Multiple sequence alignment - TraesCS5B01G564700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G564700 chr5B 100.000 4335 0 0 1 4335 710079508 710075174 0.000000e+00 8006.0
1 TraesCS5B01G564700 chr5B 82.855 1429 176 36 2095 3479 709916615 709918018 0.000000e+00 1218.0
2 TraesCS5B01G564700 chr5B 89.817 491 50 0 1475 1965 709915935 709916425 7.910000e-177 630.0
3 TraesCS5B01G564700 chr5B 88.108 185 16 4 3499 3681 709918076 709918256 9.440000e-52 215.0
4 TraesCS5B01G564700 chr5B 76.744 215 41 7 1752 1963 448314172 448314380 1.270000e-20 111.0
5 TraesCS5B01G564700 chr4B 95.260 443 18 1 3773 4212 85798797 85798355 0.000000e+00 699.0
6 TraesCS5B01G564700 chr4B 95.045 444 17 2 3773 4213 273428537 273428096 0.000000e+00 693.0
7 TraesCS5B01G564700 chr4A 89.808 520 49 2 1450 1965 605542768 605542249 0.000000e+00 664.0
8 TraesCS5B01G564700 chr4A 86.874 579 47 15 1388 1965 605425092 605424542 4.760000e-174 621.0
9 TraesCS5B01G564700 chr4A 77.219 1014 147 47 2580 3542 605423903 605422923 2.310000e-142 516.0
10 TraesCS5B01G564700 chr4A 82.474 485 74 6 2067 2544 605424386 605423906 8.670000e-112 414.0
11 TraesCS5B01G564700 chr6B 93.541 449 20 5 3773 4213 28015273 28014826 0.000000e+00 660.0
12 TraesCS5B01G564700 chr2D 93.065 447 26 2 3772 4213 95951888 95952334 0.000000e+00 649.0
13 TraesCS5B01G564700 chr2D 92.699 452 27 4 3770 4217 488464472 488464921 0.000000e+00 647.0
14 TraesCS5B01G564700 chr7D 93.034 445 27 2 3773 4213 126465658 126465214 0.000000e+00 647.0
15 TraesCS5B01G564700 chr7D 79.861 144 18 6 10 143 311862531 311862389 1.280000e-15 95.3
16 TraesCS5B01G564700 chr4D 92.825 446 28 2 3772 4213 398727922 398728367 1.020000e-180 643.0
17 TraesCS5B01G564700 chr3D 92.793 444 28 2 3773 4213 424697771 424698213 1.310000e-179 640.0
18 TraesCS5B01G564700 chr5D 92.257 452 31 2 3772 4219 95536760 95537211 4.730000e-179 638.0
19 TraesCS5B01G564700 chr5D 88.201 517 56 1 1449 1965 556925681 556925170 2.870000e-171 612.0
20 TraesCS5B01G564700 chr5D 83.224 459 58 9 2102 2553 556924972 556924526 1.880000e-108 403.0
21 TraesCS5B01G564700 chr5D 87.786 262 29 2 3088 3349 556923907 556923649 1.960000e-78 303.0
22 TraesCS5B01G564700 chr5D 87.624 202 25 0 3097 3298 556914393 556914192 7.250000e-58 235.0
23 TraesCS5B01G564700 chr5D 76.744 215 41 7 1752 1963 375585807 375586015 1.270000e-20 111.0
24 TraesCS5B01G564700 chr5D 82.645 121 17 4 3168 3286 559680053 559679935 2.130000e-18 104.0
25 TraesCS5B01G564700 chr5D 100.000 34 0 0 4216 4249 556923062 556923029 3.620000e-06 63.9
26 TraesCS5B01G564700 chr6A 80.761 447 70 7 1473 1903 611309484 611309038 6.950000e-88 335.0
27 TraesCS5B01G564700 chr5A 76.279 215 42 7 1752 1963 476767731 476767939 5.930000e-19 106.0
28 TraesCS5B01G564700 chr5A 97.143 35 0 1 46 80 706250194 706250161 1.680000e-04 58.4
29 TraesCS5B01G564700 chr7A 87.059 85 10 1 10 94 375898953 375899036 1.280000e-15 95.3
30 TraesCS5B01G564700 chr7B 83.133 83 14 0 3169 3251 720117911 720117829 4.650000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G564700 chr5B 710075174 710079508 4334 True 8006.000000 8006 100.000000 1 4335 1 chr5B.!!$R1 4334
1 TraesCS5B01G564700 chr5B 709915935 709918256 2321 False 687.666667 1218 86.926667 1475 3681 3 chr5B.!!$F2 2206
2 TraesCS5B01G564700 chr4A 605542249 605542768 519 True 664.000000 664 89.808000 1450 1965 1 chr4A.!!$R1 515
3 TraesCS5B01G564700 chr4A 605422923 605425092 2169 True 517.000000 621 82.189000 1388 3542 3 chr4A.!!$R2 2154
4 TraesCS5B01G564700 chr5D 556923029 556925681 2652 True 345.475000 612 89.802750 1449 4249 4 chr5D.!!$R3 2800


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
130 131 0.034896 ACGGATTTGTCAAGCTCGGT 59.965 50.0 0.00 6.56 0.00 4.69 F
738 739 0.035056 CATTCTTTGGGAGCCTCCGT 60.035 55.0 4.29 0.00 37.43 4.69 F
1187 1188 0.037326 TTCTCATCTCCCGTGTGTGC 60.037 55.0 0.00 0.00 0.00 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1168 1169 0.037326 GCACACACGGGAGATGAGAA 60.037 55.0 0.00 0.0 0.00 2.87 R
2710 2837 0.106015 GCTGGGGGCTACCATCATTT 60.106 55.0 2.09 0.0 42.91 2.32 R
3923 4290 0.035534 CCGACCATCAATCACCACCA 60.036 55.0 0.00 0.0 0.00 4.17 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 4.475051 TTGGATTGCATGGATTTGAAGG 57.525 40.909 0.00 0.00 0.00 3.46
22 23 3.443052 TGGATTGCATGGATTTGAAGGT 58.557 40.909 0.00 0.00 0.00 3.50
23 24 3.839490 TGGATTGCATGGATTTGAAGGTT 59.161 39.130 0.00 0.00 0.00 3.50
24 25 4.286549 TGGATTGCATGGATTTGAAGGTTT 59.713 37.500 0.00 0.00 0.00 3.27
25 26 4.632688 GGATTGCATGGATTTGAAGGTTTG 59.367 41.667 0.00 0.00 0.00 2.93
26 27 3.681593 TGCATGGATTTGAAGGTTTGG 57.318 42.857 0.00 0.00 0.00 3.28
27 28 3.237746 TGCATGGATTTGAAGGTTTGGA 58.762 40.909 0.00 0.00 0.00 3.53
28 29 3.839490 TGCATGGATTTGAAGGTTTGGAT 59.161 39.130 0.00 0.00 0.00 3.41
29 30 4.186159 GCATGGATTTGAAGGTTTGGATG 58.814 43.478 0.00 0.00 0.00 3.51
30 31 4.322953 GCATGGATTTGAAGGTTTGGATGT 60.323 41.667 0.00 0.00 0.00 3.06
31 32 4.870123 TGGATTTGAAGGTTTGGATGTG 57.130 40.909 0.00 0.00 0.00 3.21
32 33 4.478203 TGGATTTGAAGGTTTGGATGTGA 58.522 39.130 0.00 0.00 0.00 3.58
33 34 4.523943 TGGATTTGAAGGTTTGGATGTGAG 59.476 41.667 0.00 0.00 0.00 3.51
34 35 4.082026 GGATTTGAAGGTTTGGATGTGAGG 60.082 45.833 0.00 0.00 0.00 3.86
35 36 3.874383 TTGAAGGTTTGGATGTGAGGA 57.126 42.857 0.00 0.00 0.00 3.71
36 37 3.423539 TGAAGGTTTGGATGTGAGGAG 57.576 47.619 0.00 0.00 0.00 3.69
37 38 2.711009 TGAAGGTTTGGATGTGAGGAGT 59.289 45.455 0.00 0.00 0.00 3.85
38 39 2.867109 AGGTTTGGATGTGAGGAGTG 57.133 50.000 0.00 0.00 0.00 3.51
39 40 1.168714 GGTTTGGATGTGAGGAGTGC 58.831 55.000 0.00 0.00 0.00 4.40
40 41 0.798776 GTTTGGATGTGAGGAGTGCG 59.201 55.000 0.00 0.00 0.00 5.34
41 42 0.321564 TTTGGATGTGAGGAGTGCGG 60.322 55.000 0.00 0.00 0.00 5.69
42 43 1.480212 TTGGATGTGAGGAGTGCGGT 61.480 55.000 0.00 0.00 0.00 5.68
43 44 1.296715 GGATGTGAGGAGTGCGGTT 59.703 57.895 0.00 0.00 0.00 4.44
44 45 0.535335 GGATGTGAGGAGTGCGGTTA 59.465 55.000 0.00 0.00 0.00 2.85
45 46 1.139058 GGATGTGAGGAGTGCGGTTAT 59.861 52.381 0.00 0.00 0.00 1.89
46 47 2.474816 GATGTGAGGAGTGCGGTTATC 58.525 52.381 0.00 0.00 0.00 1.75
47 48 0.535335 TGTGAGGAGTGCGGTTATCC 59.465 55.000 0.00 0.00 0.00 2.59
64 65 0.758734 TCCGGCAAGGACATATGAGG 59.241 55.000 10.38 0.14 45.98 3.86
65 66 0.250467 CCGGCAAGGACATATGAGGG 60.250 60.000 10.38 0.00 45.00 4.30
66 67 0.250467 CGGCAAGGACATATGAGGGG 60.250 60.000 10.38 0.00 0.00 4.79
67 68 0.538287 GGCAAGGACATATGAGGGGC 60.538 60.000 10.38 6.19 0.00 5.80
68 69 0.538287 GCAAGGACATATGAGGGGCC 60.538 60.000 10.38 0.00 0.00 5.80
69 70 0.250467 CAAGGACATATGAGGGGCCG 60.250 60.000 10.38 0.00 0.00 6.13
70 71 0.694444 AAGGACATATGAGGGGCCGT 60.694 55.000 10.38 0.00 0.00 5.68
71 72 1.122019 AGGACATATGAGGGGCCGTC 61.122 60.000 19.10 19.10 0.00 4.79
72 73 1.371558 GACATATGAGGGGCCGTCC 59.628 63.158 22.54 6.28 0.00 4.79
73 74 2.343758 CATATGAGGGGCCGTCCG 59.656 66.667 22.54 5.81 36.01 4.79
74 75 2.923035 ATATGAGGGGCCGTCCGG 60.923 66.667 22.54 0.24 36.01 5.14
94 95 4.436998 CTGTCTGGGGTCGCGTCC 62.437 72.222 14.35 14.35 0.00 4.79
97 98 4.720902 TCTGGGGTCGCGTCCGTA 62.721 66.667 16.09 6.66 35.54 4.02
98 99 4.189188 CTGGGGTCGCGTCCGTAG 62.189 72.222 16.09 12.30 35.54 3.51
99 100 4.720902 TGGGGTCGCGTCCGTAGA 62.721 66.667 16.09 0.00 35.54 2.59
100 101 4.185059 GGGGTCGCGTCCGTAGAC 62.185 72.222 16.09 1.80 39.83 2.59
110 111 2.268730 GTCCGTAGACGTTTAGTGGG 57.731 55.000 0.85 0.00 37.74 4.61
111 112 1.812571 GTCCGTAGACGTTTAGTGGGA 59.187 52.381 0.85 0.00 37.74 4.37
112 113 1.812571 TCCGTAGACGTTTAGTGGGAC 59.187 52.381 0.85 0.00 37.74 4.46
113 114 1.466360 CCGTAGACGTTTAGTGGGACG 60.466 57.143 0.85 0.00 44.34 4.79
114 115 1.466360 CGTAGACGTTTAGTGGGACGG 60.466 57.143 0.00 0.00 43.16 4.79
115 116 1.812571 GTAGACGTTTAGTGGGACGGA 59.187 52.381 0.00 0.00 43.16 4.69
116 117 1.553706 AGACGTTTAGTGGGACGGAT 58.446 50.000 0.00 0.00 43.16 4.18
117 118 1.897802 AGACGTTTAGTGGGACGGATT 59.102 47.619 0.00 0.00 43.16 3.01
118 119 2.301009 AGACGTTTAGTGGGACGGATTT 59.699 45.455 0.00 0.00 43.16 2.17
119 120 2.414138 GACGTTTAGTGGGACGGATTTG 59.586 50.000 0.00 0.00 43.16 2.32
120 121 2.224354 ACGTTTAGTGGGACGGATTTGT 60.224 45.455 0.90 0.00 43.16 2.83
121 122 2.414138 CGTTTAGTGGGACGGATTTGTC 59.586 50.000 0.00 0.00 38.17 3.18
122 123 3.404899 GTTTAGTGGGACGGATTTGTCA 58.595 45.455 0.00 0.00 40.72 3.58
123 124 3.773418 TTAGTGGGACGGATTTGTCAA 57.227 42.857 0.00 0.00 40.72 3.18
124 125 2.185004 AGTGGGACGGATTTGTCAAG 57.815 50.000 0.00 0.00 40.72 3.02
125 126 0.521735 GTGGGACGGATTTGTCAAGC 59.478 55.000 0.00 0.00 40.72 4.01
126 127 0.400213 TGGGACGGATTTGTCAAGCT 59.600 50.000 0.00 0.00 40.72 3.74
127 128 1.087501 GGGACGGATTTGTCAAGCTC 58.912 55.000 0.00 0.00 40.72 4.09
128 129 0.721718 GGACGGATTTGTCAAGCTCG 59.278 55.000 0.00 0.00 40.72 5.03
129 130 0.721718 GACGGATTTGTCAAGCTCGG 59.278 55.000 0.00 6.09 38.75 4.63
130 131 0.034896 ACGGATTTGTCAAGCTCGGT 59.965 50.000 0.00 6.56 0.00 4.69
131 132 1.156736 CGGATTTGTCAAGCTCGGTT 58.843 50.000 0.00 0.00 0.00 4.44
132 133 1.135972 CGGATTTGTCAAGCTCGGTTG 60.136 52.381 2.60 2.60 0.00 3.77
133 134 1.880027 GGATTTGTCAAGCTCGGTTGT 59.120 47.619 8.49 0.00 0.00 3.32
134 135 3.071479 GGATTTGTCAAGCTCGGTTGTA 58.929 45.455 8.49 0.00 0.00 2.41
135 136 3.125316 GGATTTGTCAAGCTCGGTTGTAG 59.875 47.826 8.49 0.00 0.00 2.74
136 137 3.462483 TTTGTCAAGCTCGGTTGTAGA 57.538 42.857 8.49 0.00 0.00 2.59
137 138 3.678056 TTGTCAAGCTCGGTTGTAGAT 57.322 42.857 8.49 0.00 0.00 1.98
138 139 2.959516 TGTCAAGCTCGGTTGTAGATG 58.040 47.619 8.49 0.00 0.00 2.90
139 140 1.661112 GTCAAGCTCGGTTGTAGATGC 59.339 52.381 8.49 0.00 0.00 3.91
140 141 1.550524 TCAAGCTCGGTTGTAGATGCT 59.449 47.619 8.49 0.00 0.00 3.79
141 142 1.929836 CAAGCTCGGTTGTAGATGCTC 59.070 52.381 0.92 0.00 0.00 4.26
142 143 1.479709 AGCTCGGTTGTAGATGCTCT 58.520 50.000 0.00 0.00 0.00 4.09
143 144 1.827969 AGCTCGGTTGTAGATGCTCTT 59.172 47.619 0.00 0.00 0.00 2.85
144 145 3.024547 AGCTCGGTTGTAGATGCTCTTA 58.975 45.455 0.00 0.00 0.00 2.10
145 146 3.067461 AGCTCGGTTGTAGATGCTCTTAG 59.933 47.826 0.00 0.00 0.00 2.18
146 147 3.797184 GCTCGGTTGTAGATGCTCTTAGG 60.797 52.174 0.00 0.00 0.00 2.69
147 148 2.100916 TCGGTTGTAGATGCTCTTAGGC 59.899 50.000 0.00 0.00 0.00 3.93
148 149 2.159099 CGGTTGTAGATGCTCTTAGGCA 60.159 50.000 0.00 0.00 46.63 4.75
149 150 3.678806 CGGTTGTAGATGCTCTTAGGCAA 60.679 47.826 0.04 0.00 45.68 4.52
150 151 3.623510 GGTTGTAGATGCTCTTAGGCAAC 59.376 47.826 0.04 0.00 45.68 4.17
151 152 3.543680 TGTAGATGCTCTTAGGCAACC 57.456 47.619 0.04 0.00 45.68 3.77
152 153 2.837591 TGTAGATGCTCTTAGGCAACCA 59.162 45.455 0.04 0.00 45.68 3.67
153 154 2.706339 AGATGCTCTTAGGCAACCAG 57.294 50.000 0.04 0.00 45.68 4.00
154 155 2.191400 AGATGCTCTTAGGCAACCAGA 58.809 47.619 0.04 0.00 45.68 3.86
155 156 2.776536 AGATGCTCTTAGGCAACCAGAT 59.223 45.455 0.04 0.00 45.68 2.90
156 157 3.969976 AGATGCTCTTAGGCAACCAGATA 59.030 43.478 0.04 0.00 45.68 1.98
157 158 4.596643 AGATGCTCTTAGGCAACCAGATAT 59.403 41.667 0.04 0.00 45.68 1.63
158 159 4.077300 TGCTCTTAGGCAACCAGATATG 57.923 45.455 0.00 0.00 39.43 1.78
159 160 3.711190 TGCTCTTAGGCAACCAGATATGA 59.289 43.478 0.00 0.00 39.43 2.15
160 161 4.164030 TGCTCTTAGGCAACCAGATATGAA 59.836 41.667 0.00 0.00 39.43 2.57
161 162 5.126067 GCTCTTAGGCAACCAGATATGAAA 58.874 41.667 0.00 0.00 37.17 2.69
162 163 5.590259 GCTCTTAGGCAACCAGATATGAAAA 59.410 40.000 0.00 0.00 37.17 2.29
163 164 6.458888 GCTCTTAGGCAACCAGATATGAAAAC 60.459 42.308 0.00 0.00 37.17 2.43
164 165 5.885912 TCTTAGGCAACCAGATATGAAAACC 59.114 40.000 0.00 0.00 37.17 3.27
165 166 3.016736 AGGCAACCAGATATGAAAACCG 58.983 45.455 0.00 0.00 37.17 4.44
166 167 3.013921 GGCAACCAGATATGAAAACCGA 58.986 45.455 0.00 0.00 0.00 4.69
167 168 3.442273 GGCAACCAGATATGAAAACCGAA 59.558 43.478 0.00 0.00 0.00 4.30
168 169 4.412207 GCAACCAGATATGAAAACCGAAC 58.588 43.478 0.00 0.00 0.00 3.95
169 170 4.156008 GCAACCAGATATGAAAACCGAACT 59.844 41.667 0.00 0.00 0.00 3.01
170 171 5.335661 GCAACCAGATATGAAAACCGAACTT 60.336 40.000 0.00 0.00 0.00 2.66
171 172 6.314784 CAACCAGATATGAAAACCGAACTTC 58.685 40.000 0.00 0.00 0.00 3.01
172 173 4.630069 ACCAGATATGAAAACCGAACTTCG 59.370 41.667 4.07 4.07 40.07 3.79
173 174 4.494199 CCAGATATGAAAACCGAACTTCGC 60.494 45.833 5.61 0.00 38.82 4.70
174 175 3.621715 AGATATGAAAACCGAACTTCGCC 59.378 43.478 5.61 0.00 38.82 5.54
175 176 0.879090 ATGAAAACCGAACTTCGCCC 59.121 50.000 5.61 0.00 38.82 6.13
176 177 1.205820 GAAAACCGAACTTCGCCCG 59.794 57.895 5.61 0.00 38.82 6.13
177 178 1.223417 GAAAACCGAACTTCGCCCGA 61.223 55.000 5.61 0.00 38.82 5.14
178 179 0.814812 AAAACCGAACTTCGCCCGAA 60.815 50.000 5.61 2.92 38.82 4.30
179 180 0.814812 AAACCGAACTTCGCCCGAAA 60.815 50.000 5.61 0.00 38.82 3.46
180 181 1.501337 AACCGAACTTCGCCCGAAAC 61.501 55.000 5.61 0.00 38.82 2.78
181 182 2.674084 CCGAACTTCGCCCGAAACC 61.674 63.158 5.61 0.00 38.82 3.27
182 183 2.674084 CGAACTTCGCCCGAAACCC 61.674 63.158 4.58 0.00 33.34 4.11
183 184 1.598685 GAACTTCGCCCGAAACCCA 60.599 57.895 4.58 0.00 33.34 4.51
184 185 1.152922 AACTTCGCCCGAAACCCAA 60.153 52.632 4.58 0.00 33.34 4.12
185 186 0.752376 AACTTCGCCCGAAACCCAAA 60.752 50.000 4.58 0.00 33.34 3.28
186 187 1.284715 CTTCGCCCGAAACCCAAAC 59.715 57.895 4.58 0.00 33.34 2.93
187 188 1.448922 CTTCGCCCGAAACCCAAACA 61.449 55.000 4.58 0.00 33.34 2.83
188 189 1.448922 TTCGCCCGAAACCCAAACAG 61.449 55.000 0.00 0.00 0.00 3.16
189 190 2.190841 CGCCCGAAACCCAAACAGT 61.191 57.895 0.00 0.00 0.00 3.55
190 191 0.885596 CGCCCGAAACCCAAACAGTA 60.886 55.000 0.00 0.00 0.00 2.74
191 192 0.879090 GCCCGAAACCCAAACAGTAG 59.121 55.000 0.00 0.00 0.00 2.57
192 193 1.543871 GCCCGAAACCCAAACAGTAGA 60.544 52.381 0.00 0.00 0.00 2.59
193 194 2.853705 CCCGAAACCCAAACAGTAGAA 58.146 47.619 0.00 0.00 0.00 2.10
194 195 3.215975 CCCGAAACCCAAACAGTAGAAA 58.784 45.455 0.00 0.00 0.00 2.52
195 196 3.633065 CCCGAAACCCAAACAGTAGAAAA 59.367 43.478 0.00 0.00 0.00 2.29
196 197 4.098196 CCCGAAACCCAAACAGTAGAAAAA 59.902 41.667 0.00 0.00 0.00 1.94
216 217 4.830826 AAACAAGAACCGAATCTGAACC 57.169 40.909 0.00 0.00 0.00 3.62
217 218 3.485463 ACAAGAACCGAATCTGAACCA 57.515 42.857 0.00 0.00 0.00 3.67
218 219 3.403038 ACAAGAACCGAATCTGAACCAG 58.597 45.455 0.00 0.00 0.00 4.00
219 220 3.071023 ACAAGAACCGAATCTGAACCAGA 59.929 43.478 0.00 0.00 44.99 3.86
220 221 4.065088 CAAGAACCGAATCTGAACCAGAA 58.935 43.478 0.43 0.00 44.04 3.02
221 222 4.351874 AGAACCGAATCTGAACCAGAAA 57.648 40.909 0.43 0.00 44.04 2.52
222 223 4.714632 AGAACCGAATCTGAACCAGAAAA 58.285 39.130 0.43 0.00 44.04 2.29
223 224 4.515567 AGAACCGAATCTGAACCAGAAAAC 59.484 41.667 0.43 0.00 44.04 2.43
224 225 3.146847 ACCGAATCTGAACCAGAAAACC 58.853 45.455 0.43 0.00 44.04 3.27
225 226 2.159627 CCGAATCTGAACCAGAAAACCG 59.840 50.000 0.43 3.16 44.04 4.44
226 227 3.064207 CGAATCTGAACCAGAAAACCGA 58.936 45.455 0.43 0.00 44.04 4.69
227 228 3.496884 CGAATCTGAACCAGAAAACCGAA 59.503 43.478 0.43 0.00 44.04 4.30
228 229 4.610680 CGAATCTGAACCAGAAAACCGAAC 60.611 45.833 0.43 0.00 44.04 3.95
229 230 3.553828 TCTGAACCAGAAAACCGAACT 57.446 42.857 0.00 0.00 37.57 3.01
230 231 4.675976 TCTGAACCAGAAAACCGAACTA 57.324 40.909 0.00 0.00 37.57 2.24
231 232 4.374399 TCTGAACCAGAAAACCGAACTAC 58.626 43.478 0.00 0.00 37.57 2.73
232 233 3.469739 TGAACCAGAAAACCGAACTACC 58.530 45.455 0.00 0.00 0.00 3.18
233 234 2.556144 ACCAGAAAACCGAACTACCC 57.444 50.000 0.00 0.00 0.00 3.69
234 235 1.270465 ACCAGAAAACCGAACTACCCG 60.270 52.381 0.00 0.00 0.00 5.28
235 236 1.001181 CCAGAAAACCGAACTACCCGA 59.999 52.381 0.00 0.00 0.00 5.14
236 237 2.064014 CAGAAAACCGAACTACCCGAC 58.936 52.381 0.00 0.00 0.00 4.79
237 238 1.688197 AGAAAACCGAACTACCCGACA 59.312 47.619 0.00 0.00 0.00 4.35
238 239 2.301009 AGAAAACCGAACTACCCGACAT 59.699 45.455 0.00 0.00 0.00 3.06
239 240 2.845363 AAACCGAACTACCCGACATT 57.155 45.000 0.00 0.00 0.00 2.71
240 241 2.845363 AACCGAACTACCCGACATTT 57.155 45.000 0.00 0.00 0.00 2.32
241 242 2.375173 ACCGAACTACCCGACATTTC 57.625 50.000 0.00 0.00 0.00 2.17
242 243 1.619827 ACCGAACTACCCGACATTTCA 59.380 47.619 0.00 0.00 0.00 2.69
243 244 2.268298 CCGAACTACCCGACATTTCAG 58.732 52.381 0.00 0.00 0.00 3.02
244 245 2.353406 CCGAACTACCCGACATTTCAGT 60.353 50.000 0.00 0.00 0.00 3.41
245 246 2.921754 CGAACTACCCGACATTTCAGTC 59.078 50.000 0.00 0.00 35.19 3.51
246 247 3.613193 CGAACTACCCGACATTTCAGTCA 60.613 47.826 0.00 0.00 38.43 3.41
247 248 4.504858 GAACTACCCGACATTTCAGTCAT 58.495 43.478 0.00 0.00 38.43 3.06
248 249 5.657474 GAACTACCCGACATTTCAGTCATA 58.343 41.667 0.00 0.00 38.43 2.15
249 250 5.871396 ACTACCCGACATTTCAGTCATAT 57.129 39.130 0.00 0.00 38.43 1.78
250 251 5.844004 ACTACCCGACATTTCAGTCATATC 58.156 41.667 0.00 0.00 38.43 1.63
251 252 3.717707 ACCCGACATTTCAGTCATATCG 58.282 45.455 0.00 0.00 38.43 2.92
252 253 3.059884 CCCGACATTTCAGTCATATCGG 58.940 50.000 2.83 2.83 45.59 4.18
253 254 2.476619 CCGACATTTCAGTCATATCGGC 59.523 50.000 0.00 0.00 40.93 5.54
254 255 3.384668 CGACATTTCAGTCATATCGGCT 58.615 45.455 0.00 0.00 38.43 5.52
255 256 3.426859 CGACATTTCAGTCATATCGGCTC 59.573 47.826 0.00 0.00 38.43 4.70
256 257 3.384668 ACATTTCAGTCATATCGGCTCG 58.615 45.455 0.00 0.00 0.00 5.03
257 258 2.509052 TTTCAGTCATATCGGCTCGG 57.491 50.000 0.00 0.00 0.00 4.63
258 259 0.673985 TTCAGTCATATCGGCTCGGG 59.326 55.000 0.00 0.00 0.00 5.14
259 260 0.467474 TCAGTCATATCGGCTCGGGT 60.467 55.000 0.00 0.00 0.00 5.28
260 261 0.039074 CAGTCATATCGGCTCGGGTC 60.039 60.000 0.00 0.00 0.00 4.46
261 262 0.178987 AGTCATATCGGCTCGGGTCT 60.179 55.000 0.00 0.00 0.00 3.85
262 263 0.039074 GTCATATCGGCTCGGGTCTG 60.039 60.000 0.00 0.00 0.00 3.51
263 264 1.179174 TCATATCGGCTCGGGTCTGG 61.179 60.000 0.00 0.00 0.00 3.86
264 265 1.152525 ATATCGGCTCGGGTCTGGT 60.153 57.895 0.00 0.00 0.00 4.00
265 266 0.759436 ATATCGGCTCGGGTCTGGTT 60.759 55.000 0.00 0.00 0.00 3.67
266 267 0.974010 TATCGGCTCGGGTCTGGTTT 60.974 55.000 0.00 0.00 0.00 3.27
267 268 2.521958 ATCGGCTCGGGTCTGGTTTG 62.522 60.000 0.00 0.00 0.00 2.93
268 269 2.359975 GGCTCGGGTCTGGTTTGG 60.360 66.667 0.00 0.00 0.00 3.28
269 270 2.359975 GCTCGGGTCTGGTTTGGG 60.360 66.667 0.00 0.00 0.00 4.12
270 271 3.157680 CTCGGGTCTGGTTTGGGT 58.842 61.111 0.00 0.00 0.00 4.51
271 272 1.833787 GCTCGGGTCTGGTTTGGGTA 61.834 60.000 0.00 0.00 0.00 3.69
272 273 0.909623 CTCGGGTCTGGTTTGGGTAT 59.090 55.000 0.00 0.00 0.00 2.73
273 274 0.906775 TCGGGTCTGGTTTGGGTATC 59.093 55.000 0.00 0.00 0.00 2.24
274 275 0.461339 CGGGTCTGGTTTGGGTATCG 60.461 60.000 0.00 0.00 0.00 2.92
275 276 0.107361 GGGTCTGGTTTGGGTATCGG 60.107 60.000 0.00 0.00 0.00 4.18
276 277 0.616891 GGTCTGGTTTGGGTATCGGT 59.383 55.000 0.00 0.00 0.00 4.69
277 278 1.003928 GGTCTGGTTTGGGTATCGGTT 59.996 52.381 0.00 0.00 0.00 4.44
278 279 2.553685 GGTCTGGTTTGGGTATCGGTTT 60.554 50.000 0.00 0.00 0.00 3.27
279 280 3.151554 GTCTGGTTTGGGTATCGGTTTT 58.848 45.455 0.00 0.00 0.00 2.43
280 281 3.189910 GTCTGGTTTGGGTATCGGTTTTC 59.810 47.826 0.00 0.00 0.00 2.29
281 282 2.152830 TGGTTTGGGTATCGGTTTTCG 58.847 47.619 0.00 0.00 40.90 3.46
282 283 1.469703 GGTTTGGGTATCGGTTTTCGG 59.530 52.381 0.00 0.00 39.77 4.30
283 284 1.469703 GTTTGGGTATCGGTTTTCGGG 59.530 52.381 0.00 0.00 39.77 5.14
284 285 0.982704 TTGGGTATCGGTTTTCGGGA 59.017 50.000 0.00 0.00 39.77 5.14
285 286 0.249955 TGGGTATCGGTTTTCGGGAC 59.750 55.000 0.00 0.00 39.77 4.46
286 287 0.462581 GGGTATCGGTTTTCGGGACC 60.463 60.000 0.00 0.00 40.73 4.46
287 288 0.462581 GGTATCGGTTTTCGGGACCC 60.463 60.000 0.00 0.00 37.76 4.46
300 301 2.266055 GACCCGAAGTCCAGCCTG 59.734 66.667 0.00 0.00 39.84 4.85
301 302 2.203788 ACCCGAAGTCCAGCCTGA 60.204 61.111 0.00 0.00 0.00 3.86
302 303 2.232298 GACCCGAAGTCCAGCCTGAG 62.232 65.000 0.00 0.00 39.84 3.35
303 304 2.125350 CCGAAGTCCAGCCTGAGC 60.125 66.667 0.00 0.00 40.32 4.26
304 305 2.659016 CGAAGTCCAGCCTGAGCA 59.341 61.111 0.00 0.00 43.56 4.26
305 306 1.004560 CGAAGTCCAGCCTGAGCAA 60.005 57.895 0.00 0.00 43.56 3.91
306 307 1.294659 CGAAGTCCAGCCTGAGCAAC 61.295 60.000 0.00 0.00 43.56 4.17
307 308 1.294659 GAAGTCCAGCCTGAGCAACG 61.295 60.000 0.00 0.00 43.56 4.10
308 309 1.758440 AAGTCCAGCCTGAGCAACGA 61.758 55.000 0.00 0.00 43.56 3.85
309 310 1.739562 GTCCAGCCTGAGCAACGAG 60.740 63.158 0.00 0.00 43.56 4.18
310 311 3.123620 CCAGCCTGAGCAACGAGC 61.124 66.667 0.00 0.00 43.56 5.03
324 325 3.044305 GAGCTTTGCTCGTGGCGT 61.044 61.111 3.73 0.00 45.85 5.68
325 326 1.736645 GAGCTTTGCTCGTGGCGTA 60.737 57.895 3.73 0.00 45.85 4.42
326 327 1.956620 GAGCTTTGCTCGTGGCGTAC 61.957 60.000 3.73 0.00 45.85 3.67
327 328 3.023591 GCTTTGCTCGTGGCGTACC 62.024 63.158 0.00 0.00 45.43 3.34
328 329 2.726691 CTTTGCTCGTGGCGTACCG 61.727 63.158 0.00 0.00 45.43 4.02
329 330 3.502990 TTTGCTCGTGGCGTACCGT 62.503 57.895 0.00 0.00 45.43 4.83
330 331 3.902162 TTGCTCGTGGCGTACCGTC 62.902 63.158 0.00 0.00 45.43 4.79
332 333 3.792047 CTCGTGGCGTACCGTCGA 61.792 66.667 0.00 0.00 40.72 4.20
333 334 3.104602 CTCGTGGCGTACCGTCGAT 62.105 63.158 0.00 0.00 41.59 3.59
334 335 2.947621 CGTGGCGTACCGTCGATG 60.948 66.667 0.00 0.00 39.70 3.84
335 336 2.581409 GTGGCGTACCGTCGATGG 60.581 66.667 22.38 22.38 39.70 3.51
336 337 2.751036 TGGCGTACCGTCGATGGA 60.751 61.111 30.28 10.98 39.70 3.41
337 338 2.122797 TGGCGTACCGTCGATGGAT 61.123 57.895 30.28 16.05 39.70 3.41
338 339 1.660575 GGCGTACCGTCGATGGATG 60.661 63.158 30.28 18.31 0.00 3.51
339 340 2.300787 GCGTACCGTCGATGGATGC 61.301 63.158 30.28 23.39 0.00 3.91
340 341 1.065109 CGTACCGTCGATGGATGCA 59.935 57.895 30.28 9.08 0.00 3.96
341 342 0.934901 CGTACCGTCGATGGATGCAG 60.935 60.000 30.28 11.95 0.00 4.41
342 343 0.384309 GTACCGTCGATGGATGCAGA 59.616 55.000 30.28 5.02 0.00 4.26
343 344 1.107945 TACCGTCGATGGATGCAGAA 58.892 50.000 30.28 3.53 0.00 3.02
344 345 0.179100 ACCGTCGATGGATGCAGAAG 60.179 55.000 30.28 0.25 0.00 2.85
345 346 0.877649 CCGTCGATGGATGCAGAAGG 60.878 60.000 19.48 0.00 0.00 3.46
346 347 0.103026 CGTCGATGGATGCAGAAGGA 59.897 55.000 0.00 0.00 0.00 3.36
347 348 1.471501 CGTCGATGGATGCAGAAGGAA 60.472 52.381 0.00 0.00 0.00 3.36
348 349 2.208431 GTCGATGGATGCAGAAGGAAG 58.792 52.381 0.00 0.00 0.00 3.46
349 350 2.110578 TCGATGGATGCAGAAGGAAGA 58.889 47.619 0.00 0.00 0.00 2.87
350 351 2.501316 TCGATGGATGCAGAAGGAAGAA 59.499 45.455 0.00 0.00 0.00 2.52
351 352 2.871022 CGATGGATGCAGAAGGAAGAAG 59.129 50.000 0.00 0.00 0.00 2.85
352 353 3.681034 CGATGGATGCAGAAGGAAGAAGT 60.681 47.826 0.00 0.00 0.00 3.01
353 354 3.340814 TGGATGCAGAAGGAAGAAGTC 57.659 47.619 0.00 0.00 0.00 3.01
354 355 2.909006 TGGATGCAGAAGGAAGAAGTCT 59.091 45.455 0.00 0.00 0.00 3.24
355 356 3.328931 TGGATGCAGAAGGAAGAAGTCTT 59.671 43.478 0.00 0.00 39.23 3.01
356 357 4.202503 TGGATGCAGAAGGAAGAAGTCTTT 60.203 41.667 0.00 0.00 36.11 2.52
357 358 4.155644 GGATGCAGAAGGAAGAAGTCTTTG 59.844 45.833 0.00 0.00 36.11 2.77
358 359 3.480470 TGCAGAAGGAAGAAGTCTTTGG 58.520 45.455 0.00 0.00 36.11 3.28
359 360 2.227626 GCAGAAGGAAGAAGTCTTTGGC 59.772 50.000 0.00 0.00 36.11 4.52
360 361 3.480470 CAGAAGGAAGAAGTCTTTGGCA 58.520 45.455 0.00 0.00 36.11 4.92
361 362 3.251972 CAGAAGGAAGAAGTCTTTGGCAC 59.748 47.826 0.00 0.00 36.11 5.01
362 363 2.278332 AGGAAGAAGTCTTTGGCACC 57.722 50.000 0.00 0.00 36.11 5.01
363 364 1.777272 AGGAAGAAGTCTTTGGCACCT 59.223 47.619 0.00 0.00 36.11 4.00
364 365 2.175715 AGGAAGAAGTCTTTGGCACCTT 59.824 45.455 0.00 0.00 36.11 3.50
365 366 2.959030 GGAAGAAGTCTTTGGCACCTTT 59.041 45.455 0.00 0.00 36.11 3.11
366 367 3.243535 GGAAGAAGTCTTTGGCACCTTTG 60.244 47.826 0.00 0.00 36.11 2.77
367 368 3.297134 AGAAGTCTTTGGCACCTTTGA 57.703 42.857 0.00 0.00 0.00 2.69
368 369 3.217626 AGAAGTCTTTGGCACCTTTGAG 58.782 45.455 0.00 0.00 0.00 3.02
369 370 1.986882 AGTCTTTGGCACCTTTGAGG 58.013 50.000 0.00 0.00 42.49 3.86
370 371 1.494721 AGTCTTTGGCACCTTTGAGGA 59.505 47.619 0.07 0.00 37.67 3.71
371 372 2.108952 AGTCTTTGGCACCTTTGAGGAT 59.891 45.455 0.07 0.00 37.67 3.24
372 373 2.893489 GTCTTTGGCACCTTTGAGGATT 59.107 45.455 0.07 0.00 37.67 3.01
373 374 3.321968 GTCTTTGGCACCTTTGAGGATTT 59.678 43.478 0.07 0.00 37.67 2.17
374 375 3.966665 TCTTTGGCACCTTTGAGGATTTT 59.033 39.130 0.07 0.00 37.67 1.82
375 376 4.408596 TCTTTGGCACCTTTGAGGATTTTT 59.591 37.500 0.07 0.00 37.67 1.94
376 377 3.749665 TGGCACCTTTGAGGATTTTTG 57.250 42.857 0.07 0.00 37.67 2.44
377 378 2.368221 TGGCACCTTTGAGGATTTTTGG 59.632 45.455 0.07 0.00 37.67 3.28
378 379 2.632512 GGCACCTTTGAGGATTTTTGGA 59.367 45.455 0.07 0.00 37.67 3.53
379 380 3.261643 GGCACCTTTGAGGATTTTTGGAT 59.738 43.478 0.07 0.00 37.67 3.41
380 381 4.248058 GCACCTTTGAGGATTTTTGGATG 58.752 43.478 0.07 0.00 37.67 3.51
381 382 4.262592 GCACCTTTGAGGATTTTTGGATGT 60.263 41.667 0.07 0.00 37.67 3.06
382 383 5.047377 GCACCTTTGAGGATTTTTGGATGTA 60.047 40.000 0.07 0.00 37.67 2.29
383 384 6.351286 GCACCTTTGAGGATTTTTGGATGTAT 60.351 38.462 0.07 0.00 37.67 2.29
384 385 7.614494 CACCTTTGAGGATTTTTGGATGTATT 58.386 34.615 0.07 0.00 37.67 1.89
385 386 8.096414 CACCTTTGAGGATTTTTGGATGTATTT 58.904 33.333 0.07 0.00 37.67 1.40
386 387 8.659527 ACCTTTGAGGATTTTTGGATGTATTTT 58.340 29.630 0.07 0.00 37.67 1.82
387 388 9.506018 CCTTTGAGGATTTTTGGATGTATTTTT 57.494 29.630 0.00 0.00 37.67 1.94
409 410 7.435068 TTTTAGTTTCTGTTAGGATCTGTGC 57.565 36.000 0.00 0.00 0.00 4.57
410 411 4.899352 AGTTTCTGTTAGGATCTGTGCT 57.101 40.909 0.00 0.00 0.00 4.40
411 412 7.476540 TTAGTTTCTGTTAGGATCTGTGCTA 57.523 36.000 0.00 0.00 0.00 3.49
412 413 6.552445 AGTTTCTGTTAGGATCTGTGCTAT 57.448 37.500 0.00 0.00 0.00 2.97
413 414 7.661536 AGTTTCTGTTAGGATCTGTGCTATA 57.338 36.000 0.00 0.00 0.00 1.31
414 415 7.493367 AGTTTCTGTTAGGATCTGTGCTATAC 58.507 38.462 0.00 0.00 0.00 1.47
415 416 7.343316 AGTTTCTGTTAGGATCTGTGCTATACT 59.657 37.037 0.00 0.00 0.00 2.12
416 417 7.661536 TTCTGTTAGGATCTGTGCTATACTT 57.338 36.000 0.00 0.00 0.00 2.24
417 418 8.762481 TTCTGTTAGGATCTGTGCTATACTTA 57.238 34.615 0.00 0.00 0.00 2.24
418 419 8.762481 TCTGTTAGGATCTGTGCTATACTTAA 57.238 34.615 0.00 0.00 0.00 1.85
419 420 9.368416 TCTGTTAGGATCTGTGCTATACTTAAT 57.632 33.333 0.00 0.00 0.00 1.40
425 426 8.535335 AGGATCTGTGCTATACTTAATACATGG 58.465 37.037 0.00 0.00 0.00 3.66
426 427 7.278868 GGATCTGTGCTATACTTAATACATGGC 59.721 40.741 0.00 0.00 0.00 4.40
427 428 6.464222 TCTGTGCTATACTTAATACATGGCC 58.536 40.000 0.00 0.00 0.00 5.36
428 429 6.270000 TCTGTGCTATACTTAATACATGGCCT 59.730 38.462 3.32 0.00 0.00 5.19
429 430 6.837312 TGTGCTATACTTAATACATGGCCTT 58.163 36.000 3.32 0.00 0.00 4.35
430 431 7.287061 TGTGCTATACTTAATACATGGCCTTT 58.713 34.615 3.32 0.00 0.00 3.11
431 432 7.228507 TGTGCTATACTTAATACATGGCCTTTG 59.771 37.037 3.32 4.28 0.00 2.77
432 433 6.206634 TGCTATACTTAATACATGGCCTTTGC 59.793 38.462 3.32 0.00 0.00 3.68
442 443 2.282887 GCCTTTGCCCTTTCCGGA 60.283 61.111 0.00 0.00 33.16 5.14
443 444 1.906333 GCCTTTGCCCTTTCCGGAA 60.906 57.895 14.35 14.35 33.16 4.30
444 445 1.468506 GCCTTTGCCCTTTCCGGAAA 61.469 55.000 27.33 27.33 33.16 3.13
445 446 1.044611 CCTTTGCCCTTTCCGGAAAA 58.955 50.000 28.62 12.76 33.16 2.29
446 447 1.623311 CCTTTGCCCTTTCCGGAAAAT 59.377 47.619 28.62 0.00 33.16 1.82
447 448 2.038426 CCTTTGCCCTTTCCGGAAAATT 59.962 45.455 28.62 0.00 33.16 1.82
448 449 3.325870 CTTTGCCCTTTCCGGAAAATTC 58.674 45.455 28.62 19.49 33.16 2.17
449 450 2.002505 TGCCCTTTCCGGAAAATTCA 57.997 45.000 28.62 21.52 33.16 2.57
450 451 2.320781 TGCCCTTTCCGGAAAATTCAA 58.679 42.857 28.62 12.07 33.16 2.69
451 452 2.903135 TGCCCTTTCCGGAAAATTCAAT 59.097 40.909 28.62 0.00 33.16 2.57
452 453 4.090090 TGCCCTTTCCGGAAAATTCAATA 58.910 39.130 28.62 10.21 33.16 1.90
453 454 4.714308 TGCCCTTTCCGGAAAATTCAATAT 59.286 37.500 28.62 0.00 33.16 1.28
454 455 5.894393 TGCCCTTTCCGGAAAATTCAATATA 59.106 36.000 28.62 4.43 33.16 0.86
455 456 6.381420 TGCCCTTTCCGGAAAATTCAATATAA 59.619 34.615 28.62 3.89 33.16 0.98
456 457 7.070571 TGCCCTTTCCGGAAAATTCAATATAAT 59.929 33.333 28.62 0.00 33.16 1.28
457 458 7.931407 GCCCTTTCCGGAAAATTCAATATAATT 59.069 33.333 28.62 0.00 33.16 1.40
458 459 9.830975 CCCTTTCCGGAAAATTCAATATAATTT 57.169 29.630 28.62 0.00 40.02 1.82
501 502 3.360249 AAAAAGATGTGCAGTGCTGAC 57.640 42.857 17.60 7.69 0.00 3.51
502 503 2.267174 AAAGATGTGCAGTGCTGACT 57.733 45.000 17.60 7.67 0.00 3.41
503 504 1.805869 AAGATGTGCAGTGCTGACTC 58.194 50.000 17.60 7.92 0.00 3.36
504 505 0.683412 AGATGTGCAGTGCTGACTCA 59.317 50.000 17.60 8.12 0.00 3.41
505 506 1.071228 AGATGTGCAGTGCTGACTCAA 59.929 47.619 17.60 0.00 0.00 3.02
506 507 2.082231 GATGTGCAGTGCTGACTCAAT 58.918 47.619 17.60 0.00 0.00 2.57
507 508 1.232119 TGTGCAGTGCTGACTCAATG 58.768 50.000 17.60 0.00 35.39 2.82
508 509 1.202675 TGTGCAGTGCTGACTCAATGA 60.203 47.619 17.60 0.00 34.31 2.57
509 510 2.082231 GTGCAGTGCTGACTCAATGAT 58.918 47.619 17.60 0.00 34.31 2.45
510 511 2.486982 GTGCAGTGCTGACTCAATGATT 59.513 45.455 17.60 0.00 34.31 2.57
511 512 3.057736 GTGCAGTGCTGACTCAATGATTT 60.058 43.478 17.60 0.00 34.31 2.17
512 513 3.570975 TGCAGTGCTGACTCAATGATTTT 59.429 39.130 17.60 0.00 34.31 1.82
513 514 3.918591 GCAGTGCTGACTCAATGATTTTG 59.081 43.478 8.18 0.00 34.31 2.44
514 515 4.558095 GCAGTGCTGACTCAATGATTTTGT 60.558 41.667 8.18 0.00 34.31 2.83
515 516 5.152097 CAGTGCTGACTCAATGATTTTGTC 58.848 41.667 0.00 1.75 34.31 3.18
516 517 4.217118 AGTGCTGACTCAATGATTTTGTCC 59.783 41.667 5.30 0.00 0.00 4.02
517 518 4.022935 GTGCTGACTCAATGATTTTGTCCA 60.023 41.667 5.30 0.00 0.00 4.02
518 519 4.022935 TGCTGACTCAATGATTTTGTCCAC 60.023 41.667 5.30 0.10 0.00 4.02
519 520 4.715896 CTGACTCAATGATTTTGTCCACG 58.284 43.478 5.30 0.00 0.00 4.94
520 521 4.133820 TGACTCAATGATTTTGTCCACGT 58.866 39.130 5.30 0.00 0.00 4.49
521 522 4.024133 TGACTCAATGATTTTGTCCACGTG 60.024 41.667 9.08 9.08 0.00 4.49
522 523 4.133820 ACTCAATGATTTTGTCCACGTGA 58.866 39.130 19.30 0.00 0.00 4.35
523 524 4.578516 ACTCAATGATTTTGTCCACGTGAA 59.421 37.500 19.30 2.61 0.00 3.18
524 525 4.854399 TCAATGATTTTGTCCACGTGAAC 58.146 39.130 19.30 7.83 0.00 3.18
525 526 4.336713 TCAATGATTTTGTCCACGTGAACA 59.663 37.500 19.30 11.35 0.00 3.18
526 527 3.961477 TGATTTTGTCCACGTGAACAG 57.039 42.857 19.30 0.00 0.00 3.16
527 528 2.032799 TGATTTTGTCCACGTGAACAGC 59.967 45.455 19.30 4.71 0.00 4.40
528 529 1.454201 TTTTGTCCACGTGAACAGCA 58.546 45.000 19.30 0.15 0.00 4.41
529 530 1.674359 TTTGTCCACGTGAACAGCAT 58.326 45.000 19.30 0.00 0.00 3.79
530 531 0.943673 TTGTCCACGTGAACAGCATG 59.056 50.000 19.30 0.00 46.00 4.06
531 532 0.884259 TGTCCACGTGAACAGCATGG 60.884 55.000 19.30 0.00 43.62 3.66
532 533 0.602638 GTCCACGTGAACAGCATGGA 60.603 55.000 19.30 0.00 43.62 3.41
533 534 0.107643 TCCACGTGAACAGCATGGAA 59.892 50.000 19.30 0.00 43.62 3.53
534 535 1.167851 CCACGTGAACAGCATGGAAT 58.832 50.000 19.30 0.00 43.62 3.01
535 536 1.131126 CCACGTGAACAGCATGGAATC 59.869 52.381 19.30 0.00 43.62 2.52
536 537 1.805943 CACGTGAACAGCATGGAATCA 59.194 47.619 10.90 0.00 43.62 2.57
537 538 2.226200 CACGTGAACAGCATGGAATCAA 59.774 45.455 10.90 0.00 43.62 2.57
538 539 2.884012 ACGTGAACAGCATGGAATCAAA 59.116 40.909 0.00 0.00 43.62 2.69
539 540 3.317711 ACGTGAACAGCATGGAATCAAAA 59.682 39.130 0.00 0.00 43.62 2.44
540 541 4.022068 ACGTGAACAGCATGGAATCAAAAT 60.022 37.500 0.00 0.00 43.62 1.82
541 542 5.182950 ACGTGAACAGCATGGAATCAAAATA 59.817 36.000 0.00 0.00 43.62 1.40
542 543 6.092092 CGTGAACAGCATGGAATCAAAATAA 58.908 36.000 0.00 0.00 43.62 1.40
543 544 6.585702 CGTGAACAGCATGGAATCAAAATAAA 59.414 34.615 0.00 0.00 43.62 1.40
544 545 7.116090 CGTGAACAGCATGGAATCAAAATAAAA 59.884 33.333 0.00 0.00 43.62 1.52
545 546 8.772705 GTGAACAGCATGGAATCAAAATAAAAA 58.227 29.630 0.00 0.00 43.62 1.94
546 547 8.991026 TGAACAGCATGGAATCAAAATAAAAAG 58.009 29.630 0.00 0.00 43.62 2.27
547 548 9.206870 GAACAGCATGGAATCAAAATAAAAAGA 57.793 29.630 0.00 0.00 43.62 2.52
548 549 9.558396 AACAGCATGGAATCAAAATAAAAAGAA 57.442 25.926 0.00 0.00 43.62 2.52
549 550 9.211485 ACAGCATGGAATCAAAATAAAAAGAAG 57.789 29.630 0.00 0.00 43.62 2.85
550 551 9.426837 CAGCATGGAATCAAAATAAAAAGAAGA 57.573 29.630 0.00 0.00 0.00 2.87
560 561 9.607988 TCAAAATAAAAAGAAGAAAAGTTCCCC 57.392 29.630 0.00 0.00 0.00 4.81
561 562 8.836413 CAAAATAAAAAGAAGAAAAGTTCCCCC 58.164 33.333 0.00 0.00 0.00 5.40
562 563 7.931015 AATAAAAAGAAGAAAAGTTCCCCCT 57.069 32.000 0.00 0.00 0.00 4.79
563 564 5.871396 AAAAAGAAGAAAAGTTCCCCCTC 57.129 39.130 0.00 0.00 0.00 4.30
564 565 3.527507 AAGAAGAAAAGTTCCCCCTCC 57.472 47.619 0.00 0.00 0.00 4.30
565 566 1.711375 AGAAGAAAAGTTCCCCCTCCC 59.289 52.381 0.00 0.00 0.00 4.30
566 567 0.784495 AAGAAAAGTTCCCCCTCCCC 59.216 55.000 0.00 0.00 0.00 4.81
567 568 1.147190 AGAAAAGTTCCCCCTCCCCC 61.147 60.000 0.00 0.00 0.00 5.40
568 569 2.494777 GAAAAGTTCCCCCTCCCCCG 62.495 65.000 0.00 0.00 0.00 5.73
569 570 3.823696 AAAGTTCCCCCTCCCCCGT 62.824 63.158 0.00 0.00 0.00 5.28
570 571 4.735599 AGTTCCCCCTCCCCCGTC 62.736 72.222 0.00 0.00 0.00 4.79
585 586 3.148279 GTCGCCCCTGACTCGGAT 61.148 66.667 0.00 0.00 35.95 4.18
586 587 2.363795 TCGCCCCTGACTCGGATT 60.364 61.111 0.00 0.00 0.00 3.01
587 588 2.202932 CGCCCCTGACTCGGATTG 60.203 66.667 0.00 0.00 0.00 2.67
588 589 2.721167 CGCCCCTGACTCGGATTGA 61.721 63.158 0.00 0.00 0.00 2.57
589 590 1.602237 GCCCCTGACTCGGATTGAA 59.398 57.895 0.00 0.00 0.00 2.69
590 591 0.744771 GCCCCTGACTCGGATTGAAC 60.745 60.000 0.00 0.00 0.00 3.18
591 592 0.460284 CCCCTGACTCGGATTGAACG 60.460 60.000 0.00 0.00 0.00 3.95
592 593 0.460284 CCCTGACTCGGATTGAACGG 60.460 60.000 0.00 0.00 0.00 4.44
593 594 0.246635 CCTGACTCGGATTGAACGGT 59.753 55.000 0.00 0.00 0.00 4.83
594 595 1.475280 CCTGACTCGGATTGAACGGTA 59.525 52.381 0.00 0.00 0.00 4.02
595 596 2.479730 CCTGACTCGGATTGAACGGTAG 60.480 54.545 0.00 0.00 0.00 3.18
596 597 2.163815 CTGACTCGGATTGAACGGTAGT 59.836 50.000 0.00 0.00 0.00 2.73
597 598 3.346315 TGACTCGGATTGAACGGTAGTA 58.654 45.455 0.00 0.00 0.00 1.82
598 599 3.376234 TGACTCGGATTGAACGGTAGTAG 59.624 47.826 0.00 0.00 0.00 2.57
599 600 3.350833 ACTCGGATTGAACGGTAGTAGT 58.649 45.455 0.00 0.00 0.00 2.73
600 601 4.517285 ACTCGGATTGAACGGTAGTAGTA 58.483 43.478 0.00 0.00 0.00 1.82
601 602 4.943705 ACTCGGATTGAACGGTAGTAGTAA 59.056 41.667 0.00 0.00 0.00 2.24
602 603 5.163713 ACTCGGATTGAACGGTAGTAGTAAC 60.164 44.000 0.00 0.00 0.00 2.50
603 604 4.699735 TCGGATTGAACGGTAGTAGTAACA 59.300 41.667 0.00 0.00 0.00 2.41
604 605 5.357878 TCGGATTGAACGGTAGTAGTAACAT 59.642 40.000 0.00 0.00 0.00 2.71
605 606 5.457799 CGGATTGAACGGTAGTAGTAACATG 59.542 44.000 0.00 0.00 0.00 3.21
606 607 5.751990 GGATTGAACGGTAGTAGTAACATGG 59.248 44.000 0.00 0.00 0.00 3.66
607 608 5.981088 TTGAACGGTAGTAGTAACATGGA 57.019 39.130 0.00 0.00 0.00 3.41
608 609 6.534475 TTGAACGGTAGTAGTAACATGGAT 57.466 37.500 0.00 0.00 0.00 3.41
609 610 5.898174 TGAACGGTAGTAGTAACATGGATG 58.102 41.667 0.00 0.00 0.00 3.51
610 611 4.317671 ACGGTAGTAGTAACATGGATGC 57.682 45.455 0.00 0.00 0.00 3.91
611 612 3.243301 ACGGTAGTAGTAACATGGATGCG 60.243 47.826 0.00 0.00 0.00 4.73
612 613 3.057734 GGTAGTAGTAACATGGATGCGC 58.942 50.000 0.00 0.00 0.00 6.09
613 614 2.979814 AGTAGTAACATGGATGCGCA 57.020 45.000 14.96 14.96 0.00 6.09
614 615 2.826428 AGTAGTAACATGGATGCGCAG 58.174 47.619 18.32 3.73 0.00 5.18
615 616 2.168521 AGTAGTAACATGGATGCGCAGT 59.831 45.455 18.32 4.51 0.00 4.40
616 617 1.372582 AGTAACATGGATGCGCAGTG 58.627 50.000 18.32 14.25 0.00 3.66
617 618 1.066215 AGTAACATGGATGCGCAGTGA 60.066 47.619 18.32 1.13 0.00 3.41
618 619 1.942657 GTAACATGGATGCGCAGTGAT 59.057 47.619 18.32 9.31 0.00 3.06
619 620 2.330440 AACATGGATGCGCAGTGATA 57.670 45.000 18.32 0.09 0.00 2.15
620 621 1.875009 ACATGGATGCGCAGTGATAG 58.125 50.000 18.32 6.61 0.00 2.08
621 622 1.154197 CATGGATGCGCAGTGATAGG 58.846 55.000 18.32 0.00 0.00 2.57
622 623 0.761187 ATGGATGCGCAGTGATAGGT 59.239 50.000 18.32 0.00 0.00 3.08
623 624 0.104855 TGGATGCGCAGTGATAGGTC 59.895 55.000 18.32 5.42 0.00 3.85
624 625 0.104855 GGATGCGCAGTGATAGGTCA 59.895 55.000 18.32 0.00 0.00 4.02
631 632 2.585247 GTGATAGGTCACGGGCGC 60.585 66.667 0.00 0.00 44.71 6.53
632 633 2.758327 TGATAGGTCACGGGCGCT 60.758 61.111 7.64 0.00 0.00 5.92
633 634 2.027751 GATAGGTCACGGGCGCTC 59.972 66.667 7.64 0.06 0.00 5.03
634 635 2.758327 ATAGGTCACGGGCGCTCA 60.758 61.111 8.62 0.00 0.00 4.26
635 636 2.685387 GATAGGTCACGGGCGCTCAG 62.685 65.000 8.62 2.21 0.00 3.35
641 642 4.643387 ACGGGCGCTCAGGCTTTT 62.643 61.111 8.62 0.00 45.89 2.27
642 643 3.804193 CGGGCGCTCAGGCTTTTC 61.804 66.667 8.62 0.00 45.89 2.29
643 644 3.443925 GGGCGCTCAGGCTTTTCC 61.444 66.667 7.64 0.00 45.89 3.13
644 645 2.672996 GGCGCTCAGGCTTTTCCA 60.673 61.111 7.64 0.00 42.90 3.53
645 646 2.694760 GGCGCTCAGGCTTTTCCAG 61.695 63.158 7.64 0.00 42.90 3.86
654 655 1.508088 GCTTTTCCAGCGGTCATGG 59.492 57.895 0.00 0.00 39.29 3.66
655 656 1.937546 GCTTTTCCAGCGGTCATGGG 61.938 60.000 0.00 0.00 39.29 4.00
656 657 1.304052 TTTTCCAGCGGTCATGGGG 60.304 57.895 0.00 0.00 38.44 4.96
657 658 1.784301 TTTTCCAGCGGTCATGGGGA 61.784 55.000 0.00 0.00 38.44 4.81
658 659 2.196997 TTTCCAGCGGTCATGGGGAG 62.197 60.000 0.00 0.00 38.44 4.30
659 660 3.083349 CCAGCGGTCATGGGGAGA 61.083 66.667 0.00 0.00 33.94 3.71
660 661 2.503061 CAGCGGTCATGGGGAGAG 59.497 66.667 0.00 0.00 0.00 3.20
661 662 2.060383 CAGCGGTCATGGGGAGAGA 61.060 63.158 0.00 0.00 0.00 3.10
662 663 2.060980 AGCGGTCATGGGGAGAGAC 61.061 63.158 0.00 0.00 0.00 3.36
663 664 2.808315 CGGTCATGGGGAGAGACG 59.192 66.667 0.00 0.00 33.18 4.18
664 665 2.501610 GGTCATGGGGAGAGACGC 59.498 66.667 0.00 0.00 33.18 5.19
665 666 2.060980 GGTCATGGGGAGAGACGCT 61.061 63.158 0.00 0.00 33.18 5.07
666 667 1.142748 GTCATGGGGAGAGACGCTG 59.857 63.158 0.00 0.00 0.00 5.18
667 668 2.202987 CATGGGGAGAGACGCTGC 60.203 66.667 0.00 0.00 0.00 5.25
668 669 3.842923 ATGGGGAGAGACGCTGCG 61.843 66.667 21.91 21.91 35.50 5.18
671 672 3.138798 GGGAGAGACGCTGCGGTA 61.139 66.667 26.95 0.00 35.50 4.02
672 673 2.102553 GGAGAGACGCTGCGGTAC 59.897 66.667 26.95 16.27 0.00 3.34
673 674 2.102553 GAGAGACGCTGCGGTACC 59.897 66.667 26.95 11.91 0.00 3.34
674 675 3.412879 GAGAGACGCTGCGGTACCC 62.413 68.421 26.95 10.15 0.00 3.69
684 685 3.113979 CGGTACCCGGCGTGTTTC 61.114 66.667 6.25 0.00 44.15 2.78
685 686 2.030862 GGTACCCGGCGTGTTTCA 59.969 61.111 6.01 0.00 0.00 2.69
686 687 2.319841 GGTACCCGGCGTGTTTCAC 61.320 63.158 6.01 0.00 0.00 3.18
687 688 1.594836 GTACCCGGCGTGTTTCACA 60.595 57.895 6.01 0.00 33.40 3.58
688 689 1.301087 TACCCGGCGTGTTTCACAG 60.301 57.895 6.01 0.00 33.40 3.66
689 690 2.030490 TACCCGGCGTGTTTCACAGT 62.030 55.000 6.01 0.00 33.40 3.55
690 691 2.184167 CCCGGCGTGTTTCACAGTT 61.184 57.895 6.01 0.00 33.40 3.16
691 692 1.278637 CCGGCGTGTTTCACAGTTC 59.721 57.895 6.01 0.00 33.40 3.01
692 693 1.433053 CCGGCGTGTTTCACAGTTCA 61.433 55.000 6.01 0.00 33.40 3.18
693 694 0.315869 CGGCGTGTTTCACAGTTCAC 60.316 55.000 0.00 0.00 33.40 3.18
694 695 0.730265 GGCGTGTTTCACAGTTCACA 59.270 50.000 1.00 0.00 33.40 3.58
695 696 1.531058 GGCGTGTTTCACAGTTCACAC 60.531 52.381 1.00 0.00 36.89 3.82
697 698 1.810197 GTGTTTCACAGTTCACACGC 58.190 50.000 0.00 0.00 34.08 5.34
698 699 1.129624 GTGTTTCACAGTTCACACGCA 59.870 47.619 0.00 0.00 34.08 5.24
699 700 1.396648 TGTTTCACAGTTCACACGCAG 59.603 47.619 0.00 0.00 0.00 5.18
700 701 1.013596 TTTCACAGTTCACACGCAGG 58.986 50.000 0.00 0.00 0.00 4.85
701 702 0.107897 TTCACAGTTCACACGCAGGT 60.108 50.000 0.00 0.00 0.00 4.00
720 721 4.424711 GTGGGGGCCGAGCATTCA 62.425 66.667 0.00 0.00 0.00 2.57
721 722 3.419580 TGGGGGCCGAGCATTCAT 61.420 61.111 0.00 0.00 0.00 2.57
722 723 2.123726 GGGGGCCGAGCATTCATT 60.124 61.111 0.00 0.00 0.00 2.57
723 724 2.196245 GGGGGCCGAGCATTCATTC 61.196 63.158 0.00 0.00 0.00 2.67
724 725 1.152881 GGGGCCGAGCATTCATTCT 60.153 57.895 0.00 0.00 0.00 2.40
725 726 0.753111 GGGGCCGAGCATTCATTCTT 60.753 55.000 0.00 0.00 0.00 2.52
726 727 1.106285 GGGCCGAGCATTCATTCTTT 58.894 50.000 0.00 0.00 0.00 2.52
727 728 1.202336 GGGCCGAGCATTCATTCTTTG 60.202 52.381 0.00 0.00 0.00 2.77
728 729 1.202336 GGCCGAGCATTCATTCTTTGG 60.202 52.381 0.00 0.00 0.00 3.28
729 730 1.202336 GCCGAGCATTCATTCTTTGGG 60.202 52.381 0.00 0.00 0.00 4.12
730 731 2.368439 CCGAGCATTCATTCTTTGGGA 58.632 47.619 0.00 0.00 0.00 4.37
731 732 2.357009 CCGAGCATTCATTCTTTGGGAG 59.643 50.000 0.00 0.00 0.00 4.30
732 733 2.223433 CGAGCATTCATTCTTTGGGAGC 60.223 50.000 0.00 0.00 0.00 4.70
733 734 2.100418 GAGCATTCATTCTTTGGGAGCC 59.900 50.000 0.00 0.00 0.00 4.70
734 735 2.105766 GCATTCATTCTTTGGGAGCCT 58.894 47.619 0.00 0.00 0.00 4.58
735 736 2.100418 GCATTCATTCTTTGGGAGCCTC 59.900 50.000 0.00 0.00 0.00 4.70
736 737 2.514458 TTCATTCTTTGGGAGCCTCC 57.486 50.000 0.73 0.73 35.23 4.30
737 738 0.253044 TCATTCTTTGGGAGCCTCCG 59.747 55.000 4.29 0.00 37.43 4.63
738 739 0.035056 CATTCTTTGGGAGCCTCCGT 60.035 55.000 4.29 0.00 37.43 4.69
739 740 1.209504 CATTCTTTGGGAGCCTCCGTA 59.790 52.381 4.29 0.00 37.43 4.02
740 741 0.902531 TTCTTTGGGAGCCTCCGTAG 59.097 55.000 4.29 1.97 37.43 3.51
741 742 0.252103 TCTTTGGGAGCCTCCGTAGT 60.252 55.000 4.29 0.00 37.43 2.73
742 743 0.175989 CTTTGGGAGCCTCCGTAGTC 59.824 60.000 4.29 0.00 37.43 2.59
743 744 0.252103 TTTGGGAGCCTCCGTAGTCT 60.252 55.000 4.29 0.00 37.43 3.24
744 745 0.683504 TTGGGAGCCTCCGTAGTCTC 60.684 60.000 4.29 0.00 37.43 3.36
745 746 2.188161 GGGAGCCTCCGTAGTCTCG 61.188 68.421 4.29 0.00 37.43 4.04
746 747 2.716864 GAGCCTCCGTAGTCTCGC 59.283 66.667 0.00 0.00 0.00 5.03
747 748 2.829458 AGCCTCCGTAGTCTCGCC 60.829 66.667 0.00 0.00 0.00 5.54
748 749 3.138798 GCCTCCGTAGTCTCGCCA 61.139 66.667 0.00 0.00 0.00 5.69
749 750 2.491022 GCCTCCGTAGTCTCGCCAT 61.491 63.158 0.00 0.00 0.00 4.40
750 751 1.360551 CCTCCGTAGTCTCGCCATG 59.639 63.158 0.00 0.00 0.00 3.66
751 752 1.360551 CTCCGTAGTCTCGCCATGG 59.639 63.158 7.63 7.63 0.00 3.66
752 753 1.379443 TCCGTAGTCTCGCCATGGT 60.379 57.895 14.67 0.00 0.00 3.55
753 754 1.065928 CCGTAGTCTCGCCATGGTC 59.934 63.158 14.67 4.79 0.00 4.02
754 755 1.298413 CGTAGTCTCGCCATGGTCG 60.298 63.158 14.67 17.10 0.00 4.79
755 756 1.807886 GTAGTCTCGCCATGGTCGT 59.192 57.895 22.22 10.22 0.00 4.34
756 757 0.248539 GTAGTCTCGCCATGGTCGTC 60.249 60.000 22.22 15.56 0.00 4.20
757 758 1.381928 TAGTCTCGCCATGGTCGTCC 61.382 60.000 22.22 13.83 0.00 4.79
766 767 2.447920 TGGTCGTCCAGATGGGGA 59.552 61.111 0.00 0.00 39.03 4.81
767 768 1.002921 TGGTCGTCCAGATGGGGAT 59.997 57.895 0.00 0.00 39.62 3.85
768 769 1.048724 TGGTCGTCCAGATGGGGATC 61.049 60.000 0.00 0.00 39.62 3.36
769 770 0.760945 GGTCGTCCAGATGGGGATCT 60.761 60.000 0.00 0.00 39.62 2.75
770 771 1.480683 GGTCGTCCAGATGGGGATCTA 60.481 57.143 0.00 0.00 39.62 1.98
771 772 2.530701 GTCGTCCAGATGGGGATCTAT 58.469 52.381 0.00 0.00 39.62 1.98
772 773 3.563697 GGTCGTCCAGATGGGGATCTATA 60.564 52.174 0.00 0.00 39.62 1.31
773 774 4.282496 GTCGTCCAGATGGGGATCTATAT 58.718 47.826 0.00 0.00 39.62 0.86
774 775 5.446860 GTCGTCCAGATGGGGATCTATATA 58.553 45.833 0.00 0.00 39.62 0.86
775 776 5.533154 GTCGTCCAGATGGGGATCTATATAG 59.467 48.000 3.10 3.10 39.62 1.31
776 777 5.432060 TCGTCCAGATGGGGATCTATATAGA 59.568 44.000 14.76 14.76 39.62 1.98
777 778 6.069029 TCGTCCAGATGGGGATCTATATAGAA 60.069 42.308 16.27 0.12 39.62 2.10
778 779 6.039941 CGTCCAGATGGGGATCTATATAGAAC 59.960 46.154 16.27 13.31 39.62 3.01
779 780 7.129425 GTCCAGATGGGGATCTATATAGAACT 58.871 42.308 16.27 0.95 39.62 3.01
780 781 7.286775 GTCCAGATGGGGATCTATATAGAACTC 59.713 44.444 16.27 13.30 39.62 3.01
781 782 6.553100 CCAGATGGGGATCTATATAGAACTCC 59.447 46.154 25.22 25.22 43.80 3.85
782 783 6.553100 CAGATGGGGATCTATATAGAACTCCC 59.447 46.154 29.07 29.07 43.11 4.30
783 784 6.456657 AGATGGGGATCTATATAGAACTCCCT 59.543 42.308 32.31 24.57 45.13 4.20
784 785 6.500490 TGGGGATCTATATAGAACTCCCTT 57.500 41.667 32.31 13.15 45.13 3.95
785 786 6.503944 TGGGGATCTATATAGAACTCCCTTC 58.496 44.000 32.31 23.60 45.13 3.46
786 787 5.900699 GGGGATCTATATAGAACTCCCTTCC 59.099 48.000 32.31 24.06 45.13 3.46
787 788 6.298542 GGGGATCTATATAGAACTCCCTTCCT 60.299 46.154 32.31 11.41 45.13 3.36
788 789 7.193338 GGGATCTATATAGAACTCCCTTCCTT 58.807 42.308 29.38 8.42 43.60 3.36
789 790 7.680739 GGGATCTATATAGAACTCCCTTCCTTT 59.319 40.741 29.38 8.25 43.60 3.11
790 791 8.755028 GGATCTATATAGAACTCCCTTCCTTTC 58.245 40.741 16.27 4.87 35.69 2.62
791 792 8.673456 ATCTATATAGAACTCCCTTCCTTTCC 57.327 38.462 16.27 0.00 35.69 3.13
792 793 7.601942 TCTATATAGAACTCCCTTCCTTTCCA 58.398 38.462 10.11 0.00 0.00 3.53
793 794 4.846168 ATAGAACTCCCTTCCTTTCCAC 57.154 45.455 0.00 0.00 0.00 4.02
794 795 1.705745 AGAACTCCCTTCCTTTCCACC 59.294 52.381 0.00 0.00 0.00 4.61
795 796 1.423921 GAACTCCCTTCCTTTCCACCA 59.576 52.381 0.00 0.00 0.00 4.17
796 797 1.529744 ACTCCCTTCCTTTCCACCAA 58.470 50.000 0.00 0.00 0.00 3.67
797 798 1.145119 ACTCCCTTCCTTTCCACCAAC 59.855 52.381 0.00 0.00 0.00 3.77
798 799 1.144913 CTCCCTTCCTTTCCACCAACA 59.855 52.381 0.00 0.00 0.00 3.33
799 800 1.133606 TCCCTTCCTTTCCACCAACAC 60.134 52.381 0.00 0.00 0.00 3.32
800 801 1.328279 CCTTCCTTTCCACCAACACC 58.672 55.000 0.00 0.00 0.00 4.16
801 802 1.410932 CCTTCCTTTCCACCAACACCA 60.411 52.381 0.00 0.00 0.00 4.17
802 803 2.383855 CTTCCTTTCCACCAACACCAA 58.616 47.619 0.00 0.00 0.00 3.67
803 804 1.770294 TCCTTTCCACCAACACCAAC 58.230 50.000 0.00 0.00 0.00 3.77
804 805 0.383949 CCTTTCCACCAACACCAACG 59.616 55.000 0.00 0.00 0.00 4.10
805 806 0.248866 CTTTCCACCAACACCAACGC 60.249 55.000 0.00 0.00 0.00 4.84
806 807 1.668101 TTTCCACCAACACCAACGCC 61.668 55.000 0.00 0.00 0.00 5.68
807 808 2.518349 CCACCAACACCAACGCCT 60.518 61.111 0.00 0.00 0.00 5.52
808 809 2.551912 CCACCAACACCAACGCCTC 61.552 63.158 0.00 0.00 0.00 4.70
809 810 2.203294 ACCAACACCAACGCCTCC 60.203 61.111 0.00 0.00 0.00 4.30
810 811 2.983592 CCAACACCAACGCCTCCC 60.984 66.667 0.00 0.00 0.00 4.30
811 812 2.203280 CAACACCAACGCCTCCCA 60.203 61.111 0.00 0.00 0.00 4.37
812 813 2.113139 AACACCAACGCCTCCCAG 59.887 61.111 0.00 0.00 0.00 4.45
813 814 4.643387 ACACCAACGCCTCCCAGC 62.643 66.667 0.00 0.00 0.00 4.85
814 815 4.641645 CACCAACGCCTCCCAGCA 62.642 66.667 0.00 0.00 0.00 4.41
815 816 3.884774 ACCAACGCCTCCCAGCAA 61.885 61.111 0.00 0.00 0.00 3.91
816 817 3.365265 CCAACGCCTCCCAGCAAC 61.365 66.667 0.00 0.00 0.00 4.17
817 818 2.281761 CAACGCCTCCCAGCAACT 60.282 61.111 0.00 0.00 0.00 3.16
818 819 2.032681 AACGCCTCCCAGCAACTC 59.967 61.111 0.00 0.00 0.00 3.01
819 820 2.520536 AACGCCTCCCAGCAACTCT 61.521 57.895 0.00 0.00 0.00 3.24
820 821 2.125350 CGCCTCCCAGCAACTCTC 60.125 66.667 0.00 0.00 0.00 3.20
821 822 2.270527 GCCTCCCAGCAACTCTCC 59.729 66.667 0.00 0.00 0.00 3.71
822 823 2.993853 CCTCCCAGCAACTCTCCC 59.006 66.667 0.00 0.00 0.00 4.30
823 824 1.920325 CCTCCCAGCAACTCTCCCA 60.920 63.158 0.00 0.00 0.00 4.37
824 825 1.298014 CTCCCAGCAACTCTCCCAC 59.702 63.158 0.00 0.00 0.00 4.61
825 826 2.190488 CTCCCAGCAACTCTCCCACC 62.190 65.000 0.00 0.00 0.00 4.61
826 827 2.227036 CCCAGCAACTCTCCCACCT 61.227 63.158 0.00 0.00 0.00 4.00
827 828 1.298014 CCAGCAACTCTCCCACCTC 59.702 63.158 0.00 0.00 0.00 3.85
828 829 1.197430 CCAGCAACTCTCCCACCTCT 61.197 60.000 0.00 0.00 0.00 3.69
829 830 0.689623 CAGCAACTCTCCCACCTCTT 59.310 55.000 0.00 0.00 0.00 2.85
830 831 1.072965 CAGCAACTCTCCCACCTCTTT 59.927 52.381 0.00 0.00 0.00 2.52
831 832 1.777272 AGCAACTCTCCCACCTCTTTT 59.223 47.619 0.00 0.00 0.00 2.27
832 833 2.979678 AGCAACTCTCCCACCTCTTTTA 59.020 45.455 0.00 0.00 0.00 1.52
833 834 3.589288 AGCAACTCTCCCACCTCTTTTAT 59.411 43.478 0.00 0.00 0.00 1.40
834 835 4.783227 AGCAACTCTCCCACCTCTTTTATA 59.217 41.667 0.00 0.00 0.00 0.98
835 836 5.430089 AGCAACTCTCCCACCTCTTTTATAT 59.570 40.000 0.00 0.00 0.00 0.86
836 837 6.615726 AGCAACTCTCCCACCTCTTTTATATA 59.384 38.462 0.00 0.00 0.00 0.86
837 838 7.293535 AGCAACTCTCCCACCTCTTTTATATAT 59.706 37.037 0.00 0.00 0.00 0.86
838 839 8.594550 GCAACTCTCCCACCTCTTTTATATATA 58.405 37.037 0.00 0.00 0.00 0.86
840 841 9.900112 AACTCTCCCACCTCTTTTATATATAGT 57.100 33.333 0.00 0.00 0.00 2.12
841 842 9.900112 ACTCTCCCACCTCTTTTATATATAGTT 57.100 33.333 0.00 0.00 0.00 2.24
845 846 9.043548 TCCCACCTCTTTTATATATAGTTAGCC 57.956 37.037 0.00 0.00 0.00 3.93
846 847 8.822805 CCCACCTCTTTTATATATAGTTAGCCA 58.177 37.037 0.00 0.00 0.00 4.75
850 851 9.331282 CCTCTTTTATATATAGTTAGCCATGGC 57.669 37.037 30.12 30.12 42.33 4.40
867 868 7.422878 GCCATGGCTTAGTTACTAGTTATTC 57.577 40.000 29.98 0.00 38.26 1.75
868 869 6.427242 GCCATGGCTTAGTTACTAGTTATTCC 59.573 42.308 29.98 0.00 38.26 3.01
869 870 6.645415 CCATGGCTTAGTTACTAGTTATTCCG 59.355 42.308 0.00 0.00 0.00 4.30
870 871 6.780457 TGGCTTAGTTACTAGTTATTCCGT 57.220 37.500 0.00 0.00 0.00 4.69
871 872 7.174107 TGGCTTAGTTACTAGTTATTCCGTT 57.826 36.000 0.00 0.00 0.00 4.44
872 873 7.614494 TGGCTTAGTTACTAGTTATTCCGTTT 58.386 34.615 0.00 0.00 0.00 3.60
873 874 7.546667 TGGCTTAGTTACTAGTTATTCCGTTTG 59.453 37.037 0.00 0.00 0.00 2.93
874 875 7.547019 GGCTTAGTTACTAGTTATTCCGTTTGT 59.453 37.037 0.00 0.00 0.00 2.83
875 876 9.573133 GCTTAGTTACTAGTTATTCCGTTTGTA 57.427 33.333 0.00 0.00 0.00 2.41
878 879 7.038048 AGTTACTAGTTATTCCGTTTGTAGGC 58.962 38.462 0.00 0.00 0.00 3.93
879 880 5.410355 ACTAGTTATTCCGTTTGTAGGCA 57.590 39.130 0.00 0.00 0.00 4.75
880 881 5.797051 ACTAGTTATTCCGTTTGTAGGCAA 58.203 37.500 0.00 0.00 0.00 4.52
881 882 5.640783 ACTAGTTATTCCGTTTGTAGGCAAC 59.359 40.000 0.00 0.00 33.82 4.17
882 883 3.754850 AGTTATTCCGTTTGTAGGCAACC 59.245 43.478 0.00 0.00 33.82 3.77
883 884 2.279935 ATTCCGTTTGTAGGCAACCA 57.720 45.000 0.00 0.00 33.82 3.67
884 885 2.279935 TTCCGTTTGTAGGCAACCAT 57.720 45.000 0.00 0.00 33.82 3.55
885 886 1.816074 TCCGTTTGTAGGCAACCATC 58.184 50.000 0.00 0.00 33.82 3.51
886 887 1.349688 TCCGTTTGTAGGCAACCATCT 59.650 47.619 0.00 0.00 33.82 2.90
887 888 1.737793 CCGTTTGTAGGCAACCATCTC 59.262 52.381 0.00 0.00 33.82 2.75
888 889 2.615493 CCGTTTGTAGGCAACCATCTCT 60.615 50.000 0.00 0.00 33.82 3.10
889 890 3.369052 CCGTTTGTAGGCAACCATCTCTA 60.369 47.826 0.00 0.00 33.82 2.43
890 891 3.865745 CGTTTGTAGGCAACCATCTCTAG 59.134 47.826 0.00 0.00 33.82 2.43
891 892 3.543680 TTGTAGGCAACCATCTCTAGC 57.456 47.619 0.00 0.00 37.17 3.42
892 893 2.752030 TGTAGGCAACCATCTCTAGCT 58.248 47.619 0.00 0.00 37.17 3.32
893 894 3.910989 TGTAGGCAACCATCTCTAGCTA 58.089 45.455 0.00 0.00 37.17 3.32
894 895 3.891977 TGTAGGCAACCATCTCTAGCTAG 59.108 47.826 15.01 15.01 37.17 3.42
895 896 3.039252 AGGCAACCATCTCTAGCTAGT 57.961 47.619 20.10 0.00 37.17 2.57
896 897 3.379452 AGGCAACCATCTCTAGCTAGTT 58.621 45.455 20.10 4.39 37.17 2.24
897 898 4.547671 AGGCAACCATCTCTAGCTAGTTA 58.452 43.478 20.10 10.07 37.17 2.24
898 899 4.962995 AGGCAACCATCTCTAGCTAGTTAA 59.037 41.667 20.10 7.66 37.17 2.01
899 900 5.051153 GGCAACCATCTCTAGCTAGTTAAC 58.949 45.833 20.10 0.00 0.00 2.01
900 901 5.051153 GCAACCATCTCTAGCTAGTTAACC 58.949 45.833 20.10 0.00 0.00 2.85
901 902 5.395324 GCAACCATCTCTAGCTAGTTAACCA 60.395 44.000 20.10 0.00 0.00 3.67
902 903 6.686632 GCAACCATCTCTAGCTAGTTAACCAT 60.687 42.308 20.10 1.59 0.00 3.55
903 904 7.471539 GCAACCATCTCTAGCTAGTTAACCATA 60.472 40.741 20.10 0.00 0.00 2.74
904 905 8.589338 CAACCATCTCTAGCTAGTTAACCATAT 58.411 37.037 20.10 0.00 0.00 1.78
905 906 8.728596 ACCATCTCTAGCTAGTTAACCATATT 57.271 34.615 20.10 0.00 0.00 1.28
906 907 8.808092 ACCATCTCTAGCTAGTTAACCATATTC 58.192 37.037 20.10 0.00 0.00 1.75
907 908 8.807118 CCATCTCTAGCTAGTTAACCATATTCA 58.193 37.037 20.10 0.00 0.00 2.57
910 911 9.642343 TCTCTAGCTAGTTAACCATATTCAAGA 57.358 33.333 20.10 7.65 0.00 3.02
913 914 9.817809 CTAGCTAGTTAACCATATTCAAGAACA 57.182 33.333 12.92 0.00 0.00 3.18
915 916 9.515226 AGCTAGTTAACCATATTCAAGAACAAA 57.485 29.630 0.88 0.00 0.00 2.83
941 942 4.913126 CACGGGAAGTGCTAGGTC 57.087 61.111 0.00 0.00 44.72 3.85
942 943 1.972198 CACGGGAAGTGCTAGGTCA 59.028 57.895 0.00 0.00 44.72 4.02
943 944 0.389948 CACGGGAAGTGCTAGGTCAC 60.390 60.000 0.00 0.00 44.72 3.67
944 945 1.218316 CGGGAAGTGCTAGGTCACC 59.782 63.158 0.00 0.00 37.68 4.02
945 946 1.258445 CGGGAAGTGCTAGGTCACCT 61.258 60.000 0.00 0.00 37.68 4.00
946 947 0.537653 GGGAAGTGCTAGGTCACCTC 59.462 60.000 0.00 0.00 37.68 3.85
947 948 1.562783 GGAAGTGCTAGGTCACCTCT 58.437 55.000 0.00 0.00 37.68 3.69
948 949 1.478916 GGAAGTGCTAGGTCACCTCTC 59.521 57.143 0.00 0.00 37.68 3.20
949 950 2.452505 GAAGTGCTAGGTCACCTCTCT 58.547 52.381 0.00 0.00 37.68 3.10
950 951 2.137810 AGTGCTAGGTCACCTCTCTC 57.862 55.000 0.00 0.00 37.68 3.20
951 952 1.638589 AGTGCTAGGTCACCTCTCTCT 59.361 52.381 0.00 0.00 37.68 3.10
952 953 2.021457 GTGCTAGGTCACCTCTCTCTC 58.979 57.143 0.00 0.00 34.61 3.20
953 954 1.636003 TGCTAGGTCACCTCTCTCTCA 59.364 52.381 0.00 0.00 34.61 3.27
954 955 2.297701 GCTAGGTCACCTCTCTCTCAG 58.702 57.143 0.00 0.00 34.61 3.35
955 956 2.092646 GCTAGGTCACCTCTCTCTCAGA 60.093 54.545 0.00 0.00 34.61 3.27
956 957 3.623703 GCTAGGTCACCTCTCTCTCAGAA 60.624 52.174 0.00 0.00 34.61 3.02
957 958 3.085952 AGGTCACCTCTCTCTCAGAAG 57.914 52.381 0.00 0.00 0.00 2.85
958 959 2.647299 AGGTCACCTCTCTCTCAGAAGA 59.353 50.000 0.00 0.00 0.00 2.87
959 960 3.075283 AGGTCACCTCTCTCTCAGAAGAA 59.925 47.826 0.00 0.00 0.00 2.52
960 961 3.443681 GGTCACCTCTCTCTCAGAAGAAG 59.556 52.174 0.00 0.00 0.00 2.85
961 962 4.331968 GTCACCTCTCTCTCAGAAGAAGA 58.668 47.826 0.00 0.00 0.00 2.87
962 963 4.764823 GTCACCTCTCTCTCAGAAGAAGAA 59.235 45.833 0.00 0.00 0.00 2.52
963 964 5.009631 TCACCTCTCTCTCAGAAGAAGAAG 58.990 45.833 0.00 0.00 0.00 2.85
964 965 5.009631 CACCTCTCTCTCAGAAGAAGAAGA 58.990 45.833 0.00 0.00 0.00 2.87
965 966 5.476599 CACCTCTCTCTCAGAAGAAGAAGAA 59.523 44.000 0.00 0.00 0.00 2.52
966 967 6.015519 CACCTCTCTCTCAGAAGAAGAAGAAA 60.016 42.308 0.00 0.00 0.00 2.52
967 968 6.015434 ACCTCTCTCTCAGAAGAAGAAGAAAC 60.015 42.308 0.00 0.00 0.00 2.78
968 969 6.015519 CCTCTCTCTCAGAAGAAGAAGAAACA 60.016 42.308 0.00 0.00 0.00 2.83
969 970 6.744112 TCTCTCTCAGAAGAAGAAGAAACAC 58.256 40.000 0.00 0.00 0.00 3.32
970 971 5.524284 TCTCTCAGAAGAAGAAGAAACACG 58.476 41.667 0.00 0.00 0.00 4.49
971 972 4.621991 TCTCAGAAGAAGAAGAAACACGG 58.378 43.478 0.00 0.00 0.00 4.94
972 973 3.131396 TCAGAAGAAGAAGAAACACGGC 58.869 45.455 0.00 0.00 0.00 5.68
973 974 2.872245 CAGAAGAAGAAGAAACACGGCA 59.128 45.455 0.00 0.00 0.00 5.69
974 975 3.312421 CAGAAGAAGAAGAAACACGGCAA 59.688 43.478 0.00 0.00 0.00 4.52
975 976 3.561725 AGAAGAAGAAGAAACACGGCAAG 59.438 43.478 0.00 0.00 0.00 4.01
976 977 3.194005 AGAAGAAGAAACACGGCAAGA 57.806 42.857 0.00 0.00 0.00 3.02
977 978 3.541632 AGAAGAAGAAACACGGCAAGAA 58.458 40.909 0.00 0.00 0.00 2.52
978 979 3.945285 AGAAGAAGAAACACGGCAAGAAA 59.055 39.130 0.00 0.00 0.00 2.52
979 980 3.971032 AGAAGAAACACGGCAAGAAAG 57.029 42.857 0.00 0.00 0.00 2.62
980 981 2.033424 AGAAGAAACACGGCAAGAAAGC 59.967 45.455 0.00 0.00 0.00 3.51
981 982 0.307760 AGAAACACGGCAAGAAAGCG 59.692 50.000 0.00 0.00 34.64 4.68
982 983 1.268778 GAAACACGGCAAGAAAGCGC 61.269 55.000 0.00 0.00 34.64 5.92
983 984 2.677573 AAACACGGCAAGAAAGCGCC 62.678 55.000 2.29 0.00 45.28 6.53
1002 1003 2.869636 AGCTCAGCTGCAGGAAATG 58.130 52.632 17.12 0.00 37.57 2.32
1003 1004 0.680280 AGCTCAGCTGCAGGAAATGG 60.680 55.000 17.12 0.00 37.57 3.16
1004 1005 1.807886 CTCAGCTGCAGGAAATGGC 59.192 57.895 17.12 0.00 0.00 4.40
1005 1006 0.680280 CTCAGCTGCAGGAAATGGCT 60.680 55.000 17.12 1.55 0.00 4.75
1006 1007 0.620030 TCAGCTGCAGGAAATGGCTA 59.380 50.000 17.12 0.00 0.00 3.93
1007 1008 1.022735 CAGCTGCAGGAAATGGCTAG 58.977 55.000 17.12 0.00 0.00 3.42
1008 1009 0.106819 AGCTGCAGGAAATGGCTAGG 60.107 55.000 17.12 0.00 0.00 3.02
1009 1010 1.105759 GCTGCAGGAAATGGCTAGGG 61.106 60.000 17.12 0.00 0.00 3.53
1010 1011 1.076777 TGCAGGAAATGGCTAGGGC 60.077 57.895 0.00 0.00 37.82 5.19
1011 1012 1.228510 GCAGGAAATGGCTAGGGCT 59.771 57.895 0.00 0.00 38.73 5.19
1012 1013 0.474184 GCAGGAAATGGCTAGGGCTA 59.526 55.000 0.00 0.00 38.73 3.93
1013 1014 1.544314 GCAGGAAATGGCTAGGGCTAG 60.544 57.143 0.00 0.00 38.73 3.42
1014 1015 1.771255 CAGGAAATGGCTAGGGCTAGT 59.229 52.381 0.00 0.00 38.73 2.57
1015 1016 2.173569 CAGGAAATGGCTAGGGCTAGTT 59.826 50.000 0.00 0.00 39.72 2.24
1017 1018 2.484889 GAAATGGCTAGGGCTAGTTCG 58.515 52.381 0.00 0.00 42.12 3.95
1018 1019 0.106894 AATGGCTAGGGCTAGTTCGC 59.893 55.000 0.00 0.00 38.73 4.70
1019 1020 0.760945 ATGGCTAGGGCTAGTTCGCT 60.761 55.000 0.00 0.00 38.73 4.93
1020 1021 1.068250 GGCTAGGGCTAGTTCGCTG 59.932 63.158 0.00 0.00 38.73 5.18
1021 1022 1.592939 GCTAGGGCTAGTTCGCTGC 60.593 63.158 0.00 0.00 35.65 5.25
1022 1023 1.299468 CTAGGGCTAGTTCGCTGCG 60.299 63.158 17.25 17.25 0.00 5.18
1023 1024 3.426117 TAGGGCTAGTTCGCTGCGC 62.426 63.158 18.65 0.00 39.46 6.09
1025 1026 3.118454 GGCTAGTTCGCTGCGCAA 61.118 61.111 18.65 9.87 0.00 4.85
1026 1027 2.096594 GCTAGTTCGCTGCGCAAC 59.903 61.111 18.65 20.35 0.00 4.17
1027 1028 2.391821 CTAGTTCGCTGCGCAACG 59.608 61.111 26.21 26.21 0.00 4.10
1028 1029 2.355363 TAGTTCGCTGCGCAACGT 60.355 55.556 29.75 15.54 0.00 3.99
1029 1030 1.068832 CTAGTTCGCTGCGCAACGTA 61.069 55.000 29.75 19.98 0.00 3.57
1030 1031 1.339235 TAGTTCGCTGCGCAACGTAC 61.339 55.000 28.16 28.16 0.00 3.67
1031 1032 2.658918 TTCGCTGCGCAACGTACA 60.659 55.556 29.75 14.43 0.00 2.90
1032 1033 2.653967 TTCGCTGCGCAACGTACAG 61.654 57.895 29.75 9.61 34.48 2.74
1033 1034 3.103289 CGCTGCGCAACGTACAGA 61.103 61.111 24.13 0.00 33.10 3.41
1034 1035 2.772189 GCTGCGCAACGTACAGAG 59.228 61.111 13.05 0.00 33.10 3.35
1035 1036 1.733041 GCTGCGCAACGTACAGAGA 60.733 57.895 13.05 0.00 33.10 3.10
1036 1037 1.078759 GCTGCGCAACGTACAGAGAT 61.079 55.000 13.05 0.00 33.10 2.75
1037 1038 1.350193 CTGCGCAACGTACAGAGATT 58.650 50.000 13.05 0.00 33.10 2.40
1038 1039 1.726791 CTGCGCAACGTACAGAGATTT 59.273 47.619 13.05 0.00 33.10 2.17
1039 1040 1.724623 TGCGCAACGTACAGAGATTTC 59.275 47.619 8.16 0.00 0.00 2.17
1040 1041 1.724623 GCGCAACGTACAGAGATTTCA 59.275 47.619 0.30 0.00 0.00 2.69
1041 1042 2.472397 GCGCAACGTACAGAGATTTCAC 60.472 50.000 0.30 0.00 0.00 3.18
1042 1043 2.092211 CGCAACGTACAGAGATTTCACC 59.908 50.000 0.00 0.00 0.00 4.02
1043 1044 2.415512 GCAACGTACAGAGATTTCACCC 59.584 50.000 0.00 0.00 0.00 4.61
1044 1045 3.000727 CAACGTACAGAGATTTCACCCC 58.999 50.000 0.00 0.00 0.00 4.95
1045 1046 2.537143 ACGTACAGAGATTTCACCCCT 58.463 47.619 0.00 0.00 0.00 4.79
1046 1047 2.496470 ACGTACAGAGATTTCACCCCTC 59.504 50.000 0.00 0.00 0.00 4.30
1047 1048 2.159085 CGTACAGAGATTTCACCCCTCC 60.159 54.545 0.00 0.00 0.00 4.30
1048 1049 0.905357 ACAGAGATTTCACCCCTCCG 59.095 55.000 0.00 0.00 0.00 4.63
1049 1050 0.905357 CAGAGATTTCACCCCTCCGT 59.095 55.000 0.00 0.00 0.00 4.69
1050 1051 2.108168 CAGAGATTTCACCCCTCCGTA 58.892 52.381 0.00 0.00 0.00 4.02
1051 1052 2.500098 CAGAGATTTCACCCCTCCGTAA 59.500 50.000 0.00 0.00 0.00 3.18
1052 1053 2.766828 AGAGATTTCACCCCTCCGTAAG 59.233 50.000 0.00 0.00 0.00 2.34
1053 1054 2.500504 GAGATTTCACCCCTCCGTAAGT 59.499 50.000 0.00 0.00 0.00 2.24
1054 1055 2.500504 AGATTTCACCCCTCCGTAAGTC 59.499 50.000 0.00 0.00 0.00 3.01
1055 1056 2.019807 TTTCACCCCTCCGTAAGTCT 57.980 50.000 0.00 0.00 0.00 3.24
1056 1057 2.905415 TTCACCCCTCCGTAAGTCTA 57.095 50.000 0.00 0.00 0.00 2.59
1057 1058 3.393426 TTCACCCCTCCGTAAGTCTAT 57.607 47.619 0.00 0.00 0.00 1.98
1058 1059 4.524802 TTCACCCCTCCGTAAGTCTATA 57.475 45.455 0.00 0.00 0.00 1.31
1059 1060 4.524802 TCACCCCTCCGTAAGTCTATAA 57.475 45.455 0.00 0.00 0.00 0.98
1060 1061 5.070823 TCACCCCTCCGTAAGTCTATAAT 57.929 43.478 0.00 0.00 0.00 1.28
1061 1062 5.075493 TCACCCCTCCGTAAGTCTATAATC 58.925 45.833 0.00 0.00 0.00 1.75
1062 1063 5.078256 CACCCCTCCGTAAGTCTATAATCT 58.922 45.833 0.00 0.00 0.00 2.40
1063 1064 5.183522 CACCCCTCCGTAAGTCTATAATCTC 59.816 48.000 0.00 0.00 0.00 2.75
1064 1065 5.074790 ACCCCTCCGTAAGTCTATAATCTCT 59.925 44.000 0.00 0.00 0.00 3.10
1065 1066 6.011481 CCCCTCCGTAAGTCTATAATCTCTT 58.989 44.000 0.00 0.00 0.00 2.85
1066 1067 6.151480 CCCCTCCGTAAGTCTATAATCTCTTC 59.849 46.154 0.00 0.00 0.00 2.87
1067 1068 6.715718 CCCTCCGTAAGTCTATAATCTCTTCA 59.284 42.308 0.00 0.00 0.00 3.02
1068 1069 7.230913 CCCTCCGTAAGTCTATAATCTCTTCAA 59.769 40.741 0.00 0.00 0.00 2.69
1069 1070 8.630917 CCTCCGTAAGTCTATAATCTCTTCAAA 58.369 37.037 0.00 0.00 0.00 2.69
1070 1071 9.453325 CTCCGTAAGTCTATAATCTCTTCAAAC 57.547 37.037 0.00 0.00 0.00 2.93
1071 1072 9.186837 TCCGTAAGTCTATAATCTCTTCAAACT 57.813 33.333 0.00 0.00 0.00 2.66
1072 1073 9.239002 CCGTAAGTCTATAATCTCTTCAAACTG 57.761 37.037 0.00 0.00 0.00 3.16
1082 1083 9.917887 ATAATCTCTTCAAACTGATCAAATCCT 57.082 29.630 0.00 0.00 0.00 3.24
1083 1084 7.862512 ATCTCTTCAAACTGATCAAATCCTC 57.137 36.000 0.00 0.00 0.00 3.71
1084 1085 6.176183 TCTCTTCAAACTGATCAAATCCTCC 58.824 40.000 0.00 0.00 0.00 4.30
1085 1086 5.879763 TCTTCAAACTGATCAAATCCTCCA 58.120 37.500 0.00 0.00 0.00 3.86
1086 1087 6.306199 TCTTCAAACTGATCAAATCCTCCAA 58.694 36.000 0.00 0.00 0.00 3.53
1087 1088 5.964958 TCAAACTGATCAAATCCTCCAAC 57.035 39.130 0.00 0.00 0.00 3.77
1088 1089 5.384336 TCAAACTGATCAAATCCTCCAACA 58.616 37.500 0.00 0.00 0.00 3.33
1089 1090 6.012113 TCAAACTGATCAAATCCTCCAACAT 58.988 36.000 0.00 0.00 0.00 2.71
1090 1091 6.494491 TCAAACTGATCAAATCCTCCAACATT 59.506 34.615 0.00 0.00 0.00 2.71
1091 1092 6.923199 AACTGATCAAATCCTCCAACATTT 57.077 33.333 0.00 0.00 0.00 2.32
1092 1093 6.923199 ACTGATCAAATCCTCCAACATTTT 57.077 33.333 0.00 0.00 0.00 1.82
1093 1094 6.928520 ACTGATCAAATCCTCCAACATTTTC 58.071 36.000 0.00 0.00 0.00 2.29
1094 1095 6.723052 ACTGATCAAATCCTCCAACATTTTCT 59.277 34.615 0.00 0.00 0.00 2.52
1095 1096 7.234166 ACTGATCAAATCCTCCAACATTTTCTT 59.766 33.333 0.00 0.00 0.00 2.52
1096 1097 7.380536 TGATCAAATCCTCCAACATTTTCTTG 58.619 34.615 0.00 0.00 0.00 3.02
1097 1098 6.975196 TCAAATCCTCCAACATTTTCTTGA 57.025 33.333 0.00 0.00 0.00 3.02
1098 1099 7.358770 TCAAATCCTCCAACATTTTCTTGAA 57.641 32.000 0.00 0.00 0.00 2.69
1099 1100 7.790027 TCAAATCCTCCAACATTTTCTTGAAA 58.210 30.769 0.00 0.00 0.00 2.69
1100 1101 8.431222 TCAAATCCTCCAACATTTTCTTGAAAT 58.569 29.630 0.00 0.00 38.49 2.17
1101 1102 9.059260 CAAATCCTCCAACATTTTCTTGAAATT 57.941 29.630 0.00 0.00 35.79 1.82
1105 1106 9.927668 TCCTCCAACATTTTCTTGAAATTAATC 57.072 29.630 0.00 0.00 35.79 1.75
1106 1107 8.863049 CCTCCAACATTTTCTTGAAATTAATCG 58.137 33.333 0.00 0.00 35.79 3.34
1107 1108 8.238481 TCCAACATTTTCTTGAAATTAATCGC 57.762 30.769 0.00 0.00 35.79 4.58
1108 1109 7.330700 TCCAACATTTTCTTGAAATTAATCGCC 59.669 33.333 0.00 0.00 35.79 5.54
1109 1110 7.412891 CCAACATTTTCTTGAAATTAATCGCCC 60.413 37.037 0.00 0.00 35.79 6.13
1110 1111 6.935167 ACATTTTCTTGAAATTAATCGCCCT 58.065 32.000 0.00 0.00 35.79 5.19
1111 1112 8.062065 ACATTTTCTTGAAATTAATCGCCCTA 57.938 30.769 0.00 0.00 35.79 3.53
1112 1113 8.190784 ACATTTTCTTGAAATTAATCGCCCTAG 58.809 33.333 0.00 0.00 35.79 3.02
1113 1114 5.751243 TTCTTGAAATTAATCGCCCTAGC 57.249 39.130 0.00 0.00 0.00 3.42
1114 1115 4.776349 TCTTGAAATTAATCGCCCTAGCA 58.224 39.130 0.00 0.00 39.83 3.49
1115 1116 5.376625 TCTTGAAATTAATCGCCCTAGCAT 58.623 37.500 0.00 0.00 39.83 3.79
1116 1117 5.239306 TCTTGAAATTAATCGCCCTAGCATG 59.761 40.000 0.00 0.00 39.83 4.06
1117 1118 4.713553 TGAAATTAATCGCCCTAGCATGA 58.286 39.130 0.00 0.00 39.83 3.07
1118 1119 5.316167 TGAAATTAATCGCCCTAGCATGAT 58.684 37.500 0.00 0.00 39.83 2.45
1119 1120 5.412594 TGAAATTAATCGCCCTAGCATGATC 59.587 40.000 0.00 0.00 39.83 2.92
1120 1121 2.654749 TAATCGCCCTAGCATGATCG 57.345 50.000 0.00 0.00 39.83 3.69
1121 1122 0.681733 AATCGCCCTAGCATGATCGT 59.318 50.000 0.00 0.00 39.83 3.73
1122 1123 0.244994 ATCGCCCTAGCATGATCGTC 59.755 55.000 0.00 0.00 39.83 4.20
1123 1124 1.106944 TCGCCCTAGCATGATCGTCA 61.107 55.000 0.00 0.00 39.83 4.35
1124 1125 0.249447 CGCCCTAGCATGATCGTCAA 60.249 55.000 0.00 0.00 39.83 3.18
1125 1126 1.606480 CGCCCTAGCATGATCGTCAAT 60.606 52.381 0.00 0.00 39.83 2.57
1126 1127 1.802960 GCCCTAGCATGATCGTCAATG 59.197 52.381 0.00 0.00 39.53 2.82
1127 1128 1.802960 CCCTAGCATGATCGTCAATGC 59.197 52.381 7.48 7.48 40.09 3.56
1129 1130 3.136763 CCTAGCATGATCGTCAATGCTT 58.863 45.455 19.75 7.79 46.94 3.91
1130 1131 3.562973 CCTAGCATGATCGTCAATGCTTT 59.437 43.478 19.75 3.85 46.94 3.51
1131 1132 3.687572 AGCATGATCGTCAATGCTTTC 57.312 42.857 11.43 0.00 46.94 2.62
1132 1133 3.276857 AGCATGATCGTCAATGCTTTCT 58.723 40.909 11.43 0.00 46.94 2.52
1133 1134 3.064958 AGCATGATCGTCAATGCTTTCTG 59.935 43.478 11.43 0.00 46.94 3.02
1134 1135 3.181503 GCATGATCGTCAATGCTTTCTGT 60.182 43.478 8.16 0.00 37.10 3.41
1135 1136 4.034394 GCATGATCGTCAATGCTTTCTGTA 59.966 41.667 8.16 0.00 37.10 2.74
1136 1137 5.735324 CATGATCGTCAATGCTTTCTGTAG 58.265 41.667 0.00 0.00 0.00 2.74
1137 1138 3.618594 TGATCGTCAATGCTTTCTGTAGC 59.381 43.478 0.00 0.00 41.59 3.58
1138 1139 2.346803 TCGTCAATGCTTTCTGTAGCC 58.653 47.619 0.00 0.00 40.49 3.93
1139 1140 2.028112 TCGTCAATGCTTTCTGTAGCCT 60.028 45.455 0.00 0.00 40.49 4.58
1140 1141 2.094894 CGTCAATGCTTTCTGTAGCCTG 59.905 50.000 0.00 0.00 40.49 4.85
1141 1142 3.077359 GTCAATGCTTTCTGTAGCCTGT 58.923 45.455 0.00 0.00 40.49 4.00
1142 1143 3.503748 GTCAATGCTTTCTGTAGCCTGTT 59.496 43.478 0.00 0.00 40.49 3.16
1143 1144 4.022849 GTCAATGCTTTCTGTAGCCTGTTT 60.023 41.667 0.00 0.00 40.49 2.83
1144 1145 4.584325 TCAATGCTTTCTGTAGCCTGTTTT 59.416 37.500 0.00 0.00 40.49 2.43
1145 1146 5.068987 TCAATGCTTTCTGTAGCCTGTTTTT 59.931 36.000 0.00 0.00 40.49 1.94
1146 1147 4.568152 TGCTTTCTGTAGCCTGTTTTTC 57.432 40.909 0.00 0.00 40.49 2.29
1147 1148 4.207165 TGCTTTCTGTAGCCTGTTTTTCT 58.793 39.130 0.00 0.00 40.49 2.52
1148 1149 4.275936 TGCTTTCTGTAGCCTGTTTTTCTC 59.724 41.667 0.00 0.00 40.49 2.87
1149 1150 4.320567 GCTTTCTGTAGCCTGTTTTTCTCC 60.321 45.833 0.00 0.00 35.06 3.71
1150 1151 4.431416 TTCTGTAGCCTGTTTTTCTCCA 57.569 40.909 0.00 0.00 0.00 3.86
1151 1152 3.740115 TCTGTAGCCTGTTTTTCTCCAC 58.260 45.455 0.00 0.00 0.00 4.02
1152 1153 3.135712 TCTGTAGCCTGTTTTTCTCCACA 59.864 43.478 0.00 0.00 0.00 4.17
1153 1154 4.074970 CTGTAGCCTGTTTTTCTCCACAT 58.925 43.478 0.00 0.00 0.00 3.21
1154 1155 4.072131 TGTAGCCTGTTTTTCTCCACATC 58.928 43.478 0.00 0.00 0.00 3.06
1155 1156 3.228188 AGCCTGTTTTTCTCCACATCA 57.772 42.857 0.00 0.00 0.00 3.07
1156 1157 3.565307 AGCCTGTTTTTCTCCACATCAA 58.435 40.909 0.00 0.00 0.00 2.57
1157 1158 3.319122 AGCCTGTTTTTCTCCACATCAAC 59.681 43.478 0.00 0.00 0.00 3.18
1158 1159 3.319122 GCCTGTTTTTCTCCACATCAACT 59.681 43.478 0.00 0.00 0.00 3.16
1159 1160 4.557496 GCCTGTTTTTCTCCACATCAACTC 60.557 45.833 0.00 0.00 0.00 3.01
1160 1161 4.319766 CCTGTTTTTCTCCACATCAACTCG 60.320 45.833 0.00 0.00 0.00 4.18
1161 1162 4.447290 TGTTTTTCTCCACATCAACTCGA 58.553 39.130 0.00 0.00 0.00 4.04
1162 1163 4.878971 TGTTTTTCTCCACATCAACTCGAA 59.121 37.500 0.00 0.00 0.00 3.71
1163 1164 5.530915 TGTTTTTCTCCACATCAACTCGAAT 59.469 36.000 0.00 0.00 0.00 3.34
1164 1165 6.039270 TGTTTTTCTCCACATCAACTCGAATT 59.961 34.615 0.00 0.00 0.00 2.17
1165 1166 6.633500 TTTTCTCCACATCAACTCGAATTT 57.367 33.333 0.00 0.00 0.00 1.82
1166 1167 7.737972 TTTTCTCCACATCAACTCGAATTTA 57.262 32.000 0.00 0.00 0.00 1.40
1167 1168 6.968131 TTCTCCACATCAACTCGAATTTAG 57.032 37.500 0.00 0.00 0.00 1.85
1168 1169 6.037786 TCTCCACATCAACTCGAATTTAGT 57.962 37.500 0.00 0.00 0.00 2.24
1169 1170 6.464222 TCTCCACATCAACTCGAATTTAGTT 58.536 36.000 2.24 2.24 37.67 2.24
1170 1171 6.590292 TCTCCACATCAACTCGAATTTAGTTC 59.410 38.462 4.61 0.00 34.99 3.01
1171 1172 6.464222 TCCACATCAACTCGAATTTAGTTCT 58.536 36.000 4.61 0.00 34.99 3.01
1172 1173 6.590292 TCCACATCAACTCGAATTTAGTTCTC 59.410 38.462 4.61 0.00 34.99 2.87
1173 1174 6.368791 CCACATCAACTCGAATTTAGTTCTCA 59.631 38.462 4.61 0.00 34.99 3.27
1174 1175 7.065085 CCACATCAACTCGAATTTAGTTCTCAT 59.935 37.037 4.61 0.00 34.99 2.90
1175 1176 8.113062 CACATCAACTCGAATTTAGTTCTCATC 58.887 37.037 4.61 0.00 34.99 2.92
1176 1177 8.037758 ACATCAACTCGAATTTAGTTCTCATCT 58.962 33.333 4.61 0.00 34.99 2.90
1177 1178 8.538856 CATCAACTCGAATTTAGTTCTCATCTC 58.461 37.037 4.61 0.00 34.99 2.75
1178 1179 7.036220 TCAACTCGAATTTAGTTCTCATCTCC 58.964 38.462 4.61 0.00 34.99 3.71
1179 1180 5.908341 ACTCGAATTTAGTTCTCATCTCCC 58.092 41.667 0.00 0.00 34.56 4.30
1180 1181 4.933330 TCGAATTTAGTTCTCATCTCCCG 58.067 43.478 0.00 0.00 34.56 5.14
1181 1182 4.401519 TCGAATTTAGTTCTCATCTCCCGT 59.598 41.667 0.00 0.00 34.56 5.28
1182 1183 4.504461 CGAATTTAGTTCTCATCTCCCGTG 59.496 45.833 0.00 0.00 34.56 4.94
1183 1184 5.420409 GAATTTAGTTCTCATCTCCCGTGT 58.580 41.667 0.00 0.00 33.89 4.49
1184 1185 3.868757 TTAGTTCTCATCTCCCGTGTG 57.131 47.619 0.00 0.00 0.00 3.82
1185 1186 1.633774 AGTTCTCATCTCCCGTGTGT 58.366 50.000 0.00 0.00 0.00 3.72
1186 1187 1.273606 AGTTCTCATCTCCCGTGTGTG 59.726 52.381 0.00 0.00 0.00 3.82
1187 1188 0.037326 TTCTCATCTCCCGTGTGTGC 60.037 55.000 0.00 0.00 0.00 4.57
1188 1189 1.448540 CTCATCTCCCGTGTGTGCC 60.449 63.158 0.00 0.00 0.00 5.01
1189 1190 1.892819 CTCATCTCCCGTGTGTGCCT 61.893 60.000 0.00 0.00 0.00 4.75
1190 1191 1.448540 CATCTCCCGTGTGTGCCTC 60.449 63.158 0.00 0.00 0.00 4.70
1191 1192 2.660064 ATCTCCCGTGTGTGCCTCC 61.660 63.158 0.00 0.00 0.00 4.30
1192 1193 4.742201 CTCCCGTGTGTGCCTCCG 62.742 72.222 0.00 0.00 0.00 4.63
1202 1203 2.032528 TGCCTCCGCACCTTTCTG 59.967 61.111 0.00 0.00 41.12 3.02
1203 1204 3.435186 GCCTCCGCACCTTTCTGC 61.435 66.667 0.00 0.00 34.03 4.26
1204 1205 2.747855 CCTCCGCACCTTTCTGCC 60.748 66.667 0.00 0.00 33.18 4.85
1205 1206 2.348998 CTCCGCACCTTTCTGCCT 59.651 61.111 0.00 0.00 33.18 4.75
1206 1207 2.032528 TCCGCACCTTTCTGCCTG 59.967 61.111 0.00 0.00 33.18 4.85
1207 1208 3.741476 CCGCACCTTTCTGCCTGC 61.741 66.667 0.00 0.00 33.18 4.85
1208 1209 2.979676 CGCACCTTTCTGCCTGCA 60.980 61.111 0.00 0.00 33.18 4.41
1209 1210 2.554636 CGCACCTTTCTGCCTGCAA 61.555 57.895 0.00 0.00 33.18 4.08
1210 1211 1.741525 GCACCTTTCTGCCTGCAAA 59.258 52.632 0.00 0.00 0.00 3.68
1211 1212 0.319405 GCACCTTTCTGCCTGCAAAT 59.681 50.000 0.00 0.00 0.00 2.32
1212 1213 1.545582 GCACCTTTCTGCCTGCAAATA 59.454 47.619 0.00 0.00 0.00 1.40
1213 1214 2.672195 GCACCTTTCTGCCTGCAAATAC 60.672 50.000 0.00 0.00 0.00 1.89
1214 1215 2.821969 CACCTTTCTGCCTGCAAATACT 59.178 45.455 0.00 0.00 0.00 2.12
1215 1216 4.009675 CACCTTTCTGCCTGCAAATACTA 58.990 43.478 0.00 0.00 0.00 1.82
1216 1217 4.010349 ACCTTTCTGCCTGCAAATACTAC 58.990 43.478 0.00 0.00 0.00 2.73
1217 1218 4.263506 ACCTTTCTGCCTGCAAATACTACT 60.264 41.667 0.00 0.00 0.00 2.57
1218 1219 5.045869 ACCTTTCTGCCTGCAAATACTACTA 60.046 40.000 0.00 0.00 0.00 1.82
1219 1220 5.294552 CCTTTCTGCCTGCAAATACTACTAC 59.705 44.000 0.00 0.00 0.00 2.73
1220 1221 5.677319 TTCTGCCTGCAAATACTACTACT 57.323 39.130 0.00 0.00 0.00 2.57
1221 1222 6.785337 TTCTGCCTGCAAATACTACTACTA 57.215 37.500 0.00 0.00 0.00 1.82
1222 1223 6.978674 TCTGCCTGCAAATACTACTACTAT 57.021 37.500 0.00 0.00 0.00 2.12
1223 1224 6.982852 TCTGCCTGCAAATACTACTACTATC 58.017 40.000 0.00 0.00 0.00 2.08
1224 1225 6.549736 TCTGCCTGCAAATACTACTACTATCA 59.450 38.462 0.00 0.00 0.00 2.15
1225 1226 7.233553 TCTGCCTGCAAATACTACTACTATCAT 59.766 37.037 0.00 0.00 0.00 2.45
1226 1227 8.417273 TGCCTGCAAATACTACTACTATCATA 57.583 34.615 0.00 0.00 0.00 2.15
1227 1228 9.035890 TGCCTGCAAATACTACTACTATCATAT 57.964 33.333 0.00 0.00 0.00 1.78
1240 1241 8.830915 ACTACTATCATATAAGGTGAGGATGG 57.169 38.462 0.00 0.00 0.00 3.51
1241 1242 8.402683 ACTACTATCATATAAGGTGAGGATGGT 58.597 37.037 0.00 0.00 32.43 3.55
1242 1243 7.726033 ACTATCATATAAGGTGAGGATGGTC 57.274 40.000 0.00 0.00 0.00 4.02
1243 1244 5.667539 ATCATATAAGGTGAGGATGGTCG 57.332 43.478 0.00 0.00 0.00 4.79
1244 1245 3.832490 TCATATAAGGTGAGGATGGTCGG 59.168 47.826 0.00 0.00 0.00 4.79
1245 1246 1.424638 ATAAGGTGAGGATGGTCGGG 58.575 55.000 0.00 0.00 0.00 5.14
1246 1247 0.337082 TAAGGTGAGGATGGTCGGGA 59.663 55.000 0.00 0.00 0.00 5.14
1247 1248 0.978146 AAGGTGAGGATGGTCGGGAG 60.978 60.000 0.00 0.00 0.00 4.30
1248 1249 2.435693 GGTGAGGATGGTCGGGAGG 61.436 68.421 0.00 0.00 0.00 4.30
1249 1250 2.041922 TGAGGATGGTCGGGAGGG 60.042 66.667 0.00 0.00 0.00 4.30
1250 1251 2.282446 GAGGATGGTCGGGAGGGA 59.718 66.667 0.00 0.00 0.00 4.20
1251 1252 1.834822 GAGGATGGTCGGGAGGGAG 60.835 68.421 0.00 0.00 0.00 4.30
1252 1253 2.844839 GGATGGTCGGGAGGGAGG 60.845 72.222 0.00 0.00 0.00 4.30
1253 1254 2.041819 GATGGTCGGGAGGGAGGT 60.042 66.667 0.00 0.00 0.00 3.85
1254 1255 1.689582 GATGGTCGGGAGGGAGGTT 60.690 63.158 0.00 0.00 0.00 3.50
1255 1256 0.398098 GATGGTCGGGAGGGAGGTTA 60.398 60.000 0.00 0.00 0.00 2.85
1256 1257 0.398664 ATGGTCGGGAGGGAGGTTAG 60.399 60.000 0.00 0.00 0.00 2.34
1257 1258 1.761271 GGTCGGGAGGGAGGTTAGG 60.761 68.421 0.00 0.00 0.00 2.69
1258 1259 1.761271 GTCGGGAGGGAGGTTAGGG 60.761 68.421 0.00 0.00 0.00 3.53
1259 1260 1.937528 TCGGGAGGGAGGTTAGGGA 60.938 63.158 0.00 0.00 0.00 4.20
1260 1261 1.002533 CGGGAGGGAGGTTAGGGAA 59.997 63.158 0.00 0.00 0.00 3.97
1261 1262 1.049289 CGGGAGGGAGGTTAGGGAAG 61.049 65.000 0.00 0.00 0.00 3.46
1262 1263 0.342313 GGGAGGGAGGTTAGGGAAGA 59.658 60.000 0.00 0.00 0.00 2.87
1263 1264 1.693083 GGGAGGGAGGTTAGGGAAGAG 60.693 61.905 0.00 0.00 0.00 2.85
1264 1265 1.693083 GGAGGGAGGTTAGGGAAGAGG 60.693 61.905 0.00 0.00 0.00 3.69
1265 1266 0.343726 AGGGAGGTTAGGGAAGAGGG 59.656 60.000 0.00 0.00 0.00 4.30
1266 1267 0.044397 GGGAGGTTAGGGAAGAGGGT 59.956 60.000 0.00 0.00 0.00 4.34
1267 1268 1.557426 GGGAGGTTAGGGAAGAGGGTT 60.557 57.143 0.00 0.00 0.00 4.11
1268 1269 1.838715 GGAGGTTAGGGAAGAGGGTTC 59.161 57.143 0.00 0.00 0.00 3.62
1269 1270 2.547990 GAGGTTAGGGAAGAGGGTTCA 58.452 52.381 0.00 0.00 0.00 3.18
1270 1271 2.502130 GAGGTTAGGGAAGAGGGTTCAG 59.498 54.545 0.00 0.00 0.00 3.02
1271 1272 1.560146 GGTTAGGGAAGAGGGTTCAGG 59.440 57.143 0.00 0.00 0.00 3.86
1272 1273 1.560146 GTTAGGGAAGAGGGTTCAGGG 59.440 57.143 0.00 0.00 0.00 4.45
1273 1274 0.620700 TAGGGAAGAGGGTTCAGGGC 60.621 60.000 0.00 0.00 0.00 5.19
1274 1275 2.231380 GGGAAGAGGGTTCAGGGCA 61.231 63.158 0.00 0.00 0.00 5.36
1275 1276 1.002011 GGAAGAGGGTTCAGGGCAC 60.002 63.158 0.00 0.00 0.00 5.01
1276 1277 1.376037 GAAGAGGGTTCAGGGCACG 60.376 63.158 0.00 0.00 0.00 5.34
1277 1278 2.804828 GAAGAGGGTTCAGGGCACGG 62.805 65.000 0.00 0.00 0.00 4.94
1278 1279 3.637273 GAGGGTTCAGGGCACGGT 61.637 66.667 0.00 0.00 0.00 4.83
1279 1280 3.175710 AGGGTTCAGGGCACGGTT 61.176 61.111 0.00 0.00 0.00 4.44
1280 1281 2.203437 GGGTTCAGGGCACGGTTT 60.203 61.111 0.00 0.00 0.00 3.27
1281 1282 1.830847 GGGTTCAGGGCACGGTTTT 60.831 57.895 0.00 0.00 0.00 2.43
1282 1283 1.396607 GGGTTCAGGGCACGGTTTTT 61.397 55.000 0.00 0.00 0.00 1.94
1308 1309 2.550830 CCCCCTATTTCCTGATCGTG 57.449 55.000 0.00 0.00 0.00 4.35
1309 1310 1.768870 CCCCCTATTTCCTGATCGTGT 59.231 52.381 0.00 0.00 0.00 4.49
1310 1311 2.969950 CCCCCTATTTCCTGATCGTGTA 59.030 50.000 0.00 0.00 0.00 2.90
1311 1312 3.389983 CCCCCTATTTCCTGATCGTGTAA 59.610 47.826 0.00 0.00 0.00 2.41
1312 1313 4.503296 CCCCCTATTTCCTGATCGTGTAAG 60.503 50.000 0.00 0.00 0.00 2.34
1313 1314 4.503296 CCCCTATTTCCTGATCGTGTAAGG 60.503 50.000 0.00 0.00 0.00 2.69
1314 1315 4.101119 CCCTATTTCCTGATCGTGTAAGGT 59.899 45.833 0.00 0.00 32.59 3.50
1315 1316 5.050490 CCTATTTCCTGATCGTGTAAGGTG 58.950 45.833 0.00 0.00 32.59 4.00
1316 1317 2.380084 TTCCTGATCGTGTAAGGTGC 57.620 50.000 0.00 0.00 32.59 5.01
1317 1318 1.262417 TCCTGATCGTGTAAGGTGCA 58.738 50.000 0.00 0.00 32.59 4.57
1318 1319 1.067142 TCCTGATCGTGTAAGGTGCAC 60.067 52.381 8.80 8.80 32.59 4.57
1323 1324 4.424430 GTGTAAGGTGCACGCGCG 62.424 66.667 30.96 30.96 42.97 6.86
1334 1335 4.351938 ACGCGCGCCTGTACAGAA 62.352 61.111 32.58 0.00 0.00 3.02
1335 1336 2.885644 CGCGCGCCTGTACAGAAT 60.886 61.111 27.72 0.00 0.00 2.40
1336 1337 1.587876 CGCGCGCCTGTACAGAATA 60.588 57.895 27.72 0.00 0.00 1.75
1337 1338 1.143373 CGCGCGCCTGTACAGAATAA 61.143 55.000 27.72 0.00 0.00 1.40
1338 1339 1.217882 GCGCGCCTGTACAGAATAAT 58.782 50.000 24.68 0.00 0.00 1.28
1339 1340 1.597663 GCGCGCCTGTACAGAATAATT 59.402 47.619 24.68 0.00 0.00 1.40
1340 1341 2.031683 GCGCGCCTGTACAGAATAATTT 59.968 45.455 24.68 0.00 0.00 1.82
1341 1342 3.486875 GCGCGCCTGTACAGAATAATTTT 60.487 43.478 24.68 0.00 0.00 1.82
1342 1343 4.271687 CGCGCCTGTACAGAATAATTTTC 58.728 43.478 24.68 2.17 0.00 2.29
1343 1344 4.034048 CGCGCCTGTACAGAATAATTTTCT 59.966 41.667 24.68 0.00 0.00 2.52
1354 1355 6.789262 CAGAATAATTTTCTGTACCTGGCTG 58.211 40.000 16.10 0.00 40.63 4.85
1355 1356 5.358160 AGAATAATTTTCTGTACCTGGCTGC 59.642 40.000 0.00 0.00 0.00 5.25
1356 1357 2.584835 ATTTTCTGTACCTGGCTGCA 57.415 45.000 0.50 0.00 0.00 4.41
1357 1358 1.896220 TTTTCTGTACCTGGCTGCAG 58.104 50.000 10.11 10.11 0.00 4.41
1358 1359 0.606401 TTTCTGTACCTGGCTGCAGC 60.606 55.000 30.88 30.88 41.14 5.25
1359 1360 1.767654 TTCTGTACCTGGCTGCAGCA 61.768 55.000 37.63 23.01 44.36 4.41
1360 1361 1.744368 CTGTACCTGGCTGCAGCAG 60.744 63.158 37.63 29.43 44.36 4.24
1361 1362 2.176314 CTGTACCTGGCTGCAGCAGA 62.176 60.000 37.63 23.23 44.36 4.26
1362 1363 1.003355 GTACCTGGCTGCAGCAGAA 60.003 57.895 37.63 22.16 44.36 3.02
1363 1364 0.393537 GTACCTGGCTGCAGCAGAAT 60.394 55.000 37.63 22.71 44.36 2.40
1364 1365 1.134401 GTACCTGGCTGCAGCAGAATA 60.134 52.381 37.63 21.70 44.36 1.75
1365 1366 0.107312 ACCTGGCTGCAGCAGAATAG 60.107 55.000 37.63 24.64 44.36 1.73
1366 1367 1.445716 CCTGGCTGCAGCAGAATAGC 61.446 60.000 37.63 20.06 44.36 2.97
1368 1369 0.463295 TGGCTGCAGCAGAATAGCTC 60.463 55.000 37.63 18.61 44.54 4.09
1369 1370 0.179051 GGCTGCAGCAGAATAGCTCT 60.179 55.000 37.63 0.00 44.54 4.09
1370 1371 1.069823 GGCTGCAGCAGAATAGCTCTA 59.930 52.381 37.63 0.00 44.54 2.43
1371 1372 2.289569 GGCTGCAGCAGAATAGCTCTAT 60.290 50.000 37.63 0.00 44.54 1.98
1372 1373 2.995258 GCTGCAGCAGAATAGCTCTATC 59.005 50.000 33.36 0.00 44.54 2.08
1373 1374 3.554544 GCTGCAGCAGAATAGCTCTATCA 60.555 47.826 33.36 0.00 44.54 2.15
1374 1375 4.823157 CTGCAGCAGAATAGCTCTATCAT 58.177 43.478 18.42 0.00 44.54 2.45
1375 1376 5.624052 GCTGCAGCAGAATAGCTCTATCATA 60.624 44.000 33.36 0.00 44.54 2.15
1376 1377 6.541934 TGCAGCAGAATAGCTCTATCATAT 57.458 37.500 0.00 0.00 44.54 1.78
1377 1378 7.651027 TGCAGCAGAATAGCTCTATCATATA 57.349 36.000 0.00 0.00 44.54 0.86
1378 1379 8.247666 TGCAGCAGAATAGCTCTATCATATAT 57.752 34.615 0.00 0.00 44.54 0.86
1379 1380 9.359653 TGCAGCAGAATAGCTCTATCATATATA 57.640 33.333 0.00 0.00 44.54 0.86
1402 1403 6.594788 ATCATGACAGGTTTAATTGCTGTT 57.405 33.333 0.00 0.00 0.00 3.16
1404 1405 7.517614 TCATGACAGGTTTAATTGCTGTTTA 57.482 32.000 0.00 0.00 0.00 2.01
1405 1406 8.121305 TCATGACAGGTTTAATTGCTGTTTAT 57.879 30.769 0.00 0.00 0.00 1.40
1408 1409 8.586570 TGACAGGTTTAATTGCTGTTTATTTG 57.413 30.769 0.00 0.00 0.00 2.32
1409 1410 7.170658 TGACAGGTTTAATTGCTGTTTATTTGC 59.829 33.333 0.00 0.00 0.00 3.68
1420 1421 6.054295 TGCTGTTTATTTGCCAAGTTGAAAT 58.946 32.000 3.87 6.14 0.00 2.17
1422 1423 7.066766 TGCTGTTTATTTGCCAAGTTGAAATTT 59.933 29.630 3.87 0.00 0.00 1.82
1423 1424 7.376601 GCTGTTTATTTGCCAAGTTGAAATTTG 59.623 33.333 3.87 0.00 0.00 2.32
1463 1464 2.610433 GCAAAATTAAGCCAGGCTGAC 58.390 47.619 17.05 3.71 39.62 3.51
1469 1470 0.179084 TAAGCCAGGCTGACGTATGC 60.179 55.000 17.05 9.68 39.62 3.14
1504 1506 7.730364 ATTGTAACAATATTAGGGAAGAGCG 57.270 36.000 0.00 0.00 0.00 5.03
1512 1514 2.961526 TAGGGAAGAGCGTCAATGAC 57.038 50.000 2.75 2.75 0.00 3.06
1513 1515 1.270907 AGGGAAGAGCGTCAATGACT 58.729 50.000 11.92 0.00 0.00 3.41
1541 1543 2.294074 ACCACTTAGCAACGAAAAGCA 58.706 42.857 0.00 0.00 0.00 3.91
1655 1657 1.804151 GGCGTATCAGAAACAGTGCAA 59.196 47.619 0.00 0.00 0.00 4.08
1669 1671 8.188799 AGAAACAGTGCAATGAGATCATTAATG 58.811 33.333 22.73 9.29 44.10 1.90
1681 1683 6.931281 TGAGATCATTAATGTGGCTAGCTTAC 59.069 38.462 15.72 14.37 0.00 2.34
1694 1696 1.810030 GCTTACTTGGGAGCGGACG 60.810 63.158 0.00 0.00 0.00 4.79
1702 1704 3.755628 GGAGCGGACGTGGTAGCA 61.756 66.667 0.00 0.00 0.00 3.49
1754 1756 3.199508 AGAGGTTTCCACTCATCATCTGG 59.800 47.826 0.00 0.00 37.43 3.86
1760 1762 4.038271 TCCACTCATCATCTGGCTTTTT 57.962 40.909 0.00 0.00 0.00 1.94
1844 1846 2.029844 GACAACACTCTCTGGCGGC 61.030 63.158 0.00 0.00 0.00 6.53
1894 1896 3.256136 CGTCCCTCACCCTGTATATCTTC 59.744 52.174 0.00 0.00 0.00 2.87
1909 1914 9.650539 CTGTATATCTTCTGGAAATCATTCGAT 57.349 33.333 0.00 0.00 36.36 3.59
1976 2023 0.037326 TACTGGCAGCCTGAGAAACG 60.037 55.000 24.37 0.00 0.00 3.60
1989 2036 2.223971 TGAGAAACGTCAGGGACTTGTC 60.224 50.000 0.00 0.00 34.60 3.18
1991 2038 2.434702 AGAAACGTCAGGGACTTGTCTT 59.565 45.455 0.00 0.00 34.60 3.01
1997 2044 2.036089 GTCAGGGACTTGTCTTCTCGTT 59.964 50.000 0.61 0.00 34.60 3.85
1999 2046 1.344763 AGGGACTTGTCTTCTCGTTGG 59.655 52.381 0.61 0.00 27.25 3.77
2001 2048 1.343465 GGACTTGTCTTCTCGTTGGGA 59.657 52.381 0.61 0.00 0.00 4.37
2003 2050 3.194968 GGACTTGTCTTCTCGTTGGGATA 59.805 47.826 0.61 0.00 0.00 2.59
2007 2054 5.421056 ACTTGTCTTCTCGTTGGGATACATA 59.579 40.000 0.00 0.00 39.74 2.29
2008 2055 5.258456 TGTCTTCTCGTTGGGATACATAC 57.742 43.478 0.00 0.00 39.74 2.39
2009 2056 4.098960 TGTCTTCTCGTTGGGATACATACC 59.901 45.833 0.00 0.00 39.74 2.73
2010 2057 4.341520 GTCTTCTCGTTGGGATACATACCT 59.658 45.833 0.00 0.00 39.74 3.08
2013 2072 6.781014 TCTTCTCGTTGGGATACATACCTTAT 59.219 38.462 0.00 0.00 39.74 1.73
2018 2077 6.433404 TCGTTGGGATACATACCTTATCTCTC 59.567 42.308 0.00 0.00 39.74 3.20
2022 2081 5.659079 GGGATACATACCTTATCTCTCCTGG 59.341 48.000 0.00 0.00 39.74 4.45
2031 2093 0.915364 ATCTCTCCTGGCCCTGTTTC 59.085 55.000 0.00 0.00 0.00 2.78
2042 2104 0.401738 CCCTGTTTCCTCTGCCTTGA 59.598 55.000 0.00 0.00 0.00 3.02
2044 2106 1.163554 CTGTTTCCTCTGCCTTGAGC 58.836 55.000 0.00 0.00 44.14 4.26
2051 2113 3.892122 CTGCCTTGAGCTCAGCAG 58.108 61.111 31.59 31.59 45.92 4.24
2054 2116 0.107800 TGCCTTGAGCTCAGCAGATC 60.108 55.000 22.72 11.81 44.23 2.75
2057 2119 2.281517 CCTTGAGCTCAGCAGATCTTG 58.718 52.381 17.43 0.00 35.92 3.02
2062 2124 1.714414 CTCAGCAGATCTTGTGCGC 59.286 57.895 0.00 0.00 46.06 6.09
2063 2125 1.004679 TCAGCAGATCTTGTGCGCA 60.005 52.632 5.66 5.66 46.06 6.09
2064 2126 1.134075 CAGCAGATCTTGTGCGCAC 59.866 57.895 33.11 33.11 46.06 5.34
2107 2177 0.463833 CCCTTCACGGTTGGGCTATC 60.464 60.000 0.00 0.00 33.88 2.08
2112 2182 2.244695 TCACGGTTGGGCTATCGATAT 58.755 47.619 5.40 0.00 0.00 1.63
2113 2183 2.029380 TCACGGTTGGGCTATCGATATG 60.029 50.000 5.40 1.82 0.00 1.78
2116 2186 2.736721 CGGTTGGGCTATCGATATGTTG 59.263 50.000 5.40 0.00 0.00 3.33
2136 2206 1.237285 CGCCCAGACCTTTCAACCAG 61.237 60.000 0.00 0.00 0.00 4.00
2145 2215 4.041198 AGACCTTTCAACCAGGTTATTCGA 59.959 41.667 3.89 0.00 45.30 3.71
2200 2270 8.719645 ATGATGATATCTATACTAAGGCCCTC 57.280 38.462 0.00 0.00 0.00 4.30
2281 2351 2.410774 CGCTTTTGTGCTCTTCTCTTCG 60.411 50.000 0.00 0.00 0.00 3.79
2316 2389 2.826488 AGAAGAGAGGTGGCACTACAT 58.174 47.619 18.45 1.07 0.00 2.29
2320 2393 2.906389 AGAGAGGTGGCACTACATTTCA 59.094 45.455 18.45 0.00 0.00 2.69
2321 2394 3.521126 AGAGAGGTGGCACTACATTTCAT 59.479 43.478 18.45 0.00 0.00 2.57
2327 2400 4.158384 GTGGCACTACATTTCATTTGACG 58.842 43.478 11.13 0.00 0.00 4.35
2407 2480 4.584325 TGTATCATCATGATGTCACCTCGA 59.416 41.667 30.01 12.73 37.70 4.04
2408 2481 4.886496 ATCATCATGATGTCACCTCGAT 57.114 40.909 30.01 14.29 35.43 3.59
2413 2486 3.448660 TCATGATGTCACCTCGATCTTGT 59.551 43.478 0.00 0.00 0.00 3.16
2416 2489 0.388520 TGTCACCTCGATCTTGTGCG 60.389 55.000 0.00 0.00 0.00 5.34
2419 2492 1.738099 ACCTCGATCTTGTGCGTGC 60.738 57.895 0.00 0.00 0.00 5.34
2423 2496 0.179137 TCGATCTTGTGCGTGCCTAG 60.179 55.000 0.00 0.00 0.00 3.02
2425 2498 1.536922 CGATCTTGTGCGTGCCTAGAT 60.537 52.381 0.00 6.87 0.00 1.98
2471 2559 5.298347 GTTCCATCATTACTAGGTGTAGGC 58.702 45.833 0.00 0.00 32.08 3.93
2489 2577 0.881796 GCGTCCAAGGAAAAGAAGGG 59.118 55.000 0.00 0.00 0.00 3.95
2517 2605 2.489073 GGTCAAACTCCATGGGTCAGTT 60.489 50.000 13.02 11.67 31.48 3.16
2565 2653 2.489971 TGACCGGCACTCAAGTAAAAG 58.510 47.619 0.00 0.00 0.00 2.27
2566 2654 1.197036 GACCGGCACTCAAGTAAAAGC 59.803 52.381 0.00 0.00 0.00 3.51
2570 2658 2.226437 CGGCACTCAAGTAAAAGCATGT 59.774 45.455 0.00 0.00 0.00 3.21
2572 2696 3.503748 GGCACTCAAGTAAAAGCATGTCT 59.496 43.478 0.00 0.00 0.00 3.41
2587 2711 4.223700 AGCATGTCTGTGATCAGGAAACTA 59.776 41.667 0.00 0.00 40.21 2.24
2607 2731 3.764885 AGCGAATGTATTTTGCAGGAC 57.235 42.857 0.00 0.00 45.78 3.85
2608 2732 2.095853 AGCGAATGTATTTTGCAGGACG 59.904 45.455 0.00 0.00 45.78 4.79
2609 2733 2.791158 GCGAATGTATTTTGCAGGACGG 60.791 50.000 0.00 0.00 43.26 4.79
2614 2738 3.550820 TGTATTTTGCAGGACGGCATAT 58.449 40.909 0.00 0.00 44.48 1.78
2671 2798 1.448540 CGTGGAGGTGGATGAGCAC 60.449 63.158 0.00 0.00 0.00 4.40
2698 2825 0.952280 GATGCGTCGTCCAGAGGATA 59.048 55.000 0.00 0.00 36.91 2.59
2710 2837 3.328050 TCCAGAGGATAGCTCAGTATCGA 59.672 47.826 0.00 0.00 31.10 3.59
2711 2838 4.075682 CCAGAGGATAGCTCAGTATCGAA 58.924 47.826 0.00 0.00 31.10 3.71
2716 2849 6.663093 AGAGGATAGCTCAGTATCGAAATGAT 59.337 38.462 0.00 0.00 41.30 2.45
2742 2881 2.263540 CCAGCAGCAATGGCCAAC 59.736 61.111 10.96 1.77 42.56 3.77
2759 2898 2.613977 CCAACTCTTGGTCCACTGCTAG 60.614 54.545 0.00 0.00 45.93 3.42
2760 2899 1.270907 ACTCTTGGTCCACTGCTAGG 58.729 55.000 0.00 0.00 0.00 3.02
2765 2904 0.178903 TGGTCCACTGCTAGGGAAGT 60.179 55.000 0.00 0.00 34.34 3.01
2769 2908 1.831736 TCCACTGCTAGGGAAGTTAGC 59.168 52.381 0.00 0.00 42.98 3.09
2776 2918 1.480954 CTAGGGAAGTTAGCGCAGGAA 59.519 52.381 11.47 0.00 0.00 3.36
2798 2940 5.458041 ACCTGATTCCAACTTTGATTGTG 57.542 39.130 0.00 0.00 0.00 3.33
2800 2942 5.776716 ACCTGATTCCAACTTTGATTGTGAT 59.223 36.000 0.00 0.00 0.00 3.06
2801 2943 6.097356 CCTGATTCCAACTTTGATTGTGATG 58.903 40.000 0.00 0.00 0.00 3.07
2811 2953 7.356089 ACTTTGATTGTGATGCCATTATCAT 57.644 32.000 0.00 0.00 39.13 2.45
2812 2954 7.431249 ACTTTGATTGTGATGCCATTATCATC 58.569 34.615 0.00 0.00 39.13 2.92
2819 2961 4.398358 GTGATGCCATTATCATCCTCCATG 59.602 45.833 0.00 0.00 39.13 3.66
2844 2986 5.449107 TTCACAGAGGTACAGTTGAGTAC 57.551 43.478 0.00 0.00 42.78 2.73
2852 2994 6.881065 AGAGGTACAGTTGAGTACGTATGTAA 59.119 38.462 0.00 0.00 44.08 2.41
2876 3021 1.741032 GCTGCTGTGGAGAGTGAGC 60.741 63.158 0.00 0.00 0.00 4.26
2897 3042 3.554692 GCGATGCTTCGGTCCGTG 61.555 66.667 21.74 6.91 45.59 4.94
2967 3112 1.136305 CCCTGAAATGCTGCCAATCAG 59.864 52.381 14.84 14.84 45.62 2.90
2968 3113 1.136305 CCTGAAATGCTGCCAATCAGG 59.864 52.381 22.04 22.04 45.06 3.86
2984 3129 1.906574 TCAGGGATAGCGACCAAAGTT 59.093 47.619 0.00 0.00 0.00 2.66
2985 3130 3.101437 TCAGGGATAGCGACCAAAGTTA 58.899 45.455 0.00 0.00 0.00 2.24
2991 3196 4.024809 GGATAGCGACCAAAGTTATCTTGC 60.025 45.833 0.00 0.00 33.92 4.01
2999 3204 5.302360 ACCAAAGTTATCTTGCGTCAGTAA 58.698 37.500 0.00 0.00 33.79 2.24
3002 3207 6.293190 CCAAAGTTATCTTGCGTCAGTAACAA 60.293 38.462 0.00 0.00 33.79 2.83
3006 3211 1.202592 TCTTGCGTCAGTAACAAGGCA 60.203 47.619 0.00 0.00 40.90 4.75
3011 3216 4.760878 TGCGTCAGTAACAAGGCATTATA 58.239 39.130 0.00 0.00 31.89 0.98
3016 3221 7.700656 GCGTCAGTAACAAGGCATTATAAAAAT 59.299 33.333 0.00 0.00 0.00 1.82
3072 3277 5.462398 GTCGGGCAATATTGTACTTGACTAG 59.538 44.000 16.61 0.00 30.83 2.57
3074 3279 6.041637 TCGGGCAATATTGTACTTGACTAGAT 59.958 38.462 16.61 0.00 30.83 1.98
3162 3367 1.490574 GTAGGTCTGCTCCTCCATGT 58.509 55.000 0.00 0.00 38.86 3.21
3268 3473 1.134788 CACTACGGACTTGGGGATGTC 60.135 57.143 0.00 0.00 0.00 3.06
3291 3496 1.374190 GCTGCCCCATCGAGATGAT 59.626 57.895 14.12 0.00 41.20 2.45
3300 3505 2.651135 ATCGAGATGATGGCTGATCG 57.349 50.000 0.00 0.00 35.45 3.69
3336 3541 1.448013 GCCACTACGCCTTCTGACC 60.448 63.158 0.00 0.00 0.00 4.02
3349 3554 1.216710 CTGACCTCCTCCTCAACGC 59.783 63.158 0.00 0.00 0.00 4.84
3352 3557 1.183549 GACCTCCTCCTCAACGCTAA 58.816 55.000 0.00 0.00 0.00 3.09
3354 3559 0.179097 CCTCCTCCTCAACGCTAAGC 60.179 60.000 0.00 0.00 0.00 3.09
3355 3560 0.820871 CTCCTCCTCAACGCTAAGCT 59.179 55.000 0.00 0.00 0.00 3.74
3380 3687 9.360901 CTAGCCTCATAGGTATGTACATATCAT 57.639 37.037 24.58 14.41 37.80 2.45
3384 3691 8.427276 CCTCATAGGTATGTACATATCATGCAT 58.573 37.037 24.58 10.07 31.55 3.96
3407 3715 6.729391 TGCTTGCTTACATGTACGAATTTA 57.271 33.333 13.19 0.00 0.00 1.40
3416 3724 9.594038 CTTACATGTACGAATTTATTGGTATGC 57.406 33.333 4.68 0.00 34.35 3.14
3420 3728 9.117145 CATGTACGAATTTATTGGTATGCATTC 57.883 33.333 3.54 0.00 34.35 2.67
3441 3754 1.882912 TTCACTTGATGCAAGCGACT 58.117 45.000 7.06 0.00 44.43 4.18
3444 3757 1.128136 CACTTGATGCAAGCGACTCTG 59.872 52.381 7.06 0.00 44.43 3.35
3450 3767 2.988010 TGCAAGCGACTCTGGATATT 57.012 45.000 0.00 0.00 0.00 1.28
3451 3768 3.266510 TGCAAGCGACTCTGGATATTT 57.733 42.857 0.00 0.00 0.00 1.40
3594 3953 5.590530 TTAAACCAATCCATGCCATACAC 57.409 39.130 0.00 0.00 0.00 2.90
3603 3962 2.363038 CCATGCCATACACTTTCATGGG 59.637 50.000 10.75 0.00 46.28 4.00
3615 3974 5.487488 ACACTTTCATGGGTCAATAGGAGTA 59.513 40.000 0.00 0.00 0.00 2.59
3632 3995 2.906354 AGTACCGACTCATTCCATTGC 58.094 47.619 0.00 0.00 0.00 3.56
3639 4002 2.105528 CATTCCATTGCGCCTGCC 59.894 61.111 4.18 0.00 41.78 4.85
3651 4014 1.268743 GCGCCTGCCTGATCAAATAAC 60.269 52.381 0.00 0.00 33.98 1.89
3660 4023 4.728882 GCCTGATCAAATAACTGTGCTTCG 60.729 45.833 0.00 0.00 0.00 3.79
3663 4026 6.349973 TGATCAAATAACTGTGCTTCGATC 57.650 37.500 0.00 0.00 0.00 3.69
3670 4033 2.417719 ACTGTGCTTCGATCTGGTTTC 58.582 47.619 0.00 0.00 0.00 2.78
3676 4039 4.034510 GTGCTTCGATCTGGTTTCCTTATG 59.965 45.833 0.00 0.00 0.00 1.90
3684 4047 6.018669 CGATCTGGTTTCCTTATGCTCTTTAC 60.019 42.308 0.00 0.00 0.00 2.01
3685 4048 5.497474 TCTGGTTTCCTTATGCTCTTTACC 58.503 41.667 0.00 0.00 0.00 2.85
3686 4049 5.013704 TCTGGTTTCCTTATGCTCTTTACCA 59.986 40.000 0.00 0.00 0.00 3.25
3689 4052 6.723977 TGGTTTCCTTATGCTCTTTACCATTT 59.276 34.615 0.00 0.00 0.00 2.32
3691 4054 8.094548 GGTTTCCTTATGCTCTTTACCATTTTT 58.905 33.333 0.00 0.00 0.00 1.94
3692 4055 9.140286 GTTTCCTTATGCTCTTTACCATTTTTC 57.860 33.333 0.00 0.00 0.00 2.29
3693 4056 7.083875 TCCTTATGCTCTTTACCATTTTTCG 57.916 36.000 0.00 0.00 0.00 3.46
3694 4057 5.743872 CCTTATGCTCTTTACCATTTTTCGC 59.256 40.000 0.00 0.00 0.00 4.70
3695 4058 6.404734 CCTTATGCTCTTTACCATTTTTCGCT 60.405 38.462 0.00 0.00 0.00 4.93
3739 4106 2.380064 TTTCTTCCCACAGTGCCAAT 57.620 45.000 0.00 0.00 0.00 3.16
3744 4111 0.409092 TCCCACAGTGCCAATGGAAT 59.591 50.000 2.05 0.00 35.33 3.01
3769 4136 5.587844 CCAGAGGATTGTTGTTCCTTCTATG 59.412 44.000 0.00 0.00 43.75 2.23
3771 4138 7.331026 CAGAGGATTGTTGTTCCTTCTATGTA 58.669 38.462 0.00 0.00 43.75 2.29
3772 4139 7.824289 CAGAGGATTGTTGTTCCTTCTATGTAA 59.176 37.037 0.00 0.00 43.75 2.41
3773 4140 7.824779 AGAGGATTGTTGTTCCTTCTATGTAAC 59.175 37.037 0.00 0.00 43.75 2.50
3774 4141 7.690256 AGGATTGTTGTTCCTTCTATGTAACT 58.310 34.615 0.00 0.00 40.84 2.24
3775 4142 8.822805 AGGATTGTTGTTCCTTCTATGTAACTA 58.177 33.333 0.00 0.00 40.84 2.24
3776 4143 9.099454 GGATTGTTGTTCCTTCTATGTAACTAG 57.901 37.037 0.00 0.00 0.00 2.57
3777 4144 7.900782 TTGTTGTTCCTTCTATGTAACTAGC 57.099 36.000 0.00 0.00 0.00 3.42
3778 4145 6.999950 TGTTGTTCCTTCTATGTAACTAGCA 58.000 36.000 0.00 0.00 0.00 3.49
3779 4146 7.446769 TGTTGTTCCTTCTATGTAACTAGCAA 58.553 34.615 0.00 0.00 0.00 3.91
3780 4147 7.602644 TGTTGTTCCTTCTATGTAACTAGCAAG 59.397 37.037 0.00 0.00 0.00 4.01
3781 4148 7.476540 TGTTCCTTCTATGTAACTAGCAAGA 57.523 36.000 0.00 0.00 0.00 3.02
3782 4149 8.079211 TGTTCCTTCTATGTAACTAGCAAGAT 57.921 34.615 0.00 0.00 0.00 2.40
3783 4150 7.981789 TGTTCCTTCTATGTAACTAGCAAGATG 59.018 37.037 0.00 0.00 0.00 2.90
3784 4151 6.516718 TCCTTCTATGTAACTAGCAAGATGC 58.483 40.000 0.00 0.00 45.46 3.91
3785 4152 5.698545 CCTTCTATGTAACTAGCAAGATGCC 59.301 44.000 0.00 0.00 46.52 4.40
3786 4153 5.215252 TCTATGTAACTAGCAAGATGCCC 57.785 43.478 0.00 0.00 46.52 5.36
3787 4154 2.309528 TGTAACTAGCAAGATGCCCG 57.690 50.000 0.00 0.00 46.52 6.13
3788 4155 1.553248 TGTAACTAGCAAGATGCCCGT 59.447 47.619 0.00 0.00 46.52 5.28
3789 4156 1.933853 GTAACTAGCAAGATGCCCGTG 59.066 52.381 0.00 0.00 46.52 4.94
3790 4157 1.026718 AACTAGCAAGATGCCCGTGC 61.027 55.000 6.11 6.11 46.52 5.34
3806 4173 2.638744 TGCATTGCACGGAACATCA 58.361 47.368 7.38 0.00 31.71 3.07
3807 4174 0.957362 TGCATTGCACGGAACATCAA 59.043 45.000 7.38 0.00 31.71 2.57
3808 4175 1.068402 TGCATTGCACGGAACATCAAG 60.068 47.619 7.38 0.00 31.71 3.02
3809 4176 1.199789 GCATTGCACGGAACATCAAGA 59.800 47.619 3.15 0.00 0.00 3.02
3810 4177 2.159338 GCATTGCACGGAACATCAAGAT 60.159 45.455 3.15 0.00 0.00 2.40
3811 4178 3.431856 CATTGCACGGAACATCAAGATG 58.568 45.455 8.45 8.45 44.15 2.90
3812 4179 0.804364 TGCACGGAACATCAAGATGC 59.196 50.000 9.85 0.00 42.39 3.91
3813 4180 0.804364 GCACGGAACATCAAGATGCA 59.196 50.000 9.85 0.00 42.39 3.96
3814 4181 1.402968 GCACGGAACATCAAGATGCAT 59.597 47.619 9.85 0.00 42.39 3.96
3815 4182 2.159338 GCACGGAACATCAAGATGCATT 60.159 45.455 9.85 0.00 42.39 3.56
3816 4183 3.674138 GCACGGAACATCAAGATGCATTT 60.674 43.478 9.85 0.00 42.39 2.32
3817 4184 4.487948 CACGGAACATCAAGATGCATTTT 58.512 39.130 9.85 0.00 42.39 1.82
3818 4185 4.925054 CACGGAACATCAAGATGCATTTTT 59.075 37.500 9.85 0.00 42.39 1.94
3850 4217 4.985413 ACCTGTTGTGATTAAATCATGCG 58.015 39.130 0.00 0.00 42.04 4.73
3851 4218 4.142403 ACCTGTTGTGATTAAATCATGCGG 60.142 41.667 0.00 0.00 42.04 5.69
3852 4219 4.353737 CTGTTGTGATTAAATCATGCGGG 58.646 43.478 0.00 0.00 42.04 6.13
3853 4220 4.013050 TGTTGTGATTAAATCATGCGGGA 58.987 39.130 0.00 0.00 42.04 5.14
3854 4221 4.096231 TGTTGTGATTAAATCATGCGGGAG 59.904 41.667 0.00 0.00 42.04 4.30
3855 4222 3.884895 TGTGATTAAATCATGCGGGAGT 58.115 40.909 0.00 0.00 42.04 3.85
3856 4223 5.029807 TGTGATTAAATCATGCGGGAGTA 57.970 39.130 0.00 0.00 42.04 2.59
3857 4224 5.432645 TGTGATTAAATCATGCGGGAGTAA 58.567 37.500 0.00 0.00 42.04 2.24
3858 4225 6.061441 TGTGATTAAATCATGCGGGAGTAAT 58.939 36.000 0.00 0.00 42.04 1.89
3859 4226 6.545666 TGTGATTAAATCATGCGGGAGTAATT 59.454 34.615 0.00 0.00 42.04 1.40
3860 4227 7.717436 TGTGATTAAATCATGCGGGAGTAATTA 59.283 33.333 0.00 0.00 42.04 1.40
3861 4228 8.015658 GTGATTAAATCATGCGGGAGTAATTAC 58.984 37.037 7.57 7.57 42.04 1.89
3862 4229 7.717436 TGATTAAATCATGCGGGAGTAATTACA 59.283 33.333 17.65 0.00 33.59 2.41
3863 4230 8.635765 ATTAAATCATGCGGGAGTAATTACAT 57.364 30.769 17.65 3.10 0.00 2.29
3864 4231 5.947228 AATCATGCGGGAGTAATTACATG 57.053 39.130 17.65 10.87 36.97 3.21
3865 4232 4.415881 TCATGCGGGAGTAATTACATGT 57.584 40.909 17.65 2.69 36.96 3.21
3866 4233 4.126437 TCATGCGGGAGTAATTACATGTG 58.874 43.478 17.65 6.06 36.96 3.21
3867 4234 3.620427 TGCGGGAGTAATTACATGTGT 57.380 42.857 17.65 0.00 0.00 3.72
3868 4235 4.739587 TGCGGGAGTAATTACATGTGTA 57.260 40.909 17.65 0.00 0.00 2.90
3869 4236 5.087391 TGCGGGAGTAATTACATGTGTAA 57.913 39.130 17.65 7.94 43.71 2.41
3870 4237 5.489249 TGCGGGAGTAATTACATGTGTAAA 58.511 37.500 17.65 0.00 42.93 2.01
3871 4238 5.938710 TGCGGGAGTAATTACATGTGTAAAA 59.061 36.000 17.65 0.00 42.93 1.52
3872 4239 6.430308 TGCGGGAGTAATTACATGTGTAAAAA 59.570 34.615 17.65 0.00 42.93 1.94
3873 4240 6.744082 GCGGGAGTAATTACATGTGTAAAAAC 59.256 38.462 17.65 10.10 42.93 2.43
3874 4241 7.361457 GCGGGAGTAATTACATGTGTAAAAACT 60.361 37.037 17.65 16.74 42.93 2.66
3875 4242 9.153721 CGGGAGTAATTACATGTGTAAAAACTA 57.846 33.333 17.65 0.00 42.93 2.24
3898 4265 9.653516 ACTAATGATATCTCAAGAAAGAGGAGA 57.346 33.333 3.98 0.00 41.50 3.71
3900 4267 8.780616 AATGATATCTCAAGAAAGAGGAGAGA 57.219 34.615 3.98 0.00 40.67 3.10
3901 4268 8.961293 ATGATATCTCAAGAAAGAGGAGAGAT 57.039 34.615 3.98 0.00 45.24 2.75
3903 4270 9.874195 TGATATCTCAAGAAAGAGGAGAGATAA 57.126 33.333 12.69 0.00 45.82 1.75
3906 4273 6.872920 TCTCAAGAAAGAGGAGAGATAAAGC 58.127 40.000 0.00 0.00 36.30 3.51
3907 4274 5.655488 TCAAGAAAGAGGAGAGATAAAGCG 58.345 41.667 0.00 0.00 0.00 4.68
3908 4275 5.419155 TCAAGAAAGAGGAGAGATAAAGCGA 59.581 40.000 0.00 0.00 0.00 4.93
3909 4276 5.514274 AGAAAGAGGAGAGATAAAGCGAG 57.486 43.478 0.00 0.00 0.00 5.03
3910 4277 4.340950 AGAAAGAGGAGAGATAAAGCGAGG 59.659 45.833 0.00 0.00 0.00 4.63
3911 4278 3.586470 AGAGGAGAGATAAAGCGAGGA 57.414 47.619 0.00 0.00 0.00 3.71
3912 4279 3.486383 AGAGGAGAGATAAAGCGAGGAG 58.514 50.000 0.00 0.00 0.00 3.69
3913 4280 2.556622 GAGGAGAGATAAAGCGAGGAGG 59.443 54.545 0.00 0.00 0.00 4.30
3914 4281 2.175931 AGGAGAGATAAAGCGAGGAGGA 59.824 50.000 0.00 0.00 0.00 3.71
3915 4282 2.556622 GGAGAGATAAAGCGAGGAGGAG 59.443 54.545 0.00 0.00 0.00 3.69
3916 4283 3.219281 GAGAGATAAAGCGAGGAGGAGT 58.781 50.000 0.00 0.00 0.00 3.85
3917 4284 2.955660 AGAGATAAAGCGAGGAGGAGTG 59.044 50.000 0.00 0.00 0.00 3.51
3918 4285 2.035321 GAGATAAAGCGAGGAGGAGTGG 59.965 54.545 0.00 0.00 0.00 4.00
3919 4286 1.069358 GATAAAGCGAGGAGGAGTGGG 59.931 57.143 0.00 0.00 0.00 4.61
3920 4287 0.976073 TAAAGCGAGGAGGAGTGGGG 60.976 60.000 0.00 0.00 0.00 4.96
3924 4291 3.775654 GAGGAGGAGTGGGGCGTG 61.776 72.222 0.00 0.00 0.00 5.34
3927 4294 4.394712 GAGGAGTGGGGCGTGGTG 62.395 72.222 0.00 0.00 0.00 4.17
3932 4299 4.344865 GTGGGGCGTGGTGGTGAT 62.345 66.667 0.00 0.00 0.00 3.06
3933 4300 3.575247 TGGGGCGTGGTGGTGATT 61.575 61.111 0.00 0.00 0.00 2.57
3934 4301 3.061848 GGGGCGTGGTGGTGATTG 61.062 66.667 0.00 0.00 0.00 2.67
3935 4302 2.033448 GGGCGTGGTGGTGATTGA 59.967 61.111 0.00 0.00 0.00 2.57
3936 4303 1.378514 GGGCGTGGTGGTGATTGAT 60.379 57.895 0.00 0.00 0.00 2.57
3937 4304 1.656818 GGGCGTGGTGGTGATTGATG 61.657 60.000 0.00 0.00 0.00 3.07
3938 4305 1.656818 GGCGTGGTGGTGATTGATGG 61.657 60.000 0.00 0.00 0.00 3.51
3939 4306 0.960364 GCGTGGTGGTGATTGATGGT 60.960 55.000 0.00 0.00 0.00 3.55
3940 4307 1.086696 CGTGGTGGTGATTGATGGTC 58.913 55.000 0.00 0.00 0.00 4.02
3941 4308 1.086696 GTGGTGGTGATTGATGGTCG 58.913 55.000 0.00 0.00 0.00 4.79
3942 4309 0.035534 TGGTGGTGATTGATGGTCGG 60.036 55.000 0.00 0.00 0.00 4.79
3943 4310 0.251916 GGTGGTGATTGATGGTCGGA 59.748 55.000 0.00 0.00 0.00 4.55
3944 4311 1.369625 GTGGTGATTGATGGTCGGAC 58.630 55.000 0.00 0.00 0.00 4.79
3945 4312 1.066143 GTGGTGATTGATGGTCGGACT 60.066 52.381 8.23 0.00 0.00 3.85
3946 4313 1.066215 TGGTGATTGATGGTCGGACTG 60.066 52.381 8.23 0.00 0.00 3.51
3947 4314 1.207089 GGTGATTGATGGTCGGACTGA 59.793 52.381 8.23 0.00 0.00 3.41
3948 4315 2.544685 GTGATTGATGGTCGGACTGAG 58.455 52.381 8.23 0.00 0.00 3.35
3949 4316 2.166459 GTGATTGATGGTCGGACTGAGA 59.834 50.000 8.23 0.00 0.00 3.27
3950 4317 3.033909 TGATTGATGGTCGGACTGAGAT 58.966 45.455 8.23 0.00 0.00 2.75
3951 4318 2.967599 TTGATGGTCGGACTGAGATG 57.032 50.000 8.23 0.00 0.00 2.90
3952 4319 2.143876 TGATGGTCGGACTGAGATGA 57.856 50.000 8.23 0.00 0.00 2.92
3953 4320 2.027385 TGATGGTCGGACTGAGATGAG 58.973 52.381 8.23 0.00 0.00 2.90
3954 4321 1.339610 GATGGTCGGACTGAGATGAGG 59.660 57.143 8.23 0.00 0.00 3.86
3955 4322 1.323271 TGGTCGGACTGAGATGAGGC 61.323 60.000 8.23 0.00 0.00 4.70
3956 4323 1.323271 GGTCGGACTGAGATGAGGCA 61.323 60.000 8.23 0.00 0.00 4.75
3957 4324 0.749649 GTCGGACTGAGATGAGGCAT 59.250 55.000 0.00 0.00 0.00 4.40
3958 4325 0.749049 TCGGACTGAGATGAGGCATG 59.251 55.000 0.00 0.00 0.00 4.06
3959 4326 0.249784 CGGACTGAGATGAGGCATGG 60.250 60.000 0.00 0.00 0.00 3.66
3960 4327 0.108207 GGACTGAGATGAGGCATGGG 59.892 60.000 0.00 0.00 0.00 4.00
3961 4328 0.108207 GACTGAGATGAGGCATGGGG 59.892 60.000 0.00 0.00 0.00 4.96
3962 4329 0.326904 ACTGAGATGAGGCATGGGGA 60.327 55.000 0.00 0.00 0.00 4.81
3963 4330 1.065647 CTGAGATGAGGCATGGGGAT 58.934 55.000 0.00 0.00 0.00 3.85
3964 4331 0.769247 TGAGATGAGGCATGGGGATG 59.231 55.000 0.00 0.00 0.00 3.51
3965 4332 0.037877 GAGATGAGGCATGGGGATGG 59.962 60.000 0.00 0.00 0.00 3.51
3966 4333 0.402419 AGATGAGGCATGGGGATGGA 60.402 55.000 0.00 0.00 0.00 3.41
3967 4334 0.251077 GATGAGGCATGGGGATGGAC 60.251 60.000 0.00 0.00 0.00 4.02
3968 4335 2.060567 ATGAGGCATGGGGATGGACG 62.061 60.000 0.00 0.00 0.00 4.79
3969 4336 2.366837 AGGCATGGGGATGGACGA 60.367 61.111 0.00 0.00 0.00 4.20
3970 4337 2.203209 GGCATGGGGATGGACGAC 60.203 66.667 0.00 0.00 0.00 4.34
3971 4338 2.589540 GCATGGGGATGGACGACA 59.410 61.111 0.00 0.00 0.00 4.35
3972 4339 1.819632 GCATGGGGATGGACGACAC 60.820 63.158 0.00 0.00 0.00 3.67
3973 4340 1.153168 CATGGGGATGGACGACACC 60.153 63.158 0.00 0.00 0.00 4.16
3974 4341 2.731571 ATGGGGATGGACGACACCG 61.732 63.158 0.00 0.00 42.50 4.94
3975 4342 3.072468 GGGGATGGACGACACCGA 61.072 66.667 0.00 0.00 39.50 4.69
3976 4343 2.183555 GGGATGGACGACACCGAC 59.816 66.667 0.00 0.00 39.50 4.79
3977 4344 2.642254 GGGATGGACGACACCGACA 61.642 63.158 0.00 0.00 39.50 4.35
3978 4345 1.153823 GGATGGACGACACCGACAG 60.154 63.158 0.00 0.00 39.50 3.51
3979 4346 1.585006 GATGGACGACACCGACAGT 59.415 57.895 0.00 0.00 39.50 3.55
3987 4354 4.248842 CACCGACAGTGGCCACCA 62.249 66.667 32.29 0.00 43.26 4.17
3988 4355 3.249189 ACCGACAGTGGCCACCAT 61.249 61.111 32.29 20.78 35.28 3.55
3989 4356 2.747460 CCGACAGTGGCCACCATG 60.747 66.667 32.29 25.82 35.28 3.66
3990 4357 3.434319 CGACAGTGGCCACCATGC 61.434 66.667 32.29 17.62 35.28 4.06
3991 4358 2.034687 GACAGTGGCCACCATGCT 59.965 61.111 32.29 10.87 35.28 3.79
3992 4359 1.299648 GACAGTGGCCACCATGCTA 59.700 57.895 32.29 0.00 35.28 3.49
3993 4360 0.745845 GACAGTGGCCACCATGCTAG 60.746 60.000 32.29 15.11 35.28 3.42
3994 4361 1.200760 ACAGTGGCCACCATGCTAGA 61.201 55.000 32.29 0.00 35.28 2.43
3995 4362 0.182061 CAGTGGCCACCATGCTAGAT 59.818 55.000 32.29 7.53 35.28 1.98
3996 4363 0.921896 AGTGGCCACCATGCTAGATT 59.078 50.000 32.29 6.70 35.28 2.40
3997 4364 1.027357 GTGGCCACCATGCTAGATTG 58.973 55.000 26.31 0.00 35.28 2.67
3998 4365 0.625316 TGGCCACCATGCTAGATTGT 59.375 50.000 0.00 0.00 0.00 2.71
3999 4366 1.005805 TGGCCACCATGCTAGATTGTT 59.994 47.619 0.00 0.00 0.00 2.83
4000 4367 1.678101 GGCCACCATGCTAGATTGTTC 59.322 52.381 0.00 0.00 0.00 3.18
4001 4368 1.678101 GCCACCATGCTAGATTGTTCC 59.322 52.381 0.00 0.00 0.00 3.62
4002 4369 2.945440 GCCACCATGCTAGATTGTTCCA 60.945 50.000 0.00 0.00 0.00 3.53
4003 4370 2.947652 CCACCATGCTAGATTGTTCCAG 59.052 50.000 0.00 0.00 0.00 3.86
4004 4371 3.370846 CCACCATGCTAGATTGTTCCAGA 60.371 47.826 0.00 0.00 0.00 3.86
4005 4372 3.875727 CACCATGCTAGATTGTTCCAGAG 59.124 47.826 0.00 0.00 0.00 3.35
4006 4373 3.776969 ACCATGCTAGATTGTTCCAGAGA 59.223 43.478 0.00 0.00 0.00 3.10
4007 4374 4.125703 CCATGCTAGATTGTTCCAGAGAC 58.874 47.826 0.00 0.00 0.00 3.36
4008 4375 4.141756 CCATGCTAGATTGTTCCAGAGACT 60.142 45.833 0.00 0.00 0.00 3.24
4009 4376 5.426504 CATGCTAGATTGTTCCAGAGACTT 58.573 41.667 0.00 0.00 0.00 3.01
4010 4377 5.078411 TGCTAGATTGTTCCAGAGACTTC 57.922 43.478 0.00 0.00 0.00 3.01
4011 4378 4.081420 TGCTAGATTGTTCCAGAGACTTCC 60.081 45.833 0.00 0.00 0.00 3.46
4012 4379 4.161377 GCTAGATTGTTCCAGAGACTTCCT 59.839 45.833 0.00 0.00 0.00 3.36
4013 4380 5.337975 GCTAGATTGTTCCAGAGACTTCCTT 60.338 44.000 0.00 0.00 0.00 3.36
4014 4381 5.574970 AGATTGTTCCAGAGACTTCCTTT 57.425 39.130 0.00 0.00 0.00 3.11
4015 4382 5.946486 AGATTGTTCCAGAGACTTCCTTTT 58.054 37.500 0.00 0.00 0.00 2.27
4016 4383 6.368805 AGATTGTTCCAGAGACTTCCTTTTT 58.631 36.000 0.00 0.00 0.00 1.94
4049 4416 4.970662 CAATGTGGTTGTGGGAGATAAG 57.029 45.455 0.00 0.00 33.01 1.73
4050 4417 3.652057 ATGTGGTTGTGGGAGATAAGG 57.348 47.619 0.00 0.00 0.00 2.69
4051 4418 2.626785 TGTGGTTGTGGGAGATAAGGA 58.373 47.619 0.00 0.00 0.00 3.36
4052 4419 3.189606 TGTGGTTGTGGGAGATAAGGAT 58.810 45.455 0.00 0.00 0.00 3.24
4053 4420 3.054434 TGTGGTTGTGGGAGATAAGGATG 60.054 47.826 0.00 0.00 0.00 3.51
4054 4421 3.199946 GTGGTTGTGGGAGATAAGGATGA 59.800 47.826 0.00 0.00 0.00 2.92
4055 4422 3.849574 TGGTTGTGGGAGATAAGGATGAA 59.150 43.478 0.00 0.00 0.00 2.57
4056 4423 4.200092 GGTTGTGGGAGATAAGGATGAAC 58.800 47.826 0.00 0.00 0.00 3.18
4057 4424 3.819564 TGTGGGAGATAAGGATGAACG 57.180 47.619 0.00 0.00 0.00 3.95
4058 4425 3.371034 TGTGGGAGATAAGGATGAACGA 58.629 45.455 0.00 0.00 0.00 3.85
4059 4426 3.384789 TGTGGGAGATAAGGATGAACGAG 59.615 47.826 0.00 0.00 0.00 4.18
4060 4427 2.965831 TGGGAGATAAGGATGAACGAGG 59.034 50.000 0.00 0.00 0.00 4.63
4061 4428 2.300437 GGGAGATAAGGATGAACGAGGG 59.700 54.545 0.00 0.00 0.00 4.30
4062 4429 3.231818 GGAGATAAGGATGAACGAGGGA 58.768 50.000 0.00 0.00 0.00 4.20
4063 4430 3.641906 GGAGATAAGGATGAACGAGGGAA 59.358 47.826 0.00 0.00 0.00 3.97
4064 4431 4.501743 GGAGATAAGGATGAACGAGGGAAC 60.502 50.000 0.00 0.00 0.00 3.62
4065 4432 2.953466 TAAGGATGAACGAGGGAACG 57.047 50.000 0.00 0.00 39.31 3.95
4066 4433 0.391263 AAGGATGAACGAGGGAACGC 60.391 55.000 0.00 0.00 36.70 4.84
4067 4434 1.814169 GGATGAACGAGGGAACGCC 60.814 63.158 0.00 0.00 36.70 5.68
4068 4435 1.218316 GATGAACGAGGGAACGCCT 59.782 57.895 0.00 0.00 36.70 5.52
4069 4436 0.391263 GATGAACGAGGGAACGCCTT 60.391 55.000 0.00 0.00 36.70 4.35
4070 4437 0.036306 ATGAACGAGGGAACGCCTTT 59.964 50.000 0.00 0.00 36.70 3.11
4071 4438 0.882927 TGAACGAGGGAACGCCTTTG 60.883 55.000 0.00 0.00 36.70 2.77
4072 4439 2.183858 GAACGAGGGAACGCCTTTGC 62.184 60.000 0.00 0.00 36.70 3.68
4073 4440 2.668212 CGAGGGAACGCCTTTGCA 60.668 61.111 0.00 0.00 37.32 4.08
4074 4441 2.258013 CGAGGGAACGCCTTTGCAA 61.258 57.895 0.00 0.00 37.32 4.08
4075 4442 1.791103 CGAGGGAACGCCTTTGCAAA 61.791 55.000 12.14 12.14 37.32 3.68
4076 4443 0.603065 GAGGGAACGCCTTTGCAAAT 59.397 50.000 13.23 0.00 37.32 2.32
4077 4444 0.318120 AGGGAACGCCTTTGCAAATG 59.682 50.000 13.23 11.34 37.32 2.32
4078 4445 0.033366 GGGAACGCCTTTGCAAATGT 59.967 50.000 13.23 9.04 37.32 2.71
4079 4446 1.139163 GGAACGCCTTTGCAAATGTG 58.861 50.000 21.66 21.66 37.32 3.21
4080 4447 1.139163 GAACGCCTTTGCAAATGTGG 58.861 50.000 25.25 18.62 37.32 4.17
4081 4448 0.749649 AACGCCTTTGCAAATGTGGA 59.250 45.000 25.25 0.00 37.32 4.02
4082 4449 0.314935 ACGCCTTTGCAAATGTGGAG 59.685 50.000 25.25 20.34 37.32 3.86
4083 4450 0.597568 CGCCTTTGCAAATGTGGAGA 59.402 50.000 17.63 0.00 37.32 3.71
4084 4451 1.401931 CGCCTTTGCAAATGTGGAGAG 60.402 52.381 17.63 2.24 37.32 3.20
4085 4452 1.888512 GCCTTTGCAAATGTGGAGAGA 59.111 47.619 17.63 0.00 37.47 3.10
4086 4453 2.094854 GCCTTTGCAAATGTGGAGAGAG 60.095 50.000 17.63 0.87 37.47 3.20
4087 4454 2.490903 CCTTTGCAAATGTGGAGAGAGG 59.509 50.000 13.23 1.99 29.72 3.69
4088 4455 2.957402 TTGCAAATGTGGAGAGAGGT 57.043 45.000 0.00 0.00 0.00 3.85
4089 4456 2.189594 TGCAAATGTGGAGAGAGGTG 57.810 50.000 0.00 0.00 0.00 4.00
4090 4457 0.807496 GCAAATGTGGAGAGAGGTGC 59.193 55.000 0.00 0.00 0.00 5.01
4091 4458 1.612726 GCAAATGTGGAGAGAGGTGCT 60.613 52.381 0.00 0.00 0.00 4.40
4092 4459 2.082231 CAAATGTGGAGAGAGGTGCTG 58.918 52.381 0.00 0.00 0.00 4.41
4093 4460 0.617413 AATGTGGAGAGAGGTGCTGG 59.383 55.000 0.00 0.00 0.00 4.85
4094 4461 0.546267 ATGTGGAGAGAGGTGCTGGT 60.546 55.000 0.00 0.00 0.00 4.00
4095 4462 0.114364 TGTGGAGAGAGGTGCTGGTA 59.886 55.000 0.00 0.00 0.00 3.25
4096 4463 0.533032 GTGGAGAGAGGTGCTGGTAC 59.467 60.000 0.00 0.00 0.00 3.34
4097 4464 0.409876 TGGAGAGAGGTGCTGGTACT 59.590 55.000 0.00 0.00 0.00 2.73
4098 4465 1.203187 TGGAGAGAGGTGCTGGTACTT 60.203 52.381 0.00 0.00 0.00 2.24
4099 4466 1.903183 GGAGAGAGGTGCTGGTACTTT 59.097 52.381 0.00 0.00 0.00 2.66
4100 4467 2.303311 GGAGAGAGGTGCTGGTACTTTT 59.697 50.000 0.00 0.00 0.00 2.27
4101 4468 3.244596 GGAGAGAGGTGCTGGTACTTTTT 60.245 47.826 0.00 0.00 0.00 1.94
4131 4498 9.860898 AAAATTGACATAGTTTGCTTTCTATCC 57.139 29.630 0.00 0.00 0.00 2.59
4132 4499 6.662414 TTGACATAGTTTGCTTTCTATCCG 57.338 37.500 0.00 0.00 0.00 4.18
4133 4500 5.730550 TGACATAGTTTGCTTTCTATCCGT 58.269 37.500 0.00 0.00 0.00 4.69
4134 4501 5.810587 TGACATAGTTTGCTTTCTATCCGTC 59.189 40.000 0.00 0.00 0.00 4.79
4135 4502 5.730550 ACATAGTTTGCTTTCTATCCGTCA 58.269 37.500 0.00 0.00 0.00 4.35
4136 4503 5.812642 ACATAGTTTGCTTTCTATCCGTCAG 59.187 40.000 0.00 0.00 0.00 3.51
4137 4504 4.537135 AGTTTGCTTTCTATCCGTCAGA 57.463 40.909 0.00 0.00 0.00 3.27
4138 4505 5.091261 AGTTTGCTTTCTATCCGTCAGAT 57.909 39.130 0.00 0.00 39.15 2.90
4139 4506 6.222038 AGTTTGCTTTCTATCCGTCAGATA 57.778 37.500 0.00 0.00 36.33 1.98
4140 4507 6.821388 AGTTTGCTTTCTATCCGTCAGATAT 58.179 36.000 0.00 0.00 36.84 1.63
4141 4508 7.952671 AGTTTGCTTTCTATCCGTCAGATATA 58.047 34.615 0.00 0.00 36.84 0.86
4142 4509 8.085296 AGTTTGCTTTCTATCCGTCAGATATAG 58.915 37.037 0.00 0.00 36.84 1.31
4143 4510 7.761038 TTGCTTTCTATCCGTCAGATATAGA 57.239 36.000 0.00 0.00 36.84 1.98
4144 4511 7.946381 TGCTTTCTATCCGTCAGATATAGAT 57.054 36.000 0.00 0.00 36.84 1.98
4145 4512 7.990917 TGCTTTCTATCCGTCAGATATAGATC 58.009 38.462 0.00 0.00 36.84 2.75
4146 4513 7.129622 GCTTTCTATCCGTCAGATATAGATCG 58.870 42.308 0.00 0.00 36.84 3.69
4147 4514 7.011576 GCTTTCTATCCGTCAGATATAGATCGA 59.988 40.741 0.00 0.00 36.84 3.59
4148 4515 8.788325 TTTCTATCCGTCAGATATAGATCGAA 57.212 34.615 0.00 0.00 36.84 3.71
4149 4516 7.773864 TCTATCCGTCAGATATAGATCGAAC 57.226 40.000 0.00 0.00 36.84 3.95
4150 4517 4.923264 TCCGTCAGATATAGATCGAACG 57.077 45.455 15.95 15.95 41.05 3.95
4152 4519 4.665281 CGTCAGATATAGATCGAACGGT 57.335 45.455 15.41 0.00 39.33 4.83
4153 4520 5.774878 CGTCAGATATAGATCGAACGGTA 57.225 43.478 15.41 0.00 39.33 4.02
4154 4521 6.347270 CGTCAGATATAGATCGAACGGTAT 57.653 41.667 15.41 0.00 39.33 2.73
4155 4522 7.460751 CGTCAGATATAGATCGAACGGTATA 57.539 40.000 15.41 0.00 39.33 1.47
4156 4523 8.074474 CGTCAGATATAGATCGAACGGTATAT 57.926 38.462 15.41 0.68 39.33 0.86
4157 4524 9.189723 CGTCAGATATAGATCGAACGGTATATA 57.810 37.037 15.41 4.71 39.33 0.86
4164 4531 8.858003 ATAGATCGAACGGTATATATTGCAAG 57.142 34.615 4.94 0.00 0.00 4.01
4165 4532 6.920817 AGATCGAACGGTATATATTGCAAGA 58.079 36.000 4.94 0.00 0.00 3.02
4166 4533 7.548097 AGATCGAACGGTATATATTGCAAGAT 58.452 34.615 11.88 11.88 0.00 2.40
4167 4534 6.944557 TCGAACGGTATATATTGCAAGATG 57.055 37.500 16.68 1.97 0.00 2.90
4168 4535 5.867174 TCGAACGGTATATATTGCAAGATGG 59.133 40.000 16.68 3.62 0.00 3.51
4169 4536 5.445939 CGAACGGTATATATTGCAAGATGGC 60.446 44.000 16.68 6.35 0.00 4.40
4170 4537 4.905429 ACGGTATATATTGCAAGATGGCA 58.095 39.130 16.68 0.00 43.19 4.92
4171 4538 4.937620 ACGGTATATATTGCAAGATGGCAG 59.062 41.667 16.68 9.21 45.88 4.85
4172 4539 4.333649 CGGTATATATTGCAAGATGGCAGG 59.666 45.833 16.68 0.00 45.88 4.85
4173 4540 4.096984 GGTATATATTGCAAGATGGCAGGC 59.903 45.833 16.68 1.52 45.88 4.85
4174 4541 2.076207 ATATTGCAAGATGGCAGGCA 57.924 45.000 5.61 0.00 45.88 4.75
4175 4542 1.105457 TATTGCAAGATGGCAGGCAC 58.895 50.000 4.94 0.00 45.88 5.01
4176 4543 0.901114 ATTGCAAGATGGCAGGCACA 60.901 50.000 4.94 0.00 45.88 4.57
4177 4544 1.808531 TTGCAAGATGGCAGGCACAC 61.809 55.000 0.00 0.00 45.88 3.82
4178 4545 2.998279 GCAAGATGGCAGGCACACC 61.998 63.158 0.00 0.00 0.00 4.16
4179 4546 1.604308 CAAGATGGCAGGCACACCA 60.604 57.895 0.00 0.00 41.01 4.17
4182 4549 2.765279 ATGGCAGGCACACCATCA 59.235 55.556 0.00 0.00 42.69 3.07
4183 4550 1.308666 ATGGCAGGCACACCATCAT 59.691 52.632 0.00 0.00 42.69 2.45
4184 4551 0.754217 ATGGCAGGCACACCATCATC 60.754 55.000 0.00 0.00 42.69 2.92
4185 4552 1.378911 GGCAGGCACACCATCATCA 60.379 57.895 0.00 0.00 39.06 3.07
4186 4553 1.660560 GGCAGGCACACCATCATCAC 61.661 60.000 0.00 0.00 39.06 3.06
4187 4554 1.660560 GCAGGCACACCATCATCACC 61.661 60.000 0.00 0.00 39.06 4.02
4188 4555 1.078214 AGGCACACCATCATCACCG 60.078 57.895 0.00 0.00 39.06 4.94
4189 4556 1.078497 GGCACACCATCATCACCGA 60.078 57.895 0.00 0.00 35.26 4.69
4190 4557 1.369091 GGCACACCATCATCACCGAC 61.369 60.000 0.00 0.00 35.26 4.79
4191 4558 0.391661 GCACACCATCATCACCGACT 60.392 55.000 0.00 0.00 0.00 4.18
4192 4559 1.645034 CACACCATCATCACCGACTC 58.355 55.000 0.00 0.00 0.00 3.36
4193 4560 0.173481 ACACCATCATCACCGACTCG 59.827 55.000 0.00 0.00 0.00 4.18
4252 4619 8.594881 ATCATTATCTTCACTAATCGTCAACC 57.405 34.615 0.00 0.00 0.00 3.77
4253 4620 7.782049 TCATTATCTTCACTAATCGTCAACCT 58.218 34.615 0.00 0.00 0.00 3.50
4254 4621 7.706607 TCATTATCTTCACTAATCGTCAACCTG 59.293 37.037 0.00 0.00 0.00 4.00
4255 4622 4.866508 TCTTCACTAATCGTCAACCTGT 57.133 40.909 0.00 0.00 0.00 4.00
4256 4623 5.970317 TCTTCACTAATCGTCAACCTGTA 57.030 39.130 0.00 0.00 0.00 2.74
4257 4624 6.525578 TCTTCACTAATCGTCAACCTGTAT 57.474 37.500 0.00 0.00 0.00 2.29
4258 4625 6.561614 TCTTCACTAATCGTCAACCTGTATC 58.438 40.000 0.00 0.00 0.00 2.24
4259 4626 5.258456 TCACTAATCGTCAACCTGTATCC 57.742 43.478 0.00 0.00 0.00 2.59
4260 4627 4.098960 TCACTAATCGTCAACCTGTATCCC 59.901 45.833 0.00 0.00 0.00 3.85
4261 4628 4.028131 ACTAATCGTCAACCTGTATCCCA 58.972 43.478 0.00 0.00 0.00 4.37
4262 4629 3.992943 AATCGTCAACCTGTATCCCAA 57.007 42.857 0.00 0.00 0.00 4.12
4263 4630 4.503714 AATCGTCAACCTGTATCCCAAT 57.496 40.909 0.00 0.00 0.00 3.16
4264 4631 3.992943 TCGTCAACCTGTATCCCAATT 57.007 42.857 0.00 0.00 0.00 2.32
4265 4632 4.295141 TCGTCAACCTGTATCCCAATTT 57.705 40.909 0.00 0.00 0.00 1.82
4266 4633 4.006989 TCGTCAACCTGTATCCCAATTTG 58.993 43.478 0.00 0.00 0.00 2.32
4267 4634 3.427503 CGTCAACCTGTATCCCAATTTGC 60.428 47.826 0.00 0.00 0.00 3.68
4268 4635 3.096092 TCAACCTGTATCCCAATTTGCC 58.904 45.455 0.00 0.00 0.00 4.52
4269 4636 2.830923 CAACCTGTATCCCAATTTGCCA 59.169 45.455 0.00 0.00 0.00 4.92
4270 4637 3.403228 ACCTGTATCCCAATTTGCCAT 57.597 42.857 0.00 0.00 0.00 4.40
4271 4638 3.723325 ACCTGTATCCCAATTTGCCATT 58.277 40.909 0.00 0.00 0.00 3.16
4272 4639 4.103342 ACCTGTATCCCAATTTGCCATTT 58.897 39.130 0.00 0.00 0.00 2.32
4273 4640 4.162131 ACCTGTATCCCAATTTGCCATTTC 59.838 41.667 0.00 0.00 0.00 2.17
4274 4641 4.161942 CCTGTATCCCAATTTGCCATTTCA 59.838 41.667 0.00 0.00 0.00 2.69
4275 4642 5.338219 CCTGTATCCCAATTTGCCATTTCAA 60.338 40.000 0.00 0.00 0.00 2.69
4276 4643 5.486526 TGTATCCCAATTTGCCATTTCAAC 58.513 37.500 0.00 0.00 0.00 3.18
4277 4644 3.415457 TCCCAATTTGCCATTTCAACC 57.585 42.857 0.00 0.00 0.00 3.77
4278 4645 2.075338 CCCAATTTGCCATTTCAACCG 58.925 47.619 0.00 0.00 0.00 4.44
4279 4646 1.464219 CCAATTTGCCATTTCAACCGC 59.536 47.619 0.00 0.00 0.00 5.68
4280 4647 1.126479 CAATTTGCCATTTCAACCGCG 59.874 47.619 0.00 0.00 0.00 6.46
4281 4648 0.600557 ATTTGCCATTTCAACCGCGA 59.399 45.000 8.23 0.00 0.00 5.87
4282 4649 0.385751 TTTGCCATTTCAACCGCGAA 59.614 45.000 8.23 0.00 0.00 4.70
4283 4650 0.039617 TTGCCATTTCAACCGCGAAG 60.040 50.000 8.23 0.00 0.00 3.79
4284 4651 0.886938 TGCCATTTCAACCGCGAAGA 60.887 50.000 8.23 0.00 0.00 2.87
4285 4652 0.239879 GCCATTTCAACCGCGAAGAA 59.760 50.000 8.23 5.63 0.00 2.52
4286 4653 1.135402 GCCATTTCAACCGCGAAGAAT 60.135 47.619 8.23 0.00 0.00 2.40
4287 4654 2.518949 CCATTTCAACCGCGAAGAATG 58.481 47.619 8.23 10.29 0.00 2.67
4288 4655 1.913403 CATTTCAACCGCGAAGAATGC 59.087 47.619 8.23 0.00 0.00 3.56
4289 4656 0.239879 TTTCAACCGCGAAGAATGCC 59.760 50.000 8.23 0.00 0.00 4.40
4290 4657 1.906994 TTCAACCGCGAAGAATGCCG 61.907 55.000 8.23 0.00 0.00 5.69
4291 4658 3.124921 AACCGCGAAGAATGCCGG 61.125 61.111 8.23 0.00 33.96 6.13
4292 4659 3.894547 AACCGCGAAGAATGCCGGT 62.895 57.895 8.23 0.00 39.64 5.28
4293 4660 3.124921 CCGCGAAGAATGCCGGTT 61.125 61.111 8.23 0.00 0.00 4.44
4294 4661 1.812093 CCGCGAAGAATGCCGGTTA 60.812 57.895 8.23 0.00 0.00 2.85
4295 4662 1.363145 CCGCGAAGAATGCCGGTTAA 61.363 55.000 8.23 0.00 0.00 2.01
4296 4663 0.444651 CGCGAAGAATGCCGGTTAAA 59.555 50.000 0.00 0.00 0.00 1.52
4297 4664 1.135916 CGCGAAGAATGCCGGTTAAAA 60.136 47.619 0.00 0.00 0.00 1.52
4298 4665 2.666069 CGCGAAGAATGCCGGTTAAAAA 60.666 45.455 0.00 0.00 0.00 1.94
4321 4688 7.961326 AAAAAGTTATTCCTATGAGGCACAT 57.039 32.000 2.34 2.34 42.39 3.21
4323 4690 9.646522 AAAAAGTTATTCCTATGAGGCACATAT 57.353 29.630 5.09 0.00 40.18 1.78
4324 4691 8.854614 AAAGTTATTCCTATGAGGCACATATC 57.145 34.615 5.09 0.00 40.18 1.63
4325 4692 6.951971 AGTTATTCCTATGAGGCACATATCC 58.048 40.000 5.09 0.00 40.18 2.59
4326 4693 6.501805 AGTTATTCCTATGAGGCACATATCCA 59.498 38.462 5.09 0.00 40.18 3.41
4327 4694 4.897509 TTCCTATGAGGCACATATCCAG 57.102 45.455 5.09 0.00 40.18 3.86
4328 4695 4.132122 TCCTATGAGGCACATATCCAGA 57.868 45.455 5.09 0.00 40.18 3.86
4329 4696 3.834813 TCCTATGAGGCACATATCCAGAC 59.165 47.826 5.09 0.00 40.18 3.51
4330 4697 3.055530 CCTATGAGGCACATATCCAGACC 60.056 52.174 5.09 0.00 40.18 3.85
4331 4698 1.131638 TGAGGCACATATCCAGACCC 58.868 55.000 0.00 0.00 0.00 4.46
4332 4699 1.344393 TGAGGCACATATCCAGACCCT 60.344 52.381 0.00 0.00 0.00 4.34
4333 4700 1.771255 GAGGCACATATCCAGACCCTT 59.229 52.381 0.00 0.00 0.00 3.95
4334 4701 2.972713 GAGGCACATATCCAGACCCTTA 59.027 50.000 0.00 0.00 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 3.839490 ACCTTCAAATCCATGCAATCCAA 59.161 39.130 0.00 0.00 0.00 3.53
1 2 3.443052 ACCTTCAAATCCATGCAATCCA 58.557 40.909 0.00 0.00 0.00 3.41
2 3 4.476628 AACCTTCAAATCCATGCAATCC 57.523 40.909 0.00 0.00 0.00 3.01
3 4 4.632688 CCAAACCTTCAAATCCATGCAATC 59.367 41.667 0.00 0.00 0.00 2.67
4 5 4.286549 TCCAAACCTTCAAATCCATGCAAT 59.713 37.500 0.00 0.00 0.00 3.56
5 6 3.645212 TCCAAACCTTCAAATCCATGCAA 59.355 39.130 0.00 0.00 0.00 4.08
6 7 3.237746 TCCAAACCTTCAAATCCATGCA 58.762 40.909 0.00 0.00 0.00 3.96
7 8 3.959535 TCCAAACCTTCAAATCCATGC 57.040 42.857 0.00 0.00 0.00 4.06
8 9 5.047164 TCACATCCAAACCTTCAAATCCATG 60.047 40.000 0.00 0.00 0.00 3.66
9 10 5.085920 TCACATCCAAACCTTCAAATCCAT 58.914 37.500 0.00 0.00 0.00 3.41
10 11 4.478203 TCACATCCAAACCTTCAAATCCA 58.522 39.130 0.00 0.00 0.00 3.41
11 12 4.082026 CCTCACATCCAAACCTTCAAATCC 60.082 45.833 0.00 0.00 0.00 3.01
12 13 4.766891 TCCTCACATCCAAACCTTCAAATC 59.233 41.667 0.00 0.00 0.00 2.17
13 14 4.739793 TCCTCACATCCAAACCTTCAAAT 58.260 39.130 0.00 0.00 0.00 2.32
14 15 4.144297 CTCCTCACATCCAAACCTTCAAA 58.856 43.478 0.00 0.00 0.00 2.69
15 16 3.138283 ACTCCTCACATCCAAACCTTCAA 59.862 43.478 0.00 0.00 0.00 2.69
16 17 2.711009 ACTCCTCACATCCAAACCTTCA 59.289 45.455 0.00 0.00 0.00 3.02
17 18 3.077359 CACTCCTCACATCCAAACCTTC 58.923 50.000 0.00 0.00 0.00 3.46
18 19 2.815589 GCACTCCTCACATCCAAACCTT 60.816 50.000 0.00 0.00 0.00 3.50
19 20 1.271597 GCACTCCTCACATCCAAACCT 60.272 52.381 0.00 0.00 0.00 3.50
20 21 1.168714 GCACTCCTCACATCCAAACC 58.831 55.000 0.00 0.00 0.00 3.27
21 22 0.798776 CGCACTCCTCACATCCAAAC 59.201 55.000 0.00 0.00 0.00 2.93
22 23 0.321564 CCGCACTCCTCACATCCAAA 60.322 55.000 0.00 0.00 0.00 3.28
23 24 1.296392 CCGCACTCCTCACATCCAA 59.704 57.895 0.00 0.00 0.00 3.53
24 25 1.480212 AACCGCACTCCTCACATCCA 61.480 55.000 0.00 0.00 0.00 3.41
25 26 0.535335 TAACCGCACTCCTCACATCC 59.465 55.000 0.00 0.00 0.00 3.51
26 27 2.474816 GATAACCGCACTCCTCACATC 58.525 52.381 0.00 0.00 0.00 3.06
27 28 1.139058 GGATAACCGCACTCCTCACAT 59.861 52.381 0.00 0.00 0.00 3.21
28 29 0.535335 GGATAACCGCACTCCTCACA 59.465 55.000 0.00 0.00 0.00 3.58
29 30 3.364277 GGATAACCGCACTCCTCAC 57.636 57.895 0.00 0.00 0.00 3.51
40 41 2.922740 TATGTCCTTGCCGGATAACC 57.077 50.000 5.05 0.00 45.44 2.85
41 42 3.997021 CTCATATGTCCTTGCCGGATAAC 59.003 47.826 5.05 0.00 45.44 1.89
42 43 3.007940 CCTCATATGTCCTTGCCGGATAA 59.992 47.826 5.05 0.00 45.44 1.75
43 44 2.567169 CCTCATATGTCCTTGCCGGATA 59.433 50.000 5.05 0.00 45.44 2.59
44 45 1.349026 CCTCATATGTCCTTGCCGGAT 59.651 52.381 5.05 0.00 45.44 4.18
45 46 0.758734 CCTCATATGTCCTTGCCGGA 59.241 55.000 5.05 0.00 40.30 5.14
46 47 0.250467 CCCTCATATGTCCTTGCCGG 60.250 60.000 0.00 0.00 0.00 6.13
47 48 0.250467 CCCCTCATATGTCCTTGCCG 60.250 60.000 1.90 0.00 0.00 5.69
48 49 0.538287 GCCCCTCATATGTCCTTGCC 60.538 60.000 1.90 0.00 0.00 4.52
49 50 0.538287 GGCCCCTCATATGTCCTTGC 60.538 60.000 1.90 1.07 0.00 4.01
50 51 0.250467 CGGCCCCTCATATGTCCTTG 60.250 60.000 1.90 0.00 0.00 3.61
51 52 0.694444 ACGGCCCCTCATATGTCCTT 60.694 55.000 1.90 0.00 0.00 3.36
52 53 1.074471 ACGGCCCCTCATATGTCCT 60.074 57.895 1.90 0.00 0.00 3.85
53 54 1.371558 GACGGCCCCTCATATGTCC 59.628 63.158 1.90 0.00 0.00 4.02
54 55 1.371558 GGACGGCCCCTCATATGTC 59.628 63.158 0.00 0.00 0.00 3.06
55 56 2.507854 CGGACGGCCCCTCATATGT 61.508 63.158 0.00 0.00 0.00 2.29
56 57 2.343758 CGGACGGCCCCTCATATG 59.656 66.667 0.00 0.00 0.00 1.78
57 58 2.923035 CCGGACGGCCCCTCATAT 60.923 66.667 0.00 0.00 0.00 1.78
77 78 4.436998 GGACGCGACCCCAGACAG 62.437 72.222 15.93 0.00 0.00 3.51
80 81 4.720902 TACGGACGCGACCCCAGA 62.721 66.667 21.60 1.82 0.00 3.86
81 82 4.189188 CTACGGACGCGACCCCAG 62.189 72.222 21.60 14.32 0.00 4.45
82 83 4.720902 TCTACGGACGCGACCCCA 62.721 66.667 21.60 8.68 0.00 4.96
83 84 4.185059 GTCTACGGACGCGACCCC 62.185 72.222 21.60 13.58 32.47 4.95
91 92 1.812571 TCCCACTAAACGTCTACGGAC 59.187 52.381 7.50 0.00 44.95 4.79
92 93 1.812571 GTCCCACTAAACGTCTACGGA 59.187 52.381 7.50 0.00 44.95 4.69
93 94 1.466360 CGTCCCACTAAACGTCTACGG 60.466 57.143 7.50 0.00 44.95 4.02
94 95 1.466360 CCGTCCCACTAAACGTCTACG 60.466 57.143 0.04 0.04 46.33 3.51
95 96 1.812571 TCCGTCCCACTAAACGTCTAC 59.187 52.381 0.00 0.00 37.19 2.59
96 97 2.198827 TCCGTCCCACTAAACGTCTA 57.801 50.000 0.00 0.00 37.19 2.59
97 98 1.553706 ATCCGTCCCACTAAACGTCT 58.446 50.000 0.00 0.00 37.19 4.18
98 99 2.375173 AATCCGTCCCACTAAACGTC 57.625 50.000 0.00 0.00 37.19 4.34
99 100 2.224354 ACAAATCCGTCCCACTAAACGT 60.224 45.455 0.00 0.00 37.19 3.99
100 101 2.414138 GACAAATCCGTCCCACTAAACG 59.586 50.000 0.00 0.00 38.58 3.60
101 102 3.404899 TGACAAATCCGTCCCACTAAAC 58.595 45.455 0.00 0.00 34.88 2.01
102 103 3.773418 TGACAAATCCGTCCCACTAAA 57.227 42.857 0.00 0.00 34.88 1.85
103 104 3.670625 CTTGACAAATCCGTCCCACTAA 58.329 45.455 0.00 0.00 34.88 2.24
104 105 2.614481 GCTTGACAAATCCGTCCCACTA 60.614 50.000 0.00 0.00 34.88 2.74
105 106 1.882352 GCTTGACAAATCCGTCCCACT 60.882 52.381 0.00 0.00 34.88 4.00
106 107 0.521735 GCTTGACAAATCCGTCCCAC 59.478 55.000 0.00 0.00 34.88 4.61
107 108 0.400213 AGCTTGACAAATCCGTCCCA 59.600 50.000 0.00 0.00 34.88 4.37
108 109 1.087501 GAGCTTGACAAATCCGTCCC 58.912 55.000 0.00 0.00 34.88 4.46
109 110 0.721718 CGAGCTTGACAAATCCGTCC 59.278 55.000 0.00 0.00 34.88 4.79
110 111 0.721718 CCGAGCTTGACAAATCCGTC 59.278 55.000 1.22 0.00 36.40 4.79
111 112 0.034896 ACCGAGCTTGACAAATCCGT 59.965 50.000 1.22 0.00 0.00 4.69
112 113 1.135972 CAACCGAGCTTGACAAATCCG 60.136 52.381 1.22 0.00 0.00 4.18
113 114 1.880027 ACAACCGAGCTTGACAAATCC 59.120 47.619 1.22 0.00 0.00 3.01
114 115 3.994392 TCTACAACCGAGCTTGACAAATC 59.006 43.478 1.22 0.00 0.00 2.17
115 116 4.002906 TCTACAACCGAGCTTGACAAAT 57.997 40.909 1.22 0.00 0.00 2.32
116 117 3.462483 TCTACAACCGAGCTTGACAAA 57.538 42.857 1.22 0.00 0.00 2.83
117 118 3.325870 CATCTACAACCGAGCTTGACAA 58.674 45.455 1.22 0.00 0.00 3.18
118 119 2.930887 GCATCTACAACCGAGCTTGACA 60.931 50.000 1.22 0.00 0.00 3.58
119 120 1.661112 GCATCTACAACCGAGCTTGAC 59.339 52.381 1.22 0.00 0.00 3.18
120 121 1.550524 AGCATCTACAACCGAGCTTGA 59.449 47.619 1.22 0.00 0.00 3.02
121 122 1.929836 GAGCATCTACAACCGAGCTTG 59.070 52.381 0.00 0.00 31.61 4.01
122 123 2.301577 GAGCATCTACAACCGAGCTT 57.698 50.000 0.00 0.00 31.61 3.74
135 136 2.698855 TCTGGTTGCCTAAGAGCATC 57.301 50.000 0.00 0.00 43.64 3.91
136 137 4.349048 TCATATCTGGTTGCCTAAGAGCAT 59.651 41.667 0.00 0.00 43.64 3.79
137 138 3.711190 TCATATCTGGTTGCCTAAGAGCA 59.289 43.478 0.00 0.00 42.17 4.26
138 139 4.342862 TCATATCTGGTTGCCTAAGAGC 57.657 45.455 0.00 0.00 0.00 4.09
139 140 6.038714 GGTTTTCATATCTGGTTGCCTAAGAG 59.961 42.308 0.00 0.00 0.00 2.85
140 141 5.885912 GGTTTTCATATCTGGTTGCCTAAGA 59.114 40.000 0.00 0.00 0.00 2.10
141 142 5.220854 CGGTTTTCATATCTGGTTGCCTAAG 60.221 44.000 0.00 0.00 0.00 2.18
142 143 4.638421 CGGTTTTCATATCTGGTTGCCTAA 59.362 41.667 0.00 0.00 0.00 2.69
143 144 4.080807 TCGGTTTTCATATCTGGTTGCCTA 60.081 41.667 0.00 0.00 0.00 3.93
144 145 3.016736 CGGTTTTCATATCTGGTTGCCT 58.983 45.455 0.00 0.00 0.00 4.75
145 146 3.013921 TCGGTTTTCATATCTGGTTGCC 58.986 45.455 0.00 0.00 0.00 4.52
146 147 4.156008 AGTTCGGTTTTCATATCTGGTTGC 59.844 41.667 0.00 0.00 0.00 4.17
147 148 5.880054 AGTTCGGTTTTCATATCTGGTTG 57.120 39.130 0.00 0.00 0.00 3.77
148 149 5.121768 CGAAGTTCGGTTTTCATATCTGGTT 59.878 40.000 17.61 0.00 36.00 3.67
149 150 4.630069 CGAAGTTCGGTTTTCATATCTGGT 59.370 41.667 17.61 0.00 36.00 4.00
150 151 4.494199 GCGAAGTTCGGTTTTCATATCTGG 60.494 45.833 25.55 0.00 40.84 3.86
151 152 4.494199 GGCGAAGTTCGGTTTTCATATCTG 60.494 45.833 25.55 0.00 40.84 2.90
152 153 3.621715 GGCGAAGTTCGGTTTTCATATCT 59.378 43.478 25.55 0.00 40.84 1.98
153 154 3.242641 GGGCGAAGTTCGGTTTTCATATC 60.243 47.826 25.55 5.63 40.84 1.63
154 155 2.681344 GGGCGAAGTTCGGTTTTCATAT 59.319 45.455 25.55 0.00 40.84 1.78
155 156 2.078392 GGGCGAAGTTCGGTTTTCATA 58.922 47.619 25.55 0.00 40.84 2.15
156 157 0.879090 GGGCGAAGTTCGGTTTTCAT 59.121 50.000 25.55 0.00 40.84 2.57
157 158 1.500512 CGGGCGAAGTTCGGTTTTCA 61.501 55.000 25.55 0.00 40.84 2.69
158 159 1.205820 CGGGCGAAGTTCGGTTTTC 59.794 57.895 25.55 9.13 40.84 2.29
159 160 0.814812 TTCGGGCGAAGTTCGGTTTT 60.815 50.000 25.55 0.00 40.84 2.43
160 161 0.814812 TTTCGGGCGAAGTTCGGTTT 60.815 50.000 25.55 0.00 40.84 3.27
161 162 1.227615 TTTCGGGCGAAGTTCGGTT 60.228 52.632 25.55 0.00 40.84 4.44
162 163 1.957695 GTTTCGGGCGAAGTTCGGT 60.958 57.895 25.55 0.00 40.84 4.69
163 164 2.674084 GGTTTCGGGCGAAGTTCGG 61.674 63.158 25.55 10.24 40.84 4.30
164 165 2.674084 GGGTTTCGGGCGAAGTTCG 61.674 63.158 20.87 20.87 43.89 3.95
165 166 1.167781 TTGGGTTTCGGGCGAAGTTC 61.168 55.000 0.00 0.00 35.38 3.01
166 167 0.752376 TTTGGGTTTCGGGCGAAGTT 60.752 50.000 0.00 0.00 35.38 2.66
167 168 1.152922 TTTGGGTTTCGGGCGAAGT 60.153 52.632 0.00 0.00 35.38 3.01
168 169 1.284715 GTTTGGGTTTCGGGCGAAG 59.715 57.895 0.00 0.00 35.38 3.79
169 170 1.448922 CTGTTTGGGTTTCGGGCGAA 61.449 55.000 0.00 0.00 0.00 4.70
170 171 1.894756 CTGTTTGGGTTTCGGGCGA 60.895 57.895 0.00 0.00 0.00 5.54
171 172 0.885596 TACTGTTTGGGTTTCGGGCG 60.886 55.000 0.00 0.00 0.00 6.13
172 173 0.879090 CTACTGTTTGGGTTTCGGGC 59.121 55.000 0.00 0.00 0.00 6.13
173 174 2.554370 TCTACTGTTTGGGTTTCGGG 57.446 50.000 0.00 0.00 0.00 5.14
174 175 4.904253 TTTTCTACTGTTTGGGTTTCGG 57.096 40.909 0.00 0.00 0.00 4.30
193 194 5.126384 TGGTTCAGATTCGGTTCTTGTTTTT 59.874 36.000 0.00 0.00 0.00 1.94
194 195 4.642885 TGGTTCAGATTCGGTTCTTGTTTT 59.357 37.500 0.00 0.00 0.00 2.43
195 196 4.204012 TGGTTCAGATTCGGTTCTTGTTT 58.796 39.130 0.00 0.00 0.00 2.83
196 197 3.815401 CTGGTTCAGATTCGGTTCTTGTT 59.185 43.478 0.00 0.00 32.44 2.83
197 198 3.071023 TCTGGTTCAGATTCGGTTCTTGT 59.929 43.478 0.00 0.00 35.39 3.16
198 199 3.664107 TCTGGTTCAGATTCGGTTCTTG 58.336 45.455 0.00 0.00 35.39 3.02
199 200 4.351874 TTCTGGTTCAGATTCGGTTCTT 57.648 40.909 0.00 0.00 40.39 2.52
200 201 4.351874 TTTCTGGTTCAGATTCGGTTCT 57.648 40.909 0.00 0.00 40.39 3.01
201 202 4.320275 GGTTTTCTGGTTCAGATTCGGTTC 60.320 45.833 0.00 0.00 40.39 3.62
202 203 3.568430 GGTTTTCTGGTTCAGATTCGGTT 59.432 43.478 0.00 0.00 40.39 4.44
203 204 3.146847 GGTTTTCTGGTTCAGATTCGGT 58.853 45.455 0.00 0.00 40.39 4.69
204 205 2.159627 CGGTTTTCTGGTTCAGATTCGG 59.840 50.000 0.00 0.00 40.39 4.30
205 206 3.064207 TCGGTTTTCTGGTTCAGATTCG 58.936 45.455 0.00 2.15 40.39 3.34
206 207 4.515567 AGTTCGGTTTTCTGGTTCAGATTC 59.484 41.667 0.00 0.00 40.39 2.52
207 208 4.461198 AGTTCGGTTTTCTGGTTCAGATT 58.539 39.130 0.00 0.00 40.39 2.40
208 209 4.086706 AGTTCGGTTTTCTGGTTCAGAT 57.913 40.909 0.00 0.00 40.39 2.90
209 210 3.553828 AGTTCGGTTTTCTGGTTCAGA 57.446 42.857 0.00 0.00 38.87 3.27
210 211 3.497262 GGTAGTTCGGTTTTCTGGTTCAG 59.503 47.826 0.00 0.00 0.00 3.02
211 212 3.469739 GGTAGTTCGGTTTTCTGGTTCA 58.530 45.455 0.00 0.00 0.00 3.18
212 213 2.810274 GGGTAGTTCGGTTTTCTGGTTC 59.190 50.000 0.00 0.00 0.00 3.62
213 214 2.807837 CGGGTAGTTCGGTTTTCTGGTT 60.808 50.000 0.00 0.00 0.00 3.67
214 215 1.270465 CGGGTAGTTCGGTTTTCTGGT 60.270 52.381 0.00 0.00 0.00 4.00
215 216 1.001181 TCGGGTAGTTCGGTTTTCTGG 59.999 52.381 0.00 0.00 0.00 3.86
216 217 2.064014 GTCGGGTAGTTCGGTTTTCTG 58.936 52.381 0.00 0.00 0.00 3.02
217 218 1.688197 TGTCGGGTAGTTCGGTTTTCT 59.312 47.619 0.00 0.00 0.00 2.52
218 219 2.153366 TGTCGGGTAGTTCGGTTTTC 57.847 50.000 0.00 0.00 0.00 2.29
219 220 2.845363 ATGTCGGGTAGTTCGGTTTT 57.155 45.000 0.00 0.00 0.00 2.43
220 221 2.845363 AATGTCGGGTAGTTCGGTTT 57.155 45.000 0.00 0.00 0.00 3.27
221 222 2.037511 TGAAATGTCGGGTAGTTCGGTT 59.962 45.455 0.00 0.00 0.00 4.44
222 223 1.619827 TGAAATGTCGGGTAGTTCGGT 59.380 47.619 0.00 0.00 0.00 4.69
223 224 2.268298 CTGAAATGTCGGGTAGTTCGG 58.732 52.381 0.00 0.00 0.00 4.30
224 225 2.921754 GACTGAAATGTCGGGTAGTTCG 59.078 50.000 0.00 0.00 34.06 3.95
225 226 3.921677 TGACTGAAATGTCGGGTAGTTC 58.078 45.455 0.00 0.00 39.64 3.01
226 227 4.553330 ATGACTGAAATGTCGGGTAGTT 57.447 40.909 0.00 0.00 39.64 2.24
227 228 5.507482 CGATATGACTGAAATGTCGGGTAGT 60.507 44.000 0.00 0.00 39.64 2.73
228 229 4.917998 CGATATGACTGAAATGTCGGGTAG 59.082 45.833 0.00 0.00 39.64 3.18
229 230 4.866921 CGATATGACTGAAATGTCGGGTA 58.133 43.478 0.00 0.00 39.64 3.69
230 231 3.717707 CGATATGACTGAAATGTCGGGT 58.282 45.455 0.00 0.00 39.64 5.28
233 234 3.384668 AGCCGATATGACTGAAATGTCG 58.615 45.455 6.54 6.54 39.64 4.35
234 235 3.426859 CGAGCCGATATGACTGAAATGTC 59.573 47.826 0.00 0.00 37.47 3.06
235 236 3.384668 CGAGCCGATATGACTGAAATGT 58.615 45.455 0.00 0.00 0.00 2.71
236 237 2.733552 CCGAGCCGATATGACTGAAATG 59.266 50.000 0.00 0.00 0.00 2.32
237 238 2.289072 CCCGAGCCGATATGACTGAAAT 60.289 50.000 0.00 0.00 0.00 2.17
238 239 1.068588 CCCGAGCCGATATGACTGAAA 59.931 52.381 0.00 0.00 0.00 2.69
239 240 0.673985 CCCGAGCCGATATGACTGAA 59.326 55.000 0.00 0.00 0.00 3.02
240 241 0.467474 ACCCGAGCCGATATGACTGA 60.467 55.000 0.00 0.00 0.00 3.41
241 242 0.039074 GACCCGAGCCGATATGACTG 60.039 60.000 0.00 0.00 0.00 3.51
242 243 0.178987 AGACCCGAGCCGATATGACT 60.179 55.000 0.00 0.00 0.00 3.41
243 244 0.039074 CAGACCCGAGCCGATATGAC 60.039 60.000 0.00 0.00 0.00 3.06
244 245 1.179174 CCAGACCCGAGCCGATATGA 61.179 60.000 0.00 0.00 0.00 2.15
245 246 1.290324 CCAGACCCGAGCCGATATG 59.710 63.158 0.00 0.00 0.00 1.78
246 247 0.759436 AACCAGACCCGAGCCGATAT 60.759 55.000 0.00 0.00 0.00 1.63
247 248 0.974010 AAACCAGACCCGAGCCGATA 60.974 55.000 0.00 0.00 0.00 2.92
248 249 2.291043 AAACCAGACCCGAGCCGAT 61.291 57.895 0.00 0.00 0.00 4.18
249 250 2.920912 AAACCAGACCCGAGCCGA 60.921 61.111 0.00 0.00 0.00 5.54
250 251 2.742372 CAAACCAGACCCGAGCCG 60.742 66.667 0.00 0.00 0.00 5.52
251 252 2.359975 CCAAACCAGACCCGAGCC 60.360 66.667 0.00 0.00 0.00 4.70
252 253 1.833787 TACCCAAACCAGACCCGAGC 61.834 60.000 0.00 0.00 0.00 5.03
253 254 0.909623 ATACCCAAACCAGACCCGAG 59.090 55.000 0.00 0.00 0.00 4.63
254 255 0.906775 GATACCCAAACCAGACCCGA 59.093 55.000 0.00 0.00 0.00 5.14
255 256 0.461339 CGATACCCAAACCAGACCCG 60.461 60.000 0.00 0.00 0.00 5.28
256 257 0.107361 CCGATACCCAAACCAGACCC 60.107 60.000 0.00 0.00 0.00 4.46
257 258 0.616891 ACCGATACCCAAACCAGACC 59.383 55.000 0.00 0.00 0.00 3.85
258 259 2.484742 AACCGATACCCAAACCAGAC 57.515 50.000 0.00 0.00 0.00 3.51
259 260 3.414269 GAAAACCGATACCCAAACCAGA 58.586 45.455 0.00 0.00 0.00 3.86
260 261 2.160813 CGAAAACCGATACCCAAACCAG 59.839 50.000 0.00 0.00 41.76 4.00
261 262 2.152830 CGAAAACCGATACCCAAACCA 58.847 47.619 0.00 0.00 41.76 3.67
262 263 1.469703 CCGAAAACCGATACCCAAACC 59.530 52.381 0.00 0.00 41.76 3.27
263 264 1.469703 CCCGAAAACCGATACCCAAAC 59.530 52.381 0.00 0.00 41.76 2.93
264 265 1.350351 TCCCGAAAACCGATACCCAAA 59.650 47.619 0.00 0.00 41.76 3.28
265 266 0.982704 TCCCGAAAACCGATACCCAA 59.017 50.000 0.00 0.00 41.76 4.12
266 267 0.249955 GTCCCGAAAACCGATACCCA 59.750 55.000 0.00 0.00 41.76 4.51
267 268 0.462581 GGTCCCGAAAACCGATACCC 60.463 60.000 0.00 0.00 41.76 3.69
268 269 0.462581 GGGTCCCGAAAACCGATACC 60.463 60.000 0.00 0.00 41.76 2.73
269 270 3.070076 GGGTCCCGAAAACCGATAC 57.930 57.895 0.00 0.00 41.76 2.24
283 284 2.232298 CTCAGGCTGGACTTCGGGTC 62.232 65.000 15.73 1.74 43.79 4.46
284 285 2.203788 TCAGGCTGGACTTCGGGT 60.204 61.111 15.73 0.00 0.00 5.28
285 286 2.581354 CTCAGGCTGGACTTCGGG 59.419 66.667 15.73 0.00 0.00 5.14
286 287 2.125350 GCTCAGGCTGGACTTCGG 60.125 66.667 15.73 0.00 35.22 4.30
287 288 1.004560 TTGCTCAGGCTGGACTTCG 60.005 57.895 15.73 0.00 39.59 3.79
288 289 1.294659 CGTTGCTCAGGCTGGACTTC 61.295 60.000 15.73 2.52 39.59 3.01
289 290 1.302033 CGTTGCTCAGGCTGGACTT 60.302 57.895 15.73 0.00 39.59 3.01
290 291 2.164865 CTCGTTGCTCAGGCTGGACT 62.165 60.000 15.73 0.00 39.59 3.85
291 292 1.739562 CTCGTTGCTCAGGCTGGAC 60.740 63.158 15.73 7.70 39.59 4.02
292 293 2.659016 CTCGTTGCTCAGGCTGGA 59.341 61.111 15.73 1.50 39.59 3.86
293 294 3.123620 GCTCGTTGCTCAGGCTGG 61.124 66.667 15.73 6.64 39.59 4.85
308 309 2.027625 GTACGCCACGAGCAAAGCT 61.028 57.895 0.00 0.00 44.04 3.74
309 310 2.474712 GTACGCCACGAGCAAAGC 59.525 61.111 0.00 0.00 44.04 3.51
310 311 3.165498 GGTACGCCACGAGCAAAG 58.835 61.111 0.00 0.00 44.04 2.77
323 324 0.384309 TCTGCATCCATCGACGGTAC 59.616 55.000 0.00 0.00 0.00 3.34
324 325 1.067060 CTTCTGCATCCATCGACGGTA 59.933 52.381 0.00 0.00 0.00 4.02
325 326 0.179100 CTTCTGCATCCATCGACGGT 60.179 55.000 0.00 0.00 0.00 4.83
326 327 0.877649 CCTTCTGCATCCATCGACGG 60.878 60.000 0.00 0.00 0.00 4.79
327 328 0.103026 TCCTTCTGCATCCATCGACG 59.897 55.000 0.00 0.00 0.00 5.12
328 329 2.159043 TCTTCCTTCTGCATCCATCGAC 60.159 50.000 0.00 0.00 0.00 4.20
329 330 2.110578 TCTTCCTTCTGCATCCATCGA 58.889 47.619 0.00 0.00 0.00 3.59
330 331 2.609427 TCTTCCTTCTGCATCCATCG 57.391 50.000 0.00 0.00 0.00 3.84
331 332 3.876320 GACTTCTTCCTTCTGCATCCATC 59.124 47.826 0.00 0.00 0.00 3.51
332 333 3.522750 AGACTTCTTCCTTCTGCATCCAT 59.477 43.478 0.00 0.00 0.00 3.41
333 334 2.909006 AGACTTCTTCCTTCTGCATCCA 59.091 45.455 0.00 0.00 0.00 3.41
334 335 3.625649 AGACTTCTTCCTTCTGCATCC 57.374 47.619 0.00 0.00 0.00 3.51
335 336 4.155644 CCAAAGACTTCTTCCTTCTGCATC 59.844 45.833 0.00 0.00 34.61 3.91
336 337 4.077822 CCAAAGACTTCTTCCTTCTGCAT 58.922 43.478 0.00 0.00 34.61 3.96
337 338 3.480470 CCAAAGACTTCTTCCTTCTGCA 58.520 45.455 0.00 0.00 34.61 4.41
338 339 2.227626 GCCAAAGACTTCTTCCTTCTGC 59.772 50.000 0.00 0.00 34.61 4.26
339 340 3.251972 GTGCCAAAGACTTCTTCCTTCTG 59.748 47.826 0.00 0.00 34.61 3.02
340 341 3.481453 GTGCCAAAGACTTCTTCCTTCT 58.519 45.455 0.00 0.00 34.61 2.85
341 342 2.554462 GGTGCCAAAGACTTCTTCCTTC 59.446 50.000 0.00 0.00 34.61 3.46
342 343 2.175715 AGGTGCCAAAGACTTCTTCCTT 59.824 45.455 0.00 0.00 34.61 3.36
343 344 1.777272 AGGTGCCAAAGACTTCTTCCT 59.223 47.619 0.00 0.00 34.61 3.36
344 345 2.278332 AGGTGCCAAAGACTTCTTCC 57.722 50.000 0.00 0.00 34.61 3.46
345 346 3.632145 TCAAAGGTGCCAAAGACTTCTTC 59.368 43.478 0.00 0.00 34.61 2.87
346 347 3.631250 TCAAAGGTGCCAAAGACTTCTT 58.369 40.909 0.00 0.00 37.91 2.52
347 348 3.217626 CTCAAAGGTGCCAAAGACTTCT 58.782 45.455 0.00 0.00 0.00 2.85
348 349 2.294512 CCTCAAAGGTGCCAAAGACTTC 59.705 50.000 0.00 0.00 0.00 3.01
349 350 2.091885 TCCTCAAAGGTGCCAAAGACTT 60.092 45.455 0.00 0.00 36.53 3.01
350 351 1.494721 TCCTCAAAGGTGCCAAAGACT 59.505 47.619 0.00 0.00 36.53 3.24
351 352 1.981256 TCCTCAAAGGTGCCAAAGAC 58.019 50.000 0.00 0.00 36.53 3.01
352 353 2.978156 ATCCTCAAAGGTGCCAAAGA 57.022 45.000 0.00 0.00 36.53 2.52
353 354 4.341366 AAAATCCTCAAAGGTGCCAAAG 57.659 40.909 0.00 0.00 36.53 2.77
354 355 4.450053 CAAAAATCCTCAAAGGTGCCAAA 58.550 39.130 0.00 0.00 36.53 3.28
355 356 3.181456 CCAAAAATCCTCAAAGGTGCCAA 60.181 43.478 0.00 0.00 36.53 4.52
356 357 2.368221 CCAAAAATCCTCAAAGGTGCCA 59.632 45.455 0.00 0.00 36.53 4.92
357 358 2.632512 TCCAAAAATCCTCAAAGGTGCC 59.367 45.455 0.00 0.00 36.53 5.01
358 359 4.248058 CATCCAAAAATCCTCAAAGGTGC 58.752 43.478 0.00 0.00 36.53 5.01
359 360 5.473066 ACATCCAAAAATCCTCAAAGGTG 57.527 39.130 0.00 0.00 36.53 4.00
360 361 7.797121 AATACATCCAAAAATCCTCAAAGGT 57.203 32.000 0.00 0.00 36.53 3.50
361 362 9.506018 AAAAATACATCCAAAAATCCTCAAAGG 57.494 29.630 0.00 0.00 36.46 3.11
384 385 7.719633 AGCACAGATCCTAACAGAAACTAAAAA 59.280 33.333 0.00 0.00 0.00 1.94
385 386 7.224297 AGCACAGATCCTAACAGAAACTAAAA 58.776 34.615 0.00 0.00 0.00 1.52
386 387 6.769512 AGCACAGATCCTAACAGAAACTAAA 58.230 36.000 0.00 0.00 0.00 1.85
387 388 6.360370 AGCACAGATCCTAACAGAAACTAA 57.640 37.500 0.00 0.00 0.00 2.24
388 389 7.661536 ATAGCACAGATCCTAACAGAAACTA 57.338 36.000 0.00 0.00 0.00 2.24
389 390 4.899352 AGCACAGATCCTAACAGAAACT 57.101 40.909 0.00 0.00 0.00 2.66
390 391 7.493367 AGTATAGCACAGATCCTAACAGAAAC 58.507 38.462 0.00 0.00 0.00 2.78
391 392 7.661536 AGTATAGCACAGATCCTAACAGAAA 57.338 36.000 0.00 0.00 0.00 2.52
392 393 7.661536 AAGTATAGCACAGATCCTAACAGAA 57.338 36.000 0.00 0.00 0.00 3.02
393 394 8.762481 TTAAGTATAGCACAGATCCTAACAGA 57.238 34.615 0.00 0.00 0.00 3.41
399 400 8.535335 CCATGTATTAAGTATAGCACAGATCCT 58.465 37.037 0.00 0.00 0.00 3.24
400 401 7.278868 GCCATGTATTAAGTATAGCACAGATCC 59.721 40.741 0.00 0.00 0.00 3.36
401 402 7.278868 GGCCATGTATTAAGTATAGCACAGATC 59.721 40.741 0.00 0.00 0.00 2.75
402 403 7.038017 AGGCCATGTATTAAGTATAGCACAGAT 60.038 37.037 5.01 0.00 0.00 2.90
403 404 6.270000 AGGCCATGTATTAAGTATAGCACAGA 59.730 38.462 5.01 0.00 0.00 3.41
404 405 6.467677 AGGCCATGTATTAAGTATAGCACAG 58.532 40.000 5.01 0.00 0.00 3.66
405 406 6.433847 AGGCCATGTATTAAGTATAGCACA 57.566 37.500 5.01 0.00 0.00 4.57
406 407 7.584987 CAAAGGCCATGTATTAAGTATAGCAC 58.415 38.462 5.01 0.00 0.00 4.40
407 408 6.206634 GCAAAGGCCATGTATTAAGTATAGCA 59.793 38.462 5.01 0.00 0.00 3.49
408 409 6.612306 GCAAAGGCCATGTATTAAGTATAGC 58.388 40.000 5.01 0.00 0.00 2.97
425 426 1.468506 TTTCCGGAAAGGGCAAAGGC 61.469 55.000 25.67 0.00 41.52 4.35
426 427 1.044611 TTTTCCGGAAAGGGCAAAGG 58.955 50.000 27.48 0.00 41.52 3.11
427 428 3.244044 TGAATTTTCCGGAAAGGGCAAAG 60.244 43.478 27.48 0.00 41.52 2.77
428 429 2.700897 TGAATTTTCCGGAAAGGGCAAA 59.299 40.909 27.48 13.92 41.52 3.68
429 430 2.320781 TGAATTTTCCGGAAAGGGCAA 58.679 42.857 27.48 14.64 41.52 4.52
430 431 2.002505 TGAATTTTCCGGAAAGGGCA 57.997 45.000 27.48 22.08 41.52 5.36
431 432 3.610040 ATTGAATTTTCCGGAAAGGGC 57.390 42.857 27.48 20.06 41.52 5.19
432 433 9.830975 AAATTATATTGAATTTTCCGGAAAGGG 57.169 29.630 27.48 0.00 35.90 3.95
481 482 2.954318 AGTCAGCACTGCACATCTTTTT 59.046 40.909 3.30 0.00 0.00 1.94
482 483 2.551459 GAGTCAGCACTGCACATCTTTT 59.449 45.455 3.30 0.00 30.63 2.27
483 484 2.149578 GAGTCAGCACTGCACATCTTT 58.850 47.619 3.30 0.00 30.63 2.52
484 485 1.071228 TGAGTCAGCACTGCACATCTT 59.929 47.619 3.30 0.00 30.63 2.40
485 486 0.683412 TGAGTCAGCACTGCACATCT 59.317 50.000 3.30 0.00 30.63 2.90
486 487 1.516161 TTGAGTCAGCACTGCACATC 58.484 50.000 3.30 0.00 30.63 3.06
487 488 1.810755 CATTGAGTCAGCACTGCACAT 59.189 47.619 3.30 0.00 30.63 3.21
488 489 1.202675 TCATTGAGTCAGCACTGCACA 60.203 47.619 3.30 0.00 30.63 4.57
489 490 1.516161 TCATTGAGTCAGCACTGCAC 58.484 50.000 3.30 0.00 30.63 4.57
490 491 2.484742 ATCATTGAGTCAGCACTGCA 57.515 45.000 3.30 0.00 30.63 4.41
491 492 3.844577 AAATCATTGAGTCAGCACTGC 57.155 42.857 0.00 0.00 30.63 4.40
492 493 5.117355 ACAAAATCATTGAGTCAGCACTG 57.883 39.130 0.00 0.00 30.63 3.66
493 494 4.217118 GGACAAAATCATTGAGTCAGCACT 59.783 41.667 0.00 0.00 34.57 4.40
494 495 4.022935 TGGACAAAATCATTGAGTCAGCAC 60.023 41.667 0.00 0.00 0.00 4.40
495 496 4.022935 GTGGACAAAATCATTGAGTCAGCA 60.023 41.667 0.00 0.00 0.00 4.41
496 497 4.479619 GTGGACAAAATCATTGAGTCAGC 58.520 43.478 0.00 0.00 0.00 4.26
497 498 4.214119 ACGTGGACAAAATCATTGAGTCAG 59.786 41.667 0.00 0.00 0.00 3.51
498 499 4.024133 CACGTGGACAAAATCATTGAGTCA 60.024 41.667 7.95 0.00 0.00 3.41
499 500 4.213270 TCACGTGGACAAAATCATTGAGTC 59.787 41.667 17.00 0.00 0.00 3.36
500 501 4.133820 TCACGTGGACAAAATCATTGAGT 58.866 39.130 17.00 0.00 0.00 3.41
501 502 4.747540 TCACGTGGACAAAATCATTGAG 57.252 40.909 17.00 0.00 0.00 3.02
502 503 4.336713 TGTTCACGTGGACAAAATCATTGA 59.663 37.500 27.30 0.00 0.00 2.57
503 504 4.605968 TGTTCACGTGGACAAAATCATTG 58.394 39.130 27.30 0.00 0.00 2.82
504 505 4.792704 GCTGTTCACGTGGACAAAATCATT 60.793 41.667 28.78 0.00 0.00 2.57
505 506 3.304659 GCTGTTCACGTGGACAAAATCAT 60.305 43.478 28.78 0.00 0.00 2.45
506 507 2.032799 GCTGTTCACGTGGACAAAATCA 59.967 45.455 28.78 6.76 0.00 2.57
507 508 2.032799 TGCTGTTCACGTGGACAAAATC 59.967 45.455 28.78 18.02 0.00 2.17
508 509 2.020720 TGCTGTTCACGTGGACAAAAT 58.979 42.857 28.78 0.00 0.00 1.82
509 510 1.454201 TGCTGTTCACGTGGACAAAA 58.546 45.000 28.78 17.61 0.00 2.44
510 511 1.333308 CATGCTGTTCACGTGGACAAA 59.667 47.619 28.78 20.45 0.00 2.83
511 512 0.943673 CATGCTGTTCACGTGGACAA 59.056 50.000 28.78 16.84 0.00 3.18
512 513 0.884259 CCATGCTGTTCACGTGGACA 60.884 55.000 27.49 27.49 45.46 4.02
513 514 0.602638 TCCATGCTGTTCACGTGGAC 60.603 55.000 20.54 20.54 46.01 4.02
514 515 4.377370 CCATGCTGTTCACGTGGA 57.623 55.556 17.00 3.16 45.46 4.02
515 516 1.131126 GATTCCATGCTGTTCACGTGG 59.869 52.381 17.00 0.00 44.22 4.94
516 517 1.805943 TGATTCCATGCTGTTCACGTG 59.194 47.619 9.94 9.94 0.00 4.49
517 518 2.183478 TGATTCCATGCTGTTCACGT 57.817 45.000 0.00 0.00 0.00 4.49
518 519 3.557577 TTTGATTCCATGCTGTTCACG 57.442 42.857 0.00 0.00 0.00 4.35
519 520 7.887996 TTTATTTTGATTCCATGCTGTTCAC 57.112 32.000 0.00 0.00 0.00 3.18
520 521 8.899427 TTTTTATTTTGATTCCATGCTGTTCA 57.101 26.923 0.00 0.00 0.00 3.18
521 522 9.206870 TCTTTTTATTTTGATTCCATGCTGTTC 57.793 29.630 0.00 0.00 0.00 3.18
522 523 9.558396 TTCTTTTTATTTTGATTCCATGCTGTT 57.442 25.926 0.00 0.00 0.00 3.16
523 524 9.211485 CTTCTTTTTATTTTGATTCCATGCTGT 57.789 29.630 0.00 0.00 0.00 4.40
524 525 9.426837 TCTTCTTTTTATTTTGATTCCATGCTG 57.573 29.630 0.00 0.00 0.00 4.41
534 535 9.607988 GGGGAACTTTTCTTCTTTTTATTTTGA 57.392 29.630 0.00 0.00 0.00 2.69
535 536 8.836413 GGGGGAACTTTTCTTCTTTTTATTTTG 58.164 33.333 0.00 0.00 0.00 2.44
536 537 8.778059 AGGGGGAACTTTTCTTCTTTTTATTTT 58.222 29.630 0.00 0.00 0.00 1.82
537 538 8.331931 AGGGGGAACTTTTCTTCTTTTTATTT 57.668 30.769 0.00 0.00 0.00 1.40
538 539 7.016268 GGAGGGGGAACTTTTCTTCTTTTTATT 59.984 37.037 0.00 0.00 0.00 1.40
539 540 6.497259 GGAGGGGGAACTTTTCTTCTTTTTAT 59.503 38.462 0.00 0.00 0.00 1.40
540 541 5.836898 GGAGGGGGAACTTTTCTTCTTTTTA 59.163 40.000 0.00 0.00 0.00 1.52
541 542 4.654262 GGAGGGGGAACTTTTCTTCTTTTT 59.346 41.667 0.00 0.00 0.00 1.94
542 543 4.223953 GGAGGGGGAACTTTTCTTCTTTT 58.776 43.478 0.00 0.00 0.00 2.27
543 544 3.438078 GGGAGGGGGAACTTTTCTTCTTT 60.438 47.826 0.00 0.00 0.00 2.52
544 545 2.110188 GGGAGGGGGAACTTTTCTTCTT 59.890 50.000 0.00 0.00 0.00 2.52
545 546 1.711375 GGGAGGGGGAACTTTTCTTCT 59.289 52.381 0.00 0.00 0.00 2.85
546 547 1.272536 GGGGAGGGGGAACTTTTCTTC 60.273 57.143 0.00 0.00 0.00 2.87
547 548 0.784495 GGGGAGGGGGAACTTTTCTT 59.216 55.000 0.00 0.00 0.00 2.52
548 549 1.147190 GGGGGAGGGGGAACTTTTCT 61.147 60.000 0.00 0.00 0.00 2.52
549 550 1.386945 GGGGGAGGGGGAACTTTTC 59.613 63.158 0.00 0.00 0.00 2.29
550 551 2.544745 CGGGGGAGGGGGAACTTTT 61.545 63.158 0.00 0.00 0.00 2.27
551 552 2.939353 CGGGGGAGGGGGAACTTT 60.939 66.667 0.00 0.00 0.00 2.66
552 553 4.281074 ACGGGGGAGGGGGAACTT 62.281 66.667 0.00 0.00 0.00 2.66
553 554 4.735599 GACGGGGGAGGGGGAACT 62.736 72.222 0.00 0.00 0.00 3.01
568 569 2.722201 AATCCGAGTCAGGGGCGAC 61.722 63.158 0.00 0.00 36.08 5.19
569 570 2.363795 AATCCGAGTCAGGGGCGA 60.364 61.111 0.00 0.00 0.00 5.54
570 571 2.202932 CAATCCGAGTCAGGGGCG 60.203 66.667 0.00 0.00 0.00 6.13
571 572 0.744771 GTTCAATCCGAGTCAGGGGC 60.745 60.000 0.00 0.00 0.00 5.80
572 573 0.460284 CGTTCAATCCGAGTCAGGGG 60.460 60.000 0.00 0.00 0.00 4.79
573 574 0.460284 CCGTTCAATCCGAGTCAGGG 60.460 60.000 0.00 0.00 0.00 4.45
574 575 0.246635 ACCGTTCAATCCGAGTCAGG 59.753 55.000 0.00 0.00 0.00 3.86
575 576 2.163815 ACTACCGTTCAATCCGAGTCAG 59.836 50.000 0.00 0.00 0.00 3.51
576 577 2.165167 ACTACCGTTCAATCCGAGTCA 58.835 47.619 0.00 0.00 0.00 3.41
577 578 2.935481 ACTACCGTTCAATCCGAGTC 57.065 50.000 0.00 0.00 0.00 3.36
578 579 3.350833 ACTACTACCGTTCAATCCGAGT 58.649 45.455 0.00 0.00 0.00 4.18
579 580 5.163723 TGTTACTACTACCGTTCAATCCGAG 60.164 44.000 0.00 0.00 0.00 4.63
580 581 4.699735 TGTTACTACTACCGTTCAATCCGA 59.300 41.667 0.00 0.00 0.00 4.55
581 582 4.985413 TGTTACTACTACCGTTCAATCCG 58.015 43.478 0.00 0.00 0.00 4.18
582 583 5.751990 CCATGTTACTACTACCGTTCAATCC 59.248 44.000 0.00 0.00 0.00 3.01
583 584 6.567050 TCCATGTTACTACTACCGTTCAATC 58.433 40.000 0.00 0.00 0.00 2.67
584 585 6.534475 TCCATGTTACTACTACCGTTCAAT 57.466 37.500 0.00 0.00 0.00 2.57
585 586 5.981088 TCCATGTTACTACTACCGTTCAA 57.019 39.130 0.00 0.00 0.00 2.69
586 587 5.680408 GCATCCATGTTACTACTACCGTTCA 60.680 44.000 0.00 0.00 0.00 3.18
587 588 4.743644 GCATCCATGTTACTACTACCGTTC 59.256 45.833 0.00 0.00 0.00 3.95
588 589 4.690122 GCATCCATGTTACTACTACCGTT 58.310 43.478 0.00 0.00 0.00 4.44
589 590 3.243301 CGCATCCATGTTACTACTACCGT 60.243 47.826 0.00 0.00 0.00 4.83
590 591 3.305964 CGCATCCATGTTACTACTACCG 58.694 50.000 0.00 0.00 0.00 4.02
591 592 3.057734 GCGCATCCATGTTACTACTACC 58.942 50.000 0.30 0.00 0.00 3.18
592 593 3.713288 TGCGCATCCATGTTACTACTAC 58.287 45.455 5.66 0.00 0.00 2.73
593 594 3.383505 ACTGCGCATCCATGTTACTACTA 59.616 43.478 12.24 0.00 0.00 1.82
594 595 2.168521 ACTGCGCATCCATGTTACTACT 59.831 45.455 12.24 0.00 0.00 2.57
595 596 2.285220 CACTGCGCATCCATGTTACTAC 59.715 50.000 12.24 0.00 0.00 2.73
596 597 2.167487 TCACTGCGCATCCATGTTACTA 59.833 45.455 12.24 0.00 0.00 1.82
597 598 1.066215 TCACTGCGCATCCATGTTACT 60.066 47.619 12.24 0.00 0.00 2.24
598 599 1.368641 TCACTGCGCATCCATGTTAC 58.631 50.000 12.24 0.00 0.00 2.50
599 600 2.330440 ATCACTGCGCATCCATGTTA 57.670 45.000 12.24 0.00 0.00 2.41
600 601 2.216046 CTATCACTGCGCATCCATGTT 58.784 47.619 12.24 5.30 0.00 2.71
601 602 1.541889 CCTATCACTGCGCATCCATGT 60.542 52.381 12.24 0.75 0.00 3.21
602 603 1.154197 CCTATCACTGCGCATCCATG 58.846 55.000 12.24 7.70 0.00 3.66
603 604 0.761187 ACCTATCACTGCGCATCCAT 59.239 50.000 12.24 5.37 0.00 3.41
604 605 0.104855 GACCTATCACTGCGCATCCA 59.895 55.000 12.24 0.00 0.00 3.41
605 606 0.104855 TGACCTATCACTGCGCATCC 59.895 55.000 12.24 0.00 0.00 3.51
606 607 3.667448 TGACCTATCACTGCGCATC 57.333 52.632 12.24 2.96 0.00 3.91
615 616 2.758327 AGCGCCCGTGACCTATCA 60.758 61.111 2.29 0.00 0.00 2.15
616 617 2.027751 GAGCGCCCGTGACCTATC 59.972 66.667 2.29 0.00 0.00 2.08
617 618 2.758327 TGAGCGCCCGTGACCTAT 60.758 61.111 2.29 0.00 0.00 2.57
618 619 3.449227 CTGAGCGCCCGTGACCTA 61.449 66.667 2.29 0.00 0.00 3.08
624 625 4.643387 AAAAGCCTGAGCGCCCGT 62.643 61.111 2.29 0.00 46.67 5.28
625 626 3.804193 GAAAAGCCTGAGCGCCCG 61.804 66.667 2.29 0.00 46.67 6.13
626 627 3.443925 GGAAAAGCCTGAGCGCCC 61.444 66.667 2.29 0.00 46.67 6.13
627 628 2.672996 TGGAAAAGCCTGAGCGCC 60.673 61.111 2.29 0.00 46.67 6.53
628 629 2.873288 CTGGAAAAGCCTGAGCGC 59.127 61.111 0.00 0.00 46.67 5.92
637 638 1.315257 CCCCATGACCGCTGGAAAAG 61.315 60.000 0.00 0.00 35.70 2.27
638 639 1.304052 CCCCATGACCGCTGGAAAA 60.304 57.895 0.00 0.00 35.70 2.29
639 640 2.196997 CTCCCCATGACCGCTGGAAA 62.197 60.000 0.00 0.00 35.70 3.13
640 641 2.609299 TCCCCATGACCGCTGGAA 60.609 61.111 0.00 0.00 35.70 3.53
641 642 3.083349 CTCCCCATGACCGCTGGA 61.083 66.667 0.00 0.00 35.70 3.86
642 643 3.083349 TCTCCCCATGACCGCTGG 61.083 66.667 0.00 0.00 0.00 4.85
643 644 2.060383 TCTCTCCCCATGACCGCTG 61.060 63.158 0.00 0.00 0.00 5.18
644 645 2.060980 GTCTCTCCCCATGACCGCT 61.061 63.158 0.00 0.00 0.00 5.52
645 646 2.501610 GTCTCTCCCCATGACCGC 59.498 66.667 0.00 0.00 0.00 5.68
646 647 2.808315 CGTCTCTCCCCATGACCG 59.192 66.667 0.00 0.00 0.00 4.79
647 648 2.060980 AGCGTCTCTCCCCATGACC 61.061 63.158 0.00 0.00 0.00 4.02
648 649 1.142748 CAGCGTCTCTCCCCATGAC 59.857 63.158 0.00 0.00 0.00 3.06
649 650 2.725312 GCAGCGTCTCTCCCCATGA 61.725 63.158 0.00 0.00 0.00 3.07
650 651 2.202987 GCAGCGTCTCTCCCCATG 60.203 66.667 0.00 0.00 0.00 3.66
651 652 3.842923 CGCAGCGTCTCTCCCCAT 61.843 66.667 6.65 0.00 0.00 4.00
654 655 3.138798 TACCGCAGCGTCTCTCCC 61.139 66.667 15.05 0.00 0.00 4.30
655 656 2.102553 GTACCGCAGCGTCTCTCC 59.897 66.667 15.05 0.00 0.00 3.71
656 657 2.102553 GGTACCGCAGCGTCTCTC 59.897 66.667 15.05 0.00 0.00 3.20
657 658 3.450115 GGGTACCGCAGCGTCTCT 61.450 66.667 15.05 0.00 40.86 3.10
668 669 2.319841 GTGAAACACGCCGGGTACC 61.320 63.158 2.17 2.17 41.59 3.34
669 670 1.562575 CTGTGAAACACGCCGGGTAC 61.563 60.000 2.18 0.00 45.67 3.34
670 671 1.301087 CTGTGAAACACGCCGGGTA 60.301 57.895 2.18 0.00 45.67 3.69
671 672 2.590575 CTGTGAAACACGCCGGGT 60.591 61.111 2.18 0.00 45.67 5.28
672 673 2.113131 GAACTGTGAAACACGCCGGG 62.113 60.000 2.18 0.00 45.67 5.73
673 674 1.278637 GAACTGTGAAACACGCCGG 59.721 57.895 0.00 0.00 45.67 6.13
674 675 0.315869 GTGAACTGTGAAACACGCCG 60.316 55.000 0.00 0.00 45.67 6.46
675 676 0.730265 TGTGAACTGTGAAACACGCC 59.270 50.000 0.00 0.00 45.67 5.68
676 677 1.810197 GTGTGAACTGTGAAACACGC 58.190 50.000 0.00 0.00 45.67 5.34
678 679 1.129624 TGCGTGTGAACTGTGAAACAC 59.870 47.619 9.58 9.58 45.67 3.32
680 681 1.268032 CCTGCGTGTGAACTGTGAAAC 60.268 52.381 0.00 0.00 37.35 2.78
681 682 1.013596 CCTGCGTGTGAACTGTGAAA 58.986 50.000 0.00 0.00 0.00 2.69
682 683 0.107897 ACCTGCGTGTGAACTGTGAA 60.108 50.000 0.00 0.00 0.00 3.18
683 684 0.809636 CACCTGCGTGTGAACTGTGA 60.810 55.000 0.00 0.00 38.55 3.58
684 685 1.643292 CACCTGCGTGTGAACTGTG 59.357 57.895 0.00 0.00 38.55 3.66
685 686 1.523711 CCACCTGCGTGTGAACTGT 60.524 57.895 6.97 0.00 38.55 3.55
686 687 1.523711 ACCACCTGCGTGTGAACTG 60.524 57.895 6.97 0.00 38.55 3.16
687 688 1.523711 CACCACCTGCGTGTGAACT 60.524 57.895 6.97 0.00 38.55 3.01
688 689 2.542907 CCACCACCTGCGTGTGAAC 61.543 63.158 6.97 0.00 38.55 3.18
689 690 2.203139 CCACCACCTGCGTGTGAA 60.203 61.111 6.97 0.00 38.55 3.18
690 691 4.248842 CCCACCACCTGCGTGTGA 62.249 66.667 6.97 0.00 38.55 3.58
703 704 3.721370 ATGAATGCTCGGCCCCCAC 62.721 63.158 0.00 0.00 0.00 4.61
704 705 2.909457 GAATGAATGCTCGGCCCCCA 62.909 60.000 0.00 0.00 0.00 4.96
705 706 2.123726 AATGAATGCTCGGCCCCC 60.124 61.111 0.00 0.00 0.00 5.40
706 707 0.753111 AAGAATGAATGCTCGGCCCC 60.753 55.000 0.00 0.00 0.00 5.80
707 708 1.106285 AAAGAATGAATGCTCGGCCC 58.894 50.000 0.00 0.00 0.00 5.80
708 709 1.202336 CCAAAGAATGAATGCTCGGCC 60.202 52.381 0.00 0.00 0.00 6.13
709 710 1.202336 CCCAAAGAATGAATGCTCGGC 60.202 52.381 0.00 0.00 0.00 5.54
710 711 2.357009 CTCCCAAAGAATGAATGCTCGG 59.643 50.000 0.00 0.00 0.00 4.63
711 712 2.223433 GCTCCCAAAGAATGAATGCTCG 60.223 50.000 0.00 0.00 0.00 5.03
712 713 2.100418 GGCTCCCAAAGAATGAATGCTC 59.900 50.000 0.00 0.00 0.00 4.26
713 714 2.105766 GGCTCCCAAAGAATGAATGCT 58.894 47.619 0.00 0.00 0.00 3.79
714 715 2.100418 GAGGCTCCCAAAGAATGAATGC 59.900 50.000 2.15 0.00 0.00 3.56
715 716 2.692041 GGAGGCTCCCAAAGAATGAATG 59.308 50.000 23.49 0.00 0.00 2.67
716 717 2.684927 CGGAGGCTCCCAAAGAATGAAT 60.685 50.000 27.36 0.00 31.13 2.57
717 718 1.340017 CGGAGGCTCCCAAAGAATGAA 60.340 52.381 27.36 0.00 31.13 2.57
718 719 0.253044 CGGAGGCTCCCAAAGAATGA 59.747 55.000 27.36 0.00 31.13 2.57
719 720 0.035056 ACGGAGGCTCCCAAAGAATG 60.035 55.000 27.36 13.12 31.13 2.67
720 721 1.486726 CTACGGAGGCTCCCAAAGAAT 59.513 52.381 27.36 7.16 31.13 2.40
721 722 0.902531 CTACGGAGGCTCCCAAAGAA 59.097 55.000 27.36 6.03 31.13 2.52
722 723 0.252103 ACTACGGAGGCTCCCAAAGA 60.252 55.000 27.36 7.56 31.13 2.52
723 724 0.175989 GACTACGGAGGCTCCCAAAG 59.824 60.000 27.36 22.02 31.13 2.77
724 725 0.252103 AGACTACGGAGGCTCCCAAA 60.252 55.000 27.36 12.01 35.38 3.28
725 726 1.386945 AGACTACGGAGGCTCCCAA 59.613 57.895 27.36 14.55 35.38 4.12
726 727 3.097293 AGACTACGGAGGCTCCCA 58.903 61.111 27.36 14.58 35.38 4.37
731 732 2.491022 ATGGCGAGACTACGGAGGC 61.491 63.158 0.00 0.00 0.00 4.70
732 733 1.360551 CATGGCGAGACTACGGAGG 59.639 63.158 0.00 0.00 0.00 4.30
733 734 1.360551 CCATGGCGAGACTACGGAG 59.639 63.158 0.00 0.00 0.00 4.63
734 735 1.379443 ACCATGGCGAGACTACGGA 60.379 57.895 13.04 0.00 0.00 4.69
735 736 1.065928 GACCATGGCGAGACTACGG 59.934 63.158 13.04 0.00 0.00 4.02
736 737 1.298413 CGACCATGGCGAGACTACG 60.298 63.158 19.72 6.73 0.00 3.51
737 738 0.248539 GACGACCATGGCGAGACTAC 60.249 60.000 27.68 12.13 0.00 2.73
738 739 1.381928 GGACGACCATGGCGAGACTA 61.382 60.000 27.68 0.00 35.97 2.59
739 740 2.711922 GGACGACCATGGCGAGACT 61.712 63.158 27.68 11.09 35.97 3.24
740 741 2.202756 GGACGACCATGGCGAGAC 60.203 66.667 27.68 18.93 35.97 3.36
741 742 2.678580 TGGACGACCATGGCGAGA 60.679 61.111 27.68 12.64 41.77 4.04
742 743 2.021068 ATCTGGACGACCATGGCGAG 62.021 60.000 27.68 17.65 45.87 5.03
743 744 2.058001 ATCTGGACGACCATGGCGA 61.058 57.895 27.68 11.09 45.87 5.54
744 745 1.884464 CATCTGGACGACCATGGCG 60.884 63.158 21.83 21.83 45.87 5.69
745 746 1.524621 CCATCTGGACGACCATGGC 60.525 63.158 13.04 3.65 45.87 4.40
746 747 1.146930 CCCATCTGGACGACCATGG 59.853 63.158 16.69 16.69 45.87 3.66
747 748 1.146930 CCCCATCTGGACGACCATG 59.853 63.158 7.16 3.73 45.87 3.66
748 749 0.400525 ATCCCCATCTGGACGACCAT 60.401 55.000 7.16 0.00 45.87 3.55
749 750 1.002921 ATCCCCATCTGGACGACCA 59.997 57.895 6.42 6.42 44.76 4.02
750 751 0.760945 AGATCCCCATCTGGACGACC 60.761 60.000 0.00 0.00 38.03 4.79
751 752 1.996798 TAGATCCCCATCTGGACGAC 58.003 55.000 0.00 0.00 39.90 4.34
752 753 4.609866 ATATAGATCCCCATCTGGACGA 57.390 45.455 0.00 0.00 39.90 4.20
753 754 5.696030 TCTATATAGATCCCCATCTGGACG 58.304 45.833 8.44 0.00 39.90 4.79
754 755 7.129425 AGTTCTATATAGATCCCCATCTGGAC 58.871 42.308 13.22 4.34 39.90 4.02
755 756 7.304054 AGTTCTATATAGATCCCCATCTGGA 57.696 40.000 13.22 0.00 39.90 3.86
756 757 6.553100 GGAGTTCTATATAGATCCCCATCTGG 59.447 46.154 16.90 0.00 39.90 3.86
757 758 6.553100 GGGAGTTCTATATAGATCCCCATCTG 59.447 46.154 27.78 0.00 42.20 2.90
758 759 6.456657 AGGGAGTTCTATATAGATCCCCATCT 59.543 42.308 31.28 19.13 46.18 2.90
759 760 6.688554 AGGGAGTTCTATATAGATCCCCATC 58.311 44.000 31.28 16.89 46.18 3.51
760 761 6.698894 AGGGAGTTCTATATAGATCCCCAT 57.301 41.667 31.28 19.47 46.18 4.00
761 762 6.500490 AAGGGAGTTCTATATAGATCCCCA 57.500 41.667 31.28 11.06 46.18 4.96
762 763 5.900699 GGAAGGGAGTTCTATATAGATCCCC 59.099 48.000 31.28 27.46 46.18 4.81
763 764 6.747931 AGGAAGGGAGTTCTATATAGATCCC 58.252 44.000 29.45 29.45 45.71 3.85
764 765 8.673456 AAAGGAAGGGAGTTCTATATAGATCC 57.327 38.462 18.57 18.57 35.25 3.36
765 766 8.755028 GGAAAGGAAGGGAGTTCTATATAGATC 58.245 40.741 13.22 12.23 35.25 2.75
766 767 8.242325 TGGAAAGGAAGGGAGTTCTATATAGAT 58.758 37.037 13.22 0.00 35.25 1.98
767 768 7.509659 GTGGAAAGGAAGGGAGTTCTATATAGA 59.490 40.741 8.44 8.44 35.25 1.98
768 769 7.256368 GGTGGAAAGGAAGGGAGTTCTATATAG 60.256 44.444 3.10 3.10 35.25 1.31
769 770 6.557633 GGTGGAAAGGAAGGGAGTTCTATATA 59.442 42.308 0.00 0.00 35.25 0.86
770 771 5.369993 GGTGGAAAGGAAGGGAGTTCTATAT 59.630 44.000 0.00 0.00 35.25 0.86
771 772 4.720273 GGTGGAAAGGAAGGGAGTTCTATA 59.280 45.833 0.00 0.00 35.25 1.31
772 773 3.523972 GGTGGAAAGGAAGGGAGTTCTAT 59.476 47.826 0.00 0.00 35.25 1.98
773 774 2.910977 GGTGGAAAGGAAGGGAGTTCTA 59.089 50.000 0.00 0.00 35.25 2.10
774 775 1.705745 GGTGGAAAGGAAGGGAGTTCT 59.294 52.381 0.00 0.00 35.25 3.01
775 776 1.423921 TGGTGGAAAGGAAGGGAGTTC 59.576 52.381 0.00 0.00 0.00 3.01
776 777 1.529744 TGGTGGAAAGGAAGGGAGTT 58.470 50.000 0.00 0.00 0.00 3.01
777 778 1.145119 GTTGGTGGAAAGGAAGGGAGT 59.855 52.381 0.00 0.00 0.00 3.85
778 779 1.144913 TGTTGGTGGAAAGGAAGGGAG 59.855 52.381 0.00 0.00 0.00 4.30
779 780 1.133606 GTGTTGGTGGAAAGGAAGGGA 60.134 52.381 0.00 0.00 0.00 4.20
780 781 1.328279 GTGTTGGTGGAAAGGAAGGG 58.672 55.000 0.00 0.00 0.00 3.95
781 782 1.328279 GGTGTTGGTGGAAAGGAAGG 58.672 55.000 0.00 0.00 0.00 3.46
782 783 2.065899 TGGTGTTGGTGGAAAGGAAG 57.934 50.000 0.00 0.00 0.00 3.46
783 784 2.104170 GTTGGTGTTGGTGGAAAGGAA 58.896 47.619 0.00 0.00 0.00 3.36
784 785 1.770294 GTTGGTGTTGGTGGAAAGGA 58.230 50.000 0.00 0.00 0.00 3.36
785 786 0.383949 CGTTGGTGTTGGTGGAAAGG 59.616 55.000 0.00 0.00 0.00 3.11
786 787 0.248866 GCGTTGGTGTTGGTGGAAAG 60.249 55.000 0.00 0.00 0.00 2.62
787 788 1.668101 GGCGTTGGTGTTGGTGGAAA 61.668 55.000 0.00 0.00 0.00 3.13
788 789 2.122167 GGCGTTGGTGTTGGTGGAA 61.122 57.895 0.00 0.00 0.00 3.53
789 790 2.517402 GGCGTTGGTGTTGGTGGA 60.517 61.111 0.00 0.00 0.00 4.02
790 791 2.518349 AGGCGTTGGTGTTGGTGG 60.518 61.111 0.00 0.00 0.00 4.61
791 792 2.551912 GGAGGCGTTGGTGTTGGTG 61.552 63.158 0.00 0.00 0.00 4.17
792 793 2.203294 GGAGGCGTTGGTGTTGGT 60.203 61.111 0.00 0.00 0.00 3.67
793 794 2.983592 GGGAGGCGTTGGTGTTGG 60.984 66.667 0.00 0.00 0.00 3.77
794 795 2.203280 TGGGAGGCGTTGGTGTTG 60.203 61.111 0.00 0.00 0.00 3.33
795 796 2.113139 CTGGGAGGCGTTGGTGTT 59.887 61.111 0.00 0.00 0.00 3.32
796 797 4.643387 GCTGGGAGGCGTTGGTGT 62.643 66.667 0.00 0.00 0.00 4.16
797 798 4.641645 TGCTGGGAGGCGTTGGTG 62.642 66.667 0.00 0.00 34.52 4.17
798 799 3.884774 TTGCTGGGAGGCGTTGGT 61.885 61.111 0.00 0.00 34.52 3.67
799 800 3.365265 GTTGCTGGGAGGCGTTGG 61.365 66.667 0.00 0.00 34.52 3.77
800 801 2.281761 AGTTGCTGGGAGGCGTTG 60.282 61.111 0.00 0.00 34.52 4.10
801 802 2.032681 GAGTTGCTGGGAGGCGTT 59.967 61.111 0.00 0.00 34.52 4.84
802 803 2.925170 AGAGTTGCTGGGAGGCGT 60.925 61.111 0.00 0.00 34.52 5.68
803 804 2.125350 GAGAGTTGCTGGGAGGCG 60.125 66.667 0.00 0.00 34.52 5.52
804 805 2.270527 GGAGAGTTGCTGGGAGGC 59.729 66.667 0.00 0.00 0.00 4.70
805 806 1.920325 TGGGAGAGTTGCTGGGAGG 60.920 63.158 0.00 0.00 0.00 4.30
806 807 1.298014 GTGGGAGAGTTGCTGGGAG 59.702 63.158 0.00 0.00 0.00 4.30
807 808 2.224159 GGTGGGAGAGTTGCTGGGA 61.224 63.158 0.00 0.00 0.00 4.37
808 809 2.190488 GAGGTGGGAGAGTTGCTGGG 62.190 65.000 0.00 0.00 0.00 4.45
809 810 1.197430 AGAGGTGGGAGAGTTGCTGG 61.197 60.000 0.00 0.00 0.00 4.85
810 811 0.689623 AAGAGGTGGGAGAGTTGCTG 59.310 55.000 0.00 0.00 0.00 4.41
811 812 1.439543 AAAGAGGTGGGAGAGTTGCT 58.560 50.000 0.00 0.00 0.00 3.91
812 813 2.278332 AAAAGAGGTGGGAGAGTTGC 57.722 50.000 0.00 0.00 0.00 4.17
814 815 9.900112 ACTATATATAAAAGAGGTGGGAGAGTT 57.100 33.333 3.21 0.00 0.00 3.01
815 816 9.900112 AACTATATATAAAAGAGGTGGGAGAGT 57.100 33.333 3.21 0.00 0.00 3.24
819 820 9.043548 GGCTAACTATATATAAAAGAGGTGGGA 57.956 37.037 3.21 0.00 0.00 4.37
820 821 8.822805 TGGCTAACTATATATAAAAGAGGTGGG 58.177 37.037 3.21 0.00 0.00 4.61
824 825 9.331282 GCCATGGCTAACTATATATAAAAGAGG 57.669 37.037 29.98 0.00 38.26 3.69
843 844 6.427242 GGAATAACTAGTAACTAAGCCATGGC 59.573 42.308 30.12 30.12 42.33 4.40
844 845 6.645415 CGGAATAACTAGTAACTAAGCCATGG 59.355 42.308 7.63 7.63 0.00 3.66
845 846 7.208080 ACGGAATAACTAGTAACTAAGCCATG 58.792 38.462 0.00 0.00 0.00 3.66
846 847 7.357429 ACGGAATAACTAGTAACTAAGCCAT 57.643 36.000 0.00 0.00 0.00 4.40
847 848 6.780457 ACGGAATAACTAGTAACTAAGCCA 57.220 37.500 0.00 0.00 0.00 4.75
848 849 7.547019 ACAAACGGAATAACTAGTAACTAAGCC 59.453 37.037 0.00 0.00 0.00 4.35
849 850 8.471361 ACAAACGGAATAACTAGTAACTAAGC 57.529 34.615 0.00 0.00 0.00 3.09
852 853 8.190784 GCCTACAAACGGAATAACTAGTAACTA 58.809 37.037 0.00 0.00 0.00 2.24
853 854 7.038048 GCCTACAAACGGAATAACTAGTAACT 58.962 38.462 0.00 0.00 0.00 2.24
854 855 6.813152 TGCCTACAAACGGAATAACTAGTAAC 59.187 38.462 0.00 0.00 0.00 2.50
855 856 6.934056 TGCCTACAAACGGAATAACTAGTAA 58.066 36.000 0.00 0.00 0.00 2.24
856 857 6.528537 TGCCTACAAACGGAATAACTAGTA 57.471 37.500 0.00 0.00 0.00 1.82
857 858 5.410355 TGCCTACAAACGGAATAACTAGT 57.590 39.130 0.00 0.00 0.00 2.57
858 859 5.064325 GGTTGCCTACAAACGGAATAACTAG 59.936 44.000 0.00 0.00 37.58 2.57
859 860 4.937015 GGTTGCCTACAAACGGAATAACTA 59.063 41.667 0.00 0.00 37.58 2.24
860 861 3.754850 GGTTGCCTACAAACGGAATAACT 59.245 43.478 0.00 0.00 37.58 2.24
861 862 4.087510 GGTTGCCTACAAACGGAATAAC 57.912 45.455 0.00 0.00 37.58 1.89
869 870 3.623510 GCTAGAGATGGTTGCCTACAAAC 59.376 47.826 0.00 0.00 44.22 2.93
870 871 3.519510 AGCTAGAGATGGTTGCCTACAAA 59.480 43.478 0.00 0.00 37.58 2.83
871 872 3.107601 AGCTAGAGATGGTTGCCTACAA 58.892 45.455 0.00 0.00 0.00 2.41
872 873 2.752030 AGCTAGAGATGGTTGCCTACA 58.248 47.619 0.00 0.00 0.00 2.74
873 874 3.892588 ACTAGCTAGAGATGGTTGCCTAC 59.107 47.826 27.45 0.00 0.00 3.18
874 875 4.186077 ACTAGCTAGAGATGGTTGCCTA 57.814 45.455 27.45 0.00 0.00 3.93
875 876 3.039252 ACTAGCTAGAGATGGTTGCCT 57.961 47.619 27.45 0.00 0.00 4.75
876 877 3.828875 AACTAGCTAGAGATGGTTGCC 57.171 47.619 27.45 0.00 33.93 4.52
877 878 5.051153 GGTTAACTAGCTAGAGATGGTTGC 58.949 45.833 27.45 8.07 35.92 4.17
878 879 6.222038 TGGTTAACTAGCTAGAGATGGTTG 57.778 41.667 27.45 0.00 35.92 3.77
879 880 8.728596 ATATGGTTAACTAGCTAGAGATGGTT 57.271 34.615 27.45 12.75 38.61 3.67
880 881 8.728596 AATATGGTTAACTAGCTAGAGATGGT 57.271 34.615 27.45 9.52 0.00 3.55
881 882 8.807118 TGAATATGGTTAACTAGCTAGAGATGG 58.193 37.037 27.45 0.36 0.00 3.51
884 885 9.642343 TCTTGAATATGGTTAACTAGCTAGAGA 57.358 33.333 27.45 11.21 0.00 3.10
887 888 9.817809 TGTTCTTGAATATGGTTAACTAGCTAG 57.182 33.333 19.44 19.44 0.00 3.42
889 890 9.515226 TTTGTTCTTGAATATGGTTAACTAGCT 57.485 29.630 5.42 0.00 0.00 3.32
915 916 2.758423 AGCACTTCCCGTGTTTCTTTTT 59.242 40.909 0.00 0.00 45.57 1.94
916 917 2.375146 AGCACTTCCCGTGTTTCTTTT 58.625 42.857 0.00 0.00 45.57 2.27
917 918 2.052782 AGCACTTCCCGTGTTTCTTT 57.947 45.000 0.00 0.00 45.57 2.52
918 919 2.550208 CCTAGCACTTCCCGTGTTTCTT 60.550 50.000 0.00 0.00 45.57 2.52
919 920 1.002087 CCTAGCACTTCCCGTGTTTCT 59.998 52.381 0.00 0.00 45.57 2.52
920 921 1.270678 ACCTAGCACTTCCCGTGTTTC 60.271 52.381 0.00 0.00 45.57 2.78
921 922 0.763035 ACCTAGCACTTCCCGTGTTT 59.237 50.000 0.00 0.00 45.57 2.83
922 923 0.320697 GACCTAGCACTTCCCGTGTT 59.679 55.000 0.00 0.00 45.57 3.32
923 924 0.830444 TGACCTAGCACTTCCCGTGT 60.830 55.000 0.00 0.00 45.57 4.49
924 925 0.389948 GTGACCTAGCACTTCCCGTG 60.390 60.000 0.00 0.00 46.58 4.94
925 926 1.542187 GGTGACCTAGCACTTCCCGT 61.542 60.000 0.00 0.00 38.78 5.28
926 927 1.218316 GGTGACCTAGCACTTCCCG 59.782 63.158 0.00 0.00 38.78 5.14
927 928 0.537653 GAGGTGACCTAGCACTTCCC 59.462 60.000 2.97 0.00 38.51 3.97
928 929 1.478916 GAGAGGTGACCTAGCACTTCC 59.521 57.143 2.97 0.00 43.52 3.46
929 930 2.425668 GAGAGAGGTGACCTAGCACTTC 59.574 54.545 2.97 4.96 43.01 3.01
930 931 2.042433 AGAGAGAGGTGACCTAGCACTT 59.958 50.000 2.97 0.00 38.78 3.16
931 932 1.638589 AGAGAGAGGTGACCTAGCACT 59.361 52.381 2.97 0.00 38.78 4.40
932 933 2.021457 GAGAGAGAGGTGACCTAGCAC 58.979 57.143 2.97 0.00 38.05 4.40
933 934 1.636003 TGAGAGAGAGGTGACCTAGCA 59.364 52.381 2.97 0.00 31.76 3.49
934 935 2.092646 TCTGAGAGAGAGGTGACCTAGC 60.093 54.545 2.97 0.00 31.76 3.42
935 936 3.924114 TCTGAGAGAGAGGTGACCTAG 57.076 52.381 2.97 0.00 31.76 3.02
936 937 3.847184 TCTTCTGAGAGAGAGGTGACCTA 59.153 47.826 2.97 0.00 31.76 3.08
937 938 2.647299 TCTTCTGAGAGAGAGGTGACCT 59.353 50.000 2.41 2.41 36.03 3.85
938 939 3.080300 TCTTCTGAGAGAGAGGTGACC 57.920 52.381 0.00 0.00 30.18 4.02
939 940 4.331968 TCTTCTTCTGAGAGAGAGGTGAC 58.668 47.826 4.62 0.00 32.44 3.67
940 941 4.649267 TCTTCTTCTGAGAGAGAGGTGA 57.351 45.455 4.62 0.00 32.44 4.02
941 942 5.009631 TCTTCTTCTTCTGAGAGAGAGGTG 58.990 45.833 4.62 1.60 32.44 4.00
942 943 5.255397 TCTTCTTCTTCTGAGAGAGAGGT 57.745 43.478 4.62 0.00 32.44 3.85
943 944 6.015519 TGTTTCTTCTTCTTCTGAGAGAGAGG 60.016 42.308 0.00 0.00 32.44 3.69
944 945 6.863126 GTGTTTCTTCTTCTTCTGAGAGAGAG 59.137 42.308 0.00 0.00 32.44 3.20
945 946 6.514212 CGTGTTTCTTCTTCTTCTGAGAGAGA 60.514 42.308 0.00 0.00 32.44 3.10
946 947 5.629020 CGTGTTTCTTCTTCTTCTGAGAGAG 59.371 44.000 0.00 0.00 32.44 3.20
947 948 5.508153 CCGTGTTTCTTCTTCTTCTGAGAGA 60.508 44.000 0.00 0.00 32.44 3.10
948 949 4.683781 CCGTGTTTCTTCTTCTTCTGAGAG 59.316 45.833 0.00 0.00 32.44 3.20
949 950 4.621991 CCGTGTTTCTTCTTCTTCTGAGA 58.378 43.478 0.00 0.00 0.00 3.27
950 951 3.185391 GCCGTGTTTCTTCTTCTTCTGAG 59.815 47.826 0.00 0.00 0.00 3.35
951 952 3.131396 GCCGTGTTTCTTCTTCTTCTGA 58.869 45.455 0.00 0.00 0.00 3.27
952 953 2.872245 TGCCGTGTTTCTTCTTCTTCTG 59.128 45.455 0.00 0.00 0.00 3.02
953 954 3.194005 TGCCGTGTTTCTTCTTCTTCT 57.806 42.857 0.00 0.00 0.00 2.85
954 955 3.560068 TCTTGCCGTGTTTCTTCTTCTTC 59.440 43.478 0.00 0.00 0.00 2.87
955 956 3.541632 TCTTGCCGTGTTTCTTCTTCTT 58.458 40.909 0.00 0.00 0.00 2.52
956 957 3.194005 TCTTGCCGTGTTTCTTCTTCT 57.806 42.857 0.00 0.00 0.00 2.85
957 958 3.963383 TTCTTGCCGTGTTTCTTCTTC 57.037 42.857 0.00 0.00 0.00 2.87
958 959 3.489229 GCTTTCTTGCCGTGTTTCTTCTT 60.489 43.478 0.00 0.00 0.00 2.52
959 960 2.033424 GCTTTCTTGCCGTGTTTCTTCT 59.967 45.455 0.00 0.00 0.00 2.85
960 961 2.385315 GCTTTCTTGCCGTGTTTCTTC 58.615 47.619 0.00 0.00 0.00 2.87
961 962 1.268539 CGCTTTCTTGCCGTGTTTCTT 60.269 47.619 0.00 0.00 0.00 2.52
962 963 0.307760 CGCTTTCTTGCCGTGTTTCT 59.692 50.000 0.00 0.00 0.00 2.52
963 964 1.268778 GCGCTTTCTTGCCGTGTTTC 61.269 55.000 0.00 0.00 0.00 2.78
964 965 1.299089 GCGCTTTCTTGCCGTGTTT 60.299 52.632 0.00 0.00 0.00 2.83
965 966 2.331451 GCGCTTTCTTGCCGTGTT 59.669 55.556 0.00 0.00 0.00 3.32
966 967 3.660111 GGCGCTTTCTTGCCGTGT 61.660 61.111 7.64 0.00 42.22 4.49
970 971 3.368571 AGCTGGCGCTTTCTTGCC 61.369 61.111 7.64 0.00 46.47 4.52
984 985 0.680280 CCATTTCCTGCAGCTGAGCT 60.680 55.000 20.43 0.00 40.77 4.09
985 986 1.807886 CCATTTCCTGCAGCTGAGC 59.192 57.895 20.43 2.81 0.00 4.26
986 987 0.680280 AGCCATTTCCTGCAGCTGAG 60.680 55.000 20.43 11.85 31.23 3.35
987 988 0.620030 TAGCCATTTCCTGCAGCTGA 59.380 50.000 20.43 0.00 35.03 4.26
988 989 1.022735 CTAGCCATTTCCTGCAGCTG 58.977 55.000 10.11 10.11 35.03 4.24
989 990 0.106819 CCTAGCCATTTCCTGCAGCT 60.107 55.000 8.66 3.61 37.58 4.24
990 991 1.105759 CCCTAGCCATTTCCTGCAGC 61.106 60.000 8.66 0.00 0.00 5.25
991 992 1.105759 GCCCTAGCCATTTCCTGCAG 61.106 60.000 6.78 6.78 0.00 4.41
992 993 1.076777 GCCCTAGCCATTTCCTGCA 60.077 57.895 0.00 0.00 0.00 4.41
993 994 0.474184 TAGCCCTAGCCATTTCCTGC 59.526 55.000 0.00 0.00 41.25 4.85
994 995 1.771255 ACTAGCCCTAGCCATTTCCTG 59.229 52.381 2.31 0.00 41.25 3.86
995 996 2.198334 ACTAGCCCTAGCCATTTCCT 57.802 50.000 2.31 0.00 41.25 3.36
996 997 2.807108 CGAACTAGCCCTAGCCATTTCC 60.807 54.545 2.31 0.00 41.25 3.13
997 998 2.484889 CGAACTAGCCCTAGCCATTTC 58.515 52.381 2.31 0.00 41.25 2.17
998 999 1.475213 GCGAACTAGCCCTAGCCATTT 60.475 52.381 2.31 0.00 41.25 2.32
999 1000 0.106894 GCGAACTAGCCCTAGCCATT 59.893 55.000 2.31 0.00 41.25 3.16
1000 1001 0.760945 AGCGAACTAGCCCTAGCCAT 60.761 55.000 2.31 0.00 41.25 4.40
1001 1002 1.381327 AGCGAACTAGCCCTAGCCA 60.381 57.895 2.31 0.00 41.25 4.75
1002 1003 1.068250 CAGCGAACTAGCCCTAGCC 59.932 63.158 2.31 0.00 41.25 3.93
1003 1004 1.592939 GCAGCGAACTAGCCCTAGC 60.593 63.158 2.31 0.00 36.66 3.42
1004 1005 1.299468 CGCAGCGAACTAGCCCTAG 60.299 63.158 9.98 0.88 38.01 3.02
1005 1006 2.805546 CGCAGCGAACTAGCCCTA 59.194 61.111 9.98 0.00 38.01 3.53
1018 1019 1.350193 AATCTCTGTACGTTGCGCAG 58.650 50.000 11.31 1.78 0.00 5.18
1019 1020 1.724623 GAAATCTCTGTACGTTGCGCA 59.275 47.619 5.66 5.66 0.00 6.09
1020 1021 1.724623 TGAAATCTCTGTACGTTGCGC 59.275 47.619 0.00 0.00 0.00 6.09
1021 1022 2.092211 GGTGAAATCTCTGTACGTTGCG 59.908 50.000 0.00 0.00 0.00 4.85
1022 1023 2.415512 GGGTGAAATCTCTGTACGTTGC 59.584 50.000 0.00 0.00 0.00 4.17
1023 1024 3.000727 GGGGTGAAATCTCTGTACGTTG 58.999 50.000 0.00 0.00 0.00 4.10
1024 1025 2.904434 AGGGGTGAAATCTCTGTACGTT 59.096 45.455 0.00 0.00 0.00 3.99
1025 1026 2.496470 GAGGGGTGAAATCTCTGTACGT 59.504 50.000 0.00 0.00 0.00 3.57
1026 1027 2.159085 GGAGGGGTGAAATCTCTGTACG 60.159 54.545 0.00 0.00 0.00 3.67
1027 1028 2.159085 CGGAGGGGTGAAATCTCTGTAC 60.159 54.545 0.00 0.00 31.29 2.90
1028 1029 2.108168 CGGAGGGGTGAAATCTCTGTA 58.892 52.381 0.00 0.00 31.29 2.74
1029 1030 0.905357 CGGAGGGGTGAAATCTCTGT 59.095 55.000 0.00 0.00 31.29 3.41
1030 1031 0.905357 ACGGAGGGGTGAAATCTCTG 59.095 55.000 0.00 0.00 39.21 3.35
1031 1032 2.544844 TACGGAGGGGTGAAATCTCT 57.455 50.000 0.00 0.00 0.00 3.10
1032 1033 2.500504 ACTTACGGAGGGGTGAAATCTC 59.499 50.000 0.00 0.00 0.00 2.75
1033 1034 2.500504 GACTTACGGAGGGGTGAAATCT 59.499 50.000 0.00 0.00 0.00 2.40
1034 1035 2.500504 AGACTTACGGAGGGGTGAAATC 59.499 50.000 0.00 0.00 0.00 2.17
1035 1036 2.547990 AGACTTACGGAGGGGTGAAAT 58.452 47.619 0.00 0.00 0.00 2.17
1036 1037 2.019807 AGACTTACGGAGGGGTGAAA 57.980 50.000 0.00 0.00 0.00 2.69
1037 1038 2.905415 TAGACTTACGGAGGGGTGAA 57.095 50.000 0.00 0.00 0.00 3.18
1038 1039 4.524802 TTATAGACTTACGGAGGGGTGA 57.475 45.455 0.00 0.00 0.00 4.02
1039 1040 5.078256 AGATTATAGACTTACGGAGGGGTG 58.922 45.833 0.00 0.00 0.00 4.61
1040 1041 5.074790 AGAGATTATAGACTTACGGAGGGGT 59.925 44.000 0.00 0.00 0.00 4.95
1041 1042 5.572252 AGAGATTATAGACTTACGGAGGGG 58.428 45.833 0.00 0.00 0.00 4.79
1042 1043 6.715718 TGAAGAGATTATAGACTTACGGAGGG 59.284 42.308 0.00 0.00 0.00 4.30
1043 1044 7.747155 TGAAGAGATTATAGACTTACGGAGG 57.253 40.000 0.00 0.00 0.00 4.30
1044 1045 9.453325 GTTTGAAGAGATTATAGACTTACGGAG 57.547 37.037 0.00 0.00 0.00 4.63
1045 1046 9.186837 AGTTTGAAGAGATTATAGACTTACGGA 57.813 33.333 0.00 0.00 0.00 4.69
1046 1047 9.239002 CAGTTTGAAGAGATTATAGACTTACGG 57.761 37.037 0.00 0.00 0.00 4.02
1056 1057 9.917887 AGGATTTGATCAGTTTGAAGAGATTAT 57.082 29.630 0.00 0.00 0.00 1.28
1057 1058 9.388506 GAGGATTTGATCAGTTTGAAGAGATTA 57.611 33.333 0.00 0.00 0.00 1.75
1058 1059 7.338957 GGAGGATTTGATCAGTTTGAAGAGATT 59.661 37.037 0.00 0.00 0.00 2.40
1059 1060 6.827762 GGAGGATTTGATCAGTTTGAAGAGAT 59.172 38.462 0.00 0.00 0.00 2.75
1060 1061 6.176183 GGAGGATTTGATCAGTTTGAAGAGA 58.824 40.000 0.00 0.00 0.00 3.10
1061 1062 5.942236 TGGAGGATTTGATCAGTTTGAAGAG 59.058 40.000 0.00 0.00 0.00 2.85
1062 1063 5.879763 TGGAGGATTTGATCAGTTTGAAGA 58.120 37.500 0.00 0.00 0.00 2.87
1063 1064 6.016024 TGTTGGAGGATTTGATCAGTTTGAAG 60.016 38.462 0.00 0.00 0.00 3.02
1064 1065 5.832595 TGTTGGAGGATTTGATCAGTTTGAA 59.167 36.000 0.00 0.00 0.00 2.69
1065 1066 5.384336 TGTTGGAGGATTTGATCAGTTTGA 58.616 37.500 0.00 0.00 0.00 2.69
1066 1067 5.710513 TGTTGGAGGATTTGATCAGTTTG 57.289 39.130 0.00 0.00 0.00 2.93
1067 1068 6.923199 AATGTTGGAGGATTTGATCAGTTT 57.077 33.333 0.00 0.00 0.00 2.66
1068 1069 6.923199 AAATGTTGGAGGATTTGATCAGTT 57.077 33.333 0.00 0.00 0.00 3.16
1069 1070 6.723052 AGAAAATGTTGGAGGATTTGATCAGT 59.277 34.615 0.00 0.00 0.00 3.41
1070 1071 7.166691 AGAAAATGTTGGAGGATTTGATCAG 57.833 36.000 0.00 0.00 0.00 2.90
1071 1072 7.233144 TCAAGAAAATGTTGGAGGATTTGATCA 59.767 33.333 0.00 0.00 0.00 2.92
1072 1073 7.605449 TCAAGAAAATGTTGGAGGATTTGATC 58.395 34.615 0.00 0.00 0.00 2.92
1073 1074 7.543359 TCAAGAAAATGTTGGAGGATTTGAT 57.457 32.000 0.00 0.00 0.00 2.57
1074 1075 6.975196 TCAAGAAAATGTTGGAGGATTTGA 57.025 33.333 0.00 0.00 0.00 2.69
1075 1076 8.611654 ATTTCAAGAAAATGTTGGAGGATTTG 57.388 30.769 0.00 0.00 36.20 2.32
1079 1080 9.927668 GATTAATTTCAAGAAAATGTTGGAGGA 57.072 29.630 0.00 0.00 37.64 3.71
1080 1081 8.863049 CGATTAATTTCAAGAAAATGTTGGAGG 58.137 33.333 0.00 0.00 37.64 4.30
1081 1082 8.375465 GCGATTAATTTCAAGAAAATGTTGGAG 58.625 33.333 0.00 0.00 37.64 3.86
1082 1083 7.330700 GGCGATTAATTTCAAGAAAATGTTGGA 59.669 33.333 0.00 0.00 37.64 3.53
1083 1084 7.412891 GGGCGATTAATTTCAAGAAAATGTTGG 60.413 37.037 0.00 0.00 37.64 3.77
1084 1085 7.331687 AGGGCGATTAATTTCAAGAAAATGTTG 59.668 33.333 0.00 0.00 37.64 3.33
1085 1086 7.386059 AGGGCGATTAATTTCAAGAAAATGTT 58.614 30.769 0.00 0.00 37.64 2.71
1086 1087 6.935167 AGGGCGATTAATTTCAAGAAAATGT 58.065 32.000 0.00 0.00 37.64 2.71
1087 1088 7.168135 GCTAGGGCGATTAATTTCAAGAAAATG 59.832 37.037 0.00 0.00 37.64 2.32
1088 1089 7.147915 TGCTAGGGCGATTAATTTCAAGAAAAT 60.148 33.333 0.00 0.00 42.25 1.82
1089 1090 6.151985 TGCTAGGGCGATTAATTTCAAGAAAA 59.848 34.615 0.00 0.00 42.25 2.29
1090 1091 5.650266 TGCTAGGGCGATTAATTTCAAGAAA 59.350 36.000 0.00 0.00 42.25 2.52
1091 1092 5.189928 TGCTAGGGCGATTAATTTCAAGAA 58.810 37.500 0.00 0.00 42.25 2.52
1092 1093 4.776349 TGCTAGGGCGATTAATTTCAAGA 58.224 39.130 0.00 0.00 42.25 3.02
1093 1094 5.239306 TCATGCTAGGGCGATTAATTTCAAG 59.761 40.000 0.00 0.00 42.25 3.02
1094 1095 5.129634 TCATGCTAGGGCGATTAATTTCAA 58.870 37.500 0.00 0.00 42.25 2.69
1095 1096 4.713553 TCATGCTAGGGCGATTAATTTCA 58.286 39.130 0.00 0.00 42.25 2.69
1096 1097 5.446473 CGATCATGCTAGGGCGATTAATTTC 60.446 44.000 0.00 0.00 42.25 2.17
1097 1098 4.393062 CGATCATGCTAGGGCGATTAATTT 59.607 41.667 0.00 0.00 42.25 1.82
1098 1099 3.935203 CGATCATGCTAGGGCGATTAATT 59.065 43.478 0.00 0.00 42.25 1.40
1099 1100 3.055819 ACGATCATGCTAGGGCGATTAAT 60.056 43.478 0.00 0.00 42.25 1.40
1100 1101 2.299013 ACGATCATGCTAGGGCGATTAA 59.701 45.455 0.00 0.00 42.25 1.40
1101 1102 1.893137 ACGATCATGCTAGGGCGATTA 59.107 47.619 0.00 0.00 42.25 1.75
1102 1103 0.681733 ACGATCATGCTAGGGCGATT 59.318 50.000 0.00 0.00 42.25 3.34
1103 1104 0.244994 GACGATCATGCTAGGGCGAT 59.755 55.000 0.00 0.00 42.25 4.58
1104 1105 1.106944 TGACGATCATGCTAGGGCGA 61.107 55.000 0.00 0.00 42.25 5.54
1105 1106 0.249447 TTGACGATCATGCTAGGGCG 60.249 55.000 0.00 0.00 42.25 6.13
1106 1107 1.802960 CATTGACGATCATGCTAGGGC 59.197 52.381 0.00 0.00 39.26 5.19
1107 1108 1.802960 GCATTGACGATCATGCTAGGG 59.197 52.381 8.16 0.00 37.10 3.53
1112 1113 3.181503 ACAGAAAGCATTGACGATCATGC 60.182 43.478 7.48 7.48 40.09 4.06
1113 1114 4.611310 ACAGAAAGCATTGACGATCATG 57.389 40.909 0.00 0.00 0.00 3.07
1114 1115 4.272018 GCTACAGAAAGCATTGACGATCAT 59.728 41.667 0.00 0.00 42.30 2.45
1115 1116 3.618594 GCTACAGAAAGCATTGACGATCA 59.381 43.478 0.00 0.00 42.30 2.92
1116 1117 3.001736 GGCTACAGAAAGCATTGACGATC 59.998 47.826 0.00 0.00 44.64 3.69
1117 1118 2.939103 GGCTACAGAAAGCATTGACGAT 59.061 45.455 0.00 0.00 44.64 3.73
1118 1119 2.028112 AGGCTACAGAAAGCATTGACGA 60.028 45.455 0.00 0.00 44.64 4.20
1119 1120 2.094894 CAGGCTACAGAAAGCATTGACG 59.905 50.000 0.00 0.00 44.64 4.35
1120 1121 3.077359 ACAGGCTACAGAAAGCATTGAC 58.923 45.455 0.00 0.00 44.64 3.18
1121 1122 3.423539 ACAGGCTACAGAAAGCATTGA 57.576 42.857 0.00 0.00 44.64 2.57
1122 1123 4.510038 AAACAGGCTACAGAAAGCATTG 57.490 40.909 0.00 0.00 44.64 2.82
1123 1124 5.302823 AGAAAAACAGGCTACAGAAAGCATT 59.697 36.000 0.00 0.00 44.64 3.56
1124 1125 4.829492 AGAAAAACAGGCTACAGAAAGCAT 59.171 37.500 0.00 0.00 44.64 3.79
1125 1126 4.207165 AGAAAAACAGGCTACAGAAAGCA 58.793 39.130 0.00 0.00 44.64 3.91
1126 1127 4.320567 GGAGAAAAACAGGCTACAGAAAGC 60.321 45.833 0.00 0.00 41.99 3.51
1127 1128 4.821805 TGGAGAAAAACAGGCTACAGAAAG 59.178 41.667 0.00 0.00 0.00 2.62
1128 1129 4.578928 GTGGAGAAAAACAGGCTACAGAAA 59.421 41.667 0.00 0.00 0.00 2.52
1129 1130 4.134563 GTGGAGAAAAACAGGCTACAGAA 58.865 43.478 0.00 0.00 0.00 3.02
1130 1131 3.135712 TGTGGAGAAAAACAGGCTACAGA 59.864 43.478 0.00 0.00 0.00 3.41
1131 1132 3.476552 TGTGGAGAAAAACAGGCTACAG 58.523 45.455 0.00 0.00 0.00 2.74
1132 1133 3.569194 TGTGGAGAAAAACAGGCTACA 57.431 42.857 0.00 0.00 0.00 2.74
1133 1134 4.072131 TGATGTGGAGAAAAACAGGCTAC 58.928 43.478 0.00 0.00 0.00 3.58
1134 1135 4.365514 TGATGTGGAGAAAAACAGGCTA 57.634 40.909 0.00 0.00 0.00 3.93
1135 1136 3.228188 TGATGTGGAGAAAAACAGGCT 57.772 42.857 0.00 0.00 0.00 4.58
1136 1137 3.319122 AGTTGATGTGGAGAAAAACAGGC 59.681 43.478 0.00 0.00 0.00 4.85
1137 1138 4.319766 CGAGTTGATGTGGAGAAAAACAGG 60.320 45.833 0.00 0.00 0.00 4.00
1138 1139 4.511454 TCGAGTTGATGTGGAGAAAAACAG 59.489 41.667 0.00 0.00 0.00 3.16
1139 1140 4.447290 TCGAGTTGATGTGGAGAAAAACA 58.553 39.130 0.00 0.00 0.00 2.83
1140 1141 5.418310 TTCGAGTTGATGTGGAGAAAAAC 57.582 39.130 0.00 0.00 0.00 2.43
1141 1142 6.633500 AATTCGAGTTGATGTGGAGAAAAA 57.367 33.333 0.00 0.00 0.00 1.94
1142 1143 6.633500 AAATTCGAGTTGATGTGGAGAAAA 57.367 33.333 0.00 0.00 0.00 2.29
1143 1144 6.934645 ACTAAATTCGAGTTGATGTGGAGAAA 59.065 34.615 0.00 0.00 0.00 2.52
1144 1145 6.464222 ACTAAATTCGAGTTGATGTGGAGAA 58.536 36.000 0.00 0.00 0.00 2.87
1145 1146 6.037786 ACTAAATTCGAGTTGATGTGGAGA 57.962 37.500 0.00 0.00 0.00 3.71
1146 1147 6.591834 AGAACTAAATTCGAGTTGATGTGGAG 59.408 38.462 9.75 0.00 42.69 3.86
1147 1148 6.464222 AGAACTAAATTCGAGTTGATGTGGA 58.536 36.000 9.75 0.00 42.69 4.02
1148 1149 6.368791 TGAGAACTAAATTCGAGTTGATGTGG 59.631 38.462 9.75 0.00 42.69 4.17
1149 1150 7.351414 TGAGAACTAAATTCGAGTTGATGTG 57.649 36.000 9.75 0.00