.06 2.55 34.12 1.40
5932 6629 7.121907 TGCATCACAATAGTTGGTAGCAATAAA 59.878 33.333 11.06 0.00 34.12 1.40
5933 6630 7.432252 GCATCACAATAGTTGGTAGCAATAAAC 59.568 37.037 11.06 0.00 34.12 2.01
5934 6631 8.677300 CATCACAATAGTTGGTAGCAATAAACT 58.323 33.333 11.06 6.43 36.80 2.66
5935 6632 8.263940 TCACAATAGTTGGTAGCAATAAACTC 57.736 34.615 11.06 0.00 34.76 3.01
5936 6633 8.100791 TCACAATAGTTGGTAGCAATAAACTCT 58.899 33.333 11.06 4.66 34.76 3.24
5937 6634 8.391106 CACAATAGTTGGTAGCAATAAACTCTC 58.609 37.037 11.06 0.00 34.76 3.20
5938 6635 7.553044 ACAATAGTTGGTAGCAATAAACTCTCC 59.447 37.037 11.06 0.00 34.76 3.71
5939 6636 5.499004 AGTTGGTAGCAATAAACTCTCCA 57.501 39.130 11.06 0.00 0.00 3.86
5940 6637 5.876357 AGTTGGTAGCAATAAACTCTCCAA 58.124 37.500 11.06 0.00 32.57 3.53
5941 6638 5.940470 AGTTGGTAGCAATAAACTCTCCAAG 59.060 40.000 11.06 0.00 34.34 3.61
5942 6639 4.843728 TGGTAGCAATAAACTCTCCAAGG 58.156 43.478 0.00 0.00 0.00 3.61
5943 6640 4.288626 TGGTAGCAATAAACTCTCCAAGGT 59.711 41.667 0.00 0.00 0.00 3.50
5944 6641 4.636206 GGTAGCAATAAACTCTCCAAGGTG 59.364 45.833 0.00 0.00 0.00 4.00
5945 6642 4.373156 AGCAATAAACTCTCCAAGGTGT 57.627 40.909 0.00 0.00 0.00 4.16
5946 6643 5.499004 AGCAATAAACTCTCCAAGGTGTA 57.501 39.130 0.00 0.00 0.00 2.90
5947 6644 6.067217 AGCAATAAACTCTCCAAGGTGTAT 57.933 37.500 0.00 0.00 0.00 2.29
5948 6645 6.116126 AGCAATAAACTCTCCAAGGTGTATC 58.884 40.000 0.00 0.00 0.00 2.24
5949 6646 5.297029 GCAATAAACTCTCCAAGGTGTATCC 59.703 44.000 0.00 0.00 0.00 2.59
5950 6647 6.414732 CAATAAACTCTCCAAGGTGTATCCA 58.585 40.000 0.00 0.00 39.02 3.41
5951 6648 3.983044 AACTCTCCAAGGTGTATCCAC 57.017 47.619 0.00 0.00 41.06 4.02
5952 6649 3.191888 ACTCTCCAAGGTGTATCCACT 57.808 47.619 0.00 0.00 41.53 4.00
5953 6650 4.332683 ACTCTCCAAGGTGTATCCACTA 57.667 45.455 0.00 0.00 41.53 2.74
5954 6651 4.282496 ACTCTCCAAGGTGTATCCACTAG 58.718 47.826 0.00 0.00 41.53 2.57
5955 6652 3.031736 TCTCCAAGGTGTATCCACTAGC 58.968 50.000 0.00 0.00 41.53 3.42
5956 6653 1.754803 TCCAAGGTGTATCCACTAGCG 59.245 52.381 0.00 0.00 41.53 4.26
5957 6654 1.571919 CAAGGTGTATCCACTAGCGC 58.428 55.000 0.00 0.00 41.53 5.92
5958 6655 1.137086 CAAGGTGTATCCACTAGCGCT 59.863 52.381 17.26 17.26 41.53 5.92
5959 6656 0.747255 AGGTGTATCCACTAGCGCTG 59.253 55.000 22.90 12.81 41.53 5.18
5960 6657 0.249489 GGTGTATCCACTAGCGCTGG 60.249 60.000 22.90 21.51 41.53 4.85
5961 6658 0.460311 GTGTATCCACTAGCGCTGGT 59.540 55.000 21.87 21.87 38.61 4.00
5962 6659 0.459899 TGTATCCACTAGCGCTGGTG 59.540 55.000 38.12 38.12 41.07 4.17
5963 6660 0.876342 GTATCCACTAGCGCTGGTGC 60.876 60.000 39.24 25.73 40.22 5.01
5965 6662 1.903877 ATCCACTAGCGCTGGTGCTT 61.904 55.000 39.24 27.86 44.46 3.91
5966 6663 1.672356 CCACTAGCGCTGGTGCTTT 60.672 57.895 39.24 11.60 44.46 3.51
5967 6664 1.499056 CACTAGCGCTGGTGCTTTG 59.501 57.895 35.89 16.52 44.46 2.77
5968 6665 1.672356 ACTAGCGCTGGTGCTTTGG 60.672 57.895 26.69 0.00 44.46 3.28
5969 6666 1.672356 CTAGCGCTGGTGCTTTGGT 60.672 57.895 22.90 0.00 44.46 3.67
5970 6667 0.391130 CTAGCGCTGGTGCTTTGGTA 60.391 55.000 22.90 0.00 44.46 3.25
5971 6668 0.035598 TAGCGCTGGTGCTTTGGTAA 59.964 50.000 22.90 0.00 44.46 2.85
5972 6669 0.609131 AGCGCTGGTGCTTTGGTAAT 60.609 50.000 10.39 0.00 44.46 1.89
5973 6670 0.243636 GCGCTGGTGCTTTGGTAATT 59.756 50.000 0.00 0.00 36.97 1.40
5974 6671 1.470890 GCGCTGGTGCTTTGGTAATTA 59.529 47.619 0.00 0.00 36.97 1.40
5975 6672 2.099098 GCGCTGGTGCTTTGGTAATTAT 59.901 45.455 0.00 0.00 36.97 1.28
5976 6673 3.428862 GCGCTGGTGCTTTGGTAATTATT 60.429 43.478 0.00 0.00 36.97 1.40
5977 6674 4.743493 CGCTGGTGCTTTGGTAATTATTT 58.257 39.130 0.00 0.00 36.97 1.40
5978 6675 4.562394 CGCTGGTGCTTTGGTAATTATTTG 59.438 41.667 0.00 0.00 36.97 2.32
5979 6676 5.478407 GCTGGTGCTTTGGTAATTATTTGT 58.522 37.500 0.00 0.00 36.03 2.83
5980 6677 5.348451 GCTGGTGCTTTGGTAATTATTTGTG 59.652 40.000 0.00 0.00 36.03 3.33
5981 6678 6.412362 TGGTGCTTTGGTAATTATTTGTGT 57.588 33.333 0.00 0.00 0.00 3.72
5982 6679 6.451393 TGGTGCTTTGGTAATTATTTGTGTC 58.549 36.000 0.00 0.00 0.00 3.67
5983 6680 5.571357 GGTGCTTTGGTAATTATTTGTGTCG 59.429 40.000 0.00 0.00 0.00 4.35
5984 6681 6.146898 GTGCTTTGGTAATTATTTGTGTCGT 58.853 36.000 0.00 0.00 0.00 4.34
5985 6682 6.304683 GTGCTTTGGTAATTATTTGTGTCGTC 59.695 38.462 0.00 0.00 0.00 4.20
5986 6683 6.205853 TGCTTTGGTAATTATTTGTGTCGTCT 59.794 34.615 0.00 0.00 0.00 4.18
5987 6684 6.741358 GCTTTGGTAATTATTTGTGTCGTCTC 59.259 38.462 0.00 0.00 0.00 3.36
5988 6685 7.360946 GCTTTGGTAATTATTTGTGTCGTCTCT 60.361 37.037 0.00 0.00 0.00 3.10
5989 6686 7.972832 TTGGTAATTATTTGTGTCGTCTCTT 57.027 32.000 0.00 0.00 0.00 2.85
5990 6687 7.359262 TGGTAATTATTTGTGTCGTCTCTTG 57.641 36.000 0.00 0.00 0.00 3.02
5991 6688 6.932400 TGGTAATTATTTGTGTCGTCTCTTGT 59.068 34.615 0.00 0.00 0.00 3.16
5992 6689 7.442969 TGGTAATTATTTGTGTCGTCTCTTGTT 59.557 33.333 0.00 0.00 0.00 2.83
5993 6690 8.928733 GGTAATTATTTGTGTCGTCTCTTGTTA 58.071 33.333 0.00 0.00 0.00 2.41
5994 6691 9.737025 GTAATTATTTGTGTCGTCTCTTGTTAC 57.263 33.333 0.00 0.00 0.00 2.50
5995 6692 7.956420 ATTATTTGTGTCGTCTCTTGTTACA 57.044 32.000 0.00 0.00 0.00 2.41
5996 6693 7.773864 TTATTTGTGTCGTCTCTTGTTACAA 57.226 32.000 0.00 0.00 0.00 2.41
5997 6694 6.671614 ATTTGTGTCGTCTCTTGTTACAAA 57.328 33.333 0.00 0.00 39.78 2.83
5998 6695 6.483385 TTTGTGTCGTCTCTTGTTACAAAA 57.517 33.333 0.00 0.00 34.71 2.44
5999 6696 6.671614 TTGTGTCGTCTCTTGTTACAAAAT 57.328 33.333 0.00 0.00 0.00 1.82
6000 6697 7.773864 TTGTGTCGTCTCTTGTTACAAAATA 57.226 32.000 0.00 0.00 0.00 1.40
6001 6698 7.402811 TGTGTCGTCTCTTGTTACAAAATAG 57.597 36.000 0.00 0.00 0.00 1.73
6002 6699 6.073980 TGTGTCGTCTCTTGTTACAAAATAGC 60.074 38.462 0.00 0.00 0.00 2.97
6003 6700 5.986741 TGTCGTCTCTTGTTACAAAATAGCA 59.013 36.000 0.00 0.00 0.00 3.49
6004 6701 6.145534 TGTCGTCTCTTGTTACAAAATAGCAG 59.854 38.462 0.00 0.00 0.00 4.24
6005 6702 6.365247 GTCGTCTCTTGTTACAAAATAGCAGA 59.635 38.462 0.00 0.00 0.00 4.26
6006 6703 6.926826 TCGTCTCTTGTTACAAAATAGCAGAA 59.073 34.615 0.00 0.00 0.00 3.02
6007 6704 7.439955 TCGTCTCTTGTTACAAAATAGCAGAAA 59.560 33.333 0.00 0.00 0.00 2.52
6008 6705 8.230486 CGTCTCTTGTTACAAAATAGCAGAAAT 58.770 33.333 0.00 0.00 0.00 2.17
6025 6722 8.565896 AGCAGAAATACATTTATCTGTGTTCA 57.434 30.769 0.00 0.00 30.34 3.18
6026 6723 9.182214 AGCAGAAATACATTTATCTGTGTTCAT 57.818 29.630 0.00 0.00 30.34 2.57
6027 6724 9.443283 GCAGAAATACATTTATCTGTGTTCATC 57.557 33.333 0.00 0.00 30.34 2.92
6030 6727 9.941664 GAAATACATTTATCTGTGTTCATCTGG 57.058 33.333 0.00 0.00 30.34 3.86
6031 6728 5.824904 ACATTTATCTGTGTTCATCTGGC 57.175 39.130 0.00 0.00 0.00 4.85
6032 6729 4.641989 ACATTTATCTGTGTTCATCTGGCC 59.358 41.667 0.00 0.00 0.00 5.36
6033 6730 4.574674 TTTATCTGTGTTCATCTGGCCT 57.425 40.909 3.32 0.00 0.00 5.19
6034 6731 5.692115 TTTATCTGTGTTCATCTGGCCTA 57.308 39.130 3.32 0.00 0.00 3.93
6035 6732 5.894298 TTATCTGTGTTCATCTGGCCTAT 57.106 39.130 3.32 0.00 0.00 2.57
6036 6733 3.827008 TCTGTGTTCATCTGGCCTATC 57.173 47.619 3.32 0.00 0.00 2.08
6037 6734 3.378512 TCTGTGTTCATCTGGCCTATCT 58.621 45.455 3.32 0.00 0.00 1.98
6038 6735 3.386078 TCTGTGTTCATCTGGCCTATCTC 59.614 47.826 3.32 0.00 0.00 2.75
6039 6736 3.378512 TGTGTTCATCTGGCCTATCTCT 58.621 45.455 3.32 0.00 0.00 3.10
6040 6737 3.776969 TGTGTTCATCTGGCCTATCTCTT 59.223 43.478 3.32 0.00 0.00 2.85
6041 6738 4.125703 GTGTTCATCTGGCCTATCTCTTG 58.874 47.826 3.32 0.00 0.00 3.02
6042 6739 3.776969 TGTTCATCTGGCCTATCTCTTGT 59.223 43.478 3.32 0.00 0.00 3.16
6043 6740 4.225942 TGTTCATCTGGCCTATCTCTTGTT 59.774 41.667 3.32 0.00 0.00 2.83
6044 6741 5.425217 TGTTCATCTGGCCTATCTCTTGTTA 59.575 40.000 3.32 0.00 0.00 2.41
6045 6742 5.537300 TCATCTGGCCTATCTCTTGTTAC 57.463 43.478 3.32 0.00 0.00 2.50
6046 6743 4.345257 TCATCTGGCCTATCTCTTGTTACC 59.655 45.833 3.32 0.00 0.00 2.85
6047 6744 3.719871 TCTGGCCTATCTCTTGTTACCA 58.280 45.455 3.32 0.00 0.00 3.25
6048 6745 4.298626 TCTGGCCTATCTCTTGTTACCAT 58.701 43.478 3.32 0.00 0.00 3.55
6049 6746 4.345257 TCTGGCCTATCTCTTGTTACCATC 59.655 45.833 3.32 0.00 0.00 3.51
6050 6747 4.298626 TGGCCTATCTCTTGTTACCATCT 58.701 43.478 3.32 0.00 0.00 2.90
6051 6748 5.464069 TGGCCTATCTCTTGTTACCATCTA 58.536 41.667 3.32 0.00 0.00 1.98
6052 6749 5.540337 TGGCCTATCTCTTGTTACCATCTAG 59.460 44.000 3.32 0.00 0.00 2.43
6053 6750 5.474825 GCCTATCTCTTGTTACCATCTAGC 58.525 45.833 0.00 0.00 0.00 3.42
6054 6751 5.011125 GCCTATCTCTTGTTACCATCTAGCA 59.989 44.000 0.00 0.00 0.00 3.49
6055 6752 6.295575 GCCTATCTCTTGTTACCATCTAGCAT 60.296 42.308 0.00 0.00 0.00 3.79
6056 6753 7.675062 CCTATCTCTTGTTACCATCTAGCATT 58.325 38.462 0.00 0.00 0.00 3.56
6057 6754 7.601886 CCTATCTCTTGTTACCATCTAGCATTG 59.398 40.741 0.00 0.00 0.00 2.82
6058 6755 6.544928 TCTCTTGTTACCATCTAGCATTGA 57.455 37.500 0.00 0.00 0.00 2.57
6059 6756 7.129457 TCTCTTGTTACCATCTAGCATTGAT 57.871 36.000 0.00 0.00 0.00 2.57
6060 6757 8.250143 TCTCTTGTTACCATCTAGCATTGATA 57.750 34.615 0.00 0.00 0.00 2.15
6061 6758 8.704668 TCTCTTGTTACCATCTAGCATTGATAA 58.295 33.333 0.00 0.00 0.00 1.75
6062 6759 8.662781 TCTTGTTACCATCTAGCATTGATAAC 57.337 34.615 0.00 0.00 0.00 1.89
6063 6760 8.486210 TCTTGTTACCATCTAGCATTGATAACT 58.514 33.333 6.19 0.00 0.00 2.24
6064 6761 9.113838 CTTGTTACCATCTAGCATTGATAACTT 57.886 33.333 6.19 0.00 0.00 2.66
6065 6762 8.437360 TGTTACCATCTAGCATTGATAACTTG 57.563 34.615 6.19 0.00 0.00 3.16
6066 6763 8.046708 TGTTACCATCTAGCATTGATAACTTGT 58.953 33.333 6.19 0.00 0.00 3.16
6067 6764 6.932356 ACCATCTAGCATTGATAACTTGTG 57.068 37.500 0.00 0.00 0.00 3.33
6068 6765 6.653020 ACCATCTAGCATTGATAACTTGTGA 58.347 36.000 0.00 0.00 0.00 3.58
6069 6766 7.285566 ACCATCTAGCATTGATAACTTGTGAT 58.714 34.615 0.00 0.00 0.00 3.06
6070 6767 7.776969 ACCATCTAGCATTGATAACTTGTGATT 59.223 33.333 0.00 0.00 0.00 2.57
6071 6768 9.276590 CCATCTAGCATTGATAACTTGTGATTA 57.723 33.333 0.00 0.00 0.00 1.75
6096 6793 8.922058 ATCACTGCAAATTCAAAATATGAGAC 57.078 30.769 0.00 0.00 39.77 3.36
6097 6794 7.884257 TCACTGCAAATTCAAAATATGAGACA 58.116 30.769 0.00 0.00 39.77 3.41
6098 6795 8.358895 TCACTGCAAATTCAAAATATGAGACAA 58.641 29.630 0.00 0.00 39.77 3.18
6099 6796 8.980610 CACTGCAAATTCAAAATATGAGACAAA 58.019 29.630 0.00 0.00 39.77 2.83
6100 6797 9.545105 ACTGCAAATTCAAAATATGAGACAAAA 57.455 25.926 0.00 0.00 39.77 2.44
6111 6808 9.807649 AAAATATGAGACAAAAAGTGATATGCC 57.192 29.630 0.00 0.00 0.00 4.40
6112 6809 8.757982 AATATGAGACAAAAAGTGATATGCCT 57.242 30.769 0.00 0.00 0.00 4.75
6113 6810 9.851686 AATATGAGACAAAAAGTGATATGCCTA 57.148 29.630 0.00 0.00 0.00 3.93
6114 6811 7.798596 ATGAGACAAAAAGTGATATGCCTAG 57.201 36.000 0.00 0.00 0.00 3.02
6115 6812 6.946340 TGAGACAAAAAGTGATATGCCTAGA 58.054 36.000 0.00 0.00 0.00 2.43
6116 6813 7.394016 TGAGACAAAAAGTGATATGCCTAGAA 58.606 34.615 0.00 0.00 0.00 2.10
6117 6814 8.049117 TGAGACAAAAAGTGATATGCCTAGAAT 58.951 33.333 0.00 0.00 0.00 2.40
6118 6815 8.218338 AGACAAAAAGTGATATGCCTAGAATG 57.782 34.615 0.00 0.00 0.00 2.67
6119 6816 7.284034 AGACAAAAAGTGATATGCCTAGAATGG 59.716 37.037 0.00 0.00 0.00 3.16
6120 6817 7.118723 ACAAAAAGTGATATGCCTAGAATGGA 58.881 34.615 0.00 0.00 0.00 3.41
6121 6818 7.781693 ACAAAAAGTGATATGCCTAGAATGGAT 59.218 33.333 0.00 0.00 0.00 3.41
6122 6819 9.288576 CAAAAAGTGATATGCCTAGAATGGATA 57.711 33.333 0.00 0.00 0.00 2.59
6123 6820 9.512588 AAAAAGTGATATGCCTAGAATGGATAG 57.487 33.333 0.00 0.00 0.00 2.08
6124 6821 8.441311 AAAGTGATATGCCTAGAATGGATAGA 57.559 34.615 0.00 0.00 0.00 1.98
6125 6822 8.621126 AAGTGATATGCCTAGAATGGATAGAT 57.379 34.615 0.00 0.00 0.00 1.98
6126 6823 9.720874 AAGTGATATGCCTAGAATGGATAGATA 57.279 33.333 0.00 0.00 0.00 1.98
6127 6824 9.142014 AGTGATATGCCTAGAATGGATAGATAC 57.858 37.037 0.00 0.00 0.00 2.24
6128 6825 9.142014 GTGATATGCCTAGAATGGATAGATACT 57.858 37.037 0.00 0.00 0.00 2.12
6129 6826 9.720874 TGATATGCCTAGAATGGATAGATACTT 57.279 33.333 0.00 0.00 0.00 2.24
6131 6828 6.859112 TGCCTAGAATGGATAGATACTTCC 57.141 41.667 0.00 0.00 0.00 3.46
6132 6829 5.721960 TGCCTAGAATGGATAGATACTTCCC 59.278 44.000 0.00 0.00 0.00 3.97
6133 6830 5.721960 GCCTAGAATGGATAGATACTTCCCA 59.278 44.000 0.00 0.00 0.00 4.37
6134 6831 6.213600 GCCTAGAATGGATAGATACTTCCCAA 59.786 42.308 0.00 0.00 0.00 4.12
6135 6832 7.580495 GCCTAGAATGGATAGATACTTCCCAAG 60.580 44.444 0.00 0.00 0.00 3.61
6136 6833 7.456269 CCTAGAATGGATAGATACTTCCCAAGT 59.544 40.741 0.00 0.00 45.40 3.16
6137 6834 7.698163 AGAATGGATAGATACTTCCCAAGTT 57.302 36.000 0.00 0.00 42.81 2.66
6138 6835 8.107196 AGAATGGATAGATACTTCCCAAGTTT 57.893 34.615 0.00 0.00 42.81 2.66
6139 6836 8.560903 AGAATGGATAGATACTTCCCAAGTTTT 58.439 33.333 0.00 0.00 42.81 2.43
6140 6837 8.525290 AATGGATAGATACTTCCCAAGTTTTG 57.475 34.615 0.00 0.00 42.81 2.44
6141 6838 7.265599 TGGATAGATACTTCCCAAGTTTTGA 57.734 36.000 0.00 0.00 42.81 2.69
6142 6839 7.695055 TGGATAGATACTTCCCAAGTTTTGAA 58.305 34.615 0.00 0.00 42.81 2.69
6143 6840 8.336235 TGGATAGATACTTCCCAAGTTTTGAAT 58.664 33.333 0.00 0.00 42.81 2.57
6144 6841 9.190317 GGATAGATACTTCCCAAGTTTTGAATT 57.810 33.333 0.00 0.00 42.81 2.17
6147 6844 8.477419 AGATACTTCCCAAGTTTTGAATTTGA 57.523 30.769 0.00 0.00 42.81 2.69
6148 6845 8.579863 AGATACTTCCCAAGTTTTGAATTTGAG 58.420 33.333 0.00 0.00 42.81 3.02
6149 6846 6.544928 ACTTCCCAAGTTTTGAATTTGAGT 57.455 33.333 0.00 0.00 39.04 3.41
6150 6847 7.654022 ACTTCCCAAGTTTTGAATTTGAGTA 57.346 32.000 0.00 0.00 39.04 2.59
6151 6848 8.250143 ACTTCCCAAGTTTTGAATTTGAGTAT 57.750 30.769 0.00 0.00 39.04 2.12
6152 6849 8.360390 ACTTCCCAAGTTTTGAATTTGAGTATC 58.640 33.333 0.00 0.00 39.04 2.24
6171 6868 8.134895 TGAGTATCAACATGTTTCAAAAACTCC 58.865 33.333 8.77 3.22 45.97 3.85
6172 6869 8.006298 AGTATCAACATGTTTCAAAAACTCCA 57.994 30.769 8.77 0.00 0.00 3.86
6173 6870 7.920682 AGTATCAACATGTTTCAAAAACTCCAC 59.079 33.333 8.77 0.00 0.00 4.02
6174 6871 6.030548 TCAACATGTTTCAAAAACTCCACA 57.969 33.333 8.77 0.00 0.00 4.17
6175 6872 5.866633 TCAACATGTTTCAAAAACTCCACAC 59.133 36.000 8.77 0.00 0.00 3.82
6176 6873 5.398603 ACATGTTTCAAAAACTCCACACA 57.601 34.783 0.00 0.00 0.00 3.72
6177 6874 5.167845 ACATGTTTCAAAAACTCCACACAC 58.832 37.500 0.00 0.00 0.00 3.82
6178 6875 4.855715 TGTTTCAAAAACTCCACACACA 57.144 36.364 4.40 0.00 0.00 3.72
6179 6876 5.398603 TGTTTCAAAAACTCCACACACAT 57.601 34.783 4.40 0.00 0.00 3.21
6180 6877 5.167121 TGTTTCAAAAACTCCACACACATG 58.833 37.500 4.40 0.00 0.00 3.21
6181 6878 3.435105 TCAAAAACTCCACACACATGC 57.565 42.857 0.00 0.00 0.00 4.06
6182 6879 2.757314 TCAAAAACTCCACACACATGCA 59.243 40.909 0.00 0.00 0.00 3.96
6183 6880 3.384146 TCAAAAACTCCACACACATGCAT 59.616 39.130 0.00 0.00 0.00 3.96
6184 6881 3.374220 AAAACTCCACACACATGCATG 57.626 42.857 25.09 25.09 0.00 4.06
6185 6882 1.985473 AACTCCACACACATGCATGT 58.015 45.000 26.61 26.61 42.84 3.21
6186 6883 1.985473 ACTCCACACACATGCATGTT 58.015 45.000 29.48 17.50 39.39 2.71
6187 6884 3.138884 ACTCCACACACATGCATGTTA 57.861 42.857 29.48 10.00 39.39 2.41
6188 6885 3.485394 ACTCCACACACATGCATGTTAA 58.515 40.909 29.48 10.34 39.39 2.01
6189 6886 4.081406 ACTCCACACACATGCATGTTAAT 58.919 39.130 29.48 15.19 39.39 1.40
6190 6887 4.156556 ACTCCACACACATGCATGTTAATC 59.843 41.667 29.48 0.00 39.39 1.75
6191 6888 4.077822 TCCACACACATGCATGTTAATCA 58.922 39.130 29.48 9.56 39.39 2.57
6192 6889 4.705991 TCCACACACATGCATGTTAATCAT 59.294 37.500 29.48 9.48 39.39 2.45
6204 6901 5.516996 CATGTTAATCATGTGACCTGATGC 58.483 41.667 4.13 0.16 46.18 3.91
6205 6902 4.587891 TGTTAATCATGTGACCTGATGCA 58.412 39.130 4.13 0.00 33.69 3.96
6206 6903 4.395854 TGTTAATCATGTGACCTGATGCAC 59.604 41.667 4.13 5.26 33.69 4.57
6208 6905 2.565046 TCATGTGACCTGATGCACAA 57.435 45.000 0.00 0.00 46.74 3.33
6209 6906 3.076079 TCATGTGACCTGATGCACAAT 57.924 42.857 0.00 0.00 46.74 2.71
6210 6907 3.011818 TCATGTGACCTGATGCACAATC 58.988 45.455 0.00 0.00 46.74 2.67
6211 6908 2.565046 TGTGACCTGATGCACAATCA 57.435 45.000 0.00 0.00 43.24 2.57
6212 6909 3.076079 TGTGACCTGATGCACAATCAT 57.924 42.857 0.00 0.00 44.40 2.45
6213 6910 2.750712 TGTGACCTGATGCACAATCATG 59.249 45.455 0.00 0.00 44.40 3.07
6214 6911 2.751259 GTGACCTGATGCACAATCATGT 59.249 45.455 0.00 0.00 44.40 3.21
6224 6921 1.167851 ACAATCATGTGGCAGTTCGG 58.832 50.000 0.00 0.00 38.69 4.30
6225 6922 0.179156 CAATCATGTGGCAGTTCGGC 60.179 55.000 0.00 0.00 41.67 5.54
6226 6923 1.647545 AATCATGTGGCAGTTCGGCG 61.648 55.000 0.00 0.00 45.16 6.46
6227 6924 2.803155 ATCATGTGGCAGTTCGGCGT 62.803 55.000 6.85 0.00 45.16 5.68
6228 6925 3.049674 ATGTGGCAGTTCGGCGTG 61.050 61.111 6.85 0.00 45.16 5.34
6241 6938 3.420943 GCGTGGTGCCATCCATAC 58.579 61.111 0.00 0.00 39.81 2.39
6242 6939 2.186826 GCGTGGTGCCATCCATACC 61.187 63.158 0.00 0.00 39.81 2.73
6243 6940 1.526887 CGTGGTGCCATCCATACCT 59.473 57.895 0.00 0.00 39.81 3.08
6244 6941 0.107214 CGTGGTGCCATCCATACCTT 60.107 55.000 0.00 0.00 39.81 3.50
6245 6942 1.681780 CGTGGTGCCATCCATACCTTT 60.682 52.381 0.00 0.00 39.81 3.11
6246 6943 2.456577 GTGGTGCCATCCATACCTTTT 58.543 47.619 0.00 0.00 39.81 2.27
6247 6944 2.831526 GTGGTGCCATCCATACCTTTTT 59.168 45.455 0.00 0.00 39.81 1.94
6248 6945 4.020543 GTGGTGCCATCCATACCTTTTTA 58.979 43.478 0.00 0.00 39.81 1.52
6249 6946 4.097892 GTGGTGCCATCCATACCTTTTTAG 59.902 45.833 0.00 0.00 39.81 1.85
6250 6947 4.264172 TGGTGCCATCCATACCTTTTTAGT 60.264 41.667 0.00 0.00 35.51 2.24
6251 6948 4.709886 GGTGCCATCCATACCTTTTTAGTT 59.290 41.667 0.00 0.00 0.00 2.24
6252 6949 5.163550 GGTGCCATCCATACCTTTTTAGTTC 60.164 44.000 0.00 0.00 0.00 3.01
6253 6950 5.652452 GTGCCATCCATACCTTTTTAGTTCT 59.348 40.000 0.00 0.00 0.00 3.01
6254 6951 6.152831 GTGCCATCCATACCTTTTTAGTTCTT 59.847 38.462 0.00 0.00 0.00 2.52
6255 6952 6.723977 TGCCATCCATACCTTTTTAGTTCTTT 59.276 34.615 0.00 0.00 0.00 2.52
6256 6953 7.234577 TGCCATCCATACCTTTTTAGTTCTTTT 59.765 33.333 0.00 0.00 0.00 2.27
6257 6954 8.094548 GCCATCCATACCTTTTTAGTTCTTTTT 58.905 33.333 0.00 0.00 0.00 1.94
6258 6955 9.423061 CCATCCATACCTTTTTAGTTCTTTTTG 57.577 33.333 0.00 0.00 0.00 2.44
6259 6956 9.981114 CATCCATACCTTTTTAGTTCTTTTTGT 57.019 29.630 0.00 0.00 0.00 2.83
6290 6987 7.792374 TTCATATCCTTGCTGAATACTCAAC 57.208 36.000 0.00 0.00 0.00 3.18
6291 6988 6.291377 TCATATCCTTGCTGAATACTCAACC 58.709 40.000 0.00 0.00 0.00 3.77
6292 6989 4.574674 ATCCTTGCTGAATACTCAACCA 57.425 40.909 0.00 0.00 0.00 3.67
6293 6990 4.365514 TCCTTGCTGAATACTCAACCAA 57.634 40.909 0.00 0.00 0.00 3.67
6294 6991 4.922206 TCCTTGCTGAATACTCAACCAAT 58.078 39.130 0.00 0.00 0.00 3.16
6295 6992 6.061022 TCCTTGCTGAATACTCAACCAATA 57.939 37.500 0.00 0.00 0.00 1.90
6296 6993 6.662755 TCCTTGCTGAATACTCAACCAATAT 58.337 36.000 0.00 0.00 0.00 1.28
6297 6994 6.543465 TCCTTGCTGAATACTCAACCAATATG 59.457 38.462 0.00 0.00 0.00 1.78
6298 6995 6.238842 CCTTGCTGAATACTCAACCAATATGG 60.239 42.308 0.00 0.00 45.02 2.74
6299 6996 6.000246 TGCTGAATACTCAACCAATATGGA 58.000 37.500 2.85 0.00 40.96 3.41
6300 6997 6.422333 TGCTGAATACTCAACCAATATGGAA 58.578 36.000 2.85 0.00 40.96 3.53
6301 6998 6.889177 TGCTGAATACTCAACCAATATGGAAA 59.111 34.615 2.85 0.00 40.96 3.13
6302 6999 7.148086 TGCTGAATACTCAACCAATATGGAAAC 60.148 37.037 2.85 0.00 40.96 2.78
6303 7000 7.067494 GCTGAATACTCAACCAATATGGAAACT 59.933 37.037 2.85 0.00 40.96 2.66
6304 7001 8.506168 TGAATACTCAACCAATATGGAAACTC 57.494 34.615 2.85 0.00 40.96 3.01
6305 7002 8.106462 TGAATACTCAACCAATATGGAAACTCA 58.894 33.333 2.85 0.00 40.96 3.41
6306 7003 9.125026 GAATACTCAACCAATATGGAAACTCAT 57.875 33.333 2.85 0.00 40.96 2.90
6307 7004 6.764308 ACTCAACCAATATGGAAACTCATG 57.236 37.500 2.85 0.00 40.96 3.07
6308 7005 6.484288 ACTCAACCAATATGGAAACTCATGA 58.516 36.000 2.85 0.00 40.96 3.07
6309 7006 6.600822 ACTCAACCAATATGGAAACTCATGAG 59.399 38.462 21.37 21.37 40.96 2.90
6310 7007 6.484288 TCAACCAATATGGAAACTCATGAGT 58.516 36.000 22.89 22.89 40.96 3.41
6311 7008 7.629157 TCAACCAATATGGAAACTCATGAGTA 58.371 34.615 28.10 13.47 40.96 2.59
6312 7009 8.274322 TCAACCAATATGGAAACTCATGAGTAT 58.726 33.333 28.10 19.31 40.96 2.12
6313 7010 8.906867 CAACCAATATGGAAACTCATGAGTATT 58.093 33.333 28.10 21.90 40.96 1.89
6314 7011 8.455903 ACCAATATGGAAACTCATGAGTATTG 57.544 34.615 28.10 26.89 40.96 1.90
6315 7012 8.274322 ACCAATATGGAAACTCATGAGTATTGA 58.726 33.333 30.71 18.37 40.96 2.57
6316 7013 9.293404 CCAATATGGAAACTCATGAGTATTGAT 57.707 33.333 30.71 22.11 40.96 2.57
6342 7039 8.463930 AATATTTGAATTAAGAATGGGAGCGA 57.536 30.769 0.00 0.00 0.00 4.93
6343 7040 6.966534 ATTTGAATTAAGAATGGGAGCGAT 57.033 33.333 0.00 0.00 0.00 4.58
6344 7041 5.756195 TTGAATTAAGAATGGGAGCGATG 57.244 39.130 0.00 0.00 0.00 3.84
6345 7042 5.034852 TGAATTAAGAATGGGAGCGATGA 57.965 39.130 0.00 0.00 0.00 2.92
6346 7043 5.059161 TGAATTAAGAATGGGAGCGATGAG 58.941 41.667 0.00 0.00 0.00 2.90
6347 7044 4.963318 ATTAAGAATGGGAGCGATGAGA 57.037 40.909 0.00 0.00 0.00 3.27
6348 7045 2.611225 AAGAATGGGAGCGATGAGAC 57.389 50.000 0.00 0.00 0.00 3.36
6349 7046 1.489481 AGAATGGGAGCGATGAGACA 58.511 50.000 0.00 0.00 0.00 3.41
6350 7047 1.833630 AGAATGGGAGCGATGAGACAA 59.166 47.619 0.00 0.00 0.00 3.18
6351 7048 2.437281 AGAATGGGAGCGATGAGACAAT 59.563 45.455 0.00 0.00 0.00 2.71
6352 7049 3.643320 AGAATGGGAGCGATGAGACAATA 59.357 43.478 0.00 0.00 0.00 1.90
6353 7050 4.285517 AGAATGGGAGCGATGAGACAATAT 59.714 41.667 0.00 0.00 0.00 1.28
6354 7051 5.481824 AGAATGGGAGCGATGAGACAATATA 59.518 40.000 0.00 0.00 0.00 0.86
6355 7052 5.745312 ATGGGAGCGATGAGACAATATAA 57.255 39.130 0.00 0.00 0.00 0.98
6356 7053 5.545063 TGGGAGCGATGAGACAATATAAA 57.455 39.130 0.00 0.00 0.00 1.40
6357 7054 5.297547 TGGGAGCGATGAGACAATATAAAC 58.702 41.667 0.00 0.00 0.00 2.01
6358 7055 4.386049 GGGAGCGATGAGACAATATAAACG 59.614 45.833 0.00 0.00 0.00 3.60
6359 7056 4.386049 GGAGCGATGAGACAATATAAACGG 59.614 45.833 0.00 0.00 0.00 4.44
6360 7057 4.307432 AGCGATGAGACAATATAAACGGG 58.693 43.478 0.00 0.00 0.00 5.28
6361 7058 3.432252 GCGATGAGACAATATAAACGGGG 59.568 47.826 0.00 0.00 0.00 5.73
6362 7059 4.628074 CGATGAGACAATATAAACGGGGT 58.372 43.478 0.00 0.00 0.00 4.95
6363 7060 5.775686 CGATGAGACAATATAAACGGGGTA 58.224 41.667 0.00 0.00 0.00 3.69
6364 7061 6.395629 CGATGAGACAATATAAACGGGGTAT 58.604 40.000 0.00 0.00 0.00 2.73
6365 7062 6.872020 CGATGAGACAATATAAACGGGGTATT 59.128 38.462 0.00 0.00 0.00 1.89
6366 7063 7.386848 CGATGAGACAATATAAACGGGGTATTT 59.613 37.037 0.00 0.00 0.00 1.40
6367 7064 8.990163 ATGAGACAATATAAACGGGGTATTTT 57.010 30.769 0.00 0.00 0.00 1.82
6368 7065 8.215926 TGAGACAATATAAACGGGGTATTTTG 57.784 34.615 0.00 0.00 0.00 2.44
6369 7066 7.830201 TGAGACAATATAAACGGGGTATTTTGT 59.170 33.333 9.28 9.28 36.46 2.83
6370 7067 9.328845 GAGACAATATAAACGGGGTATTTTGTA 57.671 33.333 9.41 0.00 34.97 2.41
6371 7068 9.112725 AGACAATATAAACGGGGTATTTTGTAC 57.887 33.333 9.41 0.00 34.97 2.90
6372 7069 9.112725 GACAATATAAACGGGGTATTTTGTACT 57.887 33.333 9.41 0.00 34.97 2.73
6373 7070 9.465199 ACAATATAAACGGGGTATTTTGTACTT 57.535 29.630 0.00 0.00 33.85 2.24
6376 7073 9.910267 ATATAAACGGGGTATTTTGTACTTTCT 57.090 29.630 0.00 0.00 0.00 2.52
6377 7074 6.564709 AAACGGGGTATTTTGTACTTTCTC 57.435 37.500 0.00 0.00 0.00 2.87
6378 7075 5.494390 ACGGGGTATTTTGTACTTTCTCT 57.506 39.130 0.00 0.00 0.00 3.10
6379 7076 6.610075 ACGGGGTATTTTGTACTTTCTCTA 57.390 37.500 0.00 0.00 0.00 2.43
6380 7077 7.191593 ACGGGGTATTTTGTACTTTCTCTAT 57.808 36.000 0.00 0.00 0.00 1.98
6381 7078 7.270779 ACGGGGTATTTTGTACTTTCTCTATC 58.729 38.462 0.00 0.00 0.00 2.08
6382 7079 6.704937 CGGGGTATTTTGTACTTTCTCTATCC 59.295 42.308 0.00 0.00 0.00 2.59
6383 7080 7.571025 GGGGTATTTTGTACTTTCTCTATCCA 58.429 38.462 0.00 0.00 0.00 3.41
6384 7081 8.050930 GGGGTATTTTGTACTTTCTCTATCCAA 58.949 37.037 0.00 0.00 0.00 3.53
6385 7082 8.890718 GGGTATTTTGTACTTTCTCTATCCAAC 58.109 37.037 0.00 0.00 0.00 3.77
6386 7083 9.444600 GGTATTTTGTACTTTCTCTATCCAACA 57.555 33.333 0.00 0.00 0.00 3.33
6389 7086 8.918202 TTTTGTACTTTCTCTATCCAACATGT 57.082 30.769 0.00 0.00 0.00 3.21
6392 7089 8.997621 TGTACTTTCTCTATCCAACATGTAAC 57.002 34.615 0.00 0.00 0.00 2.50
6393 7090 8.590204 TGTACTTTCTCTATCCAACATGTAACA 58.410 33.333 0.00 0.00 0.00 2.41
6394 7091 7.907214 ACTTTCTCTATCCAACATGTAACAC 57.093 36.000 0.00 0.00 0.00 3.32
6395 7092 7.450074 ACTTTCTCTATCCAACATGTAACACA 58.550 34.615 0.00 0.00 0.00 3.72
6396 7093 8.103305 ACTTTCTCTATCCAACATGTAACACAT 58.897 33.333 0.00 0.00 39.91 3.21
6397 7094 8.492673 TTTCTCTATCCAACATGTAACACATC 57.507 34.615 0.00 0.00 36.53 3.06
6398 7095 7.423844 TCTCTATCCAACATGTAACACATCT 57.576 36.000 0.00 0.00 36.53 2.90
6399 7096 7.851228 TCTCTATCCAACATGTAACACATCTT 58.149 34.615 0.00 0.00 36.53 2.40
6400 7097 8.321353 TCTCTATCCAACATGTAACACATCTTT 58.679 33.333 0.00 0.00 36.53 2.52
6401 7098 9.599866 CTCTATCCAACATGTAACACATCTTTA 57.400 33.333 0.00 0.00 36.53 1.85
6402 7099 9.378551 TCTATCCAACATGTAACACATCTTTAC 57.621 33.333 0.00 0.00 36.53 2.01
6403 7100 7.994425 ATCCAACATGTAACACATCTTTACA 57.006 32.000 0.00 0.00 42.23 2.41
6404 7101 7.809546 TCCAACATGTAACACATCTTTACAA 57.190 32.000 0.00 0.00 41.55 2.41
6405 7102 7.870826 TCCAACATGTAACACATCTTTACAAG 58.129 34.615 0.00 0.00 41.55 3.16
6406 7103 7.717436 TCCAACATGTAACACATCTTTACAAGA 59.283 33.333 0.00 0.00 41.55 3.02
6407 7104 8.349245 CCAACATGTAACACATCTTTACAAGAA 58.651 33.333 0.00 0.00 41.55 2.52
6408 7105 9.169468 CAACATGTAACACATCTTTACAAGAAC 57.831 33.333 0.00 0.00 41.55 3.01
6409 7106 8.677148 ACATGTAACACATCTTTACAAGAACT 57.323 30.769 0.00 0.00 41.55 3.01
6410 7107 8.774586 ACATGTAACACATCTTTACAAGAACTC 58.225 33.333 0.00 0.00 41.55 3.01
6411 7108 8.773645 CATGTAACACATCTTTACAAGAACTCA 58.226 33.333 0.00 0.00 41.55 3.41
6412 7109 8.138365 TGTAACACATCTTTACAAGAACTCAC 57.862 34.615 0.00 0.00 41.63 3.51
6413 7110 7.766738 TGTAACACATCTTTACAAGAACTCACA 59.233 33.333 0.00 0.00 41.63 3.58
6414 7111 7.807977 AACACATCTTTACAAGAACTCACAT 57.192 32.000 0.00 0.00 41.63 3.21
6415 7112 8.902540 AACACATCTTTACAAGAACTCACATA 57.097 30.769 0.00 0.00 41.63 2.29
6416 7113 8.311650 ACACATCTTTACAAGAACTCACATAC 57.688 34.615 0.00 0.00 41.63 2.39
6417 7114 7.387948 ACACATCTTTACAAGAACTCACATACC 59.612 37.037 0.00 0.00 41.63 2.73
6418 7115 7.387673 CACATCTTTACAAGAACTCACATACCA 59.612 37.037 0.00 0.00 41.63 3.25
6419 7116 8.103305 ACATCTTTACAAGAACTCACATACCAT 58.897 33.333 0.00 0.00 41.63 3.55
6420 7117 9.599866 CATCTTTACAAGAACTCACATACCATA 57.400 33.333 0.00 0.00 41.63 2.74
6421 7118 9.823647 ATCTTTACAAGAACTCACATACCATAG 57.176 33.333 0.00 0.00 41.63 2.23
6422 7119 9.031537 TCTTTACAAGAACTCACATACCATAGA 57.968 33.333 0.00 0.00 33.83 1.98
6423 7120 9.653287 CTTTACAAGAACTCACATACCATAGAA 57.347 33.333 0.00 0.00 0.00 2.10
6424 7121 9.653287 TTTACAAGAACTCACATACCATAGAAG 57.347 33.333 0.00 0.00 0.00 2.85
6425 7122 7.482169 ACAAGAACTCACATACCATAGAAGA 57.518 36.000 0.00 0.00 0.00 2.87
6426 7123 7.551585 ACAAGAACTCACATACCATAGAAGAG 58.448 38.462 0.00 0.00 0.00 2.85
6427 7124 7.179338 ACAAGAACTCACATACCATAGAAGAGT 59.821 37.037 0.00 0.00 36.51 3.24
6428 7125 7.726033 AGAACTCACATACCATAGAAGAGTT 57.274 36.000 0.00 0.00 44.67 3.01
6430 7127 7.482169 AACTCACATACCATAGAAGAGTTCA 57.518 36.000 0.00 0.00 39.80 3.18
6431 7128 7.482169 ACTCACATACCATAGAAGAGTTCAA 57.518 36.000 0.00 0.00 31.38 2.69
6432 7129 7.907389 ACTCACATACCATAGAAGAGTTCAAA 58.093 34.615 0.00 0.00 31.38 2.69
6433 7130 8.037758 ACTCACATACCATAGAAGAGTTCAAAG 58.962 37.037 0.00 0.00 31.38 2.77
6434 7131 7.331026 TCACATACCATAGAAGAGTTCAAAGG 58.669 38.462 0.00 0.00 0.00 3.11
6435 7132 6.540189 CACATACCATAGAAGAGTTCAAAGGG 59.460 42.308 0.00 0.00 0.00 3.95
6436 7133 6.215636 ACATACCATAGAAGAGTTCAAAGGGT 59.784 38.462 0.00 0.00 36.44 4.34
6437 7134 5.584551 ACCATAGAAGAGTTCAAAGGGTT 57.415 39.130 0.00 0.00 30.91 4.11
6438 7135 5.953571 ACCATAGAAGAGTTCAAAGGGTTT 58.046 37.500 0.00 0.00 30.91 3.27
6439 7136 5.770162 ACCATAGAAGAGTTCAAAGGGTTTG 59.230 40.000 0.00 0.00 41.96 2.93
6440 7137 5.770162 CCATAGAAGAGTTCAAAGGGTTTGT 59.230 40.000 0.00 0.00 41.36 2.83
6441 7138 6.265422 CCATAGAAGAGTTCAAAGGGTTTGTT 59.735 38.462 0.00 0.00 41.36 2.83
6442 7139 7.201911 CCATAGAAGAGTTCAAAGGGTTTGTTT 60.202 37.037 0.00 0.00 41.36 2.83
6443 7140 8.846211 CATAGAAGAGTTCAAAGGGTTTGTTTA 58.154 33.333 0.00 0.00 41.36 2.01
6444 7141 7.334844 AGAAGAGTTCAAAGGGTTTGTTTAG 57.665 36.000 0.00 0.00 41.36 1.85
6445 7142 6.321435 AGAAGAGTTCAAAGGGTTTGTTTAGG 59.679 38.462 0.00 0.00 41.36 2.69
6446 7143 4.341235 AGAGTTCAAAGGGTTTGTTTAGGC 59.659 41.667 0.00 0.00 41.36 3.93
6447 7144 4.286707 AGTTCAAAGGGTTTGTTTAGGCT 58.713 39.130 0.00 0.00 41.36 4.58
6448 7145 4.714802 AGTTCAAAGGGTTTGTTTAGGCTT 59.285 37.500 0.00 0.00 41.36 4.35
6449 7146 5.894964 AGTTCAAAGGGTTTGTTTAGGCTTA 59.105 36.000 0.00 0.00 41.36 3.09
6450 7147 6.553476 AGTTCAAAGGGTTTGTTTAGGCTTAT 59.447 34.615 0.00 0.00 41.36 1.73
6451 7148 7.726738 AGTTCAAAGGGTTTGTTTAGGCTTATA 59.273 33.333 0.00 0.00 41.36 0.98
6452 7149 7.696992 TCAAAGGGTTTGTTTAGGCTTATAG 57.303 36.000 0.00 0.00 41.36 1.31
6453 7150 7.463431 TCAAAGGGTTTGTTTAGGCTTATAGA 58.537 34.615 0.00 0.00 41.36 1.98
6454 7151 7.945664 TCAAAGGGTTTGTTTAGGCTTATAGAA 59.054 33.333 0.00 0.00 41.36 2.10
6455 7152 8.749354 CAAAGGGTTTGTTTAGGCTTATAGAAT 58.251 33.333 0.00 0.00 35.94 2.40
6456 7153 8.895141 AAGGGTTTGTTTAGGCTTATAGAATT 57.105 30.769 0.00 0.00 0.00 2.17
6457 7154 8.293699 AGGGTTTGTTTAGGCTTATAGAATTG 57.706 34.615 0.00 0.00 0.00 2.32
6458 7155 7.342026 AGGGTTTGTTTAGGCTTATAGAATTGG 59.658 37.037 0.00 0.00 0.00 3.16
6459 7156 7.123697 GGGTTTGTTTAGGCTTATAGAATTGGT 59.876 37.037 0.00 0.00 0.00 3.67
6460 7157 8.188799 GGTTTGTTTAGGCTTATAGAATTGGTC 58.811 37.037 0.00 0.00 0.00 4.02
6461 7158 7.875327 TTGTTTAGGCTTATAGAATTGGTCC 57.125 36.000 0.00 0.00 0.00 4.46
6462 7159 7.208064 TGTTTAGGCTTATAGAATTGGTCCT 57.792 36.000 0.00 0.00 0.00 3.85
6463 7160 7.639378 TGTTTAGGCTTATAGAATTGGTCCTT 58.361 34.615 0.00 0.00 0.00 3.36
6464 7161 7.556275 TGTTTAGGCTTATAGAATTGGTCCTTG 59.444 37.037 0.00 0.00 0.00 3.61
6465 7162 5.975988 AGGCTTATAGAATTGGTCCTTGA 57.024 39.130 0.00 0.00 0.00 3.02
6466 7163 6.327386 AGGCTTATAGAATTGGTCCTTGAA 57.673 37.500 0.00 0.00 0.00 2.69
6467 7164 6.360618 AGGCTTATAGAATTGGTCCTTGAAG 58.639 40.000 0.00 0.00 0.00 3.02
6468 7165 5.009110 GGCTTATAGAATTGGTCCTTGAAGC 59.991 44.000 0.00 0.00 35.87 3.86
6469 7166 5.825151 GCTTATAGAATTGGTCCTTGAAGCT 59.175 40.000 0.00 0.00 34.25 3.74
6470 7167 6.992715 GCTTATAGAATTGGTCCTTGAAGCTA 59.007 38.462 0.00 0.00 34.25 3.32
6471 7168 7.041712 GCTTATAGAATTGGTCCTTGAAGCTAC 60.042 40.741 0.00 0.00 34.25 3.58
6472 7169 4.917906 AGAATTGGTCCTTGAAGCTACT 57.082 40.909 0.00 0.00 0.00 2.57
6473 7170 7.676683 ATAGAATTGGTCCTTGAAGCTACTA 57.323 36.000 0.00 0.00 0.00 1.82
6474 7171 6.567602 AGAATTGGTCCTTGAAGCTACTAT 57.432 37.500 0.00 0.00 0.00 2.12
6475 7172 6.963322 AGAATTGGTCCTTGAAGCTACTATT 58.037 36.000 0.00 0.00 0.00 1.73
6476 7173 7.051000 AGAATTGGTCCTTGAAGCTACTATTC 58.949 38.462 0.00 2.61 0.00 1.75
6477 7174 5.755409 TTGGTCCTTGAAGCTACTATTCA 57.245 39.130 0.00 0.00 34.93 2.57
6478 7175 5.957771 TGGTCCTTGAAGCTACTATTCAT 57.042 39.130 0.00 0.00 36.60 2.57
6479 7176 7.432148 TTGGTCCTTGAAGCTACTATTCATA 57.568 36.000 0.00 0.00 36.60 2.15
6480 7177 7.432148 TGGTCCTTGAAGCTACTATTCATAA 57.568 36.000 0.00 0.00 36.60 1.90
6481 7178 7.857456 TGGTCCTTGAAGCTACTATTCATAAA 58.143 34.615 0.00 0.00 36.60 1.40
6482 7179 8.494433 TGGTCCTTGAAGCTACTATTCATAAAT 58.506 33.333 0.00 0.00 36.60 1.40
6483 7180 9.998106 GGTCCTTGAAGCTACTATTCATAAATA 57.002 33.333 0.00 0.00 36.60 1.40
6500 7197 7.885297 TCATAAATATTTCTACCTGCAATGGC 58.115 34.615 3.39 0.00 41.68 4.40
6501 7198 4.836125 AATATTTCTACCTGCAATGGCG 57.164 40.909 0.00 0.00 45.35 5.69
6502 7199 0.740737 ATTTCTACCTGCAATGGCGC 59.259 50.000 0.00 0.00 45.35 6.53
6503 7200 0.607762 TTTCTACCTGCAATGGCGCA 60.608 50.000 10.83 0.00 45.35 6.09
6504 7201 0.394216 TTCTACCTGCAATGGCGCAT 60.394 50.000 10.83 0.00 45.35 4.73
6505 7202 0.815213 TCTACCTGCAATGGCGCATC 60.815 55.000 10.83 0.00 45.35 3.91
6506 7203 0.816825 CTACCTGCAATGGCGCATCT 60.817 55.000 10.83 0.00 45.35 2.90
6507 7204 0.815213 TACCTGCAATGGCGCATCTC 60.815 55.000 10.83 0.00 45.35 2.75
6508 7205 1.822613 CCTGCAATGGCGCATCTCT 60.823 57.895 10.83 0.00 45.35 3.10
6509 7206 1.647629 CTGCAATGGCGCATCTCTC 59.352 57.895 10.83 0.00 45.35 3.20
6510 7207 0.814410 CTGCAATGGCGCATCTCTCT 60.814 55.000 10.83 0.00 45.35 3.10
6511 7208 0.812811 TGCAATGGCGCATCTCTCTC 60.813 55.000 10.83 0.00 45.35 3.20
6512 7209 1.829349 GCAATGGCGCATCTCTCTCG 61.829 60.000 10.83 0.00 0.00 4.04
6513 7210 0.249197 CAATGGCGCATCTCTCTCGA 60.249 55.000 10.83 0.00 0.00 4.04
6514 7211 0.678395 AATGGCGCATCTCTCTCGAT 59.322 50.000 10.83 0.00 0.00 3.59
6515 7212 0.678395 ATGGCGCATCTCTCTCGATT 59.322 50.000 10.83 0.00 0.00 3.34
6516 7213 0.461548 TGGCGCATCTCTCTCGATTT 59.538 50.000 10.83 0.00 0.00 2.17
6517 7214 1.134699 TGGCGCATCTCTCTCGATTTT 60.135 47.619 10.83 0.00 0.00 1.82
6518 7215 1.936547 GGCGCATCTCTCTCGATTTTT 59.063 47.619 10.83 0.00 0.00 1.94
6519 7216 3.123804 GGCGCATCTCTCTCGATTTTTA 58.876 45.455 10.83 0.00 0.00 1.52
6520 7217 3.555956 GGCGCATCTCTCTCGATTTTTAA 59.444 43.478 10.83 0.00 0.00 1.52
6521 7218 4.212214 GGCGCATCTCTCTCGATTTTTAAT 59.788 41.667 10.83 0.00 0.00 1.40
6522 7219 5.405571 GGCGCATCTCTCTCGATTTTTAATA 59.594 40.000 10.83 0.00 0.00 0.98
6523 7220 6.292873 GCGCATCTCTCTCGATTTTTAATAC 58.707 40.000 0.30 0.00 0.00 1.89
6524 7221 6.074302 GCGCATCTCTCTCGATTTTTAATACA 60.074 38.462 0.30 0.00 0.00 2.29
6525 7222 7.277205 CGCATCTCTCTCGATTTTTAATACAC 58.723 38.462 0.00 0.00 0.00 2.90
6526 7223 7.043391 CGCATCTCTCTCGATTTTTAATACACA 60.043 37.037 0.00 0.00 0.00 3.72
6527 7224 8.768955 GCATCTCTCTCGATTTTTAATACACAT 58.231 33.333 0.00 0.00 0.00 3.21
6542 7239 9.688091 TTTAATACACATTACAATTCTAGGGCA 57.312 29.630 0.00 0.00 0.00 5.36
6543 7240 7.807977 AATACACATTACAATTCTAGGGCAG 57.192 36.000 0.00 0.00 0.00 4.85
6544 7241 5.435686 ACACATTACAATTCTAGGGCAGA 57.564 39.130 0.00 0.00 0.00 4.26
6545 7242 5.431765 ACACATTACAATTCTAGGGCAGAG 58.568 41.667 0.00 0.00 33.83 3.35
6546 7243 4.818546 CACATTACAATTCTAGGGCAGAGG 59.181 45.833 0.00 0.00 33.83 3.69
6547 7244 4.141390 ACATTACAATTCTAGGGCAGAGGG 60.141 45.833 0.00 0.00 33.83 4.30
6548 7245 1.216990 ACAATTCTAGGGCAGAGGGG 58.783 55.000 0.00 0.00 33.83 4.79
6549 7246 0.475906 CAATTCTAGGGCAGAGGGGG 59.524 60.000 0.00 0.00 33.83 5.40
6550 7247 0.046397 AATTCTAGGGCAGAGGGGGT 59.954 55.000 0.00 0.00 33.83 4.95
6551 7248 0.949582 ATTCTAGGGCAGAGGGGGTA 59.050 55.000 0.00 0.00 33.83 3.69
6552 7249 0.264955 TTCTAGGGCAGAGGGGGTAG 59.735 60.000 0.00 0.00 33.83 3.18
6553 7250 0.929734 TCTAGGGCAGAGGGGGTAGT 60.930 60.000 0.00 0.00 0.00 2.73
6554 7251 0.858369 CTAGGGCAGAGGGGGTAGTA 59.142 60.000 0.00 0.00 0.00 1.82
6555 7252 0.858369 TAGGGCAGAGGGGGTAGTAG 59.142 60.000 0.00 0.00 0.00 2.57
6556 7253 1.229626 AGGGCAGAGGGGGTAGTAGT 61.230 60.000 0.00 0.00 0.00 2.73
6557 7254 1.049289 GGGCAGAGGGGGTAGTAGTG 61.049 65.000 0.00 0.00 0.00 2.74
6558 7255 0.032416 GGCAGAGGGGGTAGTAGTGA 60.032 60.000 0.00 0.00 0.00 3.41
6559 7256 1.112950 GCAGAGGGGGTAGTAGTGAC 58.887 60.000 0.00 0.00 0.00 3.67
6560 7257 1.777941 CAGAGGGGGTAGTAGTGACC 58.222 60.000 0.00 0.00 36.12 4.02
6561 7258 1.006758 CAGAGGGGGTAGTAGTGACCA 59.993 57.143 0.00 0.00 38.86 4.02
6562 7259 1.288335 AGAGGGGGTAGTAGTGACCAG 59.712 57.143 0.00 0.00 38.86 4.00
6563 7260 1.287146 GAGGGGGTAGTAGTGACCAGA 59.713 57.143 0.00 0.00 38.86 3.86
6564 7261 1.938069 AGGGGGTAGTAGTGACCAGAT 59.062 52.381 0.00 0.00 38.86 2.90
6565 7262 2.318207 AGGGGGTAGTAGTGACCAGATT 59.682 50.000 0.00 0.00 38.86 2.40
6566 7263 3.534747 AGGGGGTAGTAGTGACCAGATTA 59.465 47.826 0.00 0.00 38.86 1.75
6567 7264 3.640498 GGGGGTAGTAGTGACCAGATTAC 59.360 52.174 0.00 0.00 38.86 1.89
6568 7265 3.317430 GGGGTAGTAGTGACCAGATTACG 59.683 52.174 0.00 0.00 38.86 3.18
6569 7266 3.317430 GGGTAGTAGTGACCAGATTACGG 59.683 52.174 0.00 0.00 38.86 4.02
6570 7267 3.317430 GGTAGTAGTGACCAGATTACGGG 59.683 52.174 0.00 0.00 36.91 5.28
6571 7268 2.385803 AGTAGTGACCAGATTACGGGG 58.614 52.381 0.00 0.00 35.72 5.73
6572 7269 2.024655 AGTAGTGACCAGATTACGGGGA 60.025 50.000 0.00 0.00 35.72 4.81
6573 7270 1.486211 AGTGACCAGATTACGGGGAG 58.514 55.000 0.00 0.00 35.72 4.30
6574 7271 1.192428 GTGACCAGATTACGGGGAGT 58.808 55.000 0.00 0.00 35.72 3.85
6575 7272 2.024655 AGTGACCAGATTACGGGGAGTA 60.025 50.000 0.00 0.00 35.72 2.59
6576 7273 2.963782 GTGACCAGATTACGGGGAGTAT 59.036 50.000 0.00 0.00 35.72 2.12
6577 7274 3.387050 GTGACCAGATTACGGGGAGTATT 59.613 47.826 0.00 0.00 35.72 1.89
6578 7275 4.035112 TGACCAGATTACGGGGAGTATTT 58.965 43.478 0.00 0.00 35.72 1.40
6579 7276 5.069516 GTGACCAGATTACGGGGAGTATTTA 59.930 44.000 0.00 0.00 35.72 1.40
6580 7277 5.842328 TGACCAGATTACGGGGAGTATTTAT 59.158 40.000 0.00 0.00 35.72 1.40
6581 7278 6.014840 TGACCAGATTACGGGGAGTATTTATC 60.015 42.308 0.00 0.00 35.72 1.75
6582 7279 5.842328 ACCAGATTACGGGGAGTATTTATCA 59.158 40.000 0.00 0.00 35.72 2.15
6583 7280 6.328148 ACCAGATTACGGGGAGTATTTATCAA 59.672 38.462 0.00 0.00 35.72 2.57
6584 7281 6.649557 CCAGATTACGGGGAGTATTTATCAAC 59.350 42.308 0.00 0.00 34.88 3.18
6585 7282 7.442656 CAGATTACGGGGAGTATTTATCAACT 58.557 38.462 0.00 0.00 34.88 3.16
6586 7283 8.582437 CAGATTACGGGGAGTATTTATCAACTA 58.418 37.037 0.00 0.00 34.88 2.24
6587 7284 8.583296 AGATTACGGGGAGTATTTATCAACTAC 58.417 37.037 0.00 0.00 34.88 2.73
6588 7285 7.902920 TTACGGGGAGTATTTATCAACTACT 57.097 36.000 0.00 0.00 34.88 2.57
6589 7286 8.995027 TTACGGGGAGTATTTATCAACTACTA 57.005 34.615 0.00 0.00 34.88 1.82
6590 7287 7.902920 ACGGGGAGTATTTATCAACTACTAA 57.097 36.000 0.00 0.00 0.00 2.24
6591 7288 7.720442 ACGGGGAGTATTTATCAACTACTAAC 58.280 38.462 0.00 0.00 0.00 2.34
6592 7289 7.342799 ACGGGGAGTATTTATCAACTACTAACA 59.657 37.037 0.00 0.00 0.00 2.41
6593 7290 8.365647 CGGGGAGTATTTATCAACTACTAACAT 58.634 37.037 0.00 0.00 0.00 2.71
6594 7291 9.490379 GGGGAGTATTTATCAACTACTAACATG 57.510 37.037 0.00 0.00 0.00 3.21
6595 7292 8.989980 GGGAGTATTTATCAACTACTAACATGC 58.010 37.037 0.00 0.00 0.00 4.06
6596 7293 8.989980 GGAGTATTTATCAACTACTAACATGCC 58.010 37.037 0.00 0.00 0.00 4.40
6597 7294 9.542462 GAGTATTTATCAACTACTAACATGCCA 57.458 33.333 0.00 0.00 0.00 4.92
6601 7298 8.662781 TTTATCAACTACTAACATGCCATCTC 57.337 34.615 0.00 0.00 0.00 2.75
6602 7299 5.675684 TCAACTACTAACATGCCATCTCA 57.324 39.130 0.00 0.00 0.00 3.27
6603 7300 6.239217 TCAACTACTAACATGCCATCTCAT 57.761 37.500 0.00 0.00 0.00 2.90
6604 7301 7.360113 TCAACTACTAACATGCCATCTCATA 57.640 36.000 0.00 0.00 0.00 2.15
6605 7302 7.210174 TCAACTACTAACATGCCATCTCATAC 58.790 38.462 0.00 0.00 0.00 2.39
6606 7303 6.731292 ACTACTAACATGCCATCTCATACA 57.269 37.500 0.00 0.00 0.00 2.29
6607 7304 7.308450 ACTACTAACATGCCATCTCATACAT 57.692 36.000 0.00 0.00 0.00 2.29
6608 7305 8.422577 ACTACTAACATGCCATCTCATACATA 57.577 34.615 0.00 0.00 0.00 2.29
6609 7306 8.526978 ACTACTAACATGCCATCTCATACATAG 58.473 37.037 0.00 0.00 0.00 2.23
6610 7307 7.308450 ACTAACATGCCATCTCATACATAGT 57.692 36.000 0.00 0.00 0.00 2.12
6611 7308 7.157347 ACTAACATGCCATCTCATACATAGTG 58.843 38.462 0.00 0.00 0.00 2.74
6612 7309 5.557576 ACATGCCATCTCATACATAGTGT 57.442 39.130 0.00 0.00 0.00 3.55
6613 7310 5.303165 ACATGCCATCTCATACATAGTGTG 58.697 41.667 0.00 0.00 0.00 3.82
6614 7311 5.070847 ACATGCCATCTCATACATAGTGTGA 59.929 40.000 0.00 0.00 33.02 3.58
6615 7312 4.948847 TGCCATCTCATACATAGTGTGAC 58.051 43.478 0.00 0.00 30.93 3.67
6616 7313 4.405358 TGCCATCTCATACATAGTGTGACA 59.595 41.667 0.00 0.00 30.93 3.58
6617 7314 5.070847 TGCCATCTCATACATAGTGTGACAT 59.929 40.000 0.00 0.00 30.93 3.06
6618 7315 5.407691 GCCATCTCATACATAGTGTGACATG 59.592 44.000 0.00 5.58 32.92 3.21
6619 7316 5.930569 CCATCTCATACATAGTGTGACATGG 59.069 44.000 13.57 13.57 40.98 3.66
6620 7317 6.463472 CCATCTCATACATAGTGTGACATGGT 60.463 42.308 17.03 0.00 41.46 3.55
6621 7318 7.255942 CCATCTCATACATAGTGTGACATGGTA 60.256 40.741 17.03 0.00 41.46 3.25
6622 7319 7.839680 TCTCATACATAGTGTGACATGGTAT 57.160 36.000 0.00 0.00 30.93 2.73
6623 7320 8.250143 TCTCATACATAGTGTGACATGGTATT 57.750 34.615 0.00 0.00 30.93 1.89
6624 7321 8.360390 TCTCATACATAGTGTGACATGGTATTC 58.640 37.037 0.00 0.00 30.93 1.75
6625 7322 8.250143 TCATACATAGTGTGACATGGTATTCT 57.750 34.615 0.00 0.00 29.19 2.40
6626 7323 8.704668 TCATACATAGTGTGACATGGTATTCTT 58.295 33.333 0.00 0.00 29.19 2.52
6627 7324 9.330063 CATACATAGTGTGACATGGTATTCTTT 57.670 33.333 0.00 0.00 0.00 2.52
6629 7326 8.948631 ACATAGTGTGACATGGTATTCTTTAG 57.051 34.615 0.00 0.00 0.00 1.85
6630 7327 8.540388 ACATAGTGTGACATGGTATTCTTTAGT 58.460 33.333 0.00 0.00 0.00 2.24
6631 7328 9.383519 CATAGTGTGACATGGTATTCTTTAGTT 57.616 33.333 0.00 0.00 0.00 2.24
6632 7329 9.959721 ATAGTGTGACATGGTATTCTTTAGTTT 57.040 29.630 0.00 0.00 0.00 2.66
6634 7331 9.959721 AGTGTGACATGGTATTCTTTAGTTTAT 57.040 29.630 0.00 0.00 0.00 1.40
6635 7332 9.988350 GTGTGACATGGTATTCTTTAGTTTATG 57.012 33.333 0.00 0.00 0.00 1.90
6636 7333 9.952030 TGTGACATGGTATTCTTTAGTTTATGA 57.048 29.630 0.00 0.00 0.00 2.15
6638 7335 9.952030 TGACATGGTATTCTTTAGTTTATGACA 57.048 29.630 0.00 0.00 0.00 3.58
6640 7337 9.733556 ACATGGTATTCTTTAGTTTATGACACA 57.266 29.630 0.00 0.00 0.00 3.72
6671 7368 9.851686 TCAATTATCACTTATTCTTATGCCACT 57.148 29.630 0.00 0.00 0.00 4.00
6675 7372 9.725019 TTATCACTTATTCTTATGCCACTATGG 57.275 33.333 0.00 0.00 41.55 2.74
6676 7373 7.373617 TCACTTATTCTTATGCCACTATGGA 57.626 36.000 0.00 0.00 40.96 3.41
6677 7374 7.977818 TCACTTATTCTTATGCCACTATGGAT 58.022 34.615 0.00 0.00 40.96 3.41
6678 7375 9.100197 TCACTTATTCTTATGCCACTATGGATA 57.900 33.333 0.00 0.00 40.96 2.59
6679 7376 9.725019 CACTTATTCTTATGCCACTATGGATAA 57.275 33.333 0.00 0.41 40.96 1.75
6680 7377 9.950496 ACTTATTCTTATGCCACTATGGATAAG 57.050 33.333 14.53 14.53 40.96 1.73
6681 7378 9.950496 CTTATTCTTATGCCACTATGGATAAGT 57.050 33.333 17.36 9.07 40.96 2.24
6682 7379 9.944376 TTATTCTTATGCCACTATGGATAAGTC 57.056 33.333 17.36 0.00 40.96 3.01
6683 7380 6.025749 TCTTATGCCACTATGGATAAGTCG 57.974 41.667 17.36 0.00 40.96 4.18
6684 7381 5.538813 TCTTATGCCACTATGGATAAGTCGT 59.461 40.000 17.36 0.31 40.96 4.34
6685 7382 3.452755 TGCCACTATGGATAAGTCGTG 57.547 47.619 0.00 0.00 40.96 4.35
6686 7383 2.764010 TGCCACTATGGATAAGTCGTGT 59.236 45.455 0.00 0.00 40.96 4.49
6687 7384 3.181479 TGCCACTATGGATAAGTCGTGTC 60.181 47.826 0.00 0.00 40.96 3.67
6688 7385 3.181479 GCCACTATGGATAAGTCGTGTCA 60.181 47.826 0.00 0.00 40.96 3.58
6689 7386 4.360563 CCACTATGGATAAGTCGTGTCAC 58.639 47.826 0.00 0.00 40.96 3.67
6690 7387 4.098044 CCACTATGGATAAGTCGTGTCACT 59.902 45.833 0.65 0.00 40.96 3.41
6691 7388 5.298527 CCACTATGGATAAGTCGTGTCACTA 59.701 44.000 0.65 0.00 40.96 2.74
6692 7389 6.183360 CCACTATGGATAAGTCGTGTCACTAA 60.183 42.308 0.65 0.00 40.96 2.24
6693 7390 7.426410 CACTATGGATAAGTCGTGTCACTAAT 58.574 38.462 0.65 0.00 0.00 1.73
6694 7391 7.379797 CACTATGGATAAGTCGTGTCACTAATG 59.620 40.741 0.65 0.00 0.00 1.90
6695 7392 4.430007 TGGATAAGTCGTGTCACTAATGC 58.570 43.478 0.65 0.00 0.00 3.56
6696 7393 4.081917 TGGATAAGTCGTGTCACTAATGCA 60.082 41.667 0.65 0.00 0.00 3.96
6697 7394 5.050490 GGATAAGTCGTGTCACTAATGCAT 58.950 41.667 0.00 0.00 0.00 3.96
6698 7395 5.050769 GGATAAGTCGTGTCACTAATGCATG 60.051 44.000 0.00 0.00 0.00 4.06
6699 7396 3.319137 AGTCGTGTCACTAATGCATGT 57.681 42.857 0.00 0.00 0.00 3.21
6700 7397 3.254060 AGTCGTGTCACTAATGCATGTC 58.746 45.455 0.00 0.00 0.00 3.06
6701 7398 2.993220 GTCGTGTCACTAATGCATGTCA 59.007 45.455 0.00 0.00 0.00 3.58
6702 7399 3.431912 GTCGTGTCACTAATGCATGTCAA 59.568 43.478 0.00 0.00 0.00 3.18
6703 7400 4.061596 TCGTGTCACTAATGCATGTCAAA 58.938 39.130 0.00 0.00 0.00 2.69
6704 7401 4.694982 TCGTGTCACTAATGCATGTCAAAT 59.305 37.500 0.00 0.00 0.00 2.32
6705 7402 4.789629 CGTGTCACTAATGCATGTCAAATG 59.210 41.667 0.00 0.00 0.00 2.32
6706 7403 4.560035 GTGTCACTAATGCATGTCAAATGC 59.440 41.667 0.00 0.00 44.76 3.56
6707 7404 4.107622 GTCACTAATGCATGTCAAATGCC 58.892 43.478 0.00 0.00 43.94 4.40
6708 7405 4.018490 TCACTAATGCATGTCAAATGCCT 58.982 39.130 0.00 0.00 43.94 4.75
6709 7406 5.066375 GTCACTAATGCATGTCAAATGCCTA 59.934 40.000 0.00 0.00 43.94 3.93
6710 7407 5.066375 TCACTAATGCATGTCAAATGCCTAC 59.934 40.000 0.00 0.00 43.94 3.18
6711 7408 4.949238 ACTAATGCATGTCAAATGCCTACA 59.051 37.500 0.00 0.00 43.94 2.74
6712 7409 5.595542 ACTAATGCATGTCAAATGCCTACAT 59.404 36.000 0.00 0.00 43.94 2.29
6713 7410 4.579454 ATGCATGTCAAATGCCTACATC 57.421 40.909 0.00 0.00 43.94 3.06
6714 7411 3.354467 TGCATGTCAAATGCCTACATCA 58.646 40.909 0.00 0.00 43.94 3.07
6715 7412 3.955551 TGCATGTCAAATGCCTACATCAT 59.044 39.130 0.00 0.00 43.94 2.45
6716 7413 4.202070 TGCATGTCAAATGCCTACATCATG 60.202 41.667 0.00 0.00 43.94 3.07
6717 7414 4.202080 GCATGTCAAATGCCTACATCATGT 60.202 41.667 0.00 0.00 37.23 3.21
6718 7415 4.968812 TGTCAAATGCCTACATCATGTG 57.031 40.909 0.00 0.00 34.62 3.21
6719 7416 4.334552 TGTCAAATGCCTACATCATGTGT 58.665 39.130 0.00 6.26 44.95 3.72
6720 7417 5.495640 TGTCAAATGCCTACATCATGTGTA 58.504 37.500 0.00 7.58 42.29 2.90
6721 7418 5.353956 TGTCAAATGCCTACATCATGTGTAC 59.646 40.000 0.00 0.00 42.29 2.90
6722 7419 5.353956 GTCAAATGCCTACATCATGTGTACA 59.646 40.000 0.00 0.00 42.29 2.90
6723 7420 5.353956 TCAAATGCCTACATCATGTGTACAC 59.646 40.000 19.36 19.36 42.29 2.90
6724 7421 4.760530 ATGCCTACATCATGTGTACACT 57.239 40.909 25.60 9.56 42.29 3.55
6725 7422 5.869649 ATGCCTACATCATGTGTACACTA 57.130 39.130 25.60 13.17 42.29 2.74
6726 7423 5.006153 TGCCTACATCATGTGTACACTAC 57.994 43.478 25.60 1.05 42.29 2.73
6727 7424 4.464597 TGCCTACATCATGTGTACACTACA 59.535 41.667 25.60 7.33 42.29 2.74
6728 7425 5.128663 TGCCTACATCATGTGTACACTACAT 59.871 40.000 25.60 9.43 42.29 2.29
6729 7426 6.322712 TGCCTACATCATGTGTACACTACATA 59.677 38.462 25.60 6.50 42.29 2.29
6730 7427 7.015195 TGCCTACATCATGTGTACACTACATAT 59.985 37.037 25.60 8.63 42.29 1.78
6731 7428 7.542477 GCCTACATCATGTGTACACTACATATC 59.458 40.741 25.60 0.00 42.29 1.63
6732 7429 8.797438 CCTACATCATGTGTACACTACATATCT 58.203 37.037 25.60 5.44 42.29 1.98
6733 7430 9.833182 CTACATCATGTGTACACTACATATCTC 57.167 37.037 25.60 0.00 42.29 2.75
6734 7431 8.470657 ACATCATGTGTACACTACATATCTCT 57.529 34.615 25.60 0.00 38.26 3.10
6735 7432 9.574516 ACATCATGTGTACACTACATATCTCTA 57.425 33.333 25.60 2.22 38.26 2.43
6736 7433 9.833182 CATCATGTGTACACTACATATCTCTAC 57.167 37.037 25.60 0.00 38.26 2.59
6737 7434 8.974060 TCATGTGTACACTACATATCTCTACA 57.026 34.615 25.60 1.64 38.26 2.74
6738 7435 9.403583 TCATGTGTACACTACATATCTCTACAA 57.596 33.333 25.60 0.90 38.26 2.41
6739 7436 9.670719 CATGTGTACACTACATATCTCTACAAG 57.329 37.037 25.60 0.00 38.26 3.16
6740 7437 7.704271 TGTGTACACTACATATCTCTACAAGC 58.296 38.462 25.60 0.00 41.34 4.01
6741 7438 7.556635 TGTGTACACTACATATCTCTACAAGCT 59.443 37.037 25.60 0.00 41.34 3.74
6742 7439 8.407064 GTGTACACTACATATCTCTACAAGCTT 58.593 37.037 18.92 0.00 41.34 3.74
6743 7440 8.967918 TGTACACTACATATCTCTACAAGCTTT 58.032 33.333 0.00 0.00 32.89 3.51
6744 7441 9.804758 GTACACTACATATCTCTACAAGCTTTT 57.195 33.333 0.00 0.00 0.00 2.27
6751 7448 9.819267 ACATATCTCTACAAGCTTTTAAGGTAC 57.181 33.333 0.00 0.00 35.34 3.34
6752 7449 9.262358 CATATCTCTACAAGCTTTTAAGGTACC 57.738 37.037 2.73 2.73 35.34 3.34
6753 7450 6.675413 TCTCTACAAGCTTTTAAGGTACCA 57.325 37.500 15.94 0.00 35.34 3.25
6754 7451 6.461640 TCTCTACAAGCTTTTAAGGTACCAC 58.538 40.000 15.94 0.00 35.34 4.16
6755 7452 6.042322 TCTCTACAAGCTTTTAAGGTACCACA 59.958 38.462 15.94 0.00 35.34 4.17
6756 7453 6.593807 TCTACAAGCTTTTAAGGTACCACAA 58.406 36.000 15.94 4.25 35.34 3.33
6757 7454 7.055378 TCTACAAGCTTTTAAGGTACCACAAA 58.945 34.615 15.94 10.60 35.34 2.83
6758 7455 5.898174 ACAAGCTTTTAAGGTACCACAAAC 58.102 37.500 15.94 3.14 35.34 2.93
6759 7456 5.655090 ACAAGCTTTTAAGGTACCACAAACT 59.345 36.000 15.94 5.30 35.34 2.66
6760 7457 6.829811 ACAAGCTTTTAAGGTACCACAAACTA 59.170 34.615 15.94 0.00 35.34 2.24
6761 7458 7.504574 ACAAGCTTTTAAGGTACCACAAACTAT 59.495 33.333 15.94 0.00 35.34 2.12
6762 7459 8.357402 CAAGCTTTTAAGGTACCACAAACTATT 58.643 33.333 15.94 0.00 35.34 1.73
6763 7460 8.473358 AGCTTTTAAGGTACCACAAACTATTT 57.527 30.769 15.94 0.00 34.49 1.40
6764 7461 8.357402 AGCTTTTAAGGTACCACAAACTATTTG 58.643 33.333 15.94 0.00 39.63 2.32
6765 7462 8.354426 GCTTTTAAGGTACCACAAACTATTTGA 58.646 33.333 15.94 0.00 43.26 2.69
6772 7469 9.975218 AGGTACCACAAACTATTTGATTATTCT 57.025 29.630 15.94 0.00 43.26 2.40
6776 7473 9.077885 ACCACAAACTATTTGATTATTCTGTGT 57.922 29.630 8.24 0.00 43.26 3.72
6777 7474 9.345517 CCACAAACTATTTGATTATTCTGTGTG 57.654 33.333 8.24 0.00 43.26 3.82
6778 7475 8.853345 CACAAACTATTTGATTATTCTGTGTGC 58.147 33.333 8.24 0.00 43.26 4.57
6779 7476 8.575589 ACAAACTATTTGATTATTCTGTGTGCA 58.424 29.630 8.24 0.00 43.26 4.57
6780 7477 9.577110 CAAACTATTTGATTATTCTGTGTGCAT 57.423 29.630 0.00 0.00 43.26 3.96
6781 7478 9.577110 AAACTATTTGATTATTCTGTGTGCATG 57.423 29.630 0.00 0.00 0.00 4.06
6782 7479 7.709947 ACTATTTGATTATTCTGTGTGCATGG 58.290 34.615 0.00 0.00 0.00 3.66
6783 7480 4.374843 TTGATTATTCTGTGTGCATGGC 57.625 40.909 0.00 0.00 0.00 4.40
6784 7481 2.355444 TGATTATTCTGTGTGCATGGCG 59.645 45.455 0.00 0.00 0.00 5.69
6785 7482 1.819928 TTATTCTGTGTGCATGGCGT 58.180 45.000 0.00 0.00 0.00 5.68
6786 7483 1.819928 TATTCTGTGTGCATGGCGTT 58.180 45.000 0.00 0.00 0.00 4.84
6787 7484 1.819928 ATTCTGTGTGCATGGCGTTA 58.180 45.000 0.00 0.00 0.00 3.18
6788 7485 0.871722 TTCTGTGTGCATGGCGTTAC 59.128 50.000 0.00 0.00 0.00 2.50
6789 7486 0.034756 TCTGTGTGCATGGCGTTACT 59.965 50.000 0.00 0.00 0.00 2.24
6790 7487 0.874390 CTGTGTGCATGGCGTTACTT 59.126 50.000 0.00 0.00 0.00 2.24
6791 7488 2.073056 CTGTGTGCATGGCGTTACTTA 58.927 47.619 0.00 0.00 0.00 2.24
6792 7489 2.073056 TGTGTGCATGGCGTTACTTAG 58.927 47.619 0.00 0.00 0.00 2.18
6793 7490 1.396996 GTGTGCATGGCGTTACTTAGG 59.603 52.381 0.00 0.00 0.00 2.69
6794 7491 1.276705 TGTGCATGGCGTTACTTAGGA 59.723 47.619 0.00 0.00 0.00 2.94
6795 7492 1.933853 GTGCATGGCGTTACTTAGGAG 59.066 52.381 0.00 0.00 0.00 3.69
6796 7493 1.828595 TGCATGGCGTTACTTAGGAGA 59.171 47.619 0.00 0.00 0.00 3.71
6797 7494 2.235155 TGCATGGCGTTACTTAGGAGAA 59.765 45.455 0.00 0.00 0.00 2.87
6798 7495 3.267483 GCATGGCGTTACTTAGGAGAAA 58.733 45.455 0.00 0.00 0.00 2.52
6799 7496 3.687698 GCATGGCGTTACTTAGGAGAAAA 59.312 43.478 0.00 0.00 0.00 2.29
6800 7497 4.155280 GCATGGCGTTACTTAGGAGAAAAA 59.845 41.667 0.00 0.00 0.00 1.94
6801 7498 5.163652 GCATGGCGTTACTTAGGAGAAAAAT 60.164 40.000 0.00 0.00 0.00 1.82
6802 7499 6.487103 CATGGCGTTACTTAGGAGAAAAATC 58.513 40.000 0.00 0.00 0.00 2.17
6803 7500 4.939439 TGGCGTTACTTAGGAGAAAAATCC 59.061 41.667 0.00 0.00 39.89 3.01
6838 7535 8.385898 TGTTTTTATATAGTTAATCGGCCAGG 57.614 34.615 2.24 0.00 0.00 4.45
6839 7536 8.212312 TGTTTTTATATAGTTAATCGGCCAGGA 58.788 33.333 2.24 0.00 0.00 3.86
6840 7537 9.059260 GTTTTTATATAGTTAATCGGCCAGGAA 57.941 33.333 2.24 0.00 0.00 3.36
6841 7538 9.629878 TTTTTATATAGTTAATCGGCCAGGAAA 57.370 29.630 2.24 0.00 0.00 3.13
6842 7539 8.611654 TTTATATAGTTAATCGGCCAGGAAAC 57.388 34.615 2.24 1.40 0.00 2.78
6843 7540 2.871096 AGTTAATCGGCCAGGAAACA 57.129 45.000 2.24 0.00 0.00 2.83
6844 7541 3.149005 AGTTAATCGGCCAGGAAACAA 57.851 42.857 2.24 0.00 0.00 2.83
6845 7542 3.492337 AGTTAATCGGCCAGGAAACAAA 58.508 40.909 2.24 0.00 0.00 2.83
6846 7543 3.254903 AGTTAATCGGCCAGGAAACAAAC 59.745 43.478 2.24 0.00 0.00 2.93
6847 7544 1.995376 AATCGGCCAGGAAACAAACT 58.005 45.000 2.24 0.00 0.00 2.66
6848 7545 1.534729 ATCGGCCAGGAAACAAACTC 58.465 50.000 2.24 0.00 0.00 3.01
6849 7546 0.181587 TCGGCCAGGAAACAAACTCA 59.818 50.000 2.24 0.00 0.00 3.41
6850 7547 0.310854 CGGCCAGGAAACAAACTCAC 59.689 55.000 2.24 0.00 0.00 3.51
6851 7548 1.692411 GGCCAGGAAACAAACTCACT 58.308 50.000 0.00 0.00 0.00 3.41
6852 7549 2.808933 CGGCCAGGAAACAAACTCACTA 60.809 50.000 2.24 0.00 0.00 2.74
6853 7550 3.219281 GGCCAGGAAACAAACTCACTAA 58.781 45.455 0.00 0.00 0.00 2.24
6854 7551 3.004419 GGCCAGGAAACAAACTCACTAAC 59.996 47.826 0.00 0.00 0.00 2.34
6855 7552 3.883489 GCCAGGAAACAAACTCACTAACT 59.117 43.478 0.00 0.00 0.00 2.24
6856 7553 4.338400 GCCAGGAAACAAACTCACTAACTT 59.662 41.667 0.00 0.00 0.00 2.66
6857 7554 5.505819 GCCAGGAAACAAACTCACTAACTTC 60.506 44.000 0.00 0.00 0.00 3.01
6858 7555 5.008712 CCAGGAAACAAACTCACTAACTTCC 59.991 44.000 0.00 0.00 32.87 3.46
6859 7556 5.823045 CAGGAAACAAACTCACTAACTTCCT 59.177 40.000 0.00 0.00 41.60 3.36
6860 7557 6.318900 CAGGAAACAAACTCACTAACTTCCTT 59.681 38.462 0.00 0.00 39.47 3.36
6861 7558 6.318900 AGGAAACAAACTCACTAACTTCCTTG 59.681 38.462 0.00 0.00 38.59 3.61
6862 7559 6.317893 GGAAACAAACTCACTAACTTCCTTGA 59.682 38.462 0.00 0.00 0.00 3.02
6863 7560 7.148137 GGAAACAAACTCACTAACTTCCTTGAA 60.148 37.037 0.00 0.00 0.00 2.69
6864 7561 7.881775 AACAAACTCACTAACTTCCTTGAAT 57.118 32.000 0.00 0.00 0.00 2.57
6865 7562 7.881775 ACAAACTCACTAACTTCCTTGAATT 57.118 32.000 0.00 0.00 0.00 2.17
6866 7563 8.293699 ACAAACTCACTAACTTCCTTGAATTT 57.706 30.769 0.00 0.00 0.00 1.82
6867 7564 8.406297 ACAAACTCACTAACTTCCTTGAATTTC 58.594 33.333 0.00 0.00 0.00 2.17
6868 7565 7.511959 AACTCACTAACTTCCTTGAATTTCC 57.488 36.000 0.00 0.00 0.00 3.13
6869 7566 6.601332 ACTCACTAACTTCCTTGAATTTCCA 58.399 36.000 0.00 0.00 0.00 3.53
6870 7567 7.060421 ACTCACTAACTTCCTTGAATTTCCAA 58.940 34.615 0.00 0.00 0.00 3.53
6871 7568 7.559897 ACTCACTAACTTCCTTGAATTTCCAAA 59.440 33.333 0.00 0.00 0.00 3.28
6872 7569 7.940850 TCACTAACTTCCTTGAATTTCCAAAG 58.059 34.615 0.00 0.00 0.00 2.77
6873 7570 7.777910 TCACTAACTTCCTTGAATTTCCAAAGA 59.222 33.333 0.00 0.00 0.00 2.52
6874 7571 8.413229 CACTAACTTCCTTGAATTTCCAAAGAA 58.587 33.333 0.00 0.00 0.00 2.52
6875 7572 8.977412 ACTAACTTCCTTGAATTTCCAAAGAAA 58.023 29.630 0.00 0.00 45.78 2.52
6876 7573 9.816354 CTAACTTCCTTGAATTTCCAAAGAAAA 57.184 29.630 0.00 0.00 44.91 2.29
6910 7607 7.251704 ACACATGATAGATAAGCGAAAAAGG 57.748 36.000 0.00 0.00 0.00 3.11
6911 7608 6.823689 ACACATGATAGATAAGCGAAAAAGGT 59.176 34.615 0.00 0.00 0.00 3.50
6912 7609 7.336931 ACACATGATAGATAAGCGAAAAAGGTT 59.663 33.333 0.00 0.00 35.81 3.50
6913 7610 7.852945 CACATGATAGATAAGCGAAAAAGGTTC 59.147 37.037 0.00 0.00 33.53 3.62
6914 7611 7.770897 ACATGATAGATAAGCGAAAAAGGTTCT 59.229 33.333 0.00 0.00 33.53 3.01
6915 7612 7.539712 TGATAGATAAGCGAAAAAGGTTCTG 57.460 36.000 0.00 0.00 33.53 3.02
6916 7613 7.103641 TGATAGATAAGCGAAAAAGGTTCTGT 58.896 34.615 0.00 0.00 33.53 3.41
6917 7614 8.255206 TGATAGATAAGCGAAAAAGGTTCTGTA 58.745 33.333 0.00 0.00 33.53 2.74
6918 7615 9.262358 GATAGATAAGCGAAAAAGGTTCTGTAT 57.738 33.333 0.00 0.00 33.53 2.29
6919 7616 7.923414 AGATAAGCGAAAAAGGTTCTGTATT 57.077 32.000 0.00 0.00 33.53 1.89
6920 7617 7.975750 AGATAAGCGAAAAAGGTTCTGTATTC 58.024 34.615 0.00 0.00 33.53 1.75
6921 7618 7.824779 AGATAAGCGAAAAAGGTTCTGTATTCT 59.175 33.333 0.00 0.00 33.53 2.40
6922 7619 5.864628 AGCGAAAAAGGTTCTGTATTCTC 57.135 39.130 0.00 0.00 0.00 2.87
6923 7620 4.695928 AGCGAAAAAGGTTCTGTATTCTCC 59.304 41.667 0.00 0.00 0.00 3.71
6924 7621 4.695928 GCGAAAAAGGTTCTGTATTCTCCT 59.304 41.667 0.00 0.00 0.00 3.69
6925 7622 5.181433 GCGAAAAAGGTTCTGTATTCTCCTT 59.819 40.000 0.00 0.00 39.75 3.36
6926 7623 6.294010 GCGAAAAAGGTTCTGTATTCTCCTTT 60.294 38.462 0.00 0.00 46.26 3.11
6927 7624 7.094933 GCGAAAAAGGTTCTGTATTCTCCTTTA 60.095 37.037 7.72 0.00 44.41 1.85
6928 7625 8.780249 CGAAAAAGGTTCTGTATTCTCCTTTAA 58.220 33.333 7.72 0.00 44.41 1.52
6935 7632 9.047371 GGTTCTGTATTCTCCTTTAATCTTAGC 57.953 37.037 0.00 0.00 0.00 3.09
6936 7633 9.047371 GTTCTGTATTCTCCTTTAATCTTAGCC 57.953 37.037 0.00 0.00 0.00 3.93
6937 7634 7.736893 TCTGTATTCTCCTTTAATCTTAGCCC 58.263 38.462 0.00 0.00 0.00 5.19
6938 7635 7.569111 TCTGTATTCTCCTTTAATCTTAGCCCT 59.431 37.037 0.00 0.00 0.00 5.19
6939 7636 8.102484 TGTATTCTCCTTTAATCTTAGCCCTT 57.898 34.615 0.00 0.00 0.00 3.95
6940 7637 7.993183 TGTATTCTCCTTTAATCTTAGCCCTTG 59.007 37.037 0.00 0.00 0.00 3.61
6941 7638 5.373812 TCTCCTTTAATCTTAGCCCTTGG 57.626 43.478 0.00 0.00 0.00 3.61
6942 7639 4.166144 TCTCCTTTAATCTTAGCCCTTGGG 59.834 45.833 0.32 0.32 0.00 4.12
6943 7640 4.116113 TCCTTTAATCTTAGCCCTTGGGA 58.884 43.478 10.36 0.00 0.00 4.37
6944 7641 4.731929 TCCTTTAATCTTAGCCCTTGGGAT 59.268 41.667 10.36 5.66 0.00 3.85
6945 7642 5.073428 CCTTTAATCTTAGCCCTTGGGATC 58.927 45.833 10.36 0.00 0.00 3.36
6946 7643 5.399038 CCTTTAATCTTAGCCCTTGGGATCA 60.399 44.000 10.36 0.00 0.00 2.92
6947 7644 5.725551 TTAATCTTAGCCCTTGGGATCAA 57.274 39.130 10.36 0.00 0.00 2.57
6959 7656 3.795688 TGGGATCAAGATGGATAAGCC 57.204 47.619 0.00 0.00 37.10 4.35
6972 7669 4.922206 TGGATAAGCCAATGTTTGAGAGT 58.078 39.130 0.00 0.00 45.87 3.24
6973 7670 6.061022 TGGATAAGCCAATGTTTGAGAGTA 57.939 37.500 0.00 0.00 45.87 2.59
6974 7671 5.880332 TGGATAAGCCAATGTTTGAGAGTAC 59.120 40.000 0.00 0.00 45.87 2.73
6975 7672 5.297029 GGATAAGCCAATGTTTGAGAGTACC 59.703 44.000 0.00 0.00 36.34 3.34
6976 7673 4.373156 AAGCCAATGTTTGAGAGTACCT 57.627 40.909 0.00 0.00 0.00 3.08
6977 7674 5.499004 AAGCCAATGTTTGAGAGTACCTA 57.501 39.130 0.00 0.00 0.00 3.08
6978 7675 5.499004 AGCCAATGTTTGAGAGTACCTAA 57.501 39.130 0.00 0.00 0.00 2.69
6979 7676 5.876357 AGCCAATGTTTGAGAGTACCTAAA 58.124 37.500 0.00 0.00 0.00 1.85
6980 7677 6.303839 AGCCAATGTTTGAGAGTACCTAAAA 58.696 36.000 0.00 0.00 0.00 1.52
6981 7678 6.775629 AGCCAATGTTTGAGAGTACCTAAAAA 59.224 34.615 0.00 0.00 27.21 1.94
6982 7679 6.861572 GCCAATGTTTGAGAGTACCTAAAAAC 59.138 38.462 0.00 3.00 34.53 2.43
6983 7680 7.255486 GCCAATGTTTGAGAGTACCTAAAAACT 60.255 37.037 15.37 0.00 34.80 2.66
6984 7681 8.630037 CCAATGTTTGAGAGTACCTAAAAACTT 58.370 33.333 15.37 10.57 34.80 2.66
6988 7685 9.457436 TGTTTGAGAGTACCTAAAAACTTTTCT 57.543 29.630 15.37 0.59 34.80 2.52
6992 7689 9.675464 TGAGAGTACCTAAAAACTTTTCTTTGA 57.325 29.630 0.00 0.00 0.00 2.69
6999 7696 9.772973 ACCTAAAAACTTTTCTTTGAACAAACT 57.227 25.926 0.00 0.00 0.00 2.66
7048 7745 7.510549 TTTCTAGGAACTAATGCATAATGGC 57.489 36.000 0.00 0.00 42.17 4.40
7049 7746 6.186420 TCTAGGAACTAATGCATAATGGCA 57.814 37.500 0.00 0.00 42.17 4.92
7071 7768 7.687941 GCATTGCCACCAATAGTAATATAGT 57.312 36.000 0.00 0.00 39.60 2.12
7072 7769 8.110860 GCATTGCCACCAATAGTAATATAGTT 57.889 34.615 0.00 0.00 39.60 2.24
7073 7770 8.576442 GCATTGCCACCAATAGTAATATAGTTT 58.424 33.333 0.00 0.00 39.60 2.66
7075 7772 8.685838 TTGCCACCAATAGTAATATAGTTTCC 57.314 34.615 0.00 0.00 0.00 3.13
7076 7773 8.041143 TGCCACCAATAGTAATATAGTTTCCT 57.959 34.615 0.00 0.00 0.00 3.36
7077 7774 8.499406 TGCCACCAATAGTAATATAGTTTCCTT 58.501 33.333 0.00 0.00 0.00 3.36
7078 7775 9.350951 GCCACCAATAGTAATATAGTTTCCTTT 57.649 33.333 0.00 0.00 0.00 3.11
7088 7785 9.736023 GTAATATAGTTTCCTTTCTTTGCATGG 57.264 33.333 0.00 0.00 0.00 3.66
7089 7786 7.961326 ATATAGTTTCCTTTCTTTGCATGGT 57.039 32.000 0.00 0.00 0.00 3.55
7090 7787 4.590850 AGTTTCCTTTCTTTGCATGGTC 57.409 40.909 0.00 0.00 0.00 4.02
7091 7788 3.960102 AGTTTCCTTTCTTTGCATGGTCA 59.040 39.130 0.00 0.00 0.00 4.02
7092 7789 4.405358 AGTTTCCTTTCTTTGCATGGTCAA 59.595 37.500 0.00 0.00 0.00 3.18
7093 7790 5.070847 AGTTTCCTTTCTTTGCATGGTCAAT 59.929 36.000 0.00 0.00 0.00 2.57
7094 7791 6.267471 AGTTTCCTTTCTTTGCATGGTCAATA 59.733 34.615 0.00 0.00 0.00 1.90
7095 7792 5.902613 TCCTTTCTTTGCATGGTCAATAG 57.097 39.130 0.00 0.00 0.00 1.73
7096 7793 4.706476 TCCTTTCTTTGCATGGTCAATAGG 59.294 41.667 0.00 0.00 0.00 2.57
7097 7794 4.706476 CCTTTCTTTGCATGGTCAATAGGA 59.294 41.667 0.00 0.00 0.00 2.94
7098 7795 5.185635 CCTTTCTTTGCATGGTCAATAGGAA 59.814 40.000 0.00 0.00 0.00 3.36
7099 7796 5.643379 TTCTTTGCATGGTCAATAGGAAC 57.357 39.130 0.00 0.00 0.00 3.62
7100 7797 4.016444 TCTTTGCATGGTCAATAGGAACC 58.984 43.478 0.00 0.00 29.57 3.62
7101 7798 3.448093 TTGCATGGTCAATAGGAACCA 57.552 42.857 0.00 0.00 36.61 3.67
7102 7799 2.722094 TGCATGGTCAATAGGAACCAC 58.278 47.619 0.00 0.00 34.82 4.16
7103 7800 2.308570 TGCATGGTCAATAGGAACCACT 59.691 45.455 0.00 0.00 34.82 4.00
7104 7801 2.945668 GCATGGTCAATAGGAACCACTC 59.054 50.000 0.00 0.00 34.82 3.51
7105 7802 3.545703 CATGGTCAATAGGAACCACTCC 58.454 50.000 0.00 0.00 45.81 3.85
7106 7803 1.913419 TGGTCAATAGGAACCACTCCC 59.087 52.381 0.00 0.00 46.81 4.30
7107 7804 1.212195 GGTCAATAGGAACCACTCCCC 59.788 57.143 0.00 0.00 46.81 4.81
7108 7805 1.913419 GTCAATAGGAACCACTCCCCA 59.087 52.381 0.00 0.00 46.81 4.96
7109 7806 2.307686 GTCAATAGGAACCACTCCCCAA 59.692 50.000 0.00 0.00 46.81 4.12
7110 7807 3.053619 GTCAATAGGAACCACTCCCCAAT 60.054 47.826 0.00 0.00 46.81 3.16
7111 7808 4.165372 GTCAATAGGAACCACTCCCCAATA 59.835 45.833 0.00 0.00 46.81 1.90
7112 7809 4.981647 TCAATAGGAACCACTCCCCAATAT 59.018 41.667 0.00 0.00 46.81 1.28
7113 7810 6.043938 GTCAATAGGAACCACTCCCCAATATA 59.956 42.308 0.00 0.00 46.81 0.86
7114 7811 6.621931 TCAATAGGAACCACTCCCCAATATAA 59.378 38.462 0.00 0.00 46.81 0.98
7115 7812 7.297108 TCAATAGGAACCACTCCCCAATATAAT 59.703 37.037 0.00 0.00 46.81 1.28
7116 7813 8.611257 CAATAGGAACCACTCCCCAATATAATA 58.389 37.037 0.00 0.00 46.81 0.98
7117 7814 8.949798 ATAGGAACCACTCCCCAATATAATAT 57.050 34.615 0.00 0.00 46.81 1.28
7118 7815 7.272144 AGGAACCACTCCCCAATATAATATC 57.728 40.000 0.00 0.00 46.81 1.63
7119 7816 7.031917 AGGAACCACTCCCCAATATAATATCT 58.968 38.462 0.00 0.00 46.81 1.98
7120 7817 7.037297 AGGAACCACTCCCCAATATAATATCTG 60.037 40.741 0.00 0.00 46.81 2.90
7121 7818 7.037586 GGAACCACTCCCCAATATAATATCTGA 60.038 40.741 0.00 0.00 38.44 3.27
7122 7819 7.888514 ACCACTCCCCAATATAATATCTGAA 57.111 36.000 0.00 0.00 0.00 3.02
7123 7820 8.287904 ACCACTCCCCAATATAATATCTGAAA 57.712 34.615 0.00 0.00 0.00 2.69
7124 7821 8.904963 ACCACTCCCCAATATAATATCTGAAAT 58.095 33.333 0.00 0.00 0.00 2.17
7125 7822 9.759473 CCACTCCCCAATATAATATCTGAAATT 57.241 33.333 0.00 0.00 0.00 1.82
7129 7826 9.827198 TCCCCAATATAATATCTGAAATTTGCT 57.173 29.630 0.00 0.00 0.00 3.91
7172 7869 4.314522 TTCCATTCTGGGAAATGCTACA 57.685 40.909 0.00 0.00 43.77 2.74
7173 7870 3.620488 TCCATTCTGGGAAATGCTACAC 58.380 45.455 0.00 0.00 38.32 2.90
7174 7871 2.689983 CCATTCTGGGAAATGCTACACC 59.310 50.000 0.00 0.00 35.68 4.16
7175 7872 3.624777 CATTCTGGGAAATGCTACACCT 58.375 45.455 0.00 0.00 30.45 4.00
7176 7873 4.385199 CCATTCTGGGAAATGCTACACCTA 60.385 45.833 0.00 0.00 35.68 3.08
7177 7874 3.906720 TCTGGGAAATGCTACACCTAC 57.093 47.619 0.00 0.00 0.00 3.18
7178 7875 3.178046 TCTGGGAAATGCTACACCTACA 58.822 45.455 0.00 0.00 0.00 2.74
7179 7876 3.585289 TCTGGGAAATGCTACACCTACAA 59.415 43.478 0.00 0.00 0.00 2.41
7180 7877 4.042311 TCTGGGAAATGCTACACCTACAAA 59.958 41.667 0.00 0.00 0.00 2.83
7181 7878 4.076394 TGGGAAATGCTACACCTACAAAC 58.924 43.478 0.00 0.00 0.00 2.93
7182 7879 3.442625 GGGAAATGCTACACCTACAAACC 59.557 47.826 0.00 0.00 0.00 3.27
7183 7880 3.126343 GGAAATGCTACACCTACAAACCG 59.874 47.826 0.00 0.00 0.00 4.44
7184 7881 3.688694 AATGCTACACCTACAAACCGA 57.311 42.857 0.00 0.00 0.00 4.69
7185 7882 2.736144 TGCTACACCTACAAACCGAG 57.264 50.000 0.00 0.00 0.00 4.63
7186 7883 1.274167 TGCTACACCTACAAACCGAGG 59.726 52.381 0.00 0.00 38.92 4.63
7188 7885 2.673326 GCTACACCTACAAACCGAGGTC 60.673 54.545 0.00 0.00 44.54 3.85
7189 7886 0.683412 ACACCTACAAACCGAGGTCC 59.317 55.000 0.00 0.00 44.54 4.46
7190 7887 0.682852 CACCTACAAACCGAGGTCCA 59.317 55.000 0.00 0.00 44.54 4.02
7191 7888 0.683412 ACCTACAAACCGAGGTCCAC 59.317 55.000 0.00 0.00 42.69 4.02
7192 7889 0.682852 CCTACAAACCGAGGTCCACA 59.317 55.000 0.00 0.00 0.00 4.17
7193 7890 1.071071 CCTACAAACCGAGGTCCACAA 59.929 52.381 0.00 0.00 0.00 3.33
7194 7891 2.485835 CCTACAAACCGAGGTCCACAAA 60.486 50.000 0.00 0.00 0.00 2.83
7195 7892 2.131776 ACAAACCGAGGTCCACAAAA 57.868 45.000 0.00 0.00 0.00 2.44
7196 7893 2.448453 ACAAACCGAGGTCCACAAAAA 58.552 42.857 0.00 0.00 0.00 1.94
7197 7894 2.164827 ACAAACCGAGGTCCACAAAAAC 59.835 45.455 0.00 0.00 0.00 2.43
7198 7895 2.131776 AACCGAGGTCCACAAAAACA 57.868 45.000 0.00 0.00 0.00 2.83
7199 7896 1.675552 ACCGAGGTCCACAAAAACAG 58.324 50.000 0.00 0.00 0.00 3.16
7200 7897 0.310854 CCGAGGTCCACAAAAACAGC 59.689 55.000 0.00 0.00 0.00 4.40
7201 7898 1.308998 CGAGGTCCACAAAAACAGCT 58.691 50.000 0.00 0.00 0.00 4.24
7202 7899 1.676006 CGAGGTCCACAAAAACAGCTT 59.324 47.619 0.00 0.00 0.00 3.74
7203 7900 2.875933 CGAGGTCCACAAAAACAGCTTA 59.124 45.455 0.00 0.00 0.00 3.09
7204 7901 3.502211 CGAGGTCCACAAAAACAGCTTAT 59.498 43.478 0.00 0.00 0.00 1.73
7205 7902 4.613622 CGAGGTCCACAAAAACAGCTTATG 60.614 45.833 0.00 0.00 0.00 1.90
7206 7903 4.215109 AGGTCCACAAAAACAGCTTATGT 58.785 39.130 0.00 0.00 46.97 2.29
7207 7904 4.037923 AGGTCCACAAAAACAGCTTATGTG 59.962 41.667 0.00 6.98 43.00 3.21
7208 7905 4.202111 GGTCCACAAAAACAGCTTATGTGT 60.202 41.667 11.08 0.00 43.00 3.72
7209 7906 5.348164 GTCCACAAAAACAGCTTATGTGTT 58.652 37.500 11.08 0.00 43.00 3.32
7210 7907 5.231991 GTCCACAAAAACAGCTTATGTGTTG 59.768 40.000 11.08 6.56 43.00 3.33
7211 7908 5.126222 TCCACAAAAACAGCTTATGTGTTGA 59.874 36.000 10.12 0.43 43.00 3.18
7212 7909 5.231991 CCACAAAAACAGCTTATGTGTTGAC 59.768 40.000 10.12 0.00 43.00 3.18
7213 7910 5.804473 CACAAAAACAGCTTATGTGTTGACA 59.196 36.000 10.12 0.00 43.00 3.58
7214 7911 6.476380 CACAAAAACAGCTTATGTGTTGACAT 59.524 34.615 10.12 0.00 43.00 3.06
7215 7912 6.476380 ACAAAAACAGCTTATGTGTTGACATG 59.524 34.615 10.12 0.00 43.00 3.21
7216 7913 3.837213 ACAGCTTATGTGTTGACATGC 57.163 42.857 0.00 0.00 43.03 4.06
7217 7914 3.148412 ACAGCTTATGTGTTGACATGCA 58.852 40.909 0.00 0.00 43.03 3.96
7218 7915 3.058016 ACAGCTTATGTGTTGACATGCAC 60.058 43.478 0.00 0.00 43.03 4.57
7220 7917 3.569277 AGCTTATGTGTTGACATGCACAA 59.431 39.130 14.58 5.13 46.75 3.33
7221 7918 4.219070 AGCTTATGTGTTGACATGCACAAT 59.781 37.500 14.58 8.24 46.75 2.71
7222 7919 5.415389 AGCTTATGTGTTGACATGCACAATA 59.585 36.000 14.58 3.83 46.75 1.90
7223 7920 6.072008 AGCTTATGTGTTGACATGCACAATAA 60.072 34.615 14.58 12.33 46.75 1.40
7224 7921 6.033831 GCTTATGTGTTGACATGCACAATAAC 59.966 38.462 14.58 9.98 46.75 1.89
7225 7922 4.907879 TGTGTTGACATGCACAATAACA 57.092 36.364 9.91 14.51 41.89 2.41
7226 7923 5.254339 TGTGTTGACATGCACAATAACAA 57.746 34.783 15.38 0.00 41.89 2.83
7227 7924 5.840715 TGTGTTGACATGCACAATAACAAT 58.159 33.333 15.38 0.00 41.89 2.71
7228 7925 5.919707 TGTGTTGACATGCACAATAACAATC 59.080 36.000 15.38 1.63 41.89 2.67
7229 7926 5.059587 GTGTTGACATGCACAATAACAATCG 59.940 40.000 9.20 0.00 35.81 3.34
7230 7927 4.354071 TGACATGCACAATAACAATCGG 57.646 40.909 0.00 0.00 0.00 4.18
7231 7928 3.128415 TGACATGCACAATAACAATCGGG 59.872 43.478 0.00 0.00 0.00 5.14
7232 7929 2.159254 ACATGCACAATAACAATCGGGC 60.159 45.455 0.00 0.00 0.00 6.13
7233 7930 0.814457 TGCACAATAACAATCGGGCC 59.186 50.000 0.00 0.00 0.00 5.80
7234 7931 1.102978 GCACAATAACAATCGGGCCT 58.897 50.000 0.84 0.00 0.00 5.19
7235 7932 1.202290 GCACAATAACAATCGGGCCTG 60.202 52.381 4.71 4.71 0.00 4.85
7236 7933 1.102978 ACAATAACAATCGGGCCTGC 58.897 50.000 6.73 0.00 0.00 4.85
7237 7934 1.340991 ACAATAACAATCGGGCCTGCT 60.341 47.619 6.73 0.00 0.00 4.24
7238 7935 1.750778 CAATAACAATCGGGCCTGCTT 59.249 47.619 6.73 0.00 0.00 3.91
7239 7936 2.143876 ATAACAATCGGGCCTGCTTT 57.856 45.000 6.73 0.00 0.00 3.51
7240 7937 1.173043 TAACAATCGGGCCTGCTTTG 58.827 50.000 19.77 19.77 0.00 2.77
7241 7938 0.827507 AACAATCGGGCCTGCTTTGT 60.828 50.000 20.80 20.80 32.19 2.83
7242 7939 1.244019 ACAATCGGGCCTGCTTTGTC 61.244 55.000 20.80 0.00 0.00 3.18
7243 7940 1.074775 AATCGGGCCTGCTTTGTCA 59.925 52.632 6.73 0.00 0.00 3.58
7244 7941 0.539438 AATCGGGCCTGCTTTGTCAA 60.539 50.000 6.73 0.00 0.00 3.18
7245 7942 0.539438 ATCGGGCCTGCTTTGTCAAA 60.539 50.000 6.73 0.00 0.00 2.69
7246 7943 1.007387 CGGGCCTGCTTTGTCAAAC 60.007 57.895 0.84 0.00 0.00 2.93
7247 7944 1.455383 CGGGCCTGCTTTGTCAAACT 61.455 55.000 0.84 0.00 0.00 2.66
7248 7945 0.752658 GGGCCTGCTTTGTCAAACTT 59.247 50.000 0.84 0.00 0.00 2.66
7249 7946 1.960689 GGGCCTGCTTTGTCAAACTTA 59.039 47.619 0.84 0.00 0.00 2.24
7250 7947 2.288213 GGGCCTGCTTTGTCAAACTTAC 60.288 50.000 0.84 0.00 0.00 2.34
7251 7948 2.288213 GGCCTGCTTTGTCAAACTTACC 60.288 50.000 0.00 0.00 0.00 2.85
7252 7949 2.360801 GCCTGCTTTGTCAAACTTACCA 59.639 45.455 0.00 0.00 0.00 3.25
7253 7950 3.181480 GCCTGCTTTGTCAAACTTACCAA 60.181 43.478 0.00 0.00 0.00 3.67
7254 7951 4.359706 CCTGCTTTGTCAAACTTACCAAC 58.640 43.478 0.00 0.00 0.00 3.77
7255 7952 4.097892 CCTGCTTTGTCAAACTTACCAACT 59.902 41.667 0.00 0.00 0.00 3.16
7256 7953 4.992688 TGCTTTGTCAAACTTACCAACTG 58.007 39.130 0.00 0.00 0.00 3.16
7257 7954 4.702612 TGCTTTGTCAAACTTACCAACTGA 59.297 37.500 0.00 0.00 0.00 3.41
7258 7955 5.184096 TGCTTTGTCAAACTTACCAACTGAA 59.816 36.000 0.00 0.00 0.00 3.02
7259 7956 6.096695 GCTTTGTCAAACTTACCAACTGAAA 58.903 36.000 0.00 0.00 0.00 2.69
7260 7957 6.253512 GCTTTGTCAAACTTACCAACTGAAAG 59.746 38.462 0.00 0.00 42.29 2.62
7261 7958 5.828299 TGTCAAACTTACCAACTGAAAGG 57.172 39.130 0.00 0.00 39.30 3.11
7262 7959 5.258051 TGTCAAACTTACCAACTGAAAGGT 58.742 37.500 0.00 0.00 39.30 3.50
7263 7960 5.712917 TGTCAAACTTACCAACTGAAAGGTT 59.287 36.000 0.00 0.00 39.30 3.50
7264 7961 6.209788 TGTCAAACTTACCAACTGAAAGGTTT 59.790 34.615 0.00 0.00 39.30 3.27
7265 7962 6.750501 GTCAAACTTACCAACTGAAAGGTTTC 59.249 38.462 0.00 0.00 39.30 2.78
7266 7963 6.434652 TCAAACTTACCAACTGAAAGGTTTCA 59.565 34.615 5.09 5.09 44.31 2.69
7267 7964 5.830000 ACTTACCAACTGAAAGGTTTCAC 57.170 39.130 0.87 0.00 41.88 3.18
7268 7965 5.506708 ACTTACCAACTGAAAGGTTTCACT 58.493 37.500 0.87 0.00 41.88 3.41
7269 7966 5.949952 ACTTACCAACTGAAAGGTTTCACTT 59.050 36.000 0.87 0.00 41.88 3.16
7270 7967 7.114095 ACTTACCAACTGAAAGGTTTCACTTA 58.886 34.615 0.87 0.00 41.88 2.24
7271 7968 7.778382 ACTTACCAACTGAAAGGTTTCACTTAT 59.222 33.333 0.87 0.00 41.88 1.73
7272 7969 8.528044 TTACCAACTGAAAGGTTTCACTTATT 57.472 30.769 0.87 0.00 41.88 1.40
7273 7970 7.418337 ACCAACTGAAAGGTTTCACTTATTT 57.582 32.000 0.87 0.00 41.88 1.40
7274 7971 7.264947 ACCAACTGAAAGGTTTCACTTATTTG 58.735 34.615 0.87 1.68 41.88 2.32
7275 7972 7.093509 ACCAACTGAAAGGTTTCACTTATTTGT 60.094 33.333 0.87 0.00 41.88 2.83
7276 7973 7.763985 CCAACTGAAAGGTTTCACTTATTTGTT 59.236 33.333 0.87 0.71 41.88 2.83
7277 7974 8.594687 CAACTGAAAGGTTTCACTTATTTGTTG 58.405 33.333 12.92 12.92 41.88 3.33
7278 7975 6.756542 ACTGAAAGGTTTCACTTATTTGTTGC 59.243 34.615 0.87 0.00 41.88 4.17
7279 7976 5.746245 TGAAAGGTTTCACTTATTTGTTGCG 59.254 36.000 0.87 0.00 41.88 4.85
7280 7977 3.638484 AGGTTTCACTTATTTGTTGCGC 58.362 40.909 0.00 0.00 0.00 6.09
7281 7978 2.729360 GGTTTCACTTATTTGTTGCGCC 59.271 45.455 4.18 0.00 0.00 6.53
7282 7979 3.552068 GGTTTCACTTATTTGTTGCGCCT 60.552 43.478 4.18 0.00 0.00 5.52
7283 7980 4.320641 GGTTTCACTTATTTGTTGCGCCTA 60.321 41.667 4.18 0.00 0.00 3.93
7284 7981 5.216648 GTTTCACTTATTTGTTGCGCCTAA 58.783 37.500 4.18 0.00 0.00 2.69
7285 7982 4.678509 TCACTTATTTGTTGCGCCTAAG 57.321 40.909 4.18 5.30 0.00 2.18
7286 7983 3.119990 TCACTTATTTGTTGCGCCTAAGC 60.120 43.478 4.18 0.00 37.71 3.09
7287 7984 2.817258 ACTTATTTGTTGCGCCTAAGCA 59.183 40.909 4.18 0.00 46.54 3.91
7294 7991 2.840974 TGCGCCTAAGCAGAGTTTC 58.159 52.632 4.18 0.00 42.92 2.78
7295 7992 0.321671 TGCGCCTAAGCAGAGTTTCT 59.678 50.000 4.18 0.00 42.92 2.52
7296 7993 0.723981 GCGCCTAAGCAGAGTTTCTG 59.276 55.000 0.00 1.75 46.90 3.02
7297 7994 1.941668 GCGCCTAAGCAGAGTTTCTGT 60.942 52.381 0.00 0.00 45.94 3.41
7298 7995 2.674177 GCGCCTAAGCAGAGTTTCTGTA 60.674 50.000 0.00 0.00 45.94 2.74
7299 7996 3.585862 CGCCTAAGCAGAGTTTCTGTAA 58.414 45.455 7.80 0.00 45.94 2.41
7300 7997 3.994392 CGCCTAAGCAGAGTTTCTGTAAA 59.006 43.478 7.80 0.00 45.94 2.01
7301 7998 4.451096 CGCCTAAGCAGAGTTTCTGTAAAA 59.549 41.667 7.80 0.00 45.94 1.52
7302 7999 5.614887 CGCCTAAGCAGAGTTTCTGTAAAAC 60.615 44.000 7.80 0.00 45.94 2.43
7303 8000 5.470437 GCCTAAGCAGAGTTTCTGTAAAACT 59.530 40.000 7.80 2.98 45.94 2.66
7304 8001 6.017026 GCCTAAGCAGAGTTTCTGTAAAACTT 60.017 38.462 7.80 5.01 45.94 2.66
7305 8002 7.172703 GCCTAAGCAGAGTTTCTGTAAAACTTA 59.827 37.037 7.80 5.75 45.94 2.24
7306 8003 9.220767 CCTAAGCAGAGTTTCTGTAAAACTTAT 57.779 33.333 7.80 0.00 45.94 1.73
7309 8006 9.736023 AAGCAGAGTTTCTGTAAAACTTATTTG 57.264 29.630 7.80 3.90 45.94 2.32
7310 8007 8.903820 AGCAGAGTTTCTGTAAAACTTATTTGT 58.096 29.630 7.80 0.00 45.94 2.83
7319 8016 9.924650 TCTGTAAAACTTATTTGTAGAGGAGAC 57.075 33.333 0.00 0.00 0.00 3.36
7320 8017 9.706691 CTGTAAAACTTATTTGTAGAGGAGACA 57.293 33.333 0.00 0.00 0.00 3.41
7324 8021 9.793259 AAAACTTATTTGTAGAGGAGACATCAA 57.207 29.630 0.00 0.00 0.00 2.57
7325 8022 9.965902 AAACTTATTTGTAGAGGAGACATCAAT 57.034 29.630 0.00 0.00 0.00 2.57
7326 8023 9.965902 AACTTATTTGTAGAGGAGACATCAATT 57.034 29.630 0.00 0.00 0.00 2.32
7371 8068 8.558973 CCATAAAAGGGCAATAAAACATTTCA 57.441 30.769 0.00 0.00 0.00 2.69
7372 8069 9.176460 CCATAAAAGGGCAATAAAACATTTCAT 57.824 29.630 0.00 0.00 0.00 2.57
7376 8073 8.776376 AAAGGGCAATAAAACATTTCATAGTG 57.224 30.769 0.00 0.00 0.00 2.74
7377 8074 7.716799 AGGGCAATAAAACATTTCATAGTGA 57.283 32.000 0.00 0.00 0.00 3.41
7378 8075 8.133024 AGGGCAATAAAACATTTCATAGTGAA 57.867 30.769 0.00 0.00 34.03 3.18
7379 8076 8.034804 AGGGCAATAAAACATTTCATAGTGAAC 58.965 33.333 0.00 0.00 35.89 3.18
7380 8077 7.816995 GGGCAATAAAACATTTCATAGTGAACA 59.183 33.333 0.00 0.00 35.89 3.18
7381 8078 9.369904 GGCAATAAAACATTTCATAGTGAACAT 57.630 29.630 0.00 0.00 35.89 2.71
7389 8086 8.412608 ACATTTCATAGTGAACATAGAGAACG 57.587 34.615 0.00 0.00 35.89 3.95
7390 8087 6.887376 TTTCATAGTGAACATAGAGAACGC 57.113 37.500 0.00 0.00 35.89 4.84
7391 8088 5.576447 TCATAGTGAACATAGAGAACGCA 57.424 39.130 0.00 0.00 0.00 5.24
7392 8089 6.149129 TCATAGTGAACATAGAGAACGCAT 57.851 37.500 0.00 0.00 0.00 4.73
7393 8090 5.979517 TCATAGTGAACATAGAGAACGCATG 59.020 40.000 0.00 0.00 0.00 4.06
7394 8091 4.456280 AGTGAACATAGAGAACGCATGA 57.544 40.909 0.00 0.00 0.00 3.07
7395 8092 4.820897 AGTGAACATAGAGAACGCATGAA 58.179 39.130 0.00 0.00 0.00 2.57
7396 8093 4.627467 AGTGAACATAGAGAACGCATGAAC 59.373 41.667 0.00 0.00 0.00 3.18
7397 8094 4.627467 GTGAACATAGAGAACGCATGAACT 59.373 41.667 0.00 0.00 0.00 3.01
7398 8095 4.864806 TGAACATAGAGAACGCATGAACTC 59.135 41.667 0.00 0.00 0.00 3.01
7399 8096 4.456280 ACATAGAGAACGCATGAACTCA 57.544 40.909 0.00 0.00 32.59 3.41
7400 8097 4.177026 ACATAGAGAACGCATGAACTCAC 58.823 43.478 0.00 0.00 32.59 3.51
7401 8098 4.081972 ACATAGAGAACGCATGAACTCACT 60.082 41.667 0.00 0.00 32.59 3.41
7402 8099 3.393089 AGAGAACGCATGAACTCACTT 57.607 42.857 0.00 0.00 32.59 3.16
7403 8100 3.733337 AGAGAACGCATGAACTCACTTT 58.267 40.909 0.00 0.00 32.59 2.66
7404 8101 4.130118 AGAGAACGCATGAACTCACTTTT 58.870 39.130 0.00 0.00 32.59 2.27
7405 8102 4.024556 AGAGAACGCATGAACTCACTTTTG 60.025 41.667 0.00 0.00 32.59 2.44
7406 8103 3.627577 AGAACGCATGAACTCACTTTTGT 59.372 39.130 0.00 0.00 0.00 2.83
7424 8121 2.615244 TGTTGTGACACCCCAGACT 58.385 52.632 2.45 0.00 0.00 3.24
7425 8122 0.916086 TGTTGTGACACCCCAGACTT 59.084 50.000 2.45 0.00 0.00 3.01
7426 8123 2.120312 TGTTGTGACACCCCAGACTTA 58.880 47.619 2.45 0.00 0.00 2.24
7427 8124 2.104111 TGTTGTGACACCCCAGACTTAG 59.896 50.000 2.45 0.00 0.00 2.18
7428 8125 2.097110 TGTGACACCCCAGACTTAGT 57.903 50.000 2.45 0.00 0.00 2.24
7429 8126 1.691976 TGTGACACCCCAGACTTAGTG 59.308 52.381 2.45 0.00 36.30 2.74
7430 8127 1.692519 GTGACACCCCAGACTTAGTGT 59.307 52.381 0.00 2.36 45.72 3.55
7431 8128 2.104281 GTGACACCCCAGACTTAGTGTT 59.896 50.000 0.00 0.00 43.22 3.32
7432 8129 2.775384 TGACACCCCAGACTTAGTGTTT 59.225 45.455 0.00 0.00 43.22 2.83
7433 8130 3.201266 TGACACCCCAGACTTAGTGTTTT 59.799 43.478 0.00 0.00 43.22 2.43
7434 8131 4.204799 GACACCCCAGACTTAGTGTTTTT 58.795 43.478 0.00 0.00 43.22 1.94
7484 8181 9.959721 GGGATATAAACTATATTTCCTGCTCAA 57.040 33.333 5.37 0.00 31.74 3.02
7492 8189 8.814038 ACTATATTTCCTGCTCAATGTCTTTT 57.186 30.769 0.00 0.00 0.00 2.27
7493 8190 8.897752 ACTATATTTCCTGCTCAATGTCTTTTC 58.102 33.333 0.00 0.00 0.00 2.29
7496 8193 6.560253 TTTCCTGCTCAATGTCTTTTCTAC 57.440 37.500 0.00 0.00 0.00 2.59
7497 8194 4.579869 TCCTGCTCAATGTCTTTTCTACC 58.420 43.478 0.00 0.00 0.00 3.18
7499 8196 5.006386 CCTGCTCAATGTCTTTTCTACCTT 58.994 41.667 0.00 0.00 0.00 3.50
7500 8197 5.106396 CCTGCTCAATGTCTTTTCTACCTTG 60.106 44.000 0.00 0.00 0.00 3.61
7508 8209 5.057149 TGTCTTTTCTACCTTGTTCTCTGC 58.943 41.667 0.00 0.00 0.00 4.26
7539 8240 1.228552 GGCTTGCAGGACCCAAAGA 60.229 57.895 0.00 0.00 0.00 2.52
7541 8242 0.538287 GCTTGCAGGACCCAAAGAGT 60.538 55.000 0.00 0.00 0.00 3.24
7554 8260 1.688197 CAAAGAGTGGCAATTGGTGGT 59.312 47.619 7.72 0.00 0.00 4.16
7580 8286 2.307686 AGTGGGAACGAATAATGTGGGT 59.692 45.455 0.00 0.00 0.00 4.51
7594 8300 3.113191 TGTGGGTTATTGGCCATCATT 57.887 42.857 6.09 0.00 0.00 2.57
7595 8301 2.765135 TGTGGGTTATTGGCCATCATTG 59.235 45.455 6.09 0.00 0.00 2.82
7622 8328 3.706086 TCTCATACTTGGCTGATAGTGCA 59.294 43.478 0.00 0.00 0.00 4.57
7652 8358 0.182775 AATGGGGCGGTGAGGTATTC 59.817 55.000 0.00 0.00 0.00 1.75
7763 8470 4.553330 ACAAGTGGTAGATTCGTCCAAT 57.447 40.909 4.84 1.96 32.82 3.16
7788 8495 3.118075 TCTCAAACCACCAAGTGATGTGA 60.118 43.478 0.00 0.00 35.23 3.58
7791 8498 3.576078 AACCACCAAGTGATGTGAAGA 57.424 42.857 0.00 0.00 35.23 2.87
7792 8499 2.851195 ACCACCAAGTGATGTGAAGAC 58.149 47.619 0.00 0.00 35.23 3.01
7805 8512 6.980978 GTGATGTGAAGACTATAGCTAAGCAA 59.019 38.462 0.00 0.00 0.00 3.91
7806 8513 6.980978 TGATGTGAAGACTATAGCTAAGCAAC 59.019 38.462 0.00 0.00 0.00 4.17
7824 8531 4.985413 GCAACAGAACTGCTATAATGCAA 58.015 39.130 0.00 0.00 42.83 4.08
7907 8614 3.962718 CCAATTGCCCATGAAGATTACCT 59.037 43.478 0.00 0.00 0.00 3.08
7947 8654 2.831685 TATGCATTACTAGTGGCCCG 57.168 50.000 3.54 0.00 0.00 6.13
7951 8658 2.299013 TGCATTACTAGTGGCCCGATAG 59.701 50.000 5.39 2.02 0.00 2.08
7973 8680 9.193806 GATAGGTATTATTGGGGTCGATACTAA 57.806 37.037 0.00 0.00 0.00 2.24
7976 8683 7.456902 AGGTATTATTGGGGTCGATACTAATGT 59.543 37.037 9.93 3.69 0.00 2.71
8000 8707 7.764901 TGTAATAATAAGTGTTGCCACGTATGA 59.235 33.333 0.00 0.00 42.84 2.15
8002 8709 2.248280 AAGTGTTGCCACGTATGACA 57.752 45.000 0.00 0.00 46.56 3.58
8010 8717 5.182190 TGTTGCCACGTATGACATTGTAATT 59.818 36.000 0.00 0.00 0.00 1.40
8020 8728 8.443160 CGTATGACATTGTAATTCTCAAGTGTT 58.557 33.333 0.00 0.00 0.00 3.32
8021 8729 9.546909 GTATGACATTGTAATTCTCAAGTGTTG 57.453 33.333 0.00 0.00 0.00 3.33
8022 8730 7.566760 TGACATTGTAATTCTCAAGTGTTGT 57.433 32.000 0.00 2.66 0.00 3.32
8023 8731 7.416817 TGACATTGTAATTCTCAAGTGTTGTG 58.583 34.615 0.00 0.00 0.00 3.33
8024 8732 7.066887 TGACATTGTAATTCTCAAGTGTTGTGT 59.933 33.333 0.00 3.16 0.00 3.72
8025 8733 7.195646 ACATTGTAATTCTCAAGTGTTGTGTG 58.804 34.615 0.00 0.00 0.00 3.82
8026 8734 6.751514 TTGTAATTCTCAAGTGTTGTGTGT 57.248 33.333 0.00 0.00 0.00 3.72
8027 8735 7.851387 TTGTAATTCTCAAGTGTTGTGTGTA 57.149 32.000 0.00 0.00 0.00 2.90
8028 8736 7.241663 TGTAATTCTCAAGTGTTGTGTGTAC 57.758 36.000 0.00 0.00 0.00 2.90
8030 8738 3.786516 TCTCAAGTGTTGTGTGTACGA 57.213 42.857 0.00 0.00 0.00 3.43
8031 8739 3.702330 TCTCAAGTGTTGTGTGTACGAG 58.298 45.455 0.00 0.00 0.00 4.18
8032 8740 3.129813 TCTCAAGTGTTGTGTGTACGAGT 59.870 43.478 0.00 0.00 0.00 4.18
8033 8741 4.336153 TCTCAAGTGTTGTGTGTACGAGTA 59.664 41.667 0.00 0.00 0.00 2.59
8069 8777 2.863137 GAGAATAAGCAGTGGAAGCTCG 59.137 50.000 0.00 0.00 42.53 5.03
8071 8779 0.807667 ATAAGCAGTGGAAGCTCGCG 60.808 55.000 0.00 0.00 42.53 5.87
8083 8791 0.179073 AGCTCGCGCCAGATGTATTT 60.179 50.000 6.09 0.00 36.60 1.40
8086 8794 2.480419 GCTCGCGCCAGATGTATTTATT 59.520 45.455 6.09 0.00 0.00 1.40
8094 8802 6.559810 CGCCAGATGTATTTATTTTTCACCA 58.440 36.000 0.00 0.00 0.00 4.17
8099 8807 9.859427 CAGATGTATTTATTTTTCACCACATGT 57.141 29.630 0.00 0.00 0.00 3.21
8187 8897 1.358152 CCTTAGTTGGGTCACCCTCA 58.642 55.000 16.04 0.00 45.70 3.86
8202 8912 1.180029 CCTCAACTGATTTGCCCCTG 58.820 55.000 0.00 0.00 34.88 4.45
8273 8983 2.432628 GCCCTTCCGACACGTCTG 60.433 66.667 0.00 0.00 0.00 3.51
8286 8996 2.340078 GTCTGCGTCCAGTCAGCA 59.660 61.111 0.00 0.00 40.09 4.41
8377 9088 2.039613 CCCCACTCTTGCTCTCTCTTTT 59.960 50.000 0.00 0.00 0.00 2.27
8383 9094 2.982488 TCTTGCTCTCTCTTTTCCCCTT 59.018 45.455 0.00 0.00 0.00 3.95
8467 9178 0.324552 CCATTGCAAGGTGATGGGGA 60.325 55.000 10.60 0.00 37.31 4.81
8577 9288 0.468226 ACAACGACAAGGGAAGCTCA 59.532 50.000 0.00 0.00 0.00 4.26
8812 9526 4.338964 TGCAGCATTCTTTCTTTCAGTTCA 59.661 37.500 0.00 0.00 0.00 3.18
8839 9553 5.071788 TGGAGACCACTGTTCTATTTTCTGT 59.928 40.000 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
15 16 4.778415 CCACACCCGAGCTCGACG 62.778 72.222 36.59 26.31 43.02 5.12
16 17 3.343788 CTCCACACCCGAGCTCGAC 62.344 68.421 36.59 0.00 43.02 4.20
17 18 3.062466 CTCCACACCCGAGCTCGA 61.062 66.667 36.59 14.34 43.02 4.04
18 19 4.135153 CCTCCACACCCGAGCTCG 62.135 72.222 29.06 29.06 39.44 5.03
19 20 2.997897 ACCTCCACACCCGAGCTC 60.998 66.667 2.73 2.73 0.00 4.09
20 21 3.314331 CACCTCCACACCCGAGCT 61.314 66.667 0.00 0.00 0.00 4.09
21 22 2.185310 AATCACCTCCACACCCGAGC 62.185 60.000 0.00 0.00 0.00 5.03
22 23 0.108138 GAATCACCTCCACACCCGAG 60.108 60.000 0.00 0.00 0.00 4.63
23 24 1.884075 CGAATCACCTCCACACCCGA 61.884 60.000 0.00 0.00 0.00 5.14
24 25 1.447838 CGAATCACCTCCACACCCG 60.448 63.158 0.00 0.00 0.00 5.28
25 26 1.745489 GCGAATCACCTCCACACCC 60.745 63.158 0.00 0.00 0.00 4.61
26 27 1.745489 GGCGAATCACCTCCACACC 60.745 63.158 0.00 0.00 0.00 4.16
27 28 0.392998 ATGGCGAATCACCTCCACAC 60.393 55.000 0.00 0.00 0.00 3.82
28 29 0.327924 AATGGCGAATCACCTCCACA 59.672 50.000 0.00 0.00 0.00 4.17
29 30 1.017387 GAATGGCGAATCACCTCCAC 58.983 55.000 0.00 0.00 0.00 4.02
30 31 0.911769 AGAATGGCGAATCACCTCCA 59.088 50.000 0.00 0.00 0.00 3.86
31 32 2.044123 AAGAATGGCGAATCACCTCC 57.956 50.000 0.00 0.00 0.00 4.30
32 33 3.691609 AGAAAAGAATGGCGAATCACCTC 59.308 43.478 0.00 0.00 0.00 3.85
33 34 3.690460 AGAAAAGAATGGCGAATCACCT 58.310 40.909 0.00 0.00 0.00 4.00
34 35 4.415735 GAAGAAAAGAATGGCGAATCACC 58.584 43.478 0.00 0.00 0.00 4.02
35 36 4.091424 CGAAGAAAAGAATGGCGAATCAC 58.909 43.478 0.00 0.00 0.00 3.06
36 37 3.126858 CCGAAGAAAAGAATGGCGAATCA 59.873 43.478 0.00 0.00 0.00 2.57
37 38 3.127030 ACCGAAGAAAAGAATGGCGAATC 59.873 43.478 0.00 0.00 0.00 2.52
38 39 3.081804 ACCGAAGAAAAGAATGGCGAAT 58.918 40.909 0.00 0.00 0.00 3.34
39 40 2.225491 CACCGAAGAAAAGAATGGCGAA 59.775 45.455 0.00 0.00 0.00 4.70
40 41 1.804151 CACCGAAGAAAAGAATGGCGA 59.196 47.619 0.00 0.00 0.00 5.54
41 42 1.135689 CCACCGAAGAAAAGAATGGCG 60.136 52.381 0.00 0.00 0.00 5.69
42 43 1.402852 GCCACCGAAGAAAAGAATGGC 60.403 52.381 0.00 0.00 43.89 4.40
43 44 2.162681 AGCCACCGAAGAAAAGAATGG 58.837 47.619 0.00 0.00 0.00 3.16
44 45 4.003648 AGTAGCCACCGAAGAAAAGAATG 58.996 43.478 0.00 0.00 0.00 2.67
45 46 4.003648 CAGTAGCCACCGAAGAAAAGAAT 58.996 43.478 0.00 0.00 0.00 2.40
46 47 3.070446 TCAGTAGCCACCGAAGAAAAGAA 59.930 43.478 0.00 0.00 0.00 2.52
47 48 2.631062 TCAGTAGCCACCGAAGAAAAGA 59.369 45.455 0.00 0.00 0.00 2.52
48 49 2.996621 CTCAGTAGCCACCGAAGAAAAG 59.003 50.000 0.00 0.00 0.00 2.27
49 50 2.289444 CCTCAGTAGCCACCGAAGAAAA 60.289 50.000 0.00 0.00 0.00 2.29
50 51 1.275291 CCTCAGTAGCCACCGAAGAAA 59.725 52.381 0.00 0.00 0.00 2.52
51 52 0.895530 CCTCAGTAGCCACCGAAGAA 59.104 55.000 0.00 0.00 0.00 2.52
52 53 0.251653 ACCTCAGTAGCCACCGAAGA 60.252 55.000 0.00 0.00 0.00 2.87
53 54 0.108615 CACCTCAGTAGCCACCGAAG 60.109 60.000 0.00 0.00 0.00 3.79
54 55 1.541310 CCACCTCAGTAGCCACCGAA 61.541 60.000 0.00 0.00 0.00 4.30
55 56 1.982395 CCACCTCAGTAGCCACCGA 60.982 63.158 0.00 0.00 0.00 4.69
56 57 2.283529 ACCACCTCAGTAGCCACCG 61.284 63.158 0.00 0.00 0.00 4.94
57 58 1.296715 CACCACCTCAGTAGCCACC 59.703 63.158 0.00 0.00 0.00 4.61
58 59 1.376037 GCACCACCTCAGTAGCCAC 60.376 63.158 0.00 0.00 0.00 5.01
59 60 2.592993 GGCACCACCTCAGTAGCCA 61.593 63.158 0.00 0.00 37.48 4.75
60 61 2.269241 GGCACCACCTCAGTAGCC 59.731 66.667 0.00 0.00 34.51 3.93
61 62 2.125512 CGGCACCACCTCAGTAGC 60.126 66.667 0.00 0.00 35.61 3.58
62 63 0.108615 CTTCGGCACCACCTCAGTAG 60.109 60.000 0.00 0.00 35.61 2.57
63 64 1.541310 CCTTCGGCACCACCTCAGTA 61.541 60.000 0.00 0.00 35.61 2.74
64 65 2.743718 CTTCGGCACCACCTCAGT 59.256 61.111 0.00 0.00 35.61 3.41
65 66 2.046892 CCTTCGGCACCACCTCAG 60.047 66.667 0.00 0.00 35.61 3.35
76 77 3.691342 TCCGTCACCTGCCTTCGG 61.691 66.667 0.00 0.00 42.12 4.30
77 78 2.432628 GTCCGTCACCTGCCTTCG 60.433 66.667 0.00 0.00 0.00 3.79
78 79 2.432628 CGTCCGTCACCTGCCTTC 60.433 66.667 0.00 0.00 0.00 3.46
79 80 2.803817 AACGTCCGTCACCTGCCTT 61.804 57.895 0.00 0.00 0.00 4.35
80 81 3.231736 AACGTCCGTCACCTGCCT 61.232 61.111 0.00 0.00 0.00 4.75
81 82 3.041940 CAACGTCCGTCACCTGCC 61.042 66.667 0.00 0.00 0.00 4.85
82 83 3.041940 CCAACGTCCGTCACCTGC 61.042 66.667 0.00 0.00 0.00 4.85
83 84 1.954146 CACCAACGTCCGTCACCTG 60.954 63.158 0.00 0.00 0.00 4.00
84 85 2.359570 GACACCAACGTCCGTCACCT 62.360 60.000 0.00 0.00 0.00 4.00
85 86 1.952635 GACACCAACGTCCGTCACC 60.953 63.158 0.00 0.00 0.00 4.02
86 87 0.806884 TTGACACCAACGTCCGTCAC 60.807 55.000 8.31 0.00 38.07 3.67
87 88 0.528901 CTTGACACCAACGTCCGTCA 60.529 55.000 0.00 0.00 36.63 4.35
88 89 1.828331 GCTTGACACCAACGTCCGTC 61.828 60.000 0.00 0.00 34.88 4.79
89 90 1.885850 GCTTGACACCAACGTCCGT 60.886 57.895 0.00 0.00 34.88 4.69
90 91 1.557443 GAGCTTGACACCAACGTCCG 61.557 60.000 0.00 0.00 34.88 4.79
91 92