Multiple sequence alignment - TraesCS5B01G564300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G564300 chr5B 100.000 5236 0 0 1 5236 709676941 709682176 0.000000e+00 9670.0
1 TraesCS5B01G564300 chr5B 79.141 163 31 2 1965 2124 479726832 479726994 5.540000e-20 110.0
2 TraesCS5B01G564300 chr5B 82.353 119 20 1 1961 2078 136047819 136047701 9.280000e-18 102.0
3 TraesCS5B01G564300 chr6A 81.216 1645 271 27 2592 4229 1831785 1833398 0.000000e+00 1291.0
4 TraesCS5B01G564300 chr6A 87.198 703 75 7 1052 1748 1830993 1831686 0.000000e+00 785.0
5 TraesCS5B01G564300 chr4A 76.516 1682 340 39 2593 4250 708650596 708648946 0.000000e+00 867.0
6 TraesCS5B01G564300 chr2B 95.614 456 16 2 1 452 779098654 779099109 0.000000e+00 728.0
7 TraesCS5B01G564300 chr2B 92.371 485 27 8 1 478 619961127 619961608 0.000000e+00 682.0
8 TraesCS5B01G564300 chr2B 90.196 102 7 2 4977 5075 318259061 318258960 4.260000e-26 130.0
9 TraesCS5B01G564300 chr2B 88.571 105 8 3 4977 5078 377132581 377132478 1.980000e-24 124.0
10 TraesCS5B01G564300 chr2B 80.952 126 23 1 1980 2104 175632830 175632705 1.200000e-16 99.0
11 TraesCS5B01G564300 chr2B 97.826 46 1 0 5191 5236 68256827 68256782 4.350000e-11 80.5
12 TraesCS5B01G564300 chr1B 95.614 456 16 2 1 452 300185604 300185149 0.000000e+00 728.0
13 TraesCS5B01G564300 chr3A 92.784 485 24 9 1 478 11619397 11619877 0.000000e+00 691.0
14 TraesCS5B01G564300 chr3A 81.366 161 26 4 1966 2124 675873182 675873024 1.530000e-25 128.0
15 TraesCS5B01G564300 chr7B 94.092 457 21 5 1 452 734292189 734291734 0.000000e+00 689.0
16 TraesCS5B01G564300 chr7B 92.181 486 27 9 1 479 538210685 538211166 0.000000e+00 676.0
17 TraesCS5B01G564300 chr7B 100.000 37 0 0 5191 5227 698239785 698239821 9.410000e-08 69.4
18 TraesCS5B01G564300 chr7B 93.333 45 1 2 5193 5236 641075239 641075196 1.220000e-06 65.8
19 TraesCS5B01G564300 chr5A 94.235 451 21 3 1 447 400793332 400793781 0.000000e+00 684.0
20 TraesCS5B01G564300 chr5A 95.652 46 2 0 5191 5236 224693143 224693188 2.020000e-09 75.0
21 TraesCS5B01G564300 chr4B 91.736 484 34 4 1 479 52581451 52581933 0.000000e+00 667.0
22 TraesCS5B01G564300 chr4B 78.516 256 36 12 4421 4669 442424558 442424801 3.270000e-32 150.0
23 TraesCS5B01G564300 chr1D 91.079 482 38 3 1 478 4230136 4229656 0.000000e+00 647.0
24 TraesCS5B01G564300 chr1D 90.099 101 8 2 4980 5078 478256555 478256455 4.260000e-26 130.0
25 TraesCS5B01G564300 chr1D 88.462 104 10 1 4977 5078 314718506 314718403 1.980000e-24 124.0
26 TraesCS5B01G564300 chr3B 80.072 276 32 14 4420 4687 663066419 663066159 3.220000e-42 183.0
27 TraesCS5B01G564300 chr3B 93.478 46 3 0 5191 5236 170761465 170761420 9.410000e-08 69.4
28 TraesCS5B01G564300 chr3D 76.603 312 40 17 4420 4728 483002752 483003033 1.970000e-29 141.0
29 TraesCS5B01G564300 chr3D 91.837 49 2 2 5178 5226 305315159 305315205 3.380000e-07 67.6
30 TraesCS5B01G564300 chr7D 90.385 104 7 2 4976 5077 393617326 393617428 3.290000e-27 134.0
31 TraesCS5B01G564300 chr2A 91.000 100 7 1 4980 5077 733798240 733798141 3.290000e-27 134.0
32 TraesCS5B01G564300 chr2A 79.866 149 24 5 1980 2124 127201054 127200908 2.580000e-18 104.0
33 TraesCS5B01G564300 chr2A 93.478 46 3 0 5191 5236 771163779 771163734 9.410000e-08 69.4
34 TraesCS5B01G564300 chr6B 89.320 103 9 1 4977 5077 336181213 336181315 1.530000e-25 128.0
35 TraesCS5B01G564300 chr6B 89.320 103 8 2 4977 5077 506292354 506292253 5.500000e-25 126.0
36 TraesCS5B01G564300 chrUn 89.320 103 8 2 4980 5079 310390179 310390077 5.500000e-25 126.0
37 TraesCS5B01G564300 chr5D 79.755 163 30 2 1965 2124 399614519 399614681 1.190000e-21 115.0
38 TraesCS5B01G564300 chr2D 80.537 149 24 4 1980 2124 122866863 122866716 5.540000e-20 110.0
39 TraesCS5B01G564300 chr2D 83.929 112 16 2 1970 2079 534928751 534928640 7.170000e-19 106.0
40 TraesCS5B01G564300 chr7A 83.186 113 18 1 1965 2076 166333492 166333604 9.280000e-18 102.0
41 TraesCS5B01G564300 chr7A 95.652 46 2 0 5191 5236 1431132 1431087 2.020000e-09 75.0
42 TraesCS5B01G564300 chr7A 97.561 41 1 0 5187 5227 10900696 10900736 2.620000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G564300 chr5B 709676941 709682176 5235 False 9670 9670 100.000 1 5236 1 chr5B.!!$F2 5235
1 TraesCS5B01G564300 chr6A 1830993 1833398 2405 False 1038 1291 84.207 1052 4229 2 chr6A.!!$F1 3177
2 TraesCS5B01G564300 chr4A 708648946 708650596 1650 True 867 867 76.516 2593 4250 1 chr4A.!!$R1 1657


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
140 141 0.032515 TGACTGCGGGAGGGAATAGA 60.033 55.0 0.51 0.0 0.00 1.98 F
1404 1408 0.036952 TTGAGCTCCTCCGCAAGAAG 60.037 55.0 12.15 0.0 43.02 2.85 F
2078 2085 0.034896 GAGGCTCGTTCAAACCAGGA 59.965 55.0 0.00 0.0 0.00 3.86 F
2531 2538 0.035881 CTCAGGACCAGCAAGAGCAA 59.964 55.0 0.00 0.0 45.49 3.91 F
3916 3938 0.038599 TACTACCTCTCGTGGTGGCA 59.961 55.0 7.54 0.0 41.53 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2059 2066 0.034896 TCCTGGTTTGAACGAGCCTC 59.965 55.0 0.00 0.00 33.95 4.70 R
2539 2546 0.034477 GTGGGTCGATGGGGAACAAT 60.034 55.0 0.00 0.00 0.00 2.71 R
3951 3979 0.036732 TCTGTCATTGTGGCCACCTC 59.963 55.0 32.62 17.48 0.00 3.85 R
4123 4151 0.036952 CATCACACGCTCCTCTTGGT 60.037 55.0 0.00 0.00 34.23 3.67 R
5061 5089 0.040603 CGCGTATACTTCCTCCGTCC 60.041 60.0 0.00 0.00 0.00 4.79 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.533266 ACATCACCATGATCGGCTAC 57.467 50.000 0.00 0.00 34.28 3.58
21 22 1.070758 ACATCACCATGATCGGCTACC 59.929 52.381 0.00 0.00 34.28 3.18
22 23 1.345741 CATCACCATGATCGGCTACCT 59.654 52.381 0.00 0.00 34.28 3.08
23 24 1.040646 TCACCATGATCGGCTACCTC 58.959 55.000 0.00 0.00 0.00 3.85
24 25 0.319040 CACCATGATCGGCTACCTCG 60.319 60.000 0.00 0.00 0.00 4.63
25 26 1.290324 CCATGATCGGCTACCTCGG 59.710 63.158 0.00 0.00 0.00 4.63
26 27 1.373497 CATGATCGGCTACCTCGGC 60.373 63.158 0.00 0.00 0.00 5.54
31 32 4.124351 CGGCTACCTCGGCGTTGA 62.124 66.667 6.85 0.00 46.32 3.18
32 33 2.508663 GGCTACCTCGGCGTTGAC 60.509 66.667 6.85 0.00 0.00 3.18
33 34 2.260434 GCTACCTCGGCGTTGACA 59.740 61.111 6.85 0.00 0.00 3.58
34 35 1.153628 GCTACCTCGGCGTTGACAT 60.154 57.895 6.85 0.00 0.00 3.06
35 36 0.739813 GCTACCTCGGCGTTGACATT 60.740 55.000 6.85 0.00 0.00 2.71
36 37 1.470285 GCTACCTCGGCGTTGACATTA 60.470 52.381 6.85 0.00 0.00 1.90
37 38 2.883574 CTACCTCGGCGTTGACATTAA 58.116 47.619 6.85 0.00 0.00 1.40
38 39 2.396590 ACCTCGGCGTTGACATTAAT 57.603 45.000 6.85 0.00 0.00 1.40
39 40 2.006888 ACCTCGGCGTTGACATTAATG 58.993 47.619 14.01 14.01 0.00 1.90
40 41 1.330521 CCTCGGCGTTGACATTAATGG 59.669 52.381 19.37 2.61 0.00 3.16
41 42 0.730265 TCGGCGTTGACATTAATGGC 59.270 50.000 19.37 17.24 38.38 4.40
42 43 0.732571 CGGCGTTGACATTAATGGCT 59.267 50.000 21.77 0.22 39.27 4.75
43 44 1.937223 CGGCGTTGACATTAATGGCTA 59.063 47.619 21.77 12.12 39.27 3.93
44 45 2.286184 CGGCGTTGACATTAATGGCTAC 60.286 50.000 21.66 21.66 39.27 3.58
52 53 8.228921 GTTGACATTAATGGCTACGTCTATAG 57.771 38.462 21.77 0.00 36.54 1.31
53 54 6.387465 TGACATTAATGGCTACGTCTATAGC 58.613 40.000 21.77 0.00 45.82 2.97
62 63 4.152526 GCTACGTCTATAGCAACTCATCG 58.847 47.826 3.18 0.00 45.83 3.84
63 64 3.627732 ACGTCTATAGCAACTCATCGG 57.372 47.619 0.00 0.00 0.00 4.18
64 65 2.287668 ACGTCTATAGCAACTCATCGGC 60.288 50.000 0.00 0.00 0.00 5.54
65 66 2.287608 CGTCTATAGCAACTCATCGGCA 60.288 50.000 0.00 0.00 0.00 5.69
66 67 3.717707 GTCTATAGCAACTCATCGGCAA 58.282 45.455 0.00 0.00 0.00 4.52
67 68 3.491267 GTCTATAGCAACTCATCGGCAAC 59.509 47.826 0.00 0.00 0.00 4.17
68 69 2.401583 ATAGCAACTCATCGGCAACA 57.598 45.000 0.00 0.00 0.00 3.33
69 70 2.177394 TAGCAACTCATCGGCAACAA 57.823 45.000 0.00 0.00 0.00 2.83
70 71 0.593128 AGCAACTCATCGGCAACAAC 59.407 50.000 0.00 0.00 0.00 3.32
71 72 0.593128 GCAACTCATCGGCAACAACT 59.407 50.000 0.00 0.00 0.00 3.16
72 73 1.400242 GCAACTCATCGGCAACAACTC 60.400 52.381 0.00 0.00 0.00 3.01
73 74 1.197721 CAACTCATCGGCAACAACTCC 59.802 52.381 0.00 0.00 0.00 3.85
74 75 0.396435 ACTCATCGGCAACAACTCCA 59.604 50.000 0.00 0.00 0.00 3.86
75 76 1.081892 CTCATCGGCAACAACTCCAG 58.918 55.000 0.00 0.00 0.00 3.86
76 77 0.396435 TCATCGGCAACAACTCCAGT 59.604 50.000 0.00 0.00 0.00 4.00
77 78 0.798776 CATCGGCAACAACTCCAGTC 59.201 55.000 0.00 0.00 0.00 3.51
78 79 0.396435 ATCGGCAACAACTCCAGTCA 59.604 50.000 0.00 0.00 0.00 3.41
79 80 0.179234 TCGGCAACAACTCCAGTCAA 59.821 50.000 0.00 0.00 0.00 3.18
80 81 0.307760 CGGCAACAACTCCAGTCAAC 59.692 55.000 0.00 0.00 0.00 3.18
81 82 1.388547 GGCAACAACTCCAGTCAACA 58.611 50.000 0.00 0.00 0.00 3.33
82 83 1.334869 GGCAACAACTCCAGTCAACAG 59.665 52.381 0.00 0.00 0.00 3.16
83 84 1.268743 GCAACAACTCCAGTCAACAGC 60.269 52.381 0.00 0.00 0.00 4.40
84 85 1.003545 CAACAACTCCAGTCAACAGCG 60.004 52.381 0.00 0.00 0.00 5.18
85 86 0.178068 ACAACTCCAGTCAACAGCGT 59.822 50.000 0.00 0.00 0.00 5.07
86 87 0.861837 CAACTCCAGTCAACAGCGTC 59.138 55.000 0.00 0.00 0.00 5.19
87 88 0.249911 AACTCCAGTCAACAGCGTCC 60.250 55.000 0.00 0.00 0.00 4.79
88 89 1.734477 CTCCAGTCAACAGCGTCCG 60.734 63.158 0.00 0.00 0.00 4.79
89 90 3.414700 CCAGTCAACAGCGTCCGC 61.415 66.667 2.94 2.94 42.33 5.54
99 100 4.450122 GCGTCCGCGTCGTCACTA 62.450 66.667 18.76 0.00 40.81 2.74
100 101 2.276493 CGTCCGCGTCGTCACTAG 60.276 66.667 4.92 0.00 0.00 2.57
101 102 2.576317 GTCCGCGTCGTCACTAGC 60.576 66.667 4.92 0.00 0.00 3.42
104 105 2.938002 CGCGTCGTCACTAGCGTC 60.938 66.667 0.00 0.00 46.48 5.19
105 106 2.576317 GCGTCGTCACTAGCGTCC 60.576 66.667 0.00 0.00 0.00 4.79
106 107 2.865308 CGTCGTCACTAGCGTCCA 59.135 61.111 0.00 0.00 0.00 4.02
107 108 1.511464 CGTCGTCACTAGCGTCCAC 60.511 63.158 0.00 0.00 0.00 4.02
108 109 1.511464 GTCGTCACTAGCGTCCACG 60.511 63.158 0.00 0.00 43.27 4.94
125 126 4.008933 GCCACTCCCGCTGTGACT 62.009 66.667 0.00 0.00 37.60 3.41
126 127 2.047844 CCACTCCCGCTGTGACTG 60.048 66.667 0.00 0.00 37.60 3.51
127 128 2.740055 CACTCCCGCTGTGACTGC 60.740 66.667 4.22 4.22 37.60 4.40
134 135 4.767255 GCTGTGACTGCGGGAGGG 62.767 72.222 0.51 0.00 0.00 4.30
135 136 2.997315 CTGTGACTGCGGGAGGGA 60.997 66.667 0.51 0.00 0.00 4.20
136 137 2.525629 TGTGACTGCGGGAGGGAA 60.526 61.111 0.51 0.00 0.00 3.97
137 138 1.903877 CTGTGACTGCGGGAGGGAAT 61.904 60.000 0.51 0.00 0.00 3.01
138 139 0.616395 TGTGACTGCGGGAGGGAATA 60.616 55.000 0.51 0.00 0.00 1.75
139 140 0.105039 GTGACTGCGGGAGGGAATAG 59.895 60.000 0.51 0.00 0.00 1.73
140 141 0.032515 TGACTGCGGGAGGGAATAGA 60.033 55.000 0.51 0.00 0.00 1.98
141 142 0.676736 GACTGCGGGAGGGAATAGAG 59.323 60.000 0.51 0.00 0.00 2.43
142 143 0.261991 ACTGCGGGAGGGAATAGAGA 59.738 55.000 0.51 0.00 0.00 3.10
143 144 1.343075 ACTGCGGGAGGGAATAGAGAA 60.343 52.381 0.51 0.00 0.00 2.87
144 145 1.342819 CTGCGGGAGGGAATAGAGAAG 59.657 57.143 0.00 0.00 0.00 2.85
145 146 0.682292 GCGGGAGGGAATAGAGAAGG 59.318 60.000 0.00 0.00 0.00 3.46
146 147 0.682292 CGGGAGGGAATAGAGAAGGC 59.318 60.000 0.00 0.00 0.00 4.35
147 148 1.807814 GGGAGGGAATAGAGAAGGCA 58.192 55.000 0.00 0.00 0.00 4.75
148 149 1.696884 GGGAGGGAATAGAGAAGGCAG 59.303 57.143 0.00 0.00 0.00 4.85
149 150 1.696884 GGAGGGAATAGAGAAGGCAGG 59.303 57.143 0.00 0.00 0.00 4.85
150 151 2.683768 GAGGGAATAGAGAAGGCAGGA 58.316 52.381 0.00 0.00 0.00 3.86
151 152 3.041946 GAGGGAATAGAGAAGGCAGGAA 58.958 50.000 0.00 0.00 0.00 3.36
152 153 3.044894 AGGGAATAGAGAAGGCAGGAAG 58.955 50.000 0.00 0.00 0.00 3.46
153 154 2.105649 GGGAATAGAGAAGGCAGGAAGG 59.894 54.545 0.00 0.00 0.00 3.46
154 155 2.486370 GGAATAGAGAAGGCAGGAAGGC 60.486 54.545 0.00 0.00 44.61 4.35
161 162 2.436109 GGCAGGAAGGCACCAGAA 59.564 61.111 3.78 0.00 43.51 3.02
162 163 1.676967 GGCAGGAAGGCACCAGAAG 60.677 63.158 3.78 0.00 43.51 2.85
163 164 1.676967 GCAGGAAGGCACCAGAAGG 60.677 63.158 3.78 0.00 42.21 3.46
164 165 1.001641 CAGGAAGGCACCAGAAGGG 60.002 63.158 3.78 0.00 44.81 3.95
165 166 2.234296 AGGAAGGCACCAGAAGGGG 61.234 63.158 3.78 0.00 42.91 4.79
166 167 2.231380 GGAAGGCACCAGAAGGGGA 61.231 63.158 0.00 0.00 42.79 4.81
170 171 4.329545 GCACCAGAAGGGGACGCA 62.330 66.667 0.00 0.00 42.79 5.24
171 172 2.046892 CACCAGAAGGGGACGCAG 60.047 66.667 0.00 0.00 42.79 5.18
172 173 2.526873 ACCAGAAGGGGACGCAGT 60.527 61.111 0.00 0.00 43.12 4.40
173 174 1.229082 ACCAGAAGGGGACGCAGTA 60.229 57.895 0.00 0.00 40.72 2.74
174 175 0.834687 ACCAGAAGGGGACGCAGTAA 60.835 55.000 0.00 0.00 40.72 2.24
175 176 3.048972 ACCAGAAGGGGACGCAGTAAC 62.049 57.143 0.00 0.00 40.72 2.50
183 184 2.890371 ACGCAGTAACCGCCCTAG 59.110 61.111 0.00 0.00 41.94 3.02
184 185 2.106332 CGCAGTAACCGCCCTAGG 59.894 66.667 0.06 0.06 37.30 3.02
186 187 1.153429 GCAGTAACCGCCCTAGGTG 60.153 63.158 8.29 0.05 45.21 4.00
195 196 2.768344 CCCTAGGTGGCGACCCAT 60.768 66.667 15.08 0.00 44.40 4.00
196 197 2.808206 CCCTAGGTGGCGACCCATC 61.808 68.421 15.08 0.00 44.40 3.51
197 198 2.063979 CCTAGGTGGCGACCCATCA 61.064 63.158 15.08 0.00 45.19 3.07
198 199 1.443407 CTAGGTGGCGACCCATCAG 59.557 63.158 15.08 3.29 45.19 2.90
199 200 1.001120 TAGGTGGCGACCCATCAGA 59.999 57.895 15.08 0.00 45.19 3.27
200 201 1.043116 TAGGTGGCGACCCATCAGAG 61.043 60.000 15.08 0.00 45.19 3.35
201 202 2.359169 GGTGGCGACCCATCAGAGA 61.359 63.158 6.63 0.00 44.51 3.10
202 203 1.153549 GTGGCGACCCATCAGAGAC 60.154 63.158 0.00 0.00 44.51 3.36
203 204 2.105128 GGCGACCCATCAGAGACG 59.895 66.667 0.00 0.00 0.00 4.18
204 205 2.583593 GCGACCCATCAGAGACGC 60.584 66.667 0.00 0.00 39.33 5.19
205 206 2.885113 CGACCCATCAGAGACGCA 59.115 61.111 0.00 0.00 0.00 5.24
206 207 1.226802 CGACCCATCAGAGACGCAG 60.227 63.158 0.00 0.00 0.00 5.18
212 213 1.931841 CCATCAGAGACGCAGTTGATG 59.068 52.381 11.45 11.45 46.73 3.07
219 220 3.489731 CGCAGTTGATGATGGCGT 58.510 55.556 0.00 0.00 42.51 5.68
220 221 1.061411 CGCAGTTGATGATGGCGTG 59.939 57.895 0.00 0.00 42.51 5.34
221 222 1.430632 GCAGTTGATGATGGCGTGG 59.569 57.895 0.00 0.00 0.00 4.94
222 223 1.430632 CAGTTGATGATGGCGTGGC 59.569 57.895 0.00 0.00 0.00 5.01
223 224 2.108514 AGTTGATGATGGCGTGGCG 61.109 57.895 0.00 0.00 0.00 5.69
224 225 2.823593 TTGATGATGGCGTGGCGG 60.824 61.111 0.00 0.00 0.00 6.13
225 226 3.322318 TTGATGATGGCGTGGCGGA 62.322 57.895 0.00 0.00 0.00 5.54
226 227 2.969238 GATGATGGCGTGGCGGAG 60.969 66.667 0.00 0.00 0.00 4.63
227 228 3.445518 GATGATGGCGTGGCGGAGA 62.446 63.158 0.00 0.00 0.00 3.71
228 229 2.923426 GATGATGGCGTGGCGGAGAA 62.923 60.000 0.00 0.00 0.00 2.87
229 230 2.892425 GATGGCGTGGCGGAGAAG 60.892 66.667 0.00 0.00 0.00 2.85
230 231 3.371097 GATGGCGTGGCGGAGAAGA 62.371 63.158 0.00 0.00 0.00 2.87
231 232 3.665675 ATGGCGTGGCGGAGAAGAC 62.666 63.158 0.00 0.00 0.00 3.01
233 234 4.415332 GCGTGGCGGAGAAGACGA 62.415 66.667 0.00 0.00 33.64 4.20
234 235 2.504244 CGTGGCGGAGAAGACGAC 60.504 66.667 0.00 0.00 40.49 4.34
235 236 2.504244 GTGGCGGAGAAGACGACG 60.504 66.667 0.00 0.00 43.75 5.12
236 237 3.744719 TGGCGGAGAAGACGACGG 61.745 66.667 0.00 0.00 43.75 4.79
237 238 4.493747 GGCGGAGAAGACGACGGG 62.494 72.222 0.00 0.00 0.00 5.28
238 239 3.437795 GCGGAGAAGACGACGGGA 61.438 66.667 0.00 0.00 0.00 5.14
239 240 2.792599 CGGAGAAGACGACGGGAG 59.207 66.667 0.00 0.00 0.00 4.30
240 241 2.490685 GGAGAAGACGACGGGAGC 59.509 66.667 0.00 0.00 0.00 4.70
241 242 2.341101 GGAGAAGACGACGGGAGCA 61.341 63.158 0.00 0.00 0.00 4.26
242 243 1.153997 GAGAAGACGACGGGAGCAC 60.154 63.158 0.00 0.00 0.00 4.40
243 244 1.863662 GAGAAGACGACGGGAGCACA 61.864 60.000 0.00 0.00 0.00 4.57
244 245 1.006571 GAAGACGACGGGAGCACAA 60.007 57.895 0.00 0.00 0.00 3.33
245 246 1.006102 AAGACGACGGGAGCACAAG 60.006 57.895 0.00 0.00 0.00 3.16
246 247 1.461091 AAGACGACGGGAGCACAAGA 61.461 55.000 0.00 0.00 0.00 3.02
247 248 1.444553 GACGACGGGAGCACAAGAG 60.445 63.158 0.00 0.00 0.00 2.85
248 249 2.143594 GACGACGGGAGCACAAGAGT 62.144 60.000 0.00 0.00 0.00 3.24
249 250 1.006102 CGACGGGAGCACAAGAGTT 60.006 57.895 0.00 0.00 0.00 3.01
250 251 0.600255 CGACGGGAGCACAAGAGTTT 60.600 55.000 0.00 0.00 0.00 2.66
251 252 1.336517 CGACGGGAGCACAAGAGTTTA 60.337 52.381 0.00 0.00 0.00 2.01
252 253 2.762745 GACGGGAGCACAAGAGTTTAA 58.237 47.619 0.00 0.00 0.00 1.52
253 254 3.135994 GACGGGAGCACAAGAGTTTAAA 58.864 45.455 0.00 0.00 0.00 1.52
254 255 3.751518 ACGGGAGCACAAGAGTTTAAAT 58.248 40.909 0.00 0.00 0.00 1.40
255 256 4.142038 ACGGGAGCACAAGAGTTTAAATT 58.858 39.130 0.00 0.00 0.00 1.82
256 257 4.215613 ACGGGAGCACAAGAGTTTAAATTC 59.784 41.667 2.62 2.62 0.00 2.17
257 258 4.215399 CGGGAGCACAAGAGTTTAAATTCA 59.785 41.667 12.61 0.00 0.00 2.57
258 259 5.617751 CGGGAGCACAAGAGTTTAAATTCAG 60.618 44.000 12.61 7.37 0.00 3.02
259 260 5.241728 GGGAGCACAAGAGTTTAAATTCAGT 59.758 40.000 12.61 7.92 0.00 3.41
260 261 6.374578 GGAGCACAAGAGTTTAAATTCAGTC 58.625 40.000 12.61 5.90 0.00 3.51
261 262 5.990408 AGCACAAGAGTTTAAATTCAGTCG 58.010 37.500 12.61 7.17 0.00 4.18
262 263 4.613031 GCACAAGAGTTTAAATTCAGTCGC 59.387 41.667 12.61 11.59 0.00 5.19
263 264 5.147162 CACAAGAGTTTAAATTCAGTCGCC 58.853 41.667 12.61 0.00 0.00 5.54
264 265 4.819630 ACAAGAGTTTAAATTCAGTCGCCA 59.180 37.500 12.61 0.00 0.00 5.69
265 266 5.473504 ACAAGAGTTTAAATTCAGTCGCCAT 59.526 36.000 12.61 0.00 0.00 4.40
266 267 5.803020 AGAGTTTAAATTCAGTCGCCATC 57.197 39.130 12.61 0.00 0.00 3.51
267 268 4.330074 AGAGTTTAAATTCAGTCGCCATCG 59.670 41.667 12.61 0.00 0.00 3.84
268 269 4.000988 AGTTTAAATTCAGTCGCCATCGT 58.999 39.130 0.00 0.00 36.96 3.73
269 270 4.092968 AGTTTAAATTCAGTCGCCATCGTC 59.907 41.667 0.00 0.00 36.96 4.20
270 271 1.369625 AAATTCAGTCGCCATCGTCC 58.630 50.000 0.00 0.00 36.96 4.79
271 272 0.249120 AATTCAGTCGCCATCGTCCA 59.751 50.000 0.00 0.00 36.96 4.02
272 273 0.460284 ATTCAGTCGCCATCGTCCAC 60.460 55.000 0.00 0.00 36.96 4.02
273 274 1.532604 TTCAGTCGCCATCGTCCACT 61.533 55.000 0.00 0.00 36.96 4.00
274 275 1.079819 CAGTCGCCATCGTCCACTT 60.080 57.895 0.00 0.00 36.96 3.16
275 276 1.078759 CAGTCGCCATCGTCCACTTC 61.079 60.000 0.00 0.00 36.96 3.01
276 277 1.080093 GTCGCCATCGTCCACTTCA 60.080 57.895 0.00 0.00 36.96 3.02
277 278 1.080093 TCGCCATCGTCCACTTCAC 60.080 57.895 0.00 0.00 36.96 3.18
278 279 1.079819 CGCCATCGTCCACTTCACT 60.080 57.895 0.00 0.00 0.00 3.41
279 280 1.078759 CGCCATCGTCCACTTCACTC 61.079 60.000 0.00 0.00 0.00 3.51
280 281 0.741221 GCCATCGTCCACTTCACTCC 60.741 60.000 0.00 0.00 0.00 3.85
281 282 0.108138 CCATCGTCCACTTCACTCCC 60.108 60.000 0.00 0.00 0.00 4.30
282 283 0.458543 CATCGTCCACTTCACTCCCG 60.459 60.000 0.00 0.00 0.00 5.14
283 284 2.227089 ATCGTCCACTTCACTCCCGC 62.227 60.000 0.00 0.00 0.00 6.13
284 285 2.932234 CGTCCACTTCACTCCCGCT 61.932 63.158 0.00 0.00 0.00 5.52
285 286 1.592400 CGTCCACTTCACTCCCGCTA 61.592 60.000 0.00 0.00 0.00 4.26
286 287 0.108756 GTCCACTTCACTCCCGCTAC 60.109 60.000 0.00 0.00 0.00 3.58
287 288 1.153823 CCACTTCACTCCCGCTACG 60.154 63.158 0.00 0.00 0.00 3.51
288 289 1.592400 CCACTTCACTCCCGCTACGA 61.592 60.000 0.00 0.00 0.00 3.43
289 290 0.456312 CACTTCACTCCCGCTACGAC 60.456 60.000 0.00 0.00 0.00 4.34
290 291 0.608582 ACTTCACTCCCGCTACGACT 60.609 55.000 0.00 0.00 0.00 4.18
291 292 0.179161 CTTCACTCCCGCTACGACTG 60.179 60.000 0.00 0.00 0.00 3.51
292 293 0.607217 TTCACTCCCGCTACGACTGA 60.607 55.000 0.00 0.00 0.00 3.41
293 294 1.025113 TCACTCCCGCTACGACTGAG 61.025 60.000 0.00 0.00 0.00 3.35
294 295 1.749638 ACTCCCGCTACGACTGAGG 60.750 63.158 0.00 0.00 0.00 3.86
295 296 2.439701 TCCCGCTACGACTGAGGG 60.440 66.667 8.83 8.83 43.32 4.30
296 297 3.528370 CCCGCTACGACTGAGGGG 61.528 72.222 0.00 0.00 44.60 4.79
298 299 3.599584 CGCTACGACTGAGGGGAA 58.400 61.111 0.00 0.00 0.00 3.97
299 300 1.888018 CGCTACGACTGAGGGGAAA 59.112 57.895 0.00 0.00 0.00 3.13
300 301 0.460311 CGCTACGACTGAGGGGAAAT 59.540 55.000 0.00 0.00 0.00 2.17
301 302 1.802880 CGCTACGACTGAGGGGAAATG 60.803 57.143 0.00 0.00 0.00 2.32
302 303 1.207329 GCTACGACTGAGGGGAAATGT 59.793 52.381 0.00 0.00 0.00 2.71
303 304 2.354805 GCTACGACTGAGGGGAAATGTT 60.355 50.000 0.00 0.00 0.00 2.71
304 305 3.118884 GCTACGACTGAGGGGAAATGTTA 60.119 47.826 0.00 0.00 0.00 2.41
305 306 3.611766 ACGACTGAGGGGAAATGTTAG 57.388 47.619 0.00 0.00 0.00 2.34
306 307 3.170717 ACGACTGAGGGGAAATGTTAGA 58.829 45.455 0.00 0.00 0.00 2.10
307 308 3.581332 ACGACTGAGGGGAAATGTTAGAA 59.419 43.478 0.00 0.00 0.00 2.10
308 309 4.184629 CGACTGAGGGGAAATGTTAGAAG 58.815 47.826 0.00 0.00 0.00 2.85
309 310 4.322801 CGACTGAGGGGAAATGTTAGAAGT 60.323 45.833 0.00 0.00 0.00 3.01
310 311 5.105473 CGACTGAGGGGAAATGTTAGAAGTA 60.105 44.000 0.00 0.00 0.00 2.24
311 312 6.407074 CGACTGAGGGGAAATGTTAGAAGTAT 60.407 42.308 0.00 0.00 0.00 2.12
312 313 7.201884 CGACTGAGGGGAAATGTTAGAAGTATA 60.202 40.741 0.00 0.00 0.00 1.47
313 314 8.388656 ACTGAGGGGAAATGTTAGAAGTATAA 57.611 34.615 0.00 0.00 0.00 0.98
314 315 9.004231 ACTGAGGGGAAATGTTAGAAGTATAAT 57.996 33.333 0.00 0.00 0.00 1.28
315 316 9.853177 CTGAGGGGAAATGTTAGAAGTATAATT 57.147 33.333 0.00 0.00 0.00 1.40
353 354 9.753674 AGAGATTAGGAGTTAGAGATAGGATTG 57.246 37.037 0.00 0.00 0.00 2.67
354 355 8.893563 AGATTAGGAGTTAGAGATAGGATTGG 57.106 38.462 0.00 0.00 0.00 3.16
355 356 8.461033 AGATTAGGAGTTAGAGATAGGATTGGT 58.539 37.037 0.00 0.00 0.00 3.67
356 357 9.095700 GATTAGGAGTTAGAGATAGGATTGGTT 57.904 37.037 0.00 0.00 0.00 3.67
357 358 8.855804 TTAGGAGTTAGAGATAGGATTGGTTT 57.144 34.615 0.00 0.00 0.00 3.27
358 359 9.947189 TTAGGAGTTAGAGATAGGATTGGTTTA 57.053 33.333 0.00 0.00 0.00 2.01
359 360 8.855804 AGGAGTTAGAGATAGGATTGGTTTAA 57.144 34.615 0.00 0.00 0.00 1.52
360 361 9.280456 AGGAGTTAGAGATAGGATTGGTTTAAA 57.720 33.333 0.00 0.00 0.00 1.52
361 362 9.327628 GGAGTTAGAGATAGGATTGGTTTAAAC 57.672 37.037 9.98 9.98 0.00 2.01
377 378 5.682869 GTTTAAACCATGTACGACTTGTCC 58.317 41.667 7.12 0.00 0.00 4.02
378 379 2.467566 AACCATGTACGACTTGTCCC 57.532 50.000 0.00 0.00 0.00 4.46
379 380 0.611714 ACCATGTACGACTTGTCCCC 59.388 55.000 0.00 0.00 0.00 4.81
380 381 0.902531 CCATGTACGACTTGTCCCCT 59.097 55.000 0.00 0.00 0.00 4.79
381 382 2.104967 CCATGTACGACTTGTCCCCTA 58.895 52.381 0.00 0.00 0.00 3.53
382 383 2.159142 CCATGTACGACTTGTCCCCTAC 60.159 54.545 0.00 0.00 0.00 3.18
383 384 2.592102 TGTACGACTTGTCCCCTACT 57.408 50.000 0.00 0.00 0.00 2.57
384 385 2.440409 TGTACGACTTGTCCCCTACTC 58.560 52.381 0.00 0.00 0.00 2.59
385 386 1.747924 GTACGACTTGTCCCCTACTCC 59.252 57.143 0.00 0.00 0.00 3.85
386 387 0.113776 ACGACTTGTCCCCTACTCCA 59.886 55.000 0.00 0.00 0.00 3.86
387 388 1.263356 CGACTTGTCCCCTACTCCAA 58.737 55.000 0.00 0.00 0.00 3.53
388 389 1.621814 CGACTTGTCCCCTACTCCAAA 59.378 52.381 0.00 0.00 0.00 3.28
389 390 2.236395 CGACTTGTCCCCTACTCCAAAT 59.764 50.000 0.00 0.00 0.00 2.32
390 391 3.679083 CGACTTGTCCCCTACTCCAAATC 60.679 52.174 0.00 0.00 0.00 2.17
391 392 3.519913 GACTTGTCCCCTACTCCAAATCT 59.480 47.826 0.00 0.00 0.00 2.40
392 393 3.519913 ACTTGTCCCCTACTCCAAATCTC 59.480 47.826 0.00 0.00 0.00 2.75
393 394 3.491766 TGTCCCCTACTCCAAATCTCT 57.508 47.619 0.00 0.00 0.00 3.10
394 395 3.803340 TGTCCCCTACTCCAAATCTCTT 58.197 45.455 0.00 0.00 0.00 2.85
395 396 3.775316 TGTCCCCTACTCCAAATCTCTTC 59.225 47.826 0.00 0.00 0.00 2.87
396 397 3.775316 GTCCCCTACTCCAAATCTCTTCA 59.225 47.826 0.00 0.00 0.00 3.02
397 398 3.775316 TCCCCTACTCCAAATCTCTTCAC 59.225 47.826 0.00 0.00 0.00 3.18
398 399 3.519510 CCCCTACTCCAAATCTCTTCACA 59.480 47.826 0.00 0.00 0.00 3.58
399 400 4.164988 CCCCTACTCCAAATCTCTTCACAT 59.835 45.833 0.00 0.00 0.00 3.21
400 401 5.366768 CCCCTACTCCAAATCTCTTCACATA 59.633 44.000 0.00 0.00 0.00 2.29
401 402 6.043706 CCCCTACTCCAAATCTCTTCACATAT 59.956 42.308 0.00 0.00 0.00 1.78
402 403 7.420680 CCCCTACTCCAAATCTCTTCACATATT 60.421 40.741 0.00 0.00 0.00 1.28
403 404 7.443575 CCCTACTCCAAATCTCTTCACATATTG 59.556 40.741 0.00 0.00 0.00 1.90
404 405 7.989741 CCTACTCCAAATCTCTTCACATATTGT 59.010 37.037 0.00 0.00 0.00 2.71
406 407 8.723942 ACTCCAAATCTCTTCACATATTGTAC 57.276 34.615 0.00 0.00 0.00 2.90
407 408 8.543774 ACTCCAAATCTCTTCACATATTGTACT 58.456 33.333 0.00 0.00 0.00 2.73
408 409 8.948631 TCCAAATCTCTTCACATATTGTACTC 57.051 34.615 0.00 0.00 0.00 2.59
409 410 8.762645 TCCAAATCTCTTCACATATTGTACTCT 58.237 33.333 0.00 0.00 0.00 3.24
427 428 9.475620 TTGTACTCTATATATATCCCACACCTG 57.524 37.037 0.00 0.00 0.00 4.00
428 429 8.059461 TGTACTCTATATATATCCCACACCTGG 58.941 40.741 0.00 0.00 37.29 4.45
437 438 2.376063 CCACACCTGGGTCAGATCA 58.624 57.895 0.00 0.00 33.23 2.92
438 439 0.692476 CCACACCTGGGTCAGATCAA 59.308 55.000 0.00 0.00 33.23 2.57
439 440 1.283029 CCACACCTGGGTCAGATCAAT 59.717 52.381 0.00 0.00 33.23 2.57
440 441 2.505407 CCACACCTGGGTCAGATCAATA 59.495 50.000 0.00 0.00 33.23 1.90
441 442 3.137176 CCACACCTGGGTCAGATCAATAT 59.863 47.826 0.00 0.00 33.23 1.28
442 443 4.347876 CCACACCTGGGTCAGATCAATATA 59.652 45.833 0.00 0.00 33.23 0.86
443 444 5.163205 CCACACCTGGGTCAGATCAATATAA 60.163 44.000 0.00 0.00 33.23 0.98
444 445 5.760253 CACACCTGGGTCAGATCAATATAAC 59.240 44.000 0.00 0.00 32.44 1.89
445 446 5.428457 ACACCTGGGTCAGATCAATATAACA 59.572 40.000 0.00 0.00 32.44 2.41
446 447 6.069673 ACACCTGGGTCAGATCAATATAACAA 60.070 38.462 0.00 0.00 32.44 2.83
447 448 7.000472 CACCTGGGTCAGATCAATATAACAAT 59.000 38.462 0.00 0.00 32.44 2.71
448 449 8.156820 CACCTGGGTCAGATCAATATAACAATA 58.843 37.037 0.00 0.00 32.44 1.90
449 450 8.157476 ACCTGGGTCAGATCAATATAACAATAC 58.843 37.037 0.00 0.00 32.44 1.89
450 451 8.156820 CCTGGGTCAGATCAATATAACAATACA 58.843 37.037 0.00 0.00 32.44 2.29
451 452 9.559732 CTGGGTCAGATCAATATAACAATACAA 57.440 33.333 0.00 0.00 32.44 2.41
477 478 7.943079 ATTCAGTCATCATACAATTTCCACA 57.057 32.000 0.00 0.00 0.00 4.17
478 479 6.990341 TCAGTCATCATACAATTTCCACAG 57.010 37.500 0.00 0.00 0.00 3.66
479 480 5.882000 TCAGTCATCATACAATTTCCACAGG 59.118 40.000 0.00 0.00 0.00 4.00
480 481 4.641989 AGTCATCATACAATTTCCACAGGC 59.358 41.667 0.00 0.00 0.00 4.85
481 482 3.627123 TCATCATACAATTTCCACAGGCG 59.373 43.478 0.00 0.00 0.00 5.52
482 483 2.364632 TCATACAATTTCCACAGGCGG 58.635 47.619 0.00 0.00 0.00 6.13
483 484 1.102978 ATACAATTTCCACAGGCGGC 58.897 50.000 0.00 0.00 0.00 6.53
484 485 0.037590 TACAATTTCCACAGGCGGCT 59.962 50.000 5.25 5.25 0.00 5.52
485 486 1.244019 ACAATTTCCACAGGCGGCTC 61.244 55.000 9.32 0.00 0.00 4.70
486 487 2.040544 AATTTCCACAGGCGGCTCG 61.041 57.895 9.32 7.75 0.00 5.03
487 488 3.976701 ATTTCCACAGGCGGCTCGG 62.977 63.158 9.32 13.46 0.00 4.63
507 508 4.752879 GCGCGGACTAGGCCAACA 62.753 66.667 16.92 0.00 0.00 3.33
508 509 2.186903 CGCGGACTAGGCCAACAT 59.813 61.111 16.92 0.00 0.00 2.71
509 510 2.173669 CGCGGACTAGGCCAACATG 61.174 63.158 16.92 0.00 0.00 3.21
510 511 1.819632 GCGGACTAGGCCAACATGG 60.820 63.158 16.92 0.00 41.55 3.66
511 512 1.904771 CGGACTAGGCCAACATGGA 59.095 57.895 16.92 0.00 40.96 3.41
519 520 1.137404 GCCAACATGGACATCGTGC 59.863 57.895 0.00 0.00 40.96 5.34
520 521 1.585267 GCCAACATGGACATCGTGCA 61.585 55.000 0.00 0.00 40.96 4.57
521 522 1.097232 CCAACATGGACATCGTGCAT 58.903 50.000 0.00 0.00 45.01 3.96
522 523 1.064505 CCAACATGGACATCGTGCATC 59.935 52.381 0.00 0.00 42.41 3.91
523 524 1.738908 CAACATGGACATCGTGCATCA 59.261 47.619 0.00 0.00 42.41 3.07
524 525 1.372582 ACATGGACATCGTGCATCAC 58.627 50.000 0.00 0.00 42.41 3.06
534 535 3.650409 GTGCATCACGGAGACCTAG 57.350 57.895 0.00 0.00 0.00 3.02
535 536 0.528684 GTGCATCACGGAGACCTAGC 60.529 60.000 0.00 0.00 0.00 3.42
536 537 1.068250 GCATCACGGAGACCTAGCC 59.932 63.158 0.00 0.00 0.00 3.93
543 544 3.917760 GAGACCTAGCCGCCGCAT 61.918 66.667 0.00 0.00 37.52 4.73
544 545 2.520982 AGACCTAGCCGCCGCATA 60.521 61.111 0.00 0.00 37.52 3.14
545 546 2.355956 GACCTAGCCGCCGCATAC 60.356 66.667 0.00 0.00 37.52 2.39
546 547 3.860630 GACCTAGCCGCCGCATACC 62.861 68.421 0.00 0.00 37.52 2.73
547 548 3.923864 CCTAGCCGCCGCATACCA 61.924 66.667 0.00 0.00 37.52 3.25
548 549 2.356313 CTAGCCGCCGCATACCAG 60.356 66.667 0.00 0.00 37.52 4.00
549 550 4.602259 TAGCCGCCGCATACCAGC 62.602 66.667 0.00 0.00 37.52 4.85
551 552 4.602259 GCCGCCGCATACCAGCTA 62.602 66.667 0.00 0.00 34.03 3.32
552 553 2.356313 CCGCCGCATACCAGCTAG 60.356 66.667 0.00 0.00 0.00 3.42
553 554 2.728180 CGCCGCATACCAGCTAGA 59.272 61.111 0.00 0.00 0.00 2.43
554 555 1.067416 CGCCGCATACCAGCTAGAA 59.933 57.895 0.00 0.00 0.00 2.10
555 556 1.215655 CGCCGCATACCAGCTAGAAC 61.216 60.000 0.00 0.00 0.00 3.01
556 557 0.179084 GCCGCATACCAGCTAGAACA 60.179 55.000 0.00 0.00 0.00 3.18
557 558 1.858091 CCGCATACCAGCTAGAACAG 58.142 55.000 0.00 0.00 0.00 3.16
558 559 1.409064 CCGCATACCAGCTAGAACAGA 59.591 52.381 0.00 0.00 0.00 3.41
559 560 2.544694 CCGCATACCAGCTAGAACAGAG 60.545 54.545 0.00 0.00 0.00 3.35
560 561 2.544694 CGCATACCAGCTAGAACAGAGG 60.545 54.545 0.00 0.00 0.00 3.69
561 562 2.224161 GCATACCAGCTAGAACAGAGGG 60.224 54.545 0.00 0.00 0.00 4.30
562 563 3.300388 CATACCAGCTAGAACAGAGGGA 58.700 50.000 0.00 0.00 0.00 4.20
563 564 1.859302 ACCAGCTAGAACAGAGGGAG 58.141 55.000 0.00 0.00 0.00 4.30
564 565 1.359474 ACCAGCTAGAACAGAGGGAGA 59.641 52.381 0.00 0.00 0.00 3.71
565 566 2.225394 ACCAGCTAGAACAGAGGGAGAA 60.225 50.000 0.00 0.00 0.00 2.87
566 567 2.430332 CCAGCTAGAACAGAGGGAGAAG 59.570 54.545 0.00 0.00 0.00 2.85
567 568 3.360867 CAGCTAGAACAGAGGGAGAAGA 58.639 50.000 0.00 0.00 0.00 2.87
568 569 3.381272 CAGCTAGAACAGAGGGAGAAGAG 59.619 52.174 0.00 0.00 0.00 2.85
569 570 3.268334 AGCTAGAACAGAGGGAGAAGAGA 59.732 47.826 0.00 0.00 0.00 3.10
570 571 4.079212 AGCTAGAACAGAGGGAGAAGAGAT 60.079 45.833 0.00 0.00 0.00 2.75
571 572 4.278419 GCTAGAACAGAGGGAGAAGAGATC 59.722 50.000 0.00 0.00 0.00 2.75
572 573 4.608170 AGAACAGAGGGAGAAGAGATCT 57.392 45.455 0.00 0.00 42.61 2.75
573 574 4.280819 AGAACAGAGGGAGAAGAGATCTG 58.719 47.826 0.00 0.00 42.43 2.90
574 575 3.030873 ACAGAGGGAGAAGAGATCTGG 57.969 52.381 0.00 0.00 41.32 3.86
575 576 2.584965 ACAGAGGGAGAAGAGATCTGGA 59.415 50.000 0.00 0.00 41.32 3.86
576 577 3.012274 ACAGAGGGAGAAGAGATCTGGAA 59.988 47.826 0.00 0.00 41.32 3.53
577 578 4.029520 CAGAGGGAGAAGAGATCTGGAAA 58.970 47.826 0.00 0.00 38.96 3.13
578 579 4.469227 CAGAGGGAGAAGAGATCTGGAAAA 59.531 45.833 0.00 0.00 38.96 2.29
579 580 4.716287 AGAGGGAGAAGAGATCTGGAAAAG 59.284 45.833 0.00 0.00 38.96 2.27
580 581 4.693420 AGGGAGAAGAGATCTGGAAAAGA 58.307 43.478 0.00 0.00 38.96 2.52
581 582 5.097234 AGGGAGAAGAGATCTGGAAAAGAA 58.903 41.667 0.00 0.00 38.96 2.52
582 583 5.549619 AGGGAGAAGAGATCTGGAAAAGAAA 59.450 40.000 0.00 0.00 38.96 2.52
583 584 6.044871 AGGGAGAAGAGATCTGGAAAAGAAAA 59.955 38.462 0.00 0.00 38.96 2.29
584 585 6.717084 GGGAGAAGAGATCTGGAAAAGAAAAA 59.283 38.462 0.00 0.00 38.96 1.94
585 586 7.308891 GGGAGAAGAGATCTGGAAAAGAAAAAC 60.309 40.741 0.00 0.00 38.96 2.43
586 587 7.308891 GGAGAAGAGATCTGGAAAAGAAAAACC 60.309 40.741 0.00 0.00 38.96 3.27
587 588 7.062957 AGAAGAGATCTGGAAAAGAAAAACCA 58.937 34.615 0.00 0.00 38.79 3.67
588 589 6.641169 AGAGATCTGGAAAAGAAAAACCAC 57.359 37.500 0.00 0.00 38.79 4.16
589 590 6.368805 AGAGATCTGGAAAAGAAAAACCACT 58.631 36.000 0.00 0.00 38.79 4.00
590 591 7.518188 AGAGATCTGGAAAAGAAAAACCACTA 58.482 34.615 0.00 0.00 38.79 2.74
591 592 7.663493 AGAGATCTGGAAAAGAAAAACCACTAG 59.337 37.037 0.00 0.00 38.79 2.57
592 593 7.518188 AGATCTGGAAAAGAAAAACCACTAGA 58.482 34.615 0.00 0.00 38.79 2.43
593 594 7.663493 AGATCTGGAAAAGAAAAACCACTAGAG 59.337 37.037 0.00 0.00 38.79 2.43
594 595 6.895782 TCTGGAAAAGAAAAACCACTAGAGA 58.104 36.000 0.00 0.00 29.54 3.10
595 596 7.518188 TCTGGAAAAGAAAAACCACTAGAGAT 58.482 34.615 0.00 0.00 29.54 2.75
596 597 7.661847 TCTGGAAAAGAAAAACCACTAGAGATC 59.338 37.037 0.00 0.00 29.54 2.75
597 598 6.426937 TGGAAAAGAAAAACCACTAGAGATCG 59.573 38.462 0.00 0.00 0.00 3.69
598 599 6.427242 GGAAAAGAAAAACCACTAGAGATCGT 59.573 38.462 0.00 0.00 0.00 3.73
599 600 6.787085 AAAGAAAAACCACTAGAGATCGTG 57.213 37.500 0.00 0.00 0.00 4.35
600 601 5.470047 AGAAAAACCACTAGAGATCGTGT 57.530 39.130 0.00 0.00 0.00 4.49
601 602 5.855045 AGAAAAACCACTAGAGATCGTGTT 58.145 37.500 0.00 0.00 0.00 3.32
602 603 5.927115 AGAAAAACCACTAGAGATCGTGTTC 59.073 40.000 0.00 0.00 0.00 3.18
603 604 4.866508 AAACCACTAGAGATCGTGTTCA 57.133 40.909 0.00 0.00 0.00 3.18
604 605 5.407407 AAACCACTAGAGATCGTGTTCAT 57.593 39.130 0.00 0.00 0.00 2.57
605 606 4.640789 ACCACTAGAGATCGTGTTCATC 57.359 45.455 0.00 0.00 0.00 2.92
606 607 4.274147 ACCACTAGAGATCGTGTTCATCT 58.726 43.478 0.00 0.00 33.01 2.90
607 608 4.336993 ACCACTAGAGATCGTGTTCATCTC 59.663 45.833 0.00 3.47 44.69 2.75
613 614 5.517037 GAGATCGTGTTCATCTCGTTTTT 57.483 39.130 0.00 0.00 37.59 1.94
614 615 5.517037 AGATCGTGTTCATCTCGTTTTTC 57.483 39.130 0.00 0.00 35.06 2.29
615 616 4.988540 AGATCGTGTTCATCTCGTTTTTCA 59.011 37.500 0.00 0.00 35.06 2.69
616 617 4.446857 TCGTGTTCATCTCGTTTTTCAC 57.553 40.909 0.00 0.00 35.06 3.18
617 618 3.866327 TCGTGTTCATCTCGTTTTTCACA 59.134 39.130 0.00 0.00 35.06 3.58
618 619 4.509970 TCGTGTTCATCTCGTTTTTCACAT 59.490 37.500 0.00 0.00 35.06 3.21
619 620 5.007234 TCGTGTTCATCTCGTTTTTCACATT 59.993 36.000 0.00 0.00 35.06 2.71
620 621 5.681105 CGTGTTCATCTCGTTTTTCACATTT 59.319 36.000 0.00 0.00 0.00 2.32
621 622 6.344157 CGTGTTCATCTCGTTTTTCACATTTG 60.344 38.462 0.00 0.00 0.00 2.32
622 623 6.690957 GTGTTCATCTCGTTTTTCACATTTGA 59.309 34.615 0.00 0.00 0.00 2.69
623 624 7.379529 GTGTTCATCTCGTTTTTCACATTTGAT 59.620 33.333 0.00 0.00 0.00 2.57
624 625 7.920151 TGTTCATCTCGTTTTTCACATTTGATT 59.080 29.630 0.00 0.00 0.00 2.57
625 626 8.420189 GTTCATCTCGTTTTTCACATTTGATTC 58.580 33.333 0.00 0.00 0.00 2.52
626 627 6.796552 TCATCTCGTTTTTCACATTTGATTCG 59.203 34.615 0.00 0.00 0.00 3.34
627 628 6.055231 TCTCGTTTTTCACATTTGATTCGT 57.945 33.333 0.00 0.00 0.00 3.85
628 629 6.133392 TCTCGTTTTTCACATTTGATTCGTC 58.867 36.000 0.00 0.00 0.00 4.20
629 630 5.811588 TCGTTTTTCACATTTGATTCGTCA 58.188 33.333 0.00 0.00 0.00 4.35
630 631 5.679355 TCGTTTTTCACATTTGATTCGTCAC 59.321 36.000 0.00 0.00 0.00 3.67
631 632 5.453909 CGTTTTTCACATTTGATTCGTCACA 59.546 36.000 0.00 0.00 0.00 3.58
632 633 6.142161 CGTTTTTCACATTTGATTCGTCACAT 59.858 34.615 0.00 0.00 0.00 3.21
633 634 7.493313 GTTTTTCACATTTGATTCGTCACATC 58.507 34.615 0.00 0.00 0.00 3.06
634 635 4.582441 TCACATTTGATTCGTCACATCG 57.418 40.909 0.00 0.00 0.00 3.84
635 636 3.993736 TCACATTTGATTCGTCACATCGT 59.006 39.130 0.00 0.00 0.00 3.73
636 637 4.091365 TCACATTTGATTCGTCACATCGTC 59.909 41.667 0.00 0.00 0.00 4.20
637 638 3.993736 ACATTTGATTCGTCACATCGTCA 59.006 39.130 0.00 0.00 0.00 4.35
638 639 4.143115 ACATTTGATTCGTCACATCGTCAC 60.143 41.667 0.00 0.00 0.00 3.67
639 640 1.990799 TGATTCGTCACATCGTCACC 58.009 50.000 0.00 0.00 0.00 4.02
640 641 1.271102 TGATTCGTCACATCGTCACCA 59.729 47.619 0.00 0.00 0.00 4.17
641 642 1.654105 GATTCGTCACATCGTCACCAC 59.346 52.381 0.00 0.00 0.00 4.16
642 643 0.386113 TTCGTCACATCGTCACCACA 59.614 50.000 0.00 0.00 0.00 4.17
643 644 0.601057 TCGTCACATCGTCACCACAT 59.399 50.000 0.00 0.00 0.00 3.21
644 645 0.715551 CGTCACATCGTCACCACATG 59.284 55.000 0.00 0.00 0.00 3.21
645 646 1.078709 GTCACATCGTCACCACATGG 58.921 55.000 0.00 0.00 42.17 3.66
646 647 0.972883 TCACATCGTCACCACATGGA 59.027 50.000 4.53 0.00 38.94 3.41
647 648 1.066929 TCACATCGTCACCACATGGAG 60.067 52.381 4.53 0.00 38.94 3.86
648 649 1.066929 CACATCGTCACCACATGGAGA 60.067 52.381 4.53 0.00 38.94 3.71
649 650 1.833630 ACATCGTCACCACATGGAGAT 59.166 47.619 4.53 1.58 37.16 2.75
650 651 2.159043 ACATCGTCACCACATGGAGATC 60.159 50.000 4.53 0.00 37.16 2.75
651 652 0.824109 TCGTCACCACATGGAGATCC 59.176 55.000 4.53 0.00 37.16 3.36
652 653 0.826715 CGTCACCACATGGAGATCCT 59.173 55.000 4.53 0.00 37.16 3.24
653 654 1.472201 CGTCACCACATGGAGATCCTG 60.472 57.143 4.53 0.00 37.16 3.86
654 655 1.833630 GTCACCACATGGAGATCCTGA 59.166 52.381 4.53 0.00 37.16 3.86
655 656 2.437281 GTCACCACATGGAGATCCTGAT 59.563 50.000 4.53 0.00 37.16 2.90
656 657 3.117745 TCACCACATGGAGATCCTGATT 58.882 45.455 4.53 0.00 38.94 2.57
657 658 3.135348 TCACCACATGGAGATCCTGATTC 59.865 47.826 4.53 0.00 38.94 2.52
658 659 3.117745 ACCACATGGAGATCCTGATTCA 58.882 45.455 4.53 0.00 38.94 2.57
659 660 3.524789 ACCACATGGAGATCCTGATTCAA 59.475 43.478 4.53 0.00 38.94 2.69
660 661 4.135306 CCACATGGAGATCCTGATTCAAG 58.865 47.826 0.00 0.00 37.39 3.02
661 662 4.135306 CACATGGAGATCCTGATTCAAGG 58.865 47.826 0.00 0.00 38.84 3.61
662 663 3.147629 CATGGAGATCCTGATTCAAGGC 58.852 50.000 0.00 0.00 37.24 4.35
663 664 2.485659 TGGAGATCCTGATTCAAGGCT 58.514 47.619 0.00 0.00 37.24 4.58
664 665 3.657610 TGGAGATCCTGATTCAAGGCTA 58.342 45.455 0.00 0.00 37.24 3.93
665 666 3.645212 TGGAGATCCTGATTCAAGGCTAG 59.355 47.826 0.00 0.00 37.24 3.42
666 667 3.556843 GGAGATCCTGATTCAAGGCTAGC 60.557 52.174 6.04 6.04 37.24 3.42
667 668 3.316501 AGATCCTGATTCAAGGCTAGCT 58.683 45.455 15.72 0.00 37.24 3.32
668 669 2.996249 TCCTGATTCAAGGCTAGCTG 57.004 50.000 15.72 6.12 37.24 4.24
669 670 1.134280 TCCTGATTCAAGGCTAGCTGC 60.134 52.381 15.72 0.00 37.24 5.25
678 679 4.831698 GCTAGCTGCCTCTGAGTG 57.168 61.111 7.70 0.00 35.15 3.51
679 680 1.896694 GCTAGCTGCCTCTGAGTGT 59.103 57.895 7.70 0.00 35.15 3.55
680 681 0.248843 GCTAGCTGCCTCTGAGTGTT 59.751 55.000 7.70 0.00 35.15 3.32
681 682 2.006056 GCTAGCTGCCTCTGAGTGTTG 61.006 57.143 7.70 0.00 35.15 3.33
682 683 1.547820 CTAGCTGCCTCTGAGTGTTGA 59.452 52.381 3.66 0.00 0.00 3.18
683 684 0.982704 AGCTGCCTCTGAGTGTTGAT 59.017 50.000 3.66 0.00 0.00 2.57
684 685 1.085091 GCTGCCTCTGAGTGTTGATG 58.915 55.000 3.66 0.00 0.00 3.07
685 686 1.735386 CTGCCTCTGAGTGTTGATGG 58.265 55.000 3.66 0.00 0.00 3.51
686 687 1.277273 CTGCCTCTGAGTGTTGATGGA 59.723 52.381 3.66 0.00 0.00 3.41
687 688 1.277273 TGCCTCTGAGTGTTGATGGAG 59.723 52.381 3.66 0.00 0.00 3.86
688 689 1.552337 GCCTCTGAGTGTTGATGGAGA 59.448 52.381 3.66 0.00 0.00 3.71
689 690 2.027745 GCCTCTGAGTGTTGATGGAGAA 60.028 50.000 3.66 0.00 0.00 2.87
690 691 3.557898 GCCTCTGAGTGTTGATGGAGAAA 60.558 47.826 3.66 0.00 0.00 2.52
691 692 4.645535 CCTCTGAGTGTTGATGGAGAAAA 58.354 43.478 3.66 0.00 0.00 2.29
692 693 4.694509 CCTCTGAGTGTTGATGGAGAAAAG 59.305 45.833 3.66 0.00 0.00 2.27
693 694 5.512060 CCTCTGAGTGTTGATGGAGAAAAGA 60.512 44.000 3.66 0.00 0.00 2.52
694 695 5.928976 TCTGAGTGTTGATGGAGAAAAGAA 58.071 37.500 0.00 0.00 0.00 2.52
695 696 6.537355 TCTGAGTGTTGATGGAGAAAAGAAT 58.463 36.000 0.00 0.00 0.00 2.40
696 697 6.652481 TCTGAGTGTTGATGGAGAAAAGAATC 59.348 38.462 0.00 0.00 0.00 2.52
697 698 5.707298 TGAGTGTTGATGGAGAAAAGAATCC 59.293 40.000 0.00 0.00 36.05 3.01
698 699 5.012893 AGTGTTGATGGAGAAAAGAATCCC 58.987 41.667 0.00 0.00 34.47 3.85
699 700 4.766891 GTGTTGATGGAGAAAAGAATCCCA 59.233 41.667 0.00 0.00 34.47 4.37
700 701 4.766891 TGTTGATGGAGAAAAGAATCCCAC 59.233 41.667 0.00 0.00 34.47 4.61
701 702 4.934797 TGATGGAGAAAAGAATCCCACT 57.065 40.909 0.00 0.00 34.47 4.00
702 703 4.592942 TGATGGAGAAAAGAATCCCACTG 58.407 43.478 0.00 0.00 34.47 3.66
703 704 4.289410 TGATGGAGAAAAGAATCCCACTGA 59.711 41.667 0.00 0.00 34.47 3.41
704 705 4.722526 TGGAGAAAAGAATCCCACTGAA 57.277 40.909 0.00 0.00 34.47 3.02
705 706 5.060427 TGGAGAAAAGAATCCCACTGAAA 57.940 39.130 0.00 0.00 34.47 2.69
706 707 5.454062 TGGAGAAAAGAATCCCACTGAAAA 58.546 37.500 0.00 0.00 34.47 2.29
707 708 5.896678 TGGAGAAAAGAATCCCACTGAAAAA 59.103 36.000 0.00 0.00 34.47 1.94
708 709 6.554605 TGGAGAAAAGAATCCCACTGAAAAAT 59.445 34.615 0.00 0.00 34.47 1.82
709 710 6.870439 GGAGAAAAGAATCCCACTGAAAAATG 59.130 38.462 0.00 0.00 0.00 2.32
710 711 6.762333 AGAAAAGAATCCCACTGAAAAATGG 58.238 36.000 0.00 0.00 35.59 3.16
711 712 6.327365 AGAAAAGAATCCCACTGAAAAATGGT 59.673 34.615 0.00 0.00 33.80 3.55
712 713 5.728637 AAGAATCCCACTGAAAAATGGTC 57.271 39.130 0.00 0.00 33.80 4.02
713 714 4.739793 AGAATCCCACTGAAAAATGGTCA 58.260 39.130 0.00 0.00 33.80 4.02
714 715 4.524328 AGAATCCCACTGAAAAATGGTCAC 59.476 41.667 0.00 0.00 33.80 3.67
715 716 3.593442 TCCCACTGAAAAATGGTCACT 57.407 42.857 0.00 0.00 33.80 3.41
716 717 3.909732 TCCCACTGAAAAATGGTCACTT 58.090 40.909 0.00 0.00 33.80 3.16
717 718 3.888930 TCCCACTGAAAAATGGTCACTTC 59.111 43.478 0.00 0.00 33.80 3.01
718 719 3.005791 CCCACTGAAAAATGGTCACTTCC 59.994 47.826 0.00 0.00 33.80 3.46
719 720 3.636300 CCACTGAAAAATGGTCACTTCCA 59.364 43.478 0.00 0.00 42.01 3.53
720 721 4.499696 CCACTGAAAAATGGTCACTTCCAC 60.500 45.833 0.00 0.00 40.51 4.02
721 722 4.097741 CACTGAAAAATGGTCACTTCCACA 59.902 41.667 0.00 0.00 40.51 4.17
722 723 4.895297 ACTGAAAAATGGTCACTTCCACAT 59.105 37.500 0.00 0.00 40.51 3.21
723 724 5.010012 ACTGAAAAATGGTCACTTCCACATC 59.990 40.000 0.00 0.00 40.51 3.06
724 725 4.280677 TGAAAAATGGTCACTTCCACATCC 59.719 41.667 0.00 0.00 40.51 3.51
725 726 2.514458 AATGGTCACTTCCACATCCC 57.486 50.000 0.00 0.00 40.51 3.85
726 727 1.673767 ATGGTCACTTCCACATCCCT 58.326 50.000 0.00 0.00 40.51 4.20
727 728 0.984230 TGGTCACTTCCACATCCCTC 59.016 55.000 0.00 0.00 31.96 4.30
728 729 1.280457 GGTCACTTCCACATCCCTCT 58.720 55.000 0.00 0.00 0.00 3.69
729 730 1.208293 GGTCACTTCCACATCCCTCTC 59.792 57.143 0.00 0.00 0.00 3.20
730 731 1.902508 GTCACTTCCACATCCCTCTCA 59.097 52.381 0.00 0.00 0.00 3.27
731 732 2.503356 GTCACTTCCACATCCCTCTCAT 59.497 50.000 0.00 0.00 0.00 2.90
732 733 3.054802 GTCACTTCCACATCCCTCTCATT 60.055 47.826 0.00 0.00 0.00 2.57
733 734 3.054875 TCACTTCCACATCCCTCTCATTG 60.055 47.826 0.00 0.00 0.00 2.82
734 735 2.240667 ACTTCCACATCCCTCTCATTGG 59.759 50.000 0.00 0.00 0.00 3.16
735 736 1.216064 TCCACATCCCTCTCATTGGG 58.784 55.000 0.00 0.00 45.90 4.12
736 737 0.921896 CCACATCCCTCTCATTGGGT 59.078 55.000 0.00 0.00 44.84 4.51
737 738 1.133976 CCACATCCCTCTCATTGGGTC 60.134 57.143 0.00 0.00 44.84 4.46
738 739 1.133976 CACATCCCTCTCATTGGGTCC 60.134 57.143 0.00 0.00 44.84 4.46
739 740 1.216064 CATCCCTCTCATTGGGTCCA 58.784 55.000 0.00 0.00 44.84 4.02
740 741 1.133976 CATCCCTCTCATTGGGTCCAC 60.134 57.143 0.00 0.00 44.84 4.02
741 742 0.914417 TCCCTCTCATTGGGTCCACC 60.914 60.000 0.00 0.00 44.84 4.61
742 743 1.221840 CCTCTCATTGGGTCCACCG 59.778 63.158 0.00 0.00 44.64 4.94
743 744 1.221840 CTCTCATTGGGTCCACCGG 59.778 63.158 0.00 0.00 44.64 5.28
744 745 1.537889 TCTCATTGGGTCCACCGGT 60.538 57.895 0.00 0.00 44.64 5.28
745 746 0.252330 TCTCATTGGGTCCACCGGTA 60.252 55.000 6.87 0.00 44.64 4.02
746 747 0.616371 CTCATTGGGTCCACCGGTAA 59.384 55.000 6.87 0.00 44.64 2.85
747 748 1.003812 CTCATTGGGTCCACCGGTAAA 59.996 52.381 6.87 0.00 44.64 2.01
748 749 1.003812 TCATTGGGTCCACCGGTAAAG 59.996 52.381 6.87 0.00 44.64 1.85
749 750 1.003812 CATTGGGTCCACCGGTAAAGA 59.996 52.381 6.87 1.01 44.64 2.52
750 751 0.688487 TTGGGTCCACCGGTAAAGAG 59.312 55.000 6.87 0.00 44.64 2.85
751 752 0.178926 TGGGTCCACCGGTAAAGAGA 60.179 55.000 6.87 0.00 44.64 3.10
752 753 0.978907 GGGTCCACCGGTAAAGAGAA 59.021 55.000 6.87 0.00 36.71 2.87
753 754 1.348696 GGGTCCACCGGTAAAGAGAAA 59.651 52.381 6.87 0.00 36.71 2.52
754 755 2.224597 GGGTCCACCGGTAAAGAGAAAA 60.225 50.000 6.87 0.00 36.71 2.29
755 756 3.072211 GGTCCACCGGTAAAGAGAAAAG 58.928 50.000 6.87 0.00 0.00 2.27
756 757 3.244318 GGTCCACCGGTAAAGAGAAAAGA 60.244 47.826 6.87 0.00 0.00 2.52
757 758 4.383173 GTCCACCGGTAAAGAGAAAAGAA 58.617 43.478 6.87 0.00 0.00 2.52
758 759 4.818005 GTCCACCGGTAAAGAGAAAAGAAA 59.182 41.667 6.87 0.00 0.00 2.52
759 760 5.297527 GTCCACCGGTAAAGAGAAAAGAAAA 59.702 40.000 6.87 0.00 0.00 2.29
760 761 5.887035 TCCACCGGTAAAGAGAAAAGAAAAA 59.113 36.000 6.87 0.00 0.00 1.94
761 762 6.038936 TCCACCGGTAAAGAGAAAAGAAAAAG 59.961 38.462 6.87 0.00 0.00 2.27
762 763 6.038936 CCACCGGTAAAGAGAAAAGAAAAAGA 59.961 38.462 6.87 0.00 0.00 2.52
763 764 7.415877 CCACCGGTAAAGAGAAAAGAAAAAGAA 60.416 37.037 6.87 0.00 0.00 2.52
764 765 8.135529 CACCGGTAAAGAGAAAAGAAAAAGAAT 58.864 33.333 6.87 0.00 0.00 2.40
765 766 8.135529 ACCGGTAAAGAGAAAAGAAAAAGAATG 58.864 33.333 4.49 0.00 0.00 2.67
766 767 8.349983 CCGGTAAAGAGAAAAGAAAAAGAATGA 58.650 33.333 0.00 0.00 0.00 2.57
767 768 9.899226 CGGTAAAGAGAAAAGAAAAAGAATGAT 57.101 29.630 0.00 0.00 0.00 2.45
771 772 9.455847 AAAGAGAAAAGAAAAAGAATGATCGTG 57.544 29.630 0.00 0.00 0.00 4.35
772 773 7.080724 AGAGAAAAGAAAAAGAATGATCGTGC 58.919 34.615 0.00 0.00 0.00 5.34
773 774 6.152379 AGAAAAGAAAAAGAATGATCGTGCC 58.848 36.000 0.00 0.00 0.00 5.01
774 775 5.452078 AAAGAAAAAGAATGATCGTGCCA 57.548 34.783 0.00 0.00 0.00 4.92
775 776 5.452078 AAGAAAAAGAATGATCGTGCCAA 57.548 34.783 0.00 0.00 0.00 4.52
776 777 5.649782 AGAAAAAGAATGATCGTGCCAAT 57.350 34.783 0.00 0.00 0.00 3.16
777 778 5.404946 AGAAAAAGAATGATCGTGCCAATG 58.595 37.500 0.00 0.00 0.00 2.82
778 779 5.183713 AGAAAAAGAATGATCGTGCCAATGA 59.816 36.000 0.00 0.00 0.00 2.57
779 780 4.361451 AAAGAATGATCGTGCCAATGAC 57.639 40.909 0.00 0.00 0.00 3.06
780 781 1.935873 AGAATGATCGTGCCAATGACG 59.064 47.619 0.00 0.00 38.20 4.35
785 786 1.866237 TCGTGCCAATGACGAAAGC 59.134 52.632 0.00 0.00 42.63 3.51
786 787 0.882484 TCGTGCCAATGACGAAAGCA 60.882 50.000 0.00 0.00 42.63 3.91
787 788 0.040514 CGTGCCAATGACGAAAGCAA 60.041 50.000 0.00 0.00 39.21 3.91
788 789 1.689959 GTGCCAATGACGAAAGCAAG 58.310 50.000 0.00 0.00 34.79 4.01
789 790 1.001378 GTGCCAATGACGAAAGCAAGT 60.001 47.619 0.00 0.00 34.79 3.16
790 791 2.225491 GTGCCAATGACGAAAGCAAGTA 59.775 45.455 0.00 0.00 34.79 2.24
791 792 2.225491 TGCCAATGACGAAAGCAAGTAC 59.775 45.455 0.00 0.00 0.00 2.73
792 793 2.225491 GCCAATGACGAAAGCAAGTACA 59.775 45.455 0.00 0.00 0.00 2.90
793 794 3.667960 GCCAATGACGAAAGCAAGTACAG 60.668 47.826 0.00 0.00 0.00 2.74
794 795 3.745975 CCAATGACGAAAGCAAGTACAGA 59.254 43.478 0.00 0.00 0.00 3.41
795 796 4.393062 CCAATGACGAAAGCAAGTACAGAT 59.607 41.667 0.00 0.00 0.00 2.90
796 797 5.446473 CCAATGACGAAAGCAAGTACAGATC 60.446 44.000 0.00 0.00 0.00 2.75
797 798 4.251543 TGACGAAAGCAAGTACAGATCA 57.748 40.909 0.00 0.00 0.00 2.92
798 799 4.627058 TGACGAAAGCAAGTACAGATCAA 58.373 39.130 0.00 0.00 0.00 2.57
799 800 4.686091 TGACGAAAGCAAGTACAGATCAAG 59.314 41.667 0.00 0.00 0.00 3.02
800 801 4.883083 ACGAAAGCAAGTACAGATCAAGA 58.117 39.130 0.00 0.00 0.00 3.02
801 802 5.297547 ACGAAAGCAAGTACAGATCAAGAA 58.702 37.500 0.00 0.00 0.00 2.52
802 803 5.934625 ACGAAAGCAAGTACAGATCAAGAAT 59.065 36.000 0.00 0.00 0.00 2.40
803 804 7.097192 ACGAAAGCAAGTACAGATCAAGAATA 58.903 34.615 0.00 0.00 0.00 1.75
804 805 7.602644 ACGAAAGCAAGTACAGATCAAGAATAA 59.397 33.333 0.00 0.00 0.00 1.40
805 806 7.900352 CGAAAGCAAGTACAGATCAAGAATAAC 59.100 37.037 0.00 0.00 0.00 1.89
806 807 6.893958 AGCAAGTACAGATCAAGAATAACG 57.106 37.500 0.00 0.00 0.00 3.18
807 808 5.812642 AGCAAGTACAGATCAAGAATAACGG 59.187 40.000 0.00 0.00 0.00 4.44
808 809 5.502544 GCAAGTACAGATCAAGAATAACGGC 60.503 44.000 0.00 0.00 0.00 5.68
809 810 5.339008 AGTACAGATCAAGAATAACGGCA 57.661 39.130 0.00 0.00 0.00 5.69
810 811 5.918608 AGTACAGATCAAGAATAACGGCAT 58.081 37.500 0.00 0.00 0.00 4.40
811 812 5.755375 AGTACAGATCAAGAATAACGGCATG 59.245 40.000 0.00 0.00 0.00 4.06
812 813 3.313526 ACAGATCAAGAATAACGGCATGC 59.686 43.478 9.90 9.90 0.00 4.06
813 814 3.313249 CAGATCAAGAATAACGGCATGCA 59.687 43.478 21.36 0.00 0.00 3.96
814 815 3.947196 AGATCAAGAATAACGGCATGCAA 59.053 39.130 21.36 1.54 0.00 4.08
815 816 4.581824 AGATCAAGAATAACGGCATGCAAT 59.418 37.500 21.36 7.20 0.00 3.56
816 817 4.717233 TCAAGAATAACGGCATGCAATT 57.283 36.364 21.36 15.01 0.00 2.32
817 818 5.826601 TCAAGAATAACGGCATGCAATTA 57.173 34.783 21.36 16.72 0.00 1.40
818 819 6.389830 TCAAGAATAACGGCATGCAATTAT 57.610 33.333 21.36 18.18 0.00 1.28
819 820 7.503521 TCAAGAATAACGGCATGCAATTATA 57.496 32.000 21.36 5.25 0.00 0.98
820 821 8.109705 TCAAGAATAACGGCATGCAATTATAT 57.890 30.769 21.36 11.31 0.00 0.86
821 822 8.236586 TCAAGAATAACGGCATGCAATTATATC 58.763 33.333 21.36 18.18 0.00 1.63
822 823 7.928307 AGAATAACGGCATGCAATTATATCT 57.072 32.000 21.36 19.63 0.00 1.98
823 824 8.340618 AGAATAACGGCATGCAATTATATCTT 57.659 30.769 21.36 8.02 0.00 2.40
824 825 8.239314 AGAATAACGGCATGCAATTATATCTTG 58.761 33.333 21.36 0.00 0.00 3.02
834 835 6.135290 GCAATTATATCTTGCACAGTTGGA 57.865 37.500 14.78 0.00 46.44 3.53
835 836 6.742109 GCAATTATATCTTGCACAGTTGGAT 58.258 36.000 14.78 0.00 46.44 3.41
836 837 6.639686 GCAATTATATCTTGCACAGTTGGATG 59.360 38.462 14.78 0.00 46.44 3.51
837 838 6.889301 ATTATATCTTGCACAGTTGGATGG 57.111 37.500 0.00 0.00 0.00 3.51
838 839 2.885135 ATCTTGCACAGTTGGATGGA 57.115 45.000 0.00 0.00 0.00 3.41
839 840 2.885135 TCTTGCACAGTTGGATGGAT 57.115 45.000 0.00 0.00 0.00 3.41
840 841 2.715046 TCTTGCACAGTTGGATGGATC 58.285 47.619 0.00 0.00 0.00 3.36
841 842 1.399440 CTTGCACAGTTGGATGGATCG 59.601 52.381 0.00 0.00 0.00 3.69
842 843 0.612744 TGCACAGTTGGATGGATCGA 59.387 50.000 0.00 0.00 0.00 3.59
843 844 1.293924 GCACAGTTGGATGGATCGAG 58.706 55.000 0.00 0.00 0.00 4.04
844 845 1.945387 CACAGTTGGATGGATCGAGG 58.055 55.000 0.00 0.00 0.00 4.63
845 846 1.482182 CACAGTTGGATGGATCGAGGA 59.518 52.381 0.00 0.00 0.00 3.71
846 847 1.759445 ACAGTTGGATGGATCGAGGAG 59.241 52.381 0.00 0.00 0.00 3.69
847 848 1.069823 CAGTTGGATGGATCGAGGAGG 59.930 57.143 0.00 0.00 0.00 4.30
848 849 0.394565 GTTGGATGGATCGAGGAGGG 59.605 60.000 0.00 0.00 0.00 4.30
849 850 0.264657 TTGGATGGATCGAGGAGGGA 59.735 55.000 0.00 0.00 0.00 4.20
850 851 0.264657 TGGATGGATCGAGGAGGGAA 59.735 55.000 0.00 0.00 0.00 3.97
851 852 1.132721 TGGATGGATCGAGGAGGGAAT 60.133 52.381 0.00 0.00 0.00 3.01
852 853 1.552792 GGATGGATCGAGGAGGGAATC 59.447 57.143 0.00 0.00 0.00 2.52
853 854 2.251818 GATGGATCGAGGAGGGAATCA 58.748 52.381 0.00 0.00 0.00 2.57
854 855 2.174685 TGGATCGAGGAGGGAATCAA 57.825 50.000 0.00 0.00 0.00 2.57
855 856 2.477245 TGGATCGAGGAGGGAATCAAA 58.523 47.619 0.00 0.00 0.00 2.69
856 857 2.170607 TGGATCGAGGAGGGAATCAAAC 59.829 50.000 0.00 0.00 0.00 2.93
857 858 2.485657 GGATCGAGGAGGGAATCAAACC 60.486 54.545 0.00 0.00 0.00 3.27
858 859 1.952621 TCGAGGAGGGAATCAAACCT 58.047 50.000 0.00 0.00 40.54 3.50
859 860 3.110293 TCGAGGAGGGAATCAAACCTA 57.890 47.619 0.00 0.00 37.18 3.08
860 861 3.031736 TCGAGGAGGGAATCAAACCTAG 58.968 50.000 0.00 0.00 37.18 3.02
861 862 2.483889 CGAGGAGGGAATCAAACCTAGC 60.484 54.545 0.00 0.00 37.18 3.42
862 863 2.774809 GAGGAGGGAATCAAACCTAGCT 59.225 50.000 0.00 0.00 37.18 3.32
863 864 2.507471 AGGAGGGAATCAAACCTAGCTG 59.493 50.000 0.00 0.00 37.18 4.24
864 865 2.239907 GGAGGGAATCAAACCTAGCTGT 59.760 50.000 0.00 0.00 37.18 4.40
865 866 3.274288 GAGGGAATCAAACCTAGCTGTG 58.726 50.000 0.00 0.00 37.18 3.66
866 867 2.025887 AGGGAATCAAACCTAGCTGTGG 60.026 50.000 0.00 0.42 34.71 4.17
867 868 2.369394 GGAATCAAACCTAGCTGTGGG 58.631 52.381 11.49 6.60 0.00 4.61
868 869 2.290960 GGAATCAAACCTAGCTGTGGGT 60.291 50.000 11.49 7.18 39.83 4.51
870 871 2.270352 TCAAACCTAGCTGTGGGTTG 57.730 50.000 24.06 24.06 46.43 3.77
871 872 0.598065 CAAACCTAGCTGTGGGTTGC 59.402 55.000 20.39 0.00 46.43 4.17
872 873 0.539669 AAACCTAGCTGTGGGTTGCC 60.540 55.000 17.22 0.00 46.43 4.52
873 874 2.436646 CCTAGCTGTGGGTTGCCG 60.437 66.667 0.00 0.00 0.00 5.69
874 875 3.127533 CTAGCTGTGGGTTGCCGC 61.128 66.667 0.00 0.00 0.00 6.53
897 898 2.642129 CACGCGATGCCACCAAAA 59.358 55.556 15.93 0.00 0.00 2.44
898 899 1.007964 CACGCGATGCCACCAAAAA 60.008 52.632 15.93 0.00 0.00 1.94
899 900 0.388391 CACGCGATGCCACCAAAAAT 60.388 50.000 15.93 0.00 0.00 1.82
900 901 1.135546 CACGCGATGCCACCAAAAATA 60.136 47.619 15.93 0.00 0.00 1.40
901 902 1.748493 ACGCGATGCCACCAAAAATAT 59.252 42.857 15.93 0.00 0.00 1.28
902 903 2.165437 ACGCGATGCCACCAAAAATATT 59.835 40.909 15.93 0.00 0.00 1.28
903 904 2.788786 CGCGATGCCACCAAAAATATTC 59.211 45.455 0.00 0.00 0.00 1.75
904 905 3.489059 CGCGATGCCACCAAAAATATTCT 60.489 43.478 0.00 0.00 0.00 2.40
905 906 4.044426 GCGATGCCACCAAAAATATTCTC 58.956 43.478 0.00 0.00 0.00 2.87
906 907 4.439974 GCGATGCCACCAAAAATATTCTCA 60.440 41.667 0.00 0.00 0.00 3.27
907 908 5.737063 GCGATGCCACCAAAAATATTCTCAT 60.737 40.000 0.00 0.00 0.00 2.90
908 909 5.916883 CGATGCCACCAAAAATATTCTCATC 59.083 40.000 0.00 0.00 0.00 2.92
909 910 5.596836 TGCCACCAAAAATATTCTCATCC 57.403 39.130 0.00 0.00 0.00 3.51
910 911 5.022122 TGCCACCAAAAATATTCTCATCCA 58.978 37.500 0.00 0.00 0.00 3.41
911 912 5.662208 TGCCACCAAAAATATTCTCATCCAT 59.338 36.000 0.00 0.00 0.00 3.41
912 913 5.987347 GCCACCAAAAATATTCTCATCCATG 59.013 40.000 0.00 0.00 0.00 3.66
913 914 6.518493 CCACCAAAAATATTCTCATCCATGG 58.482 40.000 4.97 4.97 0.00 3.66
914 915 5.987347 CACCAAAAATATTCTCATCCATGGC 59.013 40.000 6.96 0.00 0.00 4.40
915 916 5.901276 ACCAAAAATATTCTCATCCATGGCT 59.099 36.000 6.96 0.00 0.00 4.75
916 917 7.014518 CACCAAAAATATTCTCATCCATGGCTA 59.985 37.037 6.96 0.00 0.00 3.93
917 918 7.731688 ACCAAAAATATTCTCATCCATGGCTAT 59.268 33.333 6.96 0.00 0.00 2.97
918 919 8.591072 CCAAAAATATTCTCATCCATGGCTATT 58.409 33.333 6.96 0.00 0.00 1.73
919 920 9.991906 CAAAAATATTCTCATCCATGGCTATTT 57.008 29.630 6.96 5.08 0.00 1.40
924 925 9.770097 ATATTCTCATCCATGGCTATTTATACG 57.230 33.333 6.96 0.00 0.00 3.06
925 926 5.419542 TCTCATCCATGGCTATTTATACGC 58.580 41.667 6.96 0.00 0.00 4.42
926 927 5.046663 TCTCATCCATGGCTATTTATACGCA 60.047 40.000 6.96 0.00 0.00 5.24
927 928 5.744171 TCATCCATGGCTATTTATACGCAT 58.256 37.500 6.96 0.00 0.00 4.73
928 929 6.883744 TCATCCATGGCTATTTATACGCATA 58.116 36.000 6.96 0.00 0.00 3.14
929 930 7.508687 TCATCCATGGCTATTTATACGCATAT 58.491 34.615 6.96 0.00 0.00 1.78
930 931 8.646900 TCATCCATGGCTATTTATACGCATATA 58.353 33.333 6.96 0.00 0.00 0.86
931 932 8.712363 CATCCATGGCTATTTATACGCATATAC 58.288 37.037 6.96 0.00 0.00 1.47
932 933 7.787028 TCCATGGCTATTTATACGCATATACA 58.213 34.615 6.96 0.00 0.00 2.29
933 934 8.428852 TCCATGGCTATTTATACGCATATACAT 58.571 33.333 6.96 0.00 0.00 2.29
934 935 8.498358 CCATGGCTATTTATACGCATATACATG 58.502 37.037 0.00 0.00 35.07 3.21
935 936 8.498358 CATGGCTATTTATACGCATATACATGG 58.502 37.037 0.00 0.00 32.36 3.66
937 938 6.073222 GGCTATTTATACGCATATACATGGGC 60.073 42.308 0.00 1.30 46.33 5.36
938 939 6.706270 GCTATTTATACGCATATACATGGGCT 59.294 38.462 0.00 0.00 46.33 5.19
939 940 6.925610 ATTTATACGCATATACATGGGCTG 57.074 37.500 0.00 0.00 46.33 4.85
940 941 2.093306 TACGCATATACATGGGCTGC 57.907 50.000 0.00 0.00 46.33 5.25
941 942 0.108396 ACGCATATACATGGGCTGCA 59.892 50.000 0.50 0.00 46.33 4.41
942 943 1.271543 ACGCATATACATGGGCTGCAT 60.272 47.619 0.50 0.00 46.33 3.96
943 944 1.131693 CGCATATACATGGGCTGCATG 59.868 52.381 0.50 0.00 38.16 4.06
944 945 1.135199 GCATATACATGGGCTGCATGC 60.135 52.381 11.82 11.82 35.22 4.06
945 946 2.164338 CATATACATGGGCTGCATGCA 58.836 47.619 21.29 21.29 45.15 3.96
946 947 2.590282 TATACATGGGCTGCATGCAT 57.410 45.000 22.97 6.91 45.15 3.96
947 948 1.254026 ATACATGGGCTGCATGCATC 58.746 50.000 22.97 17.75 45.15 3.91
948 949 0.184211 TACATGGGCTGCATGCATCT 59.816 50.000 22.97 2.98 45.15 2.90
949 950 0.184211 ACATGGGCTGCATGCATCTA 59.816 50.000 22.97 14.75 45.15 1.98
950 951 1.324383 CATGGGCTGCATGCATCTAA 58.676 50.000 22.97 9.88 45.15 2.10
951 952 1.893137 CATGGGCTGCATGCATCTAAT 59.107 47.619 22.97 11.77 45.15 1.73
952 953 1.324383 TGGGCTGCATGCATCTAATG 58.676 50.000 22.97 9.56 45.15 1.90
953 954 0.601558 GGGCTGCATGCATCTAATGG 59.398 55.000 22.97 8.76 45.15 3.16
954 955 0.038526 GGCTGCATGCATCTAATGGC 60.039 55.000 22.97 18.48 45.15 4.40
955 956 0.959553 GCTGCATGCATCTAATGGCT 59.040 50.000 22.97 0.00 42.31 4.75
956 957 2.156917 GCTGCATGCATCTAATGGCTA 58.843 47.619 22.97 0.00 42.31 3.93
957 958 2.753452 GCTGCATGCATCTAATGGCTAT 59.247 45.455 22.97 0.00 42.31 2.97
958 959 3.943381 GCTGCATGCATCTAATGGCTATA 59.057 43.478 22.97 0.00 42.31 1.31
959 960 4.035324 GCTGCATGCATCTAATGGCTATAG 59.965 45.833 22.97 5.09 42.31 1.31
960 961 3.943381 TGCATGCATCTAATGGCTATAGC 59.057 43.478 18.46 16.78 41.14 2.97
961 962 3.943381 GCATGCATCTAATGGCTATAGCA 59.057 43.478 25.53 12.48 44.36 3.49
962 963 4.579340 GCATGCATCTAATGGCTATAGCAT 59.421 41.667 25.53 14.11 44.36 3.79
964 965 5.425196 TGCATCTAATGGCTATAGCATGA 57.575 39.130 25.53 14.85 44.36 3.07
965 966 5.997843 TGCATCTAATGGCTATAGCATGAT 58.002 37.500 25.53 16.21 44.36 2.45
966 967 5.820947 TGCATCTAATGGCTATAGCATGATG 59.179 40.000 25.53 24.66 44.36 3.07
967 968 5.277876 GCATCTAATGGCTATAGCATGATGC 60.278 44.000 30.11 30.11 45.46 3.91
982 983 6.266168 GCATGATGCTACTAGACTACATCT 57.734 41.667 10.72 0.00 40.96 2.90
983 984 7.384439 GCATGATGCTACTAGACTACATCTA 57.616 40.000 10.72 7.36 40.96 1.98
984 985 7.821652 GCATGATGCTACTAGACTACATCTAA 58.178 38.462 10.72 3.53 38.77 2.10
985 986 7.967854 GCATGATGCTACTAGACTACATCTAAG 59.032 40.741 10.72 9.56 38.77 2.18
986 987 9.225436 CATGATGCTACTAGACTACATCTAAGA 57.775 37.037 15.50 0.00 39.52 2.10
987 988 9.973661 ATGATGCTACTAGACTACATCTAAGAT 57.026 33.333 15.50 0.00 39.52 2.40
991 992 9.932207 TGCTACTAGACTACATCTAAGATAGAC 57.068 37.037 0.00 0.00 39.52 2.59
992 993 9.374838 GCTACTAGACTACATCTAAGATAGACC 57.625 40.741 0.00 0.00 39.52 3.85
998 999 9.563748 AGACTACATCTAAGATAGACCTAACAC 57.436 37.037 0.00 0.00 37.69 3.32
999 1000 8.380743 ACTACATCTAAGATAGACCTAACACG 57.619 38.462 0.00 0.00 37.69 4.49
1000 1001 8.209584 ACTACATCTAAGATAGACCTAACACGA 58.790 37.037 0.00 0.00 37.69 4.35
1001 1002 9.221933 CTACATCTAAGATAGACCTAACACGAT 57.778 37.037 0.00 0.00 37.69 3.73
1002 1003 7.877003 ACATCTAAGATAGACCTAACACGATG 58.123 38.462 0.00 0.00 37.69 3.84
1003 1004 7.720074 ACATCTAAGATAGACCTAACACGATGA 59.280 37.037 0.00 0.00 37.69 2.92
1004 1005 8.735315 CATCTAAGATAGACCTAACACGATGAT 58.265 37.037 0.00 0.00 37.69 2.45
1005 1006 8.325421 TCTAAGATAGACCTAACACGATGATC 57.675 38.462 0.00 0.00 0.00 2.92
1006 1007 6.961360 AAGATAGACCTAACACGATGATCA 57.039 37.500 0.00 0.00 0.00 2.92
1007 1008 6.320494 AGATAGACCTAACACGATGATCAC 57.680 41.667 0.00 0.00 0.00 3.06
1008 1009 3.802948 AGACCTAACACGATGATCACC 57.197 47.619 0.00 0.00 0.00 4.02
1009 1010 3.366396 AGACCTAACACGATGATCACCT 58.634 45.455 0.00 0.00 0.00 4.00
1010 1011 3.769844 AGACCTAACACGATGATCACCTT 59.230 43.478 0.00 0.00 0.00 3.50
1011 1012 4.113354 GACCTAACACGATGATCACCTTC 58.887 47.826 0.00 0.00 0.00 3.46
1012 1013 3.118738 ACCTAACACGATGATCACCTTCC 60.119 47.826 0.00 0.00 0.00 3.46
1013 1014 2.403252 AACACGATGATCACCTTCCC 57.597 50.000 0.00 0.00 0.00 3.97
1014 1015 0.175760 ACACGATGATCACCTTCCCG 59.824 55.000 0.00 0.00 0.00 5.14
1015 1016 0.530650 CACGATGATCACCTTCCCGG 60.531 60.000 0.00 0.00 39.35 5.73
1016 1017 1.069765 CGATGATCACCTTCCCGGG 59.930 63.158 16.85 16.85 36.97 5.73
1017 1018 1.686325 CGATGATCACCTTCCCGGGT 61.686 60.000 22.86 0.00 40.73 5.28
1018 1019 1.420430 GATGATCACCTTCCCGGGTA 58.580 55.000 22.86 10.78 37.52 3.69
1019 1020 1.766496 GATGATCACCTTCCCGGGTAA 59.234 52.381 22.86 12.67 37.52 2.85
1020 1021 1.659022 TGATCACCTTCCCGGGTAAA 58.341 50.000 22.86 7.52 37.52 2.01
1021 1022 1.986631 TGATCACCTTCCCGGGTAAAA 59.013 47.619 22.86 6.66 37.52 1.52
1022 1023 2.375845 TGATCACCTTCCCGGGTAAAAA 59.624 45.455 22.86 6.23 37.52 1.94
1023 1024 3.010808 TGATCACCTTCCCGGGTAAAAAT 59.989 43.478 22.86 8.54 37.52 1.82
1024 1025 4.227754 TGATCACCTTCCCGGGTAAAAATA 59.772 41.667 22.86 2.22 37.52 1.40
1025 1026 3.954200 TCACCTTCCCGGGTAAAAATAC 58.046 45.455 22.86 0.00 37.52 1.89
1026 1027 3.018856 CACCTTCCCGGGTAAAAATACC 58.981 50.000 22.86 0.00 37.52 2.73
1035 1036 2.575532 GGTAAAAATACCCGCCCTACC 58.424 52.381 0.00 0.00 34.06 3.18
1036 1037 2.173356 GGTAAAAATACCCGCCCTACCT 59.827 50.000 0.00 0.00 34.06 3.08
1037 1038 3.390967 GGTAAAAATACCCGCCCTACCTA 59.609 47.826 0.00 0.00 34.06 3.08
1038 1039 4.042062 GGTAAAAATACCCGCCCTACCTAT 59.958 45.833 0.00 0.00 34.06 2.57
1039 1040 4.362470 AAAAATACCCGCCCTACCTATC 57.638 45.455 0.00 0.00 0.00 2.08
1040 1041 3.271153 AAATACCCGCCCTACCTATCT 57.729 47.619 0.00 0.00 0.00 1.98
1041 1042 2.528673 ATACCCGCCCTACCTATCTC 57.471 55.000 0.00 0.00 0.00 2.75
1042 1043 1.151760 TACCCGCCCTACCTATCTCA 58.848 55.000 0.00 0.00 0.00 3.27
1043 1044 0.487772 ACCCGCCCTACCTATCTCAT 59.512 55.000 0.00 0.00 0.00 2.90
1044 1045 1.187087 CCCGCCCTACCTATCTCATC 58.813 60.000 0.00 0.00 0.00 2.92
1045 1046 1.550179 CCCGCCCTACCTATCTCATCA 60.550 57.143 0.00 0.00 0.00 3.07
1046 1047 1.821753 CCGCCCTACCTATCTCATCAG 59.178 57.143 0.00 0.00 0.00 2.90
1047 1048 1.821753 CGCCCTACCTATCTCATCAGG 59.178 57.143 0.00 0.00 37.97 3.86
1048 1049 1.552792 GCCCTACCTATCTCATCAGGC 59.447 57.143 0.00 0.00 35.14 4.85
1049 1050 2.894731 CCCTACCTATCTCATCAGGCA 58.105 52.381 0.00 0.00 35.14 4.75
1050 1051 2.564947 CCCTACCTATCTCATCAGGCAC 59.435 54.545 0.00 0.00 35.14 5.01
1091 1092 2.414824 GCATCCAAAATTACGTCCGCAA 60.415 45.455 0.00 0.00 0.00 4.85
1098 1099 0.390735 ATTACGTCCGCAACCTCACC 60.391 55.000 0.00 0.00 0.00 4.02
1104 1105 2.266055 CGCAACCTCACCTCCTCC 59.734 66.667 0.00 0.00 0.00 4.30
1109 1110 2.472029 CAACCTCACCTCCTCCTACAT 58.528 52.381 0.00 0.00 0.00 2.29
1111 1112 1.323412 CCTCACCTCCTCCTACATCG 58.677 60.000 0.00 0.00 0.00 3.84
1112 1113 1.133761 CCTCACCTCCTCCTACATCGA 60.134 57.143 0.00 0.00 0.00 3.59
1113 1114 1.950909 CTCACCTCCTCCTACATCGAC 59.049 57.143 0.00 0.00 0.00 4.20
1115 1116 1.405821 CACCTCCTCCTACATCGACAC 59.594 57.143 0.00 0.00 0.00 3.67
1117 1118 1.685180 CCTCCTCCTACATCGACACCA 60.685 57.143 0.00 0.00 0.00 4.17
1118 1119 1.678627 CTCCTCCTACATCGACACCAG 59.321 57.143 0.00 0.00 0.00 4.00
1119 1120 0.747255 CCTCCTACATCGACACCAGG 59.253 60.000 0.00 0.00 0.00 4.45
1128 1129 3.036026 CGACACCAGGAATGAGTCG 57.964 57.895 0.00 0.00 44.64 4.18
1132 1133 0.608130 CACCAGGAATGAGTCGTCCA 59.392 55.000 13.61 0.00 36.28 4.02
1149 1150 3.771160 ATGGTGTCCGCCTCCGTC 61.771 66.667 0.00 0.00 0.00 4.79
1159 1160 1.154205 CGCCTCCGTCATCATGTTCC 61.154 60.000 0.00 0.00 0.00 3.62
1176 1177 3.213402 CTCCTCGTCGGCCTCTCC 61.213 72.222 0.00 0.00 0.00 3.71
1197 1198 3.181450 CCTTCAACCTCAACCTCTTCAGT 60.181 47.826 0.00 0.00 0.00 3.41
1208 1209 0.805614 CTCTTCAGTCGCTTCTCCGA 59.194 55.000 0.00 0.00 34.40 4.55
1248 1249 0.462759 CCAAGGTCCGCATCTTCCTC 60.463 60.000 0.00 0.00 0.00 3.71
1255 1256 1.361993 CGCATCTTCCTCTCCTCCG 59.638 63.158 0.00 0.00 0.00 4.63
1257 1258 1.680522 GCATCTTCCTCTCCTCCGCA 61.681 60.000 0.00 0.00 0.00 5.69
1272 1273 0.179062 CCGCATTCTCCCTCTTCCTG 60.179 60.000 0.00 0.00 0.00 3.86
1275 1276 1.211456 CATTCTCCCTCTTCCTGCCT 58.789 55.000 0.00 0.00 0.00 4.75
1299 1300 2.893215 TGTCCTACCTCTTCTCCGAA 57.107 50.000 0.00 0.00 0.00 4.30
1300 1301 2.724454 TGTCCTACCTCTTCTCCGAAG 58.276 52.381 0.00 0.00 0.00 3.79
1312 1313 2.668212 CCGAAGCCAAGAACGCCA 60.668 61.111 0.00 0.00 0.00 5.69
1319 1320 2.048222 CAAGAACGCCAGCTCCGA 60.048 61.111 10.02 0.00 0.00 4.55
1320 1321 1.448540 CAAGAACGCCAGCTCCGAT 60.449 57.895 10.02 0.00 0.00 4.18
1334 1335 3.853330 CGATGCTGCGGACAACGG 61.853 66.667 0.00 0.00 44.51 4.44
1369 1373 1.122019 ACAGGCCGGTATGATCCTCC 61.122 60.000 6.79 0.00 0.00 4.30
1371 1375 0.833834 AGGCCGGTATGATCCTCCTG 60.834 60.000 1.90 0.00 30.79 3.86
1386 1390 1.303888 CCTGTGGATGCTGCTGGTT 60.304 57.895 0.00 0.00 0.00 3.67
1404 1408 0.036952 TTGAGCTCCTCCGCAAGAAG 60.037 55.000 12.15 0.00 43.02 2.85
1410 1414 1.376037 CCTCCGCAAGAAGGTGGAC 60.376 63.158 0.00 0.00 42.31 4.02
1434 1438 2.202797 CGCATGCACGGCTACTCT 60.203 61.111 19.57 0.00 0.00 3.24
1435 1439 1.065764 CGCATGCACGGCTACTCTA 59.934 57.895 19.57 0.00 0.00 2.43
1496 1500 2.263077 CCTCGTCTTCTTCAACATCCG 58.737 52.381 0.00 0.00 0.00 4.18
1502 1506 2.093973 TCTTCTTCAACATCCGGAGAGC 60.094 50.000 11.34 0.00 0.00 4.09
1644 1648 4.578871 TCACCTCCTACATGTCACAAATG 58.421 43.478 0.00 0.00 0.00 2.32
1645 1649 3.127548 CACCTCCTACATGTCACAAATGC 59.872 47.826 0.00 0.00 0.00 3.56
1651 1655 2.232399 ACATGTCACAAATGCTGCAGA 58.768 42.857 20.43 2.70 0.00 4.26
1654 1658 3.797451 TGTCACAAATGCTGCAGAAAA 57.203 38.095 20.43 1.66 0.00 2.29
1658 1662 4.059511 TCACAAATGCTGCAGAAAAATGG 58.940 39.130 20.43 0.00 0.00 3.16
1662 1669 4.811969 AATGCTGCAGAAAAATGGATCA 57.188 36.364 20.43 1.35 0.00 2.92
1663 1670 4.811969 ATGCTGCAGAAAAATGGATCAA 57.188 36.364 20.43 0.00 0.00 2.57
1669 1676 6.024552 TGCAGAAAAATGGATCAAAGGTAC 57.975 37.500 0.00 0.00 0.00 3.34
1674 1681 8.186821 CAGAAAAATGGATCAAAGGTACTGATC 58.813 37.037 12.84 12.84 45.66 2.92
1675 1682 8.112183 AGAAAAATGGATCAAAGGTACTGATCT 58.888 33.333 18.04 3.25 45.67 2.75
1681 1688 5.698545 GGATCAAAGGTACTGATCTGCATAC 59.301 44.000 18.04 3.04 45.67 2.39
1688 1695 1.208052 ACTGATCTGCATACGCCAACT 59.792 47.619 0.00 0.00 37.32 3.16
1690 1697 3.070159 ACTGATCTGCATACGCCAACTAT 59.930 43.478 0.00 0.00 37.32 2.12
1692 1699 5.208463 TGATCTGCATACGCCAACTATTA 57.792 39.130 0.00 0.00 37.32 0.98
1693 1700 5.606505 TGATCTGCATACGCCAACTATTAA 58.393 37.500 0.00 0.00 37.32 1.40
1694 1701 5.696270 TGATCTGCATACGCCAACTATTAAG 59.304 40.000 0.00 0.00 37.32 1.85
1695 1702 4.377021 TCTGCATACGCCAACTATTAAGG 58.623 43.478 0.00 0.00 37.32 2.69
1696 1703 3.472652 TGCATACGCCAACTATTAAGGG 58.527 45.455 0.00 0.00 37.32 3.95
1697 1704 3.118186 TGCATACGCCAACTATTAAGGGT 60.118 43.478 0.00 0.00 37.32 4.34
1698 1705 3.881089 GCATACGCCAACTATTAAGGGTT 59.119 43.478 0.00 0.00 0.00 4.11
1699 1706 4.024302 GCATACGCCAACTATTAAGGGTTC 60.024 45.833 0.00 0.00 0.00 3.62
1700 1707 3.706600 ACGCCAACTATTAAGGGTTCA 57.293 42.857 0.00 0.00 0.00 3.18
1701 1708 4.230745 ACGCCAACTATTAAGGGTTCAT 57.769 40.909 0.00 0.00 0.00 2.57
1702 1709 4.196971 ACGCCAACTATTAAGGGTTCATC 58.803 43.478 0.00 0.00 0.00 2.92
1703 1710 3.564225 CGCCAACTATTAAGGGTTCATCC 59.436 47.826 0.00 0.00 0.00 3.51
1704 1711 4.532834 GCCAACTATTAAGGGTTCATCCA 58.467 43.478 0.00 0.00 38.11 3.41
1712 1719 6.796785 ATTAAGGGTTCATCCAAAATCCTG 57.203 37.500 0.00 0.00 38.11 3.86
1718 1725 4.158579 GGTTCATCCAAAATCCTGAACTCC 59.841 45.833 12.40 0.00 44.29 3.85
1720 1727 4.592942 TCATCCAAAATCCTGAACTCCTG 58.407 43.478 0.00 0.00 0.00 3.86
1721 1728 4.043310 TCATCCAAAATCCTGAACTCCTGT 59.957 41.667 0.00 0.00 0.00 4.00
1736 1743 7.112122 TGAACTCCTGTAGAAATATGCACAAT 58.888 34.615 0.00 0.00 0.00 2.71
1741 1748 9.710900 CTCCTGTAGAAATATGCACAATGTATA 57.289 33.333 0.00 0.00 29.86 1.47
1751 1758 9.586732 AATATGCACAATGTATACATTAAGGGT 57.413 29.630 26.59 18.55 44.10 4.34
1752 1759 7.896383 ATGCACAATGTATACATTAAGGGTT 57.104 32.000 26.59 10.74 44.10 4.11
1753 1760 7.710676 TGCACAATGTATACATTAAGGGTTT 57.289 32.000 26.59 4.70 44.10 3.27
1755 1762 7.613801 TGCACAATGTATACATTAAGGGTTTCT 59.386 33.333 26.59 2.53 44.10 2.52
1756 1763 8.466798 GCACAATGTATACATTAAGGGTTTCTT 58.533 33.333 26.59 2.83 44.10 2.52
1768 1775 4.522722 AGGGTTTCTTAAGTCTCAGTCG 57.477 45.455 1.63 0.00 0.00 4.18
1769 1776 4.150359 AGGGTTTCTTAAGTCTCAGTCGA 58.850 43.478 1.63 0.00 0.00 4.20
1770 1777 4.218852 AGGGTTTCTTAAGTCTCAGTCGAG 59.781 45.833 1.63 0.00 40.98 4.04
1772 1779 5.155643 GGTTTCTTAAGTCTCAGTCGAGTC 58.844 45.833 1.63 0.00 40.44 3.36
1773 1780 5.278364 GGTTTCTTAAGTCTCAGTCGAGTCA 60.278 44.000 1.63 0.00 40.44 3.41
1775 1782 4.643463 TCTTAAGTCTCAGTCGAGTCAGT 58.357 43.478 1.63 0.00 40.44 3.41
1776 1783 5.064558 TCTTAAGTCTCAGTCGAGTCAGTT 58.935 41.667 1.63 0.00 40.44 3.16
1777 1784 5.531659 TCTTAAGTCTCAGTCGAGTCAGTTT 59.468 40.000 1.63 0.00 40.44 2.66
1778 1785 3.907894 AGTCTCAGTCGAGTCAGTTTC 57.092 47.619 0.00 0.00 40.44 2.78
1779 1786 3.482436 AGTCTCAGTCGAGTCAGTTTCT 58.518 45.455 0.00 0.00 40.44 2.52
1780 1787 3.886505 AGTCTCAGTCGAGTCAGTTTCTT 59.113 43.478 0.00 0.00 40.44 2.52
1781 1788 5.064558 AGTCTCAGTCGAGTCAGTTTCTTA 58.935 41.667 0.00 0.00 40.44 2.10
1782 1789 5.531659 AGTCTCAGTCGAGTCAGTTTCTTAA 59.468 40.000 0.00 0.00 40.44 1.85
1783 1790 5.854338 GTCTCAGTCGAGTCAGTTTCTTAAG 59.146 44.000 0.00 0.00 40.44 1.85
1784 1791 5.531659 TCTCAGTCGAGTCAGTTTCTTAAGT 59.468 40.000 1.63 0.00 40.44 2.24
1785 1792 5.759963 TCAGTCGAGTCAGTTTCTTAAGTC 58.240 41.667 1.63 0.00 0.00 3.01
1786 1793 5.531659 TCAGTCGAGTCAGTTTCTTAAGTCT 59.468 40.000 1.63 0.00 0.00 3.24
1787 1794 5.854338 CAGTCGAGTCAGTTTCTTAAGTCTC 59.146 44.000 1.63 0.99 0.00 3.36
1788 1795 5.766174 AGTCGAGTCAGTTTCTTAAGTCTCT 59.234 40.000 1.63 0.00 0.00 3.10
1789 1796 6.263617 AGTCGAGTCAGTTTCTTAAGTCTCTT 59.736 38.462 1.63 0.00 0.00 2.85
1790 1797 6.919115 GTCGAGTCAGTTTCTTAAGTCTCTTT 59.081 38.462 1.63 0.00 0.00 2.52
1791 1798 7.435784 GTCGAGTCAGTTTCTTAAGTCTCTTTT 59.564 37.037 1.63 0.00 0.00 2.27
1792 1799 7.435488 TCGAGTCAGTTTCTTAAGTCTCTTTTG 59.565 37.037 1.63 0.00 0.00 2.44
1793 1800 7.435488 CGAGTCAGTTTCTTAAGTCTCTTTTGA 59.565 37.037 1.63 0.00 0.00 2.69
1795 1802 8.261522 AGTCAGTTTCTTAAGTCTCTTTTGAGT 58.738 33.333 1.63 0.30 46.30 3.41
1796 1803 8.331742 GTCAGTTTCTTAAGTCTCTTTTGAGTG 58.668 37.037 1.63 0.00 46.30 3.51
1797 1804 8.258007 TCAGTTTCTTAAGTCTCTTTTGAGTGA 58.742 33.333 1.63 0.00 46.30 3.41
1798 1805 8.547069 CAGTTTCTTAAGTCTCTTTTGAGTGAG 58.453 37.037 1.63 0.00 46.30 3.51
1799 1806 8.478877 AGTTTCTTAAGTCTCTTTTGAGTGAGA 58.521 33.333 1.63 0.00 46.30 3.27
1800 1807 8.760569 GTTTCTTAAGTCTCTTTTGAGTGAGAG 58.239 37.037 1.63 0.00 46.30 3.20
1801 1808 7.825331 TCTTAAGTCTCTTTTGAGTGAGAGA 57.175 36.000 1.63 0.00 46.30 3.10
1809 1816 8.594881 TCTCTTTTGAGTGAGAGAAATACAAC 57.405 34.615 0.86 0.00 43.90 3.32
1810 1817 8.424918 TCTCTTTTGAGTGAGAGAAATACAACT 58.575 33.333 0.86 0.00 43.90 3.16
1811 1818 8.964476 TCTTTTGAGTGAGAGAAATACAACTT 57.036 30.769 0.00 0.00 0.00 2.66
1812 1819 9.046296 TCTTTTGAGTGAGAGAAATACAACTTC 57.954 33.333 0.00 0.00 0.00 3.01
1813 1820 8.731275 TTTTGAGTGAGAGAAATACAACTTCA 57.269 30.769 0.00 0.00 0.00 3.02
1814 1821 8.731275 TTTGAGTGAGAGAAATACAACTTCAA 57.269 30.769 0.00 0.00 0.00 2.69
1815 1822 8.908786 TTGAGTGAGAGAAATACAACTTCAAT 57.091 30.769 0.00 0.00 0.00 2.57
1816 1823 9.996554 TTGAGTGAGAGAAATACAACTTCAATA 57.003 29.630 0.00 0.00 0.00 1.90
1830 1837 8.165239 ACAACTTCAATATAGTGAAAAGTGCA 57.835 30.769 15.76 0.00 37.08 4.57
1831 1838 8.292448 ACAACTTCAATATAGTGAAAAGTGCAG 58.708 33.333 15.76 5.80 37.08 4.41
1832 1839 7.986085 ACTTCAATATAGTGAAAAGTGCAGT 57.014 32.000 15.76 6.38 37.08 4.40
1833 1840 8.396272 ACTTCAATATAGTGAAAAGTGCAGTT 57.604 30.769 15.76 0.00 37.08 3.16
1834 1841 8.850156 ACTTCAATATAGTGAAAAGTGCAGTTT 58.150 29.630 15.76 13.86 37.08 2.66
1837 1844 9.278978 TCAATATAGTGAAAAGTGCAGTTTACA 57.721 29.630 19.55 7.10 0.00 2.41
1842 1849 9.816354 ATAGTGAAAAGTGCAGTTTACATTTTT 57.184 25.926 19.55 2.41 38.96 1.94
1843 1850 8.185003 AGTGAAAAGTGCAGTTTACATTTTTC 57.815 30.769 19.55 11.84 46.00 2.29
1844 1851 7.277760 AGTGAAAAGTGCAGTTTACATTTTTCC 59.722 33.333 19.55 6.50 45.59 3.13
1845 1852 6.536941 TGAAAAGTGCAGTTTACATTTTTCCC 59.463 34.615 19.55 1.42 45.59 3.97
1846 1853 5.869649 AAGTGCAGTTTACATTTTTCCCT 57.130 34.783 0.00 0.00 0.00 4.20
1847 1854 6.969993 AAGTGCAGTTTACATTTTTCCCTA 57.030 33.333 0.00 0.00 0.00 3.53
1848 1855 6.327279 AGTGCAGTTTACATTTTTCCCTAC 57.673 37.500 0.00 0.00 0.00 3.18
1849 1856 5.243060 AGTGCAGTTTACATTTTTCCCTACC 59.757 40.000 0.00 0.00 0.00 3.18
1850 1857 5.010213 GTGCAGTTTACATTTTTCCCTACCA 59.990 40.000 0.00 0.00 0.00 3.25
1851 1858 5.777732 TGCAGTTTACATTTTTCCCTACCAT 59.222 36.000 0.00 0.00 0.00 3.55
1852 1859 6.268847 TGCAGTTTACATTTTTCCCTACCATT 59.731 34.615 0.00 0.00 0.00 3.16
1853 1860 7.158697 GCAGTTTACATTTTTCCCTACCATTT 58.841 34.615 0.00 0.00 0.00 2.32
1854 1861 7.117667 GCAGTTTACATTTTTCCCTACCATTTG 59.882 37.037 0.00 0.00 0.00 2.32
1855 1862 7.117667 CAGTTTACATTTTTCCCTACCATTTGC 59.882 37.037 0.00 0.00 0.00 3.68
1856 1863 6.672266 TTACATTTTTCCCTACCATTTGCA 57.328 33.333 0.00 0.00 0.00 4.08
1857 1864 4.893608 ACATTTTTCCCTACCATTTGCAC 58.106 39.130 0.00 0.00 0.00 4.57
1858 1865 4.592778 ACATTTTTCCCTACCATTTGCACT 59.407 37.500 0.00 0.00 0.00 4.40
1859 1866 5.071653 ACATTTTTCCCTACCATTTGCACTT 59.928 36.000 0.00 0.00 0.00 3.16
1860 1867 5.622346 TTTTTCCCTACCATTTGCACTTT 57.378 34.783 0.00 0.00 0.00 2.66
1861 1868 5.622346 TTTTCCCTACCATTTGCACTTTT 57.378 34.783 0.00 0.00 0.00 2.27
1862 1869 4.864704 TTCCCTACCATTTGCACTTTTC 57.135 40.909 0.00 0.00 0.00 2.29
1863 1870 4.112634 TCCCTACCATTTGCACTTTTCT 57.887 40.909 0.00 0.00 0.00 2.52
1864 1871 5.249780 TCCCTACCATTTGCACTTTTCTA 57.750 39.130 0.00 0.00 0.00 2.10
1865 1872 5.253330 TCCCTACCATTTGCACTTTTCTAG 58.747 41.667 0.00 0.00 0.00 2.43
1866 1873 5.013704 TCCCTACCATTTGCACTTTTCTAGA 59.986 40.000 0.00 0.00 0.00 2.43
1867 1874 5.710099 CCCTACCATTTGCACTTTTCTAGAA 59.290 40.000 0.00 0.00 0.00 2.10
1868 1875 6.208599 CCCTACCATTTGCACTTTTCTAGAAA 59.791 38.462 13.99 13.99 0.00 2.52
1869 1876 7.093771 CCCTACCATTTGCACTTTTCTAGAAAT 60.094 37.037 18.37 2.07 0.00 2.17
1870 1877 7.970614 CCTACCATTTGCACTTTTCTAGAAATC 59.029 37.037 18.37 8.96 0.00 2.17
1871 1878 6.381801 ACCATTTGCACTTTTCTAGAAATCG 58.618 36.000 18.37 14.34 0.00 3.34
1872 1879 6.206634 ACCATTTGCACTTTTCTAGAAATCGA 59.793 34.615 18.37 3.47 0.00 3.59
1873 1880 7.094205 ACCATTTGCACTTTTCTAGAAATCGAT 60.094 33.333 18.37 0.00 0.00 3.59
1874 1881 7.756722 CCATTTGCACTTTTCTAGAAATCGATT 59.243 33.333 18.37 4.39 0.00 3.34
1875 1882 8.581263 CATTTGCACTTTTCTAGAAATCGATTG 58.419 33.333 18.37 9.46 0.00 2.67
1876 1883 7.433708 TTGCACTTTTCTAGAAATCGATTGA 57.566 32.000 18.37 1.30 0.00 2.57
1877 1884 7.065216 TGCACTTTTCTAGAAATCGATTGAG 57.935 36.000 18.37 12.81 0.00 3.02
1878 1885 6.873605 TGCACTTTTCTAGAAATCGATTGAGA 59.126 34.615 18.37 11.86 0.00 3.27
1879 1886 7.550551 TGCACTTTTCTAGAAATCGATTGAGAT 59.449 33.333 18.37 0.00 0.00 2.75
1880 1887 9.035607 GCACTTTTCTAGAAATCGATTGAGATA 57.964 33.333 18.37 7.55 0.00 1.98
1911 1918 8.655935 AAAATAATCCCAGTCAATTGAGACTT 57.344 30.769 8.80 0.26 46.26 3.01
1912 1919 9.753674 AAAATAATCCCAGTCAATTGAGACTTA 57.246 29.630 8.80 2.43 46.26 2.24
1913 1920 8.970859 AATAATCCCAGTCAATTGAGACTTAG 57.029 34.615 8.80 0.00 46.26 2.18
1914 1921 4.207891 TCCCAGTCAATTGAGACTTAGC 57.792 45.455 8.80 0.00 46.26 3.09
1915 1922 3.582647 TCCCAGTCAATTGAGACTTAGCA 59.417 43.478 8.80 0.00 46.26 3.49
1916 1923 4.041567 TCCCAGTCAATTGAGACTTAGCAA 59.958 41.667 8.80 0.00 46.26 3.91
1917 1924 4.946157 CCCAGTCAATTGAGACTTAGCAAT 59.054 41.667 8.80 0.00 46.26 3.56
1918 1925 6.070251 TCCCAGTCAATTGAGACTTAGCAATA 60.070 38.462 8.80 0.00 46.26 1.90
1919 1926 6.259608 CCCAGTCAATTGAGACTTAGCAATAG 59.740 42.308 8.80 0.00 46.26 1.73
1920 1927 7.044181 CCAGTCAATTGAGACTTAGCAATAGA 58.956 38.462 8.80 0.00 46.26 1.98
1921 1928 7.224362 CCAGTCAATTGAGACTTAGCAATAGAG 59.776 40.741 8.80 0.00 46.26 2.43
1922 1929 7.763528 CAGTCAATTGAGACTTAGCAATAGAGT 59.236 37.037 8.80 0.00 46.26 3.24
1923 1930 7.763528 AGTCAATTGAGACTTAGCAATAGAGTG 59.236 37.037 8.80 0.00 46.26 3.51
1924 1931 6.536582 TCAATTGAGACTTAGCAATAGAGTGC 59.463 38.462 3.38 0.00 45.28 4.40
1934 1941 4.588805 GCAATAGAGTGCAATTTTTGGC 57.411 40.909 0.00 0.00 44.29 4.52
1935 1942 4.248058 GCAATAGAGTGCAATTTTTGGCT 58.752 39.130 0.00 0.00 44.29 4.75
1936 1943 5.410067 GCAATAGAGTGCAATTTTTGGCTA 58.590 37.500 0.00 0.00 44.29 3.93
1937 1944 5.289434 GCAATAGAGTGCAATTTTTGGCTAC 59.711 40.000 0.00 0.00 44.29 3.58
1938 1945 3.942130 AGAGTGCAATTTTTGGCTACC 57.058 42.857 0.00 0.00 0.00 3.18
1939 1946 2.228822 AGAGTGCAATTTTTGGCTACCG 59.771 45.455 0.00 0.00 0.00 4.02
1940 1947 1.272212 AGTGCAATTTTTGGCTACCGG 59.728 47.619 0.00 0.00 0.00 5.28
1941 1948 0.605589 TGCAATTTTTGGCTACCGGG 59.394 50.000 6.32 0.00 0.00 5.73
1942 1949 0.739462 GCAATTTTTGGCTACCGGGC 60.739 55.000 6.32 0.00 41.27 6.13
1943 1950 0.894835 CAATTTTTGGCTACCGGGCT 59.105 50.000 6.32 0.00 41.48 5.19
1944 1951 1.275010 CAATTTTTGGCTACCGGGCTT 59.725 47.619 6.32 0.00 41.48 4.35
1945 1952 1.182667 ATTTTTGGCTACCGGGCTTC 58.817 50.000 6.32 0.00 41.48 3.86
1946 1953 0.178987 TTTTTGGCTACCGGGCTTCA 60.179 50.000 6.32 0.00 41.48 3.02
1947 1954 0.039035 TTTTGGCTACCGGGCTTCAT 59.961 50.000 6.32 0.00 41.48 2.57
1948 1955 0.679640 TTTGGCTACCGGGCTTCATG 60.680 55.000 6.32 0.00 41.48 3.07
1949 1956 2.203209 GGCTACCGGGCTTCATGG 60.203 66.667 6.32 0.00 37.53 3.66
1950 1957 2.742116 GGCTACCGGGCTTCATGGA 61.742 63.158 6.32 0.00 37.53 3.41
1951 1958 1.223487 GCTACCGGGCTTCATGGAA 59.777 57.895 6.32 0.00 0.00 3.53
1952 1959 0.393808 GCTACCGGGCTTCATGGAAA 60.394 55.000 6.32 0.00 0.00 3.13
1953 1960 1.953311 GCTACCGGGCTTCATGGAAAA 60.953 52.381 6.32 0.00 0.00 2.29
1954 1961 1.743394 CTACCGGGCTTCATGGAAAAC 59.257 52.381 6.32 0.00 0.00 2.43
1955 1962 0.898326 ACCGGGCTTCATGGAAAACC 60.898 55.000 6.32 0.00 0.00 3.27
1956 1963 1.506262 CGGGCTTCATGGAAAACCG 59.494 57.895 0.00 6.61 35.66 4.44
1957 1964 1.241315 CGGGCTTCATGGAAAACCGT 61.241 55.000 10.86 0.00 36.68 4.83
1958 1965 1.828979 GGGCTTCATGGAAAACCGTA 58.171 50.000 0.00 0.00 0.00 4.02
1959 1966 2.375146 GGGCTTCATGGAAAACCGTAT 58.625 47.619 0.00 0.00 0.00 3.06
1960 1967 2.758423 GGGCTTCATGGAAAACCGTATT 59.242 45.455 0.00 0.00 0.00 1.89
1961 1968 3.194755 GGGCTTCATGGAAAACCGTATTT 59.805 43.478 0.00 0.00 0.00 1.40
1962 1969 4.421058 GGCTTCATGGAAAACCGTATTTC 58.579 43.478 0.00 2.47 38.34 2.17
1970 1977 3.581755 GAAAACCGTATTTCCAAAGGGC 58.418 45.455 0.05 0.00 34.03 5.19
1971 1978 2.296073 AACCGTATTTCCAAAGGGCA 57.704 45.000 0.00 0.00 0.00 5.36
1972 1979 2.525105 ACCGTATTTCCAAAGGGCAT 57.475 45.000 0.00 0.00 0.00 4.40
1973 1980 3.655615 ACCGTATTTCCAAAGGGCATA 57.344 42.857 0.00 0.00 0.00 3.14
1974 1981 3.284617 ACCGTATTTCCAAAGGGCATAC 58.715 45.455 0.00 0.00 31.49 2.39
1975 1982 3.053917 ACCGTATTTCCAAAGGGCATACT 60.054 43.478 0.00 0.00 32.13 2.12
1976 1983 3.564225 CCGTATTTCCAAAGGGCATACTC 59.436 47.826 0.00 0.00 32.13 2.59
1977 1984 4.196193 CGTATTTCCAAAGGGCATACTCA 58.804 43.478 0.00 0.00 32.13 3.41
1978 1985 4.638421 CGTATTTCCAAAGGGCATACTCAA 59.362 41.667 0.00 0.00 32.13 3.02
1979 1986 5.299279 CGTATTTCCAAAGGGCATACTCAAT 59.701 40.000 0.00 0.00 32.13 2.57
1980 1987 5.603170 ATTTCCAAAGGGCATACTCAATG 57.397 39.130 0.00 0.00 38.74 2.82
2004 2011 6.064846 CTGAAAGCAATCACACAAAGTAGT 57.935 37.500 0.00 0.00 0.00 2.73
2005 2012 7.189693 CTGAAAGCAATCACACAAAGTAGTA 57.810 36.000 0.00 0.00 0.00 1.82
2006 2013 7.744087 TGAAAGCAATCACACAAAGTAGTAT 57.256 32.000 0.00 0.00 0.00 2.12
2007 2014 7.806690 TGAAAGCAATCACACAAAGTAGTATC 58.193 34.615 0.00 0.00 0.00 2.24
2008 2015 7.661437 TGAAAGCAATCACACAAAGTAGTATCT 59.339 33.333 0.00 0.00 0.00 1.98
2009 2016 6.974932 AGCAATCACACAAAGTAGTATCTG 57.025 37.500 0.00 0.00 0.00 2.90
2010 2017 5.877012 AGCAATCACACAAAGTAGTATCTGG 59.123 40.000 0.00 0.00 0.00 3.86
2011 2018 5.065218 GCAATCACACAAAGTAGTATCTGGG 59.935 44.000 0.00 0.00 0.00 4.45
2012 2019 4.819105 TCACACAAAGTAGTATCTGGGG 57.181 45.455 0.00 0.00 0.00 4.96
2013 2020 4.422057 TCACACAAAGTAGTATCTGGGGA 58.578 43.478 0.00 0.00 0.00 4.81
2014 2021 4.841813 TCACACAAAGTAGTATCTGGGGAA 59.158 41.667 0.00 0.00 0.00 3.97
2015 2022 5.046591 TCACACAAAGTAGTATCTGGGGAAG 60.047 44.000 0.00 0.00 0.00 3.46
2016 2023 4.844655 ACACAAAGTAGTATCTGGGGAAGT 59.155 41.667 0.00 0.00 0.00 3.01
2017 2024 5.178797 CACAAAGTAGTATCTGGGGAAGTG 58.821 45.833 0.00 0.00 0.00 3.16
2018 2025 5.046591 CACAAAGTAGTATCTGGGGAAGTGA 60.047 44.000 0.00 0.00 0.00 3.41
2019 2026 5.546499 ACAAAGTAGTATCTGGGGAAGTGAA 59.454 40.000 0.00 0.00 0.00 3.18
2020 2027 6.215636 ACAAAGTAGTATCTGGGGAAGTGAAT 59.784 38.462 0.00 0.00 0.00 2.57
2021 2028 6.893020 AAGTAGTATCTGGGGAAGTGAATT 57.107 37.500 0.00 0.00 0.00 2.17
2022 2029 6.893020 AGTAGTATCTGGGGAAGTGAATTT 57.107 37.500 0.00 0.00 0.00 1.82
2023 2030 6.890293 AGTAGTATCTGGGGAAGTGAATTTC 58.110 40.000 0.00 0.00 0.00 2.17
2024 2031 5.779241 AGTATCTGGGGAAGTGAATTTCA 57.221 39.130 0.00 0.00 0.00 2.69
2025 2032 6.332976 AGTATCTGGGGAAGTGAATTTCAT 57.667 37.500 1.78 0.00 0.00 2.57
2026 2033 6.125029 AGTATCTGGGGAAGTGAATTTCATG 58.875 40.000 1.78 0.00 0.00 3.07
2027 2034 4.656100 TCTGGGGAAGTGAATTTCATGA 57.344 40.909 1.78 0.00 0.00 3.07
2028 2035 4.335416 TCTGGGGAAGTGAATTTCATGAC 58.665 43.478 1.78 0.00 0.00 3.06
2029 2036 4.081406 CTGGGGAAGTGAATTTCATGACA 58.919 43.478 1.78 0.00 0.00 3.58
2030 2037 4.081406 TGGGGAAGTGAATTTCATGACAG 58.919 43.478 1.78 0.00 0.00 3.51
2031 2038 4.202556 TGGGGAAGTGAATTTCATGACAGA 60.203 41.667 1.78 0.00 0.00 3.41
2032 2039 4.952335 GGGGAAGTGAATTTCATGACAGAT 59.048 41.667 1.78 0.00 0.00 2.90
2033 2040 5.420104 GGGGAAGTGAATTTCATGACAGATT 59.580 40.000 1.78 0.00 0.00 2.40
2034 2041 6.071165 GGGGAAGTGAATTTCATGACAGATTT 60.071 38.462 1.78 0.00 0.00 2.17
2035 2042 7.122650 GGGGAAGTGAATTTCATGACAGATTTA 59.877 37.037 1.78 0.00 0.00 1.40
2036 2043 7.970614 GGGAAGTGAATTTCATGACAGATTTAC 59.029 37.037 1.78 3.95 0.00 2.01
2037 2044 7.970614 GGAAGTGAATTTCATGACAGATTTACC 59.029 37.037 1.78 0.00 0.00 2.85
2038 2045 7.396540 AGTGAATTTCATGACAGATTTACCC 57.603 36.000 1.78 0.00 0.00 3.69
2039 2046 7.177878 AGTGAATTTCATGACAGATTTACCCT 58.822 34.615 1.78 0.00 0.00 4.34
2040 2047 7.671398 AGTGAATTTCATGACAGATTTACCCTT 59.329 33.333 1.78 0.00 0.00 3.95
2041 2048 7.756722 GTGAATTTCATGACAGATTTACCCTTG 59.243 37.037 1.78 0.00 0.00 3.61
2042 2049 5.643379 TTTCATGACAGATTTACCCTTGC 57.357 39.130 0.00 0.00 0.00 4.01
2043 2050 4.299586 TCATGACAGATTTACCCTTGCA 57.700 40.909 0.00 0.00 0.00 4.08
2044 2051 4.858850 TCATGACAGATTTACCCTTGCAT 58.141 39.130 0.00 0.00 0.00 3.96
2045 2052 6.000246 TCATGACAGATTTACCCTTGCATA 58.000 37.500 0.00 0.00 0.00 3.14
2046 2053 6.422333 TCATGACAGATTTACCCTTGCATAA 58.578 36.000 0.00 0.00 0.00 1.90
2047 2054 7.062322 TCATGACAGATTTACCCTTGCATAAT 58.938 34.615 0.00 0.00 0.00 1.28
2048 2055 8.217111 TCATGACAGATTTACCCTTGCATAATA 58.783 33.333 0.00 0.00 0.00 0.98
2049 2056 8.849168 CATGACAGATTTACCCTTGCATAATAA 58.151 33.333 0.00 0.00 0.00 1.40
2050 2057 8.995027 TGACAGATTTACCCTTGCATAATAAT 57.005 30.769 0.00 0.00 0.00 1.28
2051 2058 9.420118 TGACAGATTTACCCTTGCATAATAATT 57.580 29.630 0.00 0.00 0.00 1.40
2052 2059 9.899226 GACAGATTTACCCTTGCATAATAATTC 57.101 33.333 0.00 0.00 0.00 2.17
2053 2060 9.646522 ACAGATTTACCCTTGCATAATAATTCT 57.353 29.630 0.00 0.00 0.00 2.40
2054 2061 9.903682 CAGATTTACCCTTGCATAATAATTCTG 57.096 33.333 12.78 12.78 31.90 3.02
2055 2062 8.579863 AGATTTACCCTTGCATAATAATTCTGC 58.420 33.333 0.00 0.00 36.45 4.26
2056 2063 7.652524 TTTACCCTTGCATAATAATTCTGCA 57.347 32.000 1.56 1.56 43.69 4.41
2063 2070 4.279169 TGCATAATAATTCTGCAAGGAGGC 59.721 41.667 3.13 0.00 42.53 4.70
2064 2071 4.522022 GCATAATAATTCTGCAAGGAGGCT 59.478 41.667 0.00 0.00 35.96 4.58
2065 2072 5.335504 GCATAATAATTCTGCAAGGAGGCTC 60.336 44.000 5.78 5.78 35.96 4.70
2066 2073 2.315925 TAATTCTGCAAGGAGGCTCG 57.684 50.000 8.69 0.00 34.04 5.03
2067 2074 0.326264 AATTCTGCAAGGAGGCTCGT 59.674 50.000 8.69 6.08 34.04 4.18
2068 2075 0.326264 ATTCTGCAAGGAGGCTCGTT 59.674 50.000 16.22 16.22 34.04 3.85
2069 2076 0.320771 TTCTGCAAGGAGGCTCGTTC 60.321 55.000 18.82 13.87 34.04 3.95
2070 2077 1.004560 CTGCAAGGAGGCTCGTTCA 60.005 57.895 18.82 17.01 34.04 3.18
2071 2078 0.603707 CTGCAAGGAGGCTCGTTCAA 60.604 55.000 18.82 9.63 34.04 2.69
2072 2079 0.179032 TGCAAGGAGGCTCGTTCAAA 60.179 50.000 18.82 5.69 34.04 2.69
2073 2080 0.238553 GCAAGGAGGCTCGTTCAAAC 59.761 55.000 18.82 6.31 0.00 2.93
2074 2081 0.875059 CAAGGAGGCTCGTTCAAACC 59.125 55.000 18.82 0.00 0.00 3.27
2075 2082 0.472471 AAGGAGGCTCGTTCAAACCA 59.528 50.000 16.22 0.00 0.00 3.67
2076 2083 0.035458 AGGAGGCTCGTTCAAACCAG 59.965 55.000 8.69 0.00 0.00 4.00
2077 2084 0.955919 GGAGGCTCGTTCAAACCAGG 60.956 60.000 8.69 0.00 0.00 4.45
2078 2085 0.034896 GAGGCTCGTTCAAACCAGGA 59.965 55.000 0.00 0.00 0.00 3.86
2079 2086 0.693049 AGGCTCGTTCAAACCAGGAT 59.307 50.000 0.00 0.00 0.00 3.24
2080 2087 1.073923 AGGCTCGTTCAAACCAGGATT 59.926 47.619 0.00 0.00 0.00 3.01
2081 2088 1.886542 GGCTCGTTCAAACCAGGATTT 59.113 47.619 0.00 0.00 0.00 2.17
2082 2089 2.351738 GGCTCGTTCAAACCAGGATTTG 60.352 50.000 0.00 0.64 40.32 2.32
2083 2090 2.552315 GCTCGTTCAAACCAGGATTTGA 59.448 45.455 11.20 11.20 44.80 2.69
2089 2096 3.496331 TCAAACCAGGATTTGAAGGTCC 58.504 45.455 12.31 0.00 43.81 4.46
2090 2097 2.562738 CAAACCAGGATTTGAAGGTCCC 59.437 50.000 0.00 0.00 41.28 4.46
2091 2098 1.455822 ACCAGGATTTGAAGGTCCCA 58.544 50.000 0.00 0.00 35.00 4.37
2092 2099 1.786441 ACCAGGATTTGAAGGTCCCAA 59.214 47.619 0.00 0.00 35.00 4.12
2093 2100 2.383338 ACCAGGATTTGAAGGTCCCAAT 59.617 45.455 0.00 0.00 35.00 3.16
2094 2101 3.181407 ACCAGGATTTGAAGGTCCCAATT 60.181 43.478 0.00 0.00 35.00 2.32
2095 2102 3.196254 CCAGGATTTGAAGGTCCCAATTG 59.804 47.826 0.00 0.00 35.00 2.32
2096 2103 3.196254 CAGGATTTGAAGGTCCCAATTGG 59.804 47.826 18.21 18.21 35.00 3.16
2097 2104 3.077391 AGGATTTGAAGGTCCCAATTGGA 59.923 43.478 26.60 9.22 42.41 3.53
2098 2105 3.448660 GGATTTGAAGGTCCCAATTGGAG 59.551 47.826 26.60 15.53 46.38 3.86
2099 2106 2.603075 TTGAAGGTCCCAATTGGAGG 57.397 50.000 26.60 10.26 46.38 4.30
2100 2107 0.704076 TGAAGGTCCCAATTGGAGGG 59.296 55.000 26.60 9.67 46.38 4.30
2113 2120 2.940514 TGGAGGGACTACCAATCTGA 57.059 50.000 0.00 0.00 39.75 3.27
2114 2121 2.467880 TGGAGGGACTACCAATCTGAC 58.532 52.381 0.00 0.00 39.75 3.51
2115 2122 2.225522 TGGAGGGACTACCAATCTGACA 60.226 50.000 0.00 0.00 39.75 3.58
2116 2123 2.432510 GGAGGGACTACCAATCTGACAG 59.567 54.545 0.00 0.00 41.55 3.51
2117 2124 2.432510 GAGGGACTACCAATCTGACAGG 59.567 54.545 1.81 0.00 41.55 4.00
2118 2125 1.134371 GGGACTACCAATCTGACAGGC 60.134 57.143 1.81 0.00 39.85 4.85
2119 2126 1.134371 GGACTACCAATCTGACAGGCC 60.134 57.143 1.81 0.00 35.97 5.19
2120 2127 0.912486 ACTACCAATCTGACAGGCCC 59.088 55.000 0.00 0.00 0.00 5.80
2121 2128 0.179073 CTACCAATCTGACAGGCCCG 60.179 60.000 0.00 0.00 0.00 6.13
2122 2129 2.252072 TACCAATCTGACAGGCCCGC 62.252 60.000 0.00 0.00 0.00 6.13
2123 2130 2.825836 CAATCTGACAGGCCCGCC 60.826 66.667 0.00 0.00 0.00 6.13
2124 2131 3.329889 AATCTGACAGGCCCGCCA 61.330 61.111 8.74 0.00 38.92 5.69
2125 2132 2.683465 AATCTGACAGGCCCGCCAT 61.683 57.895 8.74 0.00 38.92 4.40
2126 2133 2.615227 AATCTGACAGGCCCGCCATC 62.615 60.000 8.74 5.81 38.92 3.51
2127 2134 3.790437 CTGACAGGCCCGCCATCT 61.790 66.667 8.74 0.00 38.92 2.90
2128 2135 4.100084 TGACAGGCCCGCCATCTG 62.100 66.667 8.74 0.00 38.92 2.90
2129 2136 3.785859 GACAGGCCCGCCATCTGA 61.786 66.667 8.74 0.00 38.92 3.27
2130 2137 3.329542 GACAGGCCCGCCATCTGAA 62.330 63.158 8.74 0.00 38.92 3.02
2131 2138 2.045045 CAGGCCCGCCATCTGAAA 60.045 61.111 8.74 0.00 38.92 2.69
2132 2139 1.678635 CAGGCCCGCCATCTGAAAA 60.679 57.895 8.74 0.00 38.92 2.29
2133 2140 1.039233 CAGGCCCGCCATCTGAAAAT 61.039 55.000 8.74 0.00 38.92 1.82
2134 2141 0.324645 AGGCCCGCCATCTGAAAATT 60.325 50.000 8.74 0.00 38.92 1.82
2135 2142 0.179103 GGCCCGCCATCTGAAAATTG 60.179 55.000 0.00 0.00 35.81 2.32
2136 2143 0.532115 GCCCGCCATCTGAAAATTGT 59.468 50.000 0.00 0.00 0.00 2.71
2137 2144 1.748493 GCCCGCCATCTGAAAATTGTA 59.252 47.619 0.00 0.00 0.00 2.41
2138 2145 2.362077 GCCCGCCATCTGAAAATTGTAT 59.638 45.455 0.00 0.00 0.00 2.29
2139 2146 3.181476 GCCCGCCATCTGAAAATTGTATT 60.181 43.478 0.00 0.00 0.00 1.89
2140 2147 4.680440 GCCCGCCATCTGAAAATTGTATTT 60.680 41.667 0.00 0.00 0.00 1.40
2141 2148 5.043248 CCCGCCATCTGAAAATTGTATTTC 58.957 41.667 0.00 0.00 39.28 2.17
2142 2149 5.394005 CCCGCCATCTGAAAATTGTATTTCA 60.394 40.000 2.85 2.85 44.68 2.69
2143 2150 6.098679 CCGCCATCTGAAAATTGTATTTCAA 58.901 36.000 4.29 0.00 45.75 2.69
2144 2151 6.589523 CCGCCATCTGAAAATTGTATTTCAAA 59.410 34.615 4.29 0.00 45.75 2.69
2145 2152 7.201461 CCGCCATCTGAAAATTGTATTTCAAAG 60.201 37.037 4.29 0.00 45.75 2.77
2146 2153 7.329226 CGCCATCTGAAAATTGTATTTCAAAGT 59.671 33.333 4.29 0.00 45.75 2.66
2147 2154 8.992073 GCCATCTGAAAATTGTATTTCAAAGTT 58.008 29.630 4.29 0.00 45.75 2.66
2184 2191 9.485206 AACAGTTATGTGAAAACTTATACGTCT 57.515 29.630 0.00 0.00 40.39 4.18
2185 2192 9.485206 ACAGTTATGTGAAAACTTATACGTCTT 57.515 29.630 0.00 0.00 38.57 3.01
2186 2193 9.953825 CAGTTATGTGAAAACTTATACGTCTTC 57.046 33.333 0.00 0.00 34.99 2.87
2187 2194 9.701098 AGTTATGTGAAAACTTATACGTCTTCA 57.299 29.630 0.00 0.00 33.39 3.02
2188 2195 9.737025 GTTATGTGAAAACTTATACGTCTTCAC 57.263 33.333 17.35 17.35 41.80 3.18
2189 2196 9.701098 TTATGTGAAAACTTATACGTCTTCACT 57.299 29.630 22.03 13.67 41.91 3.41
2191 2198 8.511465 TGTGAAAACTTATACGTCTTCACTAC 57.489 34.615 22.03 4.60 41.91 2.73
2192 2199 8.136800 TGTGAAAACTTATACGTCTTCACTACA 58.863 33.333 22.03 6.61 41.91 2.74
2193 2200 8.971321 GTGAAAACTTATACGTCTTCACTACAA 58.029 33.333 17.06 0.00 39.54 2.41
2194 2201 9.531942 TGAAAACTTATACGTCTTCACTACAAA 57.468 29.630 0.00 0.00 0.00 2.83
2197 2204 9.701098 AAACTTATACGTCTTCACTACAAATCA 57.299 29.630 0.00 0.00 0.00 2.57
2198 2205 9.701098 AACTTATACGTCTTCACTACAAATCAA 57.299 29.630 0.00 0.00 0.00 2.57
2199 2206 9.871238 ACTTATACGTCTTCACTACAAATCAAT 57.129 29.630 0.00 0.00 0.00 2.57
2237 2244 9.935241 TTAAAAATATAACCATTTGAAGCTGCA 57.065 25.926 1.02 0.00 0.00 4.41
2238 2245 8.845413 AAAAATATAACCATTTGAAGCTGCAA 57.155 26.923 1.85 1.85 0.00 4.08
2239 2246 8.845413 AAAATATAACCATTTGAAGCTGCAAA 57.155 26.923 22.17 22.17 41.49 3.68
2240 2247 8.845413 AAATATAACCATTTGAAGCTGCAAAA 57.155 26.923 23.63 7.45 40.72 2.44
2241 2248 9.452287 AAATATAACCATTTGAAGCTGCAAAAT 57.548 25.926 23.63 14.14 40.72 1.82
2244 2251 8.845413 ATAACCATTTGAAGCTGCAAAATAAA 57.155 26.923 23.63 9.13 40.72 1.40
2245 2252 7.565323 AACCATTTGAAGCTGCAAAATAAAA 57.435 28.000 23.63 0.00 40.72 1.52
2246 2253 7.565323 ACCATTTGAAGCTGCAAAATAAAAA 57.435 28.000 23.63 0.00 40.72 1.94
2262 2269 2.816777 AAAAAGGGCCCAAAAGCAAA 57.183 40.000 27.56 0.00 0.00 3.68
2263 2270 2.816777 AAAAGGGCCCAAAAGCAAAA 57.183 40.000 27.56 0.00 0.00 2.44
2264 2271 2.816777 AAAGGGCCCAAAAGCAAAAA 57.183 40.000 27.56 0.00 0.00 1.94
2311 2318 8.865590 ACAAATTTGTATTTTCTGTGTACACC 57.134 30.769 22.10 5.67 40.16 4.16
2312 2319 8.470805 ACAAATTTGTATTTTCTGTGTACACCA 58.529 29.630 22.10 8.26 40.16 4.17
2313 2320 8.751335 CAAATTTGTATTTTCTGTGTACACCAC 58.249 33.333 22.91 9.60 36.92 4.16
2314 2321 7.646130 AAATTTGTATTTTCTGTGTACACCACG 59.354 33.333 22.91 11.47 37.50 4.94
2326 2333 6.956299 GTGTACACCACGTATGAAAGTATT 57.044 37.500 15.42 0.00 33.61 1.89
2327 2334 7.355332 GTGTACACCACGTATGAAAGTATTT 57.645 36.000 15.42 0.00 35.92 1.40
2328 2335 7.799784 GTGTACACCACGTATGAAAGTATTTT 58.200 34.615 15.42 0.00 34.06 1.82
2329 2336 8.284693 GTGTACACCACGTATGAAAGTATTTTT 58.715 33.333 15.42 0.00 34.06 1.94
2355 2362 4.600012 GCGTGTGCACTTATGAAAGTAT 57.400 40.909 19.41 0.00 44.28 2.12
2356 2363 5.712217 GCGTGTGCACTTATGAAAGTATA 57.288 39.130 19.41 0.00 44.28 1.47
2357 2364 6.287107 GCGTGTGCACTTATGAAAGTATAT 57.713 37.500 19.41 0.00 44.28 0.86
2358 2365 6.715464 GCGTGTGCACTTATGAAAGTATATT 58.285 36.000 19.41 0.00 44.28 1.28
2359 2366 6.628856 GCGTGTGCACTTATGAAAGTATATTG 59.371 38.462 19.41 0.00 44.28 1.90
2360 2367 7.676338 GCGTGTGCACTTATGAAAGTATATTGT 60.676 37.037 19.41 0.00 44.28 2.71
2361 2368 8.175069 CGTGTGCACTTATGAAAGTATATTGTT 58.825 33.333 19.41 0.00 44.28 2.83
2364 2371 9.632969 GTGCACTTATGAAAGTATATTGTTACG 57.367 33.333 10.32 0.00 44.28 3.18
2365 2372 9.589111 TGCACTTATGAAAGTATATTGTTACGA 57.411 29.630 0.00 0.00 44.28 3.43
2402 2409 8.273780 TGCATTGTATACATGTATTGAACACA 57.726 30.769 22.90 16.99 42.09 3.72
2403 2410 8.901793 TGCATTGTATACATGTATTGAACACAT 58.098 29.630 22.90 13.44 42.09 3.21
2404 2411 9.734620 GCATTGTATACATGTATTGAACACATT 57.265 29.630 22.90 13.50 42.09 2.71
2442 2449 7.620880 TGGGATGTAGAAATACAGTATATGGC 58.379 38.462 0.00 0.00 32.97 4.40
2443 2450 7.048512 GGGATGTAGAAATACAGTATATGGCC 58.951 42.308 0.00 0.00 32.97 5.36
2444 2451 7.092846 GGGATGTAGAAATACAGTATATGGCCT 60.093 40.741 3.32 0.00 32.97 5.19
2445 2452 7.982354 GGATGTAGAAATACAGTATATGGCCTC 59.018 40.741 3.32 0.00 32.97 4.70
2446 2453 6.920817 TGTAGAAATACAGTATATGGCCTCG 58.079 40.000 3.32 0.00 0.00 4.63
2447 2454 4.822026 AGAAATACAGTATATGGCCTCGC 58.178 43.478 3.32 0.00 0.00 5.03
2448 2455 4.528596 AGAAATACAGTATATGGCCTCGCT 59.471 41.667 3.32 0.00 0.00 4.93
2449 2456 5.715279 AGAAATACAGTATATGGCCTCGCTA 59.285 40.000 3.32 0.00 0.00 4.26
2450 2457 5.584253 AATACAGTATATGGCCTCGCTAG 57.416 43.478 3.32 0.00 0.00 3.42
2451 2458 2.877866 ACAGTATATGGCCTCGCTAGT 58.122 47.619 3.32 0.00 0.00 2.57
2452 2459 3.231818 ACAGTATATGGCCTCGCTAGTT 58.768 45.455 3.32 0.00 0.00 2.24
2453 2460 3.256136 ACAGTATATGGCCTCGCTAGTTC 59.744 47.826 3.32 0.00 0.00 3.01
2454 2461 2.826725 AGTATATGGCCTCGCTAGTTCC 59.173 50.000 3.32 0.00 0.00 3.62
2455 2462 0.977395 ATATGGCCTCGCTAGTTCCC 59.023 55.000 3.32 0.00 0.00 3.97
2456 2463 0.105658 TATGGCCTCGCTAGTTCCCT 60.106 55.000 3.32 0.00 0.00 4.20
2457 2464 0.983378 ATGGCCTCGCTAGTTCCCTT 60.983 55.000 3.32 0.00 0.00 3.95
2458 2465 1.144276 GGCCTCGCTAGTTCCCTTC 59.856 63.158 0.00 0.00 0.00 3.46
2459 2466 1.614241 GGCCTCGCTAGTTCCCTTCA 61.614 60.000 0.00 0.00 0.00 3.02
2460 2467 0.460459 GCCTCGCTAGTTCCCTTCAC 60.460 60.000 0.00 0.00 0.00 3.18
2461 2468 1.187087 CCTCGCTAGTTCCCTTCACT 58.813 55.000 0.00 0.00 0.00 3.41
2462 2469 1.135333 CCTCGCTAGTTCCCTTCACTC 59.865 57.143 0.00 0.00 0.00 3.51
2463 2470 1.135333 CTCGCTAGTTCCCTTCACTCC 59.865 57.143 0.00 0.00 0.00 3.85
2464 2471 1.187087 CGCTAGTTCCCTTCACTCCT 58.813 55.000 0.00 0.00 0.00 3.69
2465 2472 1.134965 CGCTAGTTCCCTTCACTCCTG 60.135 57.143 0.00 0.00 0.00 3.86
2466 2473 1.903183 GCTAGTTCCCTTCACTCCTGT 59.097 52.381 0.00 0.00 0.00 4.00
2467 2474 2.093921 GCTAGTTCCCTTCACTCCTGTC 60.094 54.545 0.00 0.00 0.00 3.51
2468 2475 1.353091 AGTTCCCTTCACTCCTGTCC 58.647 55.000 0.00 0.00 0.00 4.02
2469 2476 1.132689 AGTTCCCTTCACTCCTGTCCT 60.133 52.381 0.00 0.00 0.00 3.85
2470 2477 1.276705 GTTCCCTTCACTCCTGTCCTC 59.723 57.143 0.00 0.00 0.00 3.71
2471 2478 0.787084 TCCCTTCACTCCTGTCCTCT 59.213 55.000 0.00 0.00 0.00 3.69
2472 2479 2.000803 TCCCTTCACTCCTGTCCTCTA 58.999 52.381 0.00 0.00 0.00 2.43
2473 2480 2.104170 CCCTTCACTCCTGTCCTCTAC 58.896 57.143 0.00 0.00 0.00 2.59
2474 2481 1.746220 CCTTCACTCCTGTCCTCTACG 59.254 57.143 0.00 0.00 0.00 3.51
2475 2482 1.133407 CTTCACTCCTGTCCTCTACGC 59.867 57.143 0.00 0.00 0.00 4.42
2476 2483 0.037734 TCACTCCTGTCCTCTACGCA 59.962 55.000 0.00 0.00 0.00 5.24
2477 2484 0.171455 CACTCCTGTCCTCTACGCAC 59.829 60.000 0.00 0.00 0.00 5.34
2478 2485 0.251209 ACTCCTGTCCTCTACGCACA 60.251 55.000 0.00 0.00 0.00 4.57
2479 2486 1.107114 CTCCTGTCCTCTACGCACAT 58.893 55.000 0.00 0.00 0.00 3.21
2480 2487 1.478510 CTCCTGTCCTCTACGCACATT 59.521 52.381 0.00 0.00 0.00 2.71
2481 2488 1.899814 TCCTGTCCTCTACGCACATTT 59.100 47.619 0.00 0.00 0.00 2.32
2482 2489 2.002586 CCTGTCCTCTACGCACATTTG 58.997 52.381 0.00 0.00 0.00 2.32
2483 2490 2.353704 CCTGTCCTCTACGCACATTTGA 60.354 50.000 0.00 0.00 0.00 2.69
2484 2491 3.325870 CTGTCCTCTACGCACATTTGAA 58.674 45.455 0.00 0.00 0.00 2.69
2485 2492 3.935203 CTGTCCTCTACGCACATTTGAAT 59.065 43.478 0.00 0.00 0.00 2.57
2486 2493 3.684305 TGTCCTCTACGCACATTTGAATG 59.316 43.478 2.29 2.29 42.10 2.67
2487 2494 2.677836 TCCTCTACGCACATTTGAATGC 59.322 45.455 3.71 0.00 40.04 3.56
2488 2495 2.679837 CCTCTACGCACATTTGAATGCT 59.320 45.455 3.71 0.00 40.04 3.79
2489 2496 3.242543 CCTCTACGCACATTTGAATGCTC 60.243 47.826 3.71 0.00 40.04 4.26
2490 2497 3.333804 TCTACGCACATTTGAATGCTCA 58.666 40.909 3.71 0.00 40.04 4.26
2491 2498 3.940852 TCTACGCACATTTGAATGCTCAT 59.059 39.130 3.71 0.00 40.04 2.90
2492 2499 3.581024 ACGCACATTTGAATGCTCATT 57.419 38.095 3.71 0.00 40.04 2.57
2493 2500 3.504863 ACGCACATTTGAATGCTCATTC 58.495 40.909 13.99 13.99 45.55 2.67
2501 2508 2.986842 GAATGCTCATTCGTGACTCG 57.013 50.000 6.82 0.00 37.97 4.18
2512 2519 2.466846 TCGTGACTCGACTTTTCAACC 58.533 47.619 0.00 0.00 44.01 3.77
2513 2520 2.100252 TCGTGACTCGACTTTTCAACCT 59.900 45.455 0.00 0.00 44.01 3.50
2525 2532 0.843309 TTCAACCTCAGGACCAGCAA 59.157 50.000 0.00 0.00 0.00 3.91
2527 2534 0.397941 CAACCTCAGGACCAGCAAGA 59.602 55.000 0.00 0.00 0.00 3.02
2528 2535 0.689623 AACCTCAGGACCAGCAAGAG 59.310 55.000 0.00 0.00 0.00 2.85
2529 2536 1.078567 CCTCAGGACCAGCAAGAGC 60.079 63.158 0.00 0.00 42.56 4.09
2530 2537 1.675801 CTCAGGACCAGCAAGAGCA 59.324 57.895 0.00 0.00 45.49 4.26
2531 2538 0.035881 CTCAGGACCAGCAAGAGCAA 59.964 55.000 0.00 0.00 45.49 3.91
2532 2539 0.250467 TCAGGACCAGCAAGAGCAAC 60.250 55.000 0.00 0.00 45.49 4.17
2533 2540 0.535780 CAGGACCAGCAAGAGCAACA 60.536 55.000 0.00 0.00 45.49 3.33
2534 2541 0.536006 AGGACCAGCAAGAGCAACAC 60.536 55.000 0.00 0.00 45.49 3.32
2535 2542 1.518903 GGACCAGCAAGAGCAACACC 61.519 60.000 0.00 0.00 45.49 4.16
2536 2543 0.819259 GACCAGCAAGAGCAACACCA 60.819 55.000 0.00 0.00 45.49 4.17
2537 2544 0.395586 ACCAGCAAGAGCAACACCAA 60.396 50.000 0.00 0.00 45.49 3.67
2538 2545 0.963962 CCAGCAAGAGCAACACCAAT 59.036 50.000 0.00 0.00 45.49 3.16
2539 2546 2.161855 CCAGCAAGAGCAACACCAATA 58.838 47.619 0.00 0.00 45.49 1.90
2540 2547 2.756760 CCAGCAAGAGCAACACCAATAT 59.243 45.455 0.00 0.00 45.49 1.28
2541 2548 3.194116 CCAGCAAGAGCAACACCAATATT 59.806 43.478 0.00 0.00 45.49 1.28
2549 2556 2.564947 GCAACACCAATATTGTTCCCCA 59.435 45.455 14.25 0.00 34.91 4.96
2552 2559 3.287222 ACACCAATATTGTTCCCCATCG 58.713 45.455 14.25 0.00 0.00 3.84
2555 2562 2.884639 CCAATATTGTTCCCCATCGACC 59.115 50.000 14.25 0.00 0.00 4.79
2556 2563 2.884639 CAATATTGTTCCCCATCGACCC 59.115 50.000 7.32 0.00 0.00 4.46
2559 2566 1.419720 TTGTTCCCCATCGACCCACA 61.420 55.000 0.00 0.00 0.00 4.17
2562 2569 1.966901 TTCCCCATCGACCCACATCG 61.967 60.000 0.00 0.00 43.63 3.84
2576 2583 2.515926 ACATCGATGTGGATTCCTCG 57.484 50.000 29.49 5.42 40.03 4.63
2577 2584 1.069204 ACATCGATGTGGATTCCTCGG 59.931 52.381 29.49 0.00 40.03 4.63
2583 2590 0.834261 TGTGGATTCCTCGGTGGTGA 60.834 55.000 3.95 0.00 37.07 4.02
2586 2593 0.108138 GGATTCCTCGGTGGTGACTG 60.108 60.000 0.00 0.00 37.07 3.51
2587 2594 0.895530 GATTCCTCGGTGGTGACTGA 59.104 55.000 0.00 0.00 36.03 3.41
2588 2595 1.482593 GATTCCTCGGTGGTGACTGAT 59.517 52.381 0.00 0.00 36.85 2.90
2590 2597 0.541998 TCCTCGGTGGTGACTGATGT 60.542 55.000 0.00 0.00 36.85 3.06
2654 2661 0.526211 TCGTCGTCATGGGTGAAGAG 59.474 55.000 0.00 0.00 42.25 2.85
2691 2698 2.093106 CTAGTCCAGACGGCTACAAGT 58.907 52.381 0.00 0.00 36.20 3.16
2720 2727 3.372660 GTCTCCCCAGACGATAATGTC 57.627 52.381 0.00 0.00 39.91 3.06
2745 2752 4.683832 CACCGTTGGAAAAATTTGGTGTA 58.316 39.130 11.55 0.00 40.31 2.90
2750 2757 5.235186 CGTTGGAAAAATTTGGTGTAATGCA 59.765 36.000 0.00 0.00 0.00 3.96
2754 2761 5.180868 GGAAAAATTTGGTGTAATGCATGCA 59.819 36.000 25.04 25.04 0.00 3.96
2755 2765 5.866335 AAAATTTGGTGTAATGCATGCAG 57.134 34.783 26.69 0.00 0.00 4.41
2795 2811 1.197721 CGGCTTAAGAGGTTGTGCTTG 59.802 52.381 6.67 0.00 0.00 4.01
2803 2819 0.535102 AGGTTGTGCTTGTCCTTCGG 60.535 55.000 0.00 0.00 0.00 4.30
2825 2841 2.280797 TTCAAGCTTCTGCGGCGT 60.281 55.556 9.37 0.00 45.42 5.68
2840 2856 1.516603 GCGTAGGTTCGAGCACCTC 60.517 63.158 12.10 4.33 44.63 3.85
2851 2867 4.101448 GCACCTCCCGCCAGTGAT 62.101 66.667 0.00 0.00 33.21 3.06
2852 2868 2.671070 CACCTCCCGCCAGTGATT 59.329 61.111 0.00 0.00 33.21 2.57
2853 2869 1.746615 CACCTCCCGCCAGTGATTG 60.747 63.158 0.00 0.00 33.21 2.67
2855 2871 1.274703 ACCTCCCGCCAGTGATTGAT 61.275 55.000 0.00 0.00 0.00 2.57
2857 2873 0.107508 CTCCCGCCAGTGATTGATGT 60.108 55.000 0.00 0.00 0.00 3.06
2858 2874 0.392863 TCCCGCCAGTGATTGATGTG 60.393 55.000 0.00 0.00 0.00 3.21
2879 2895 1.244697 ATGCCGAGACTCGTGAGTGT 61.245 55.000 22.61 2.85 42.66 3.55
2886 2902 2.131294 GACTCGTGAGTGTCGTGGCT 62.131 60.000 7.35 0.00 43.52 4.75
2897 2913 3.006967 AGTGTCGTGGCTTACTCTTCAAT 59.993 43.478 0.00 0.00 0.00 2.57
2900 2916 2.301870 TCGTGGCTTACTCTTCAATGGT 59.698 45.455 0.00 0.00 0.00 3.55
2903 2919 3.821033 GTGGCTTACTCTTCAATGGTGTT 59.179 43.478 0.00 0.00 0.00 3.32
2912 2928 5.587043 ACTCTTCAATGGTGTTTACAACGAA 59.413 36.000 0.00 0.00 36.03 3.85
2924 2940 4.884668 TTACAACGAAAGGACAGAGGAT 57.115 40.909 0.00 0.00 0.00 3.24
2954 2970 3.458857 AGGCACTCTTCCAGATGATGAAT 59.541 43.478 0.00 0.00 0.00 2.57
2957 2973 5.064558 GCACTCTTCCAGATGATGAATGAT 58.935 41.667 0.00 0.00 28.74 2.45
3011 3027 3.000819 ATCCCCGTCGTCCTTGCA 61.001 61.111 0.00 0.00 0.00 4.08
3029 3045 2.242926 GCAAGCCCTTTCTTCTTCCTT 58.757 47.619 0.00 0.00 0.00 3.36
3039 3055 4.431416 TTCTTCTTCCTTGCCAACTACA 57.569 40.909 0.00 0.00 0.00 2.74
3044 3060 4.101114 TCTTCCTTGCCAACTACATCCTA 58.899 43.478 0.00 0.00 0.00 2.94
3047 3063 4.616553 TCCTTGCCAACTACATCCTACTA 58.383 43.478 0.00 0.00 0.00 1.82
3060 3076 1.148446 TCCTACTACCTGTGGTGGTGT 59.852 52.381 14.59 6.57 46.61 4.16
3061 3077 1.549170 CCTACTACCTGTGGTGGTGTC 59.451 57.143 14.59 0.00 46.61 3.67
3068 3084 4.699522 GTGGTGGTGTCCGGCCTC 62.700 72.222 0.00 0.00 0.00 4.70
3081 3097 1.225426 GGCCTCTGCATCATGACCA 59.775 57.895 0.00 0.00 40.13 4.02
3091 3107 3.244457 TGCATCATGACCATCATCCTCTC 60.244 47.826 0.00 0.00 34.28 3.20
3093 3109 4.222366 GCATCATGACCATCATCCTCTCTA 59.778 45.833 0.00 0.00 34.28 2.43
3102 3118 2.470990 TCATCCTCTCTAGCTTTGGCA 58.529 47.619 0.00 0.00 41.70 4.92
3104 3120 3.457380 TCATCCTCTCTAGCTTTGGCAAT 59.543 43.478 0.00 0.00 41.70 3.56
3106 3122 2.573462 TCCTCTCTAGCTTTGGCAATGT 59.427 45.455 13.79 4.70 41.70 2.71
3108 3124 2.086869 TCTCTAGCTTTGGCAATGTGC 58.913 47.619 13.79 12.25 44.08 4.57
3109 3125 2.089980 CTCTAGCTTTGGCAATGTGCT 58.910 47.619 20.66 20.66 44.28 4.40
3120 3136 3.515330 GCAATGTGCTCTTTGCCTTAT 57.485 42.857 22.06 0.00 43.95 1.73
3122 3138 3.129988 GCAATGTGCTCTTTGCCTTATCT 59.870 43.478 22.06 0.00 43.95 1.98
3132 3148 3.777106 TTGCCTTATCTAGCATCAGGG 57.223 47.619 0.00 0.00 39.11 4.45
3137 3153 2.238084 TATCTAGCATCAGGGCGGAT 57.762 50.000 0.00 0.00 39.27 4.18
3143 3159 1.212935 AGCATCAGGGCGGATAACTTT 59.787 47.619 0.00 0.00 39.27 2.66
3153 3169 1.867233 CGGATAACTTTGCCATCTCGG 59.133 52.381 0.00 0.00 38.11 4.63
3162 3178 3.083349 CCATCTCGGCTGGGGTCA 61.083 66.667 0.00 0.00 0.00 4.02
3164 3180 1.528824 CATCTCGGCTGGGGTCATT 59.471 57.895 0.00 0.00 0.00 2.57
3185 3201 2.550830 ACACCACCATGTGTCTTCTC 57.449 50.000 0.00 0.00 46.15 2.87
3186 3202 1.768275 ACACCACCATGTGTCTTCTCA 59.232 47.619 0.00 0.00 46.15 3.27
3189 3205 2.274437 CCACCATGTGTCTTCTCATCG 58.726 52.381 0.00 0.00 0.00 3.84
3195 3211 0.820871 GTGTCTTCTCATCGAGGCCT 59.179 55.000 3.86 3.86 0.00 5.19
3199 3215 2.952978 GTCTTCTCATCGAGGCCTTCTA 59.047 50.000 6.77 0.00 0.00 2.10
3200 3216 3.572255 GTCTTCTCATCGAGGCCTTCTAT 59.428 47.826 6.77 0.00 0.00 1.98
3222 3238 3.987404 CCCCCGCTTTCTTCACAG 58.013 61.111 0.00 0.00 0.00 3.66
3227 3243 0.514691 CCGCTTTCTTCACAGCAGTC 59.485 55.000 0.00 0.00 35.60 3.51
3233 3249 4.439289 GCTTTCTTCACAGCAGTCAACTTT 60.439 41.667 0.00 0.00 35.95 2.66
3246 3262 5.221126 GCAGTCAACTTTTTCATCACCTTCT 60.221 40.000 0.00 0.00 0.00 2.85
3257 3273 3.008375 TCATCACCTTCTTCCTCTTGGTG 59.992 47.826 0.00 0.00 46.71 4.17
3291 3307 3.829026 CGAGGAGATATGGGAGTTCATCA 59.171 47.826 0.00 0.00 0.00 3.07
3299 3315 3.920231 TGGGAGTTCATCATCTTCCTG 57.080 47.619 0.00 0.00 31.00 3.86
3320 3336 3.901222 TGTTCTCAGACTGGTTCATGGTA 59.099 43.478 1.81 0.00 0.00 3.25
3324 3340 4.964897 TCTCAGACTGGTTCATGGTATCAT 59.035 41.667 1.81 0.00 0.00 2.45
3329 3345 5.130975 AGACTGGTTCATGGTATCATTGCTA 59.869 40.000 0.00 0.00 0.00 3.49
3333 3349 4.082571 GGTTCATGGTATCATTGCTATGCC 60.083 45.833 3.00 0.18 0.00 4.40
3338 3354 4.641396 TGGTATCATTGCTATGCCACTAC 58.359 43.478 3.00 3.24 34.62 2.73
3382 3398 3.051392 GCCCAATGTACAGTGGCGC 62.051 63.158 32.04 29.63 44.59 6.53
3414 3430 1.762957 TCCTATGGGTACAGAGCAAGC 59.237 52.381 0.00 0.00 34.63 4.01
3419 3435 0.610687 GGGTACAGAGCAAGCTGAGT 59.389 55.000 0.00 0.07 39.20 3.41
3421 3437 1.623359 GTACAGAGCAAGCTGAGTCG 58.377 55.000 0.00 0.00 39.20 4.18
3422 3438 0.109086 TACAGAGCAAGCTGAGTCGC 60.109 55.000 0.00 0.00 39.20 5.19
3425 3441 3.308014 GAGCAAGCTGAGTCGCCCT 62.308 63.158 0.00 0.00 0.00 5.19
3428 3444 0.462759 GCAAGCTGAGTCGCCCTATT 60.463 55.000 0.00 0.00 0.00 1.73
3433 3449 3.031736 AGCTGAGTCGCCCTATTCTTAA 58.968 45.455 0.00 0.00 0.00 1.85
3450 3466 7.807977 ATTCTTAACTTCAAGCAGTTCTCAA 57.192 32.000 0.00 0.00 38.07 3.02
3506 3522 4.546674 TGCCATCCATGTTCTCTCTACTA 58.453 43.478 0.00 0.00 0.00 1.82
3507 3523 4.586421 TGCCATCCATGTTCTCTCTACTAG 59.414 45.833 0.00 0.00 0.00 2.57
3509 3525 5.508825 GCCATCCATGTTCTCTCTACTAGTG 60.509 48.000 5.39 0.00 0.00 2.74
3517 3533 3.418995 TCTCTCTACTAGTGCAAACGGT 58.581 45.455 5.39 0.00 0.00 4.83
3518 3534 3.190744 TCTCTCTACTAGTGCAAACGGTG 59.809 47.826 5.39 0.00 0.00 4.94
3581 3597 1.377202 GGCACACATCCGTGATGGT 60.377 57.895 15.41 9.25 46.80 3.55
3582 3598 1.369091 GGCACACATCCGTGATGGTC 61.369 60.000 15.41 0.23 46.80 4.02
3583 3599 1.695893 GCACACATCCGTGATGGTCG 61.696 60.000 15.41 8.06 46.80 4.79
3584 3600 0.389817 CACACATCCGTGATGGTCGT 60.390 55.000 15.41 8.53 46.80 4.34
3585 3601 0.389817 ACACATCCGTGATGGTCGTG 60.390 55.000 15.41 11.78 46.80 4.35
3586 3602 0.108851 CACATCCGTGATGGTCGTGA 60.109 55.000 15.41 0.00 46.80 4.35
3587 3603 0.606096 ACATCCGTGATGGTCGTGAA 59.394 50.000 15.41 0.00 43.60 3.18
3588 3604 1.001520 ACATCCGTGATGGTCGTGAAA 59.998 47.619 15.41 0.00 43.60 2.69
3624 3640 1.533711 AAGTCTGCACTTGTGGGCT 59.466 52.632 2.81 0.00 41.64 5.19
3630 3646 2.987547 CACTTGTGGGCTGGCCAG 60.988 66.667 29.34 29.34 37.98 4.85
3631 3647 3.177884 ACTTGTGGGCTGGCCAGA 61.178 61.111 37.21 20.45 37.98 3.86
3632 3648 2.357836 CTTGTGGGCTGGCCAGAT 59.642 61.111 37.21 0.00 37.98 2.90
3639 3655 1.703014 GGGCTGGCCAGATGATCTCA 61.703 60.000 37.21 0.00 37.98 3.27
3647 3663 1.524848 CAGATGATCTCATGCCAGCC 58.475 55.000 0.00 0.00 36.57 4.85
3677 3693 3.760035 AGCGTCGCGGAGGTCATT 61.760 61.111 12.30 0.00 0.00 2.57
3683 3699 0.965866 TCGCGGAGGTCATTCTCACT 60.966 55.000 6.13 0.00 35.58 3.41
3718 3734 0.256752 TCCATCATGGAGGCCAAGTG 59.743 55.000 0.66 0.00 42.67 3.16
3752 3768 1.133407 GGTAGACAGAGCAAGGACTCG 59.867 57.143 0.00 0.00 41.77 4.18
3758 3780 1.005630 GAGCAAGGACTCGCACACT 60.006 57.895 0.00 0.00 0.00 3.55
3809 3831 1.078426 CCTAGTGGCCTTTCACCCG 60.078 63.158 3.32 0.00 38.34 5.28
3810 3832 1.550130 CCTAGTGGCCTTTCACCCGA 61.550 60.000 3.32 0.00 38.34 5.14
3811 3833 0.391263 CTAGTGGCCTTTCACCCGAC 60.391 60.000 3.32 0.00 38.34 4.79
3812 3834 2.162338 TAGTGGCCTTTCACCCGACG 62.162 60.000 3.32 0.00 38.34 5.12
3830 3852 1.000771 GCTCCTCCCTGAAAACCCC 60.001 63.158 0.00 0.00 0.00 4.95
3857 3879 2.258591 GAGCGTGTCTTCGAGGCA 59.741 61.111 0.00 0.00 0.00 4.75
3879 3901 3.901797 AAGGCGGAACTCAAGGGCG 62.902 63.158 0.00 0.00 0.00 6.13
3880 3902 4.699522 GGCGGAACTCAAGGGCGT 62.700 66.667 0.00 0.00 0.00 5.68
3911 3933 1.025812 CCAGCTACTACCTCTCGTGG 58.974 60.000 0.00 0.00 0.00 4.94
3916 3938 0.038599 TACTACCTCTCGTGGTGGCA 59.961 55.000 7.54 0.00 41.53 4.92
3918 3940 1.532078 TACCTCTCGTGGTGGCACA 60.532 57.895 20.82 2.61 41.05 4.57
3929 3951 4.453454 TGGCACACTAGGGTCGAT 57.547 55.556 0.00 0.00 0.00 3.59
3939 3961 4.021894 ACACTAGGGTCGATAAGATCATGC 60.022 45.833 0.00 0.00 0.00 4.06
3946 3968 1.606480 CGATAAGATCATGCAGGCGGT 60.606 52.381 0.00 0.00 0.00 5.68
3949 3977 2.124570 GATCATGCAGGCGGTGGT 60.125 61.111 0.00 0.00 0.00 4.16
3950 3978 1.146041 GATCATGCAGGCGGTGGTA 59.854 57.895 0.00 0.00 0.00 3.25
3951 3979 0.882042 GATCATGCAGGCGGTGGTAG 60.882 60.000 0.00 0.00 0.00 3.18
3955 3983 3.391382 GCAGGCGGTGGTAGAGGT 61.391 66.667 0.00 0.00 0.00 3.85
3957 3985 2.683933 AGGCGGTGGTAGAGGTGG 60.684 66.667 0.00 0.00 0.00 4.61
3992 4020 2.283388 AAGGACGGCGAGGTGGTA 60.283 61.111 16.62 0.00 0.00 3.25
3993 4021 1.673808 GAAGGACGGCGAGGTGGTAT 61.674 60.000 16.62 0.00 0.00 2.73
4000 4028 0.663153 GGCGAGGTGGTATTCAATGC 59.337 55.000 0.00 0.00 0.00 3.56
4001 4029 1.668419 GCGAGGTGGTATTCAATGCT 58.332 50.000 0.00 0.00 0.00 3.79
4004 4032 1.678101 GAGGTGGTATTCAATGCTGCC 59.322 52.381 0.00 0.00 0.00 4.85
4016 4044 2.597340 GCTGCCAAGCTGGGGATA 59.403 61.111 9.87 0.00 46.60 2.59
4017 4045 1.825622 GCTGCCAAGCTGGGGATAC 60.826 63.158 9.87 0.00 46.60 2.24
4045 4073 3.454858 AGGAAGAAGCTATGAGGGACAA 58.545 45.455 0.00 0.00 0.00 3.18
4046 4074 4.043596 AGGAAGAAGCTATGAGGGACAAT 58.956 43.478 0.00 0.00 0.00 2.71
4053 4081 0.104120 TATGAGGGACAATGGCGTCG 59.896 55.000 0.00 0.00 36.73 5.12
4054 4082 2.511600 GAGGGACAATGGCGTCGG 60.512 66.667 0.00 0.00 36.73 4.79
4088 4116 3.016474 GAAGCTGCTTGCCGACGTC 62.016 63.158 21.25 5.18 44.23 4.34
4094 4122 2.651361 CTTGCCGACGTCTGGACT 59.349 61.111 24.32 0.00 0.00 3.85
4101 4129 1.135731 GACGTCTGGACTGAGCTCG 59.864 63.158 8.70 6.63 0.00 5.03
4123 4151 1.219646 GTTTACCTCGCACCGTCAAA 58.780 50.000 0.00 0.00 0.00 2.69
4125 4153 0.600782 TTACCTCGCACCGTCAAACC 60.601 55.000 0.00 0.00 0.00 3.27
4148 4176 2.124570 GAGCGTGTGATGGGGCAT 60.125 61.111 0.00 0.00 0.00 4.40
4205 4233 0.685785 TGCTTTGGGCTTTGACCACA 60.686 50.000 0.00 0.00 42.46 4.17
4220 4248 0.516877 CCACACACACTGGCATAACG 59.483 55.000 0.00 0.00 0.00 3.18
4240 4268 0.314302 CGCCCGGAGAAGTAGTATGG 59.686 60.000 0.73 0.00 0.00 2.74
4241 4269 0.033642 GCCCGGAGAAGTAGTATGGC 59.966 60.000 0.73 0.00 0.00 4.40
4242 4270 1.705873 CCCGGAGAAGTAGTATGGCT 58.294 55.000 0.73 0.00 0.00 4.75
4243 4271 1.341531 CCCGGAGAAGTAGTATGGCTG 59.658 57.143 0.73 0.00 0.00 4.85
4244 4272 2.307768 CCGGAGAAGTAGTATGGCTGA 58.692 52.381 0.00 0.00 0.00 4.26
4245 4273 2.034812 CCGGAGAAGTAGTATGGCTGAC 59.965 54.545 0.00 0.00 0.00 3.51
4248 4276 4.142138 CGGAGAAGTAGTATGGCTGACTTT 60.142 45.833 0.00 0.00 32.37 2.66
4249 4277 5.112686 GGAGAAGTAGTATGGCTGACTTTG 58.887 45.833 0.00 0.00 32.37 2.77
4250 4278 5.337652 GGAGAAGTAGTATGGCTGACTTTGT 60.338 44.000 0.00 0.00 32.37 2.83
4251 4279 6.115448 AGAAGTAGTATGGCTGACTTTGTT 57.885 37.500 0.00 0.00 32.37 2.83
4252 4280 6.534634 AGAAGTAGTATGGCTGACTTTGTTT 58.465 36.000 0.00 0.00 32.37 2.83
4253 4281 6.998673 AGAAGTAGTATGGCTGACTTTGTTTT 59.001 34.615 0.00 0.00 32.37 2.43
4254 4282 7.502561 AGAAGTAGTATGGCTGACTTTGTTTTT 59.497 33.333 0.00 0.00 32.37 1.94
4255 4283 7.203255 AGTAGTATGGCTGACTTTGTTTTTC 57.797 36.000 0.00 0.00 0.00 2.29
4256 4284 6.998673 AGTAGTATGGCTGACTTTGTTTTTCT 59.001 34.615 0.00 0.00 0.00 2.52
4257 4285 6.715347 AGTATGGCTGACTTTGTTTTTCTT 57.285 33.333 0.00 0.00 0.00 2.52
4258 4286 7.112452 AGTATGGCTGACTTTGTTTTTCTTT 57.888 32.000 0.00 0.00 0.00 2.52
4259 4287 7.203218 AGTATGGCTGACTTTGTTTTTCTTTC 58.797 34.615 0.00 0.00 0.00 2.62
4260 4288 5.659440 TGGCTGACTTTGTTTTTCTTTCT 57.341 34.783 0.00 0.00 0.00 2.52
4261 4289 6.036577 TGGCTGACTTTGTTTTTCTTTCTT 57.963 33.333 0.00 0.00 0.00 2.52
4262 4290 6.463360 TGGCTGACTTTGTTTTTCTTTCTTT 58.537 32.000 0.00 0.00 0.00 2.52
4263 4291 6.934083 TGGCTGACTTTGTTTTTCTTTCTTTT 59.066 30.769 0.00 0.00 0.00 2.27
4264 4292 7.443879 TGGCTGACTTTGTTTTTCTTTCTTTTT 59.556 29.630 0.00 0.00 0.00 1.94
4285 4313 7.873719 TTTTTCTTGTGGAAAGTATGTCTGA 57.126 32.000 0.00 0.00 43.68 3.27
4286 4314 6.861065 TTTCTTGTGGAAAGTATGTCTGAC 57.139 37.500 0.00 0.00 38.81 3.51
4287 4315 4.894784 TCTTGTGGAAAGTATGTCTGACC 58.105 43.478 5.17 0.00 0.00 4.02
4288 4316 4.593206 TCTTGTGGAAAGTATGTCTGACCT 59.407 41.667 5.17 0.00 0.00 3.85
4289 4317 4.974645 TGTGGAAAGTATGTCTGACCTT 57.025 40.909 5.17 0.00 0.00 3.50
4290 4318 4.641396 TGTGGAAAGTATGTCTGACCTTG 58.359 43.478 5.17 0.00 0.00 3.61
4291 4319 4.102524 TGTGGAAAGTATGTCTGACCTTGT 59.897 41.667 5.17 0.00 0.00 3.16
4292 4320 5.063880 GTGGAAAGTATGTCTGACCTTGTT 58.936 41.667 5.17 0.00 0.00 2.83
4293 4321 5.049405 GTGGAAAGTATGTCTGACCTTGTTG 60.049 44.000 5.17 0.00 0.00 3.33
4294 4322 4.083271 GGAAAGTATGTCTGACCTTGTTGC 60.083 45.833 5.17 0.00 0.00 4.17
4295 4323 3.769739 AGTATGTCTGACCTTGTTGCA 57.230 42.857 5.17 0.00 0.00 4.08
4296 4324 3.403038 AGTATGTCTGACCTTGTTGCAC 58.597 45.455 5.17 0.00 0.00 4.57
4297 4325 2.346766 ATGTCTGACCTTGTTGCACA 57.653 45.000 5.17 0.00 0.00 4.57
4298 4326 2.346766 TGTCTGACCTTGTTGCACAT 57.653 45.000 5.17 0.00 0.00 3.21
4299 4327 1.948834 TGTCTGACCTTGTTGCACATG 59.051 47.619 5.17 0.00 0.00 3.21
4300 4328 1.949525 GTCTGACCTTGTTGCACATGT 59.050 47.619 0.00 0.00 0.00 3.21
4301 4329 1.948834 TCTGACCTTGTTGCACATGTG 59.051 47.619 21.83 21.83 0.00 3.21
4302 4330 1.677576 CTGACCTTGTTGCACATGTGT 59.322 47.619 26.01 4.32 0.00 3.72
4303 4331 2.098614 TGACCTTGTTGCACATGTGTT 58.901 42.857 26.01 1.96 0.00 3.32
4304 4332 2.495270 TGACCTTGTTGCACATGTGTTT 59.505 40.909 26.01 2.97 0.00 2.83
4305 4333 3.056250 TGACCTTGTTGCACATGTGTTTT 60.056 39.130 26.01 3.49 0.00 2.43
4306 4334 3.260740 ACCTTGTTGCACATGTGTTTTG 58.739 40.909 26.01 11.92 0.00 2.44
4307 4335 2.608546 CCTTGTTGCACATGTGTTTTGG 59.391 45.455 26.01 16.33 0.00 3.28
4308 4336 3.519579 CTTGTTGCACATGTGTTTTGGA 58.480 40.909 26.01 8.41 0.00 3.53
4309 4337 3.815856 TGTTGCACATGTGTTTTGGAT 57.184 38.095 26.01 0.00 0.00 3.41
4310 4338 4.134379 TGTTGCACATGTGTTTTGGATT 57.866 36.364 26.01 0.00 0.00 3.01
4311 4339 5.268118 TGTTGCACATGTGTTTTGGATTA 57.732 34.783 26.01 2.24 0.00 1.75
4312 4340 5.851720 TGTTGCACATGTGTTTTGGATTAT 58.148 33.333 26.01 0.00 0.00 1.28
4313 4341 5.695363 TGTTGCACATGTGTTTTGGATTATG 59.305 36.000 26.01 0.00 0.00 1.90
4314 4342 5.465532 TGCACATGTGTTTTGGATTATGT 57.534 34.783 26.01 0.00 0.00 2.29
4315 4343 5.228665 TGCACATGTGTTTTGGATTATGTG 58.771 37.500 26.01 0.00 44.85 3.21
4316 4344 5.010415 TGCACATGTGTTTTGGATTATGTGA 59.990 36.000 26.01 2.57 44.85 3.58
4317 4345 5.345741 GCACATGTGTTTTGGATTATGTGAC 59.654 40.000 26.01 0.32 44.85 3.67
4318 4346 6.680810 CACATGTGTTTTGGATTATGTGACT 58.319 36.000 18.03 0.00 44.85 3.41
4319 4347 7.147312 CACATGTGTTTTGGATTATGTGACTT 58.853 34.615 18.03 0.00 44.85 3.01
4320 4348 7.326789 CACATGTGTTTTGGATTATGTGACTTC 59.673 37.037 18.03 0.00 44.85 3.01
4321 4349 5.996219 TGTGTTTTGGATTATGTGACTTCG 58.004 37.500 0.00 0.00 0.00 3.79
4322 4350 5.529430 TGTGTTTTGGATTATGTGACTTCGT 59.471 36.000 0.00 0.00 0.00 3.85
4323 4351 5.851177 GTGTTTTGGATTATGTGACTTCGTG 59.149 40.000 0.00 0.00 0.00 4.35
4324 4352 5.529430 TGTTTTGGATTATGTGACTTCGTGT 59.471 36.000 0.00 0.00 0.00 4.49
4325 4353 6.038825 TGTTTTGGATTATGTGACTTCGTGTT 59.961 34.615 0.00 0.00 0.00 3.32
4326 4354 6.627395 TTTGGATTATGTGACTTCGTGTTT 57.373 33.333 0.00 0.00 0.00 2.83
4327 4355 5.605564 TGGATTATGTGACTTCGTGTTTG 57.394 39.130 0.00 0.00 0.00 2.93
4328 4356 5.060506 TGGATTATGTGACTTCGTGTTTGT 58.939 37.500 0.00 0.00 0.00 2.83
4329 4357 5.529430 TGGATTATGTGACTTCGTGTTTGTT 59.471 36.000 0.00 0.00 0.00 2.83
4330 4358 6.706716 TGGATTATGTGACTTCGTGTTTGTTA 59.293 34.615 0.00 0.00 0.00 2.41
4331 4359 7.389330 TGGATTATGTGACTTCGTGTTTGTTAT 59.611 33.333 0.00 0.00 0.00 1.89
4332 4360 8.234546 GGATTATGTGACTTCGTGTTTGTTATT 58.765 33.333 0.00 0.00 0.00 1.40
4333 4361 8.948853 ATTATGTGACTTCGTGTTTGTTATTG 57.051 30.769 0.00 0.00 0.00 1.90
4334 4362 6.612247 ATGTGACTTCGTGTTTGTTATTGA 57.388 33.333 0.00 0.00 0.00 2.57
4335 4363 6.612247 TGTGACTTCGTGTTTGTTATTGAT 57.388 33.333 0.00 0.00 0.00 2.57
4336 4364 6.426327 TGTGACTTCGTGTTTGTTATTGATG 58.574 36.000 0.00 0.00 0.00 3.07
4337 4365 6.037720 TGTGACTTCGTGTTTGTTATTGATGT 59.962 34.615 0.00 0.00 0.00 3.06
4338 4366 6.573725 GTGACTTCGTGTTTGTTATTGATGTC 59.426 38.462 0.00 0.00 33.59 3.06
4339 4367 6.481976 TGACTTCGTGTTTGTTATTGATGTCT 59.518 34.615 0.00 0.00 33.91 3.41
4340 4368 7.011950 TGACTTCGTGTTTGTTATTGATGTCTT 59.988 33.333 0.00 0.00 33.91 3.01
4341 4369 7.352739 ACTTCGTGTTTGTTATTGATGTCTTC 58.647 34.615 0.00 0.00 0.00 2.87
4342 4370 7.226720 ACTTCGTGTTTGTTATTGATGTCTTCT 59.773 33.333 0.00 0.00 0.00 2.85
4343 4371 8.596271 TTCGTGTTTGTTATTGATGTCTTCTA 57.404 30.769 0.00 0.00 0.00 2.10
4344 4372 8.014322 TCGTGTTTGTTATTGATGTCTTCTAC 57.986 34.615 0.00 0.00 0.00 2.59
4345 4373 7.654116 TCGTGTTTGTTATTGATGTCTTCTACA 59.346 33.333 0.00 0.00 43.86 2.74
4391 4419 9.720769 TGATTATTTTACTATAGCACTAAGGCC 57.279 33.333 0.00 0.00 0.00 5.19
4392 4420 9.720769 GATTATTTTACTATAGCACTAAGGCCA 57.279 33.333 5.01 0.00 0.00 5.36
4394 4422 9.720769 TTATTTTACTATAGCACTAAGGCCATC 57.279 33.333 5.01 0.00 0.00 3.51
4395 4423 6.996180 TTTACTATAGCACTAAGGCCATCT 57.004 37.500 5.01 0.00 0.00 2.90
4396 4424 8.486942 TTTTACTATAGCACTAAGGCCATCTA 57.513 34.615 5.01 0.00 0.00 1.98
4397 4425 8.666129 TTTACTATAGCACTAAGGCCATCTAT 57.334 34.615 5.01 4.76 0.00 1.98
4398 4426 6.783708 ACTATAGCACTAAGGCCATCTATC 57.216 41.667 5.01 0.00 0.00 2.08
4399 4427 5.659079 ACTATAGCACTAAGGCCATCTATCC 59.341 44.000 5.01 0.00 0.00 2.59
4400 4428 1.981495 AGCACTAAGGCCATCTATCCC 59.019 52.381 5.01 0.00 0.00 3.85
4401 4429 1.003696 GCACTAAGGCCATCTATCCCC 59.996 57.143 5.01 0.00 0.00 4.81
4402 4430 1.630878 CACTAAGGCCATCTATCCCCC 59.369 57.143 5.01 0.00 0.00 5.40
4403 4431 1.514442 ACTAAGGCCATCTATCCCCCT 59.486 52.381 5.01 0.00 0.00 4.79
4404 4432 2.192263 CTAAGGCCATCTATCCCCCTC 58.808 57.143 5.01 0.00 0.00 4.30
4405 4433 0.271927 AAGGCCATCTATCCCCCTCA 59.728 55.000 5.01 0.00 0.00 3.86
4406 4434 0.271927 AGGCCATCTATCCCCCTCAA 59.728 55.000 5.01 0.00 0.00 3.02
4407 4435 1.149101 GGCCATCTATCCCCCTCAAA 58.851 55.000 0.00 0.00 0.00 2.69
4408 4436 1.202940 GGCCATCTATCCCCCTCAAAC 60.203 57.143 0.00 0.00 0.00 2.93
4409 4437 1.494721 GCCATCTATCCCCCTCAAACA 59.505 52.381 0.00 0.00 0.00 2.83
4410 4438 2.108952 GCCATCTATCCCCCTCAAACAT 59.891 50.000 0.00 0.00 0.00 2.71
4411 4439 3.812167 GCCATCTATCCCCCTCAAACATC 60.812 52.174 0.00 0.00 0.00 3.06
4412 4440 3.245052 CCATCTATCCCCCTCAAACATCC 60.245 52.174 0.00 0.00 0.00 3.51
4413 4441 2.047061 TCTATCCCCCTCAAACATCCG 58.953 52.381 0.00 0.00 0.00 4.18
4414 4442 2.047061 CTATCCCCCTCAAACATCCGA 58.953 52.381 0.00 0.00 0.00 4.55
4415 4443 0.839946 ATCCCCCTCAAACATCCGAG 59.160 55.000 0.00 0.00 0.00 4.63
4427 4455 2.215907 CATCCGAGGATGTCAGTGAC 57.784 55.000 20.87 16.68 44.93 3.67
4428 4456 1.115467 ATCCGAGGATGTCAGTGACC 58.885 55.000 20.43 5.47 32.98 4.02
4429 4457 1.139734 CCGAGGATGTCAGTGACCG 59.860 63.158 20.43 15.03 0.00 4.79
4430 4458 1.313091 CCGAGGATGTCAGTGACCGA 61.313 60.000 20.43 3.13 0.00 4.69
4431 4459 0.526211 CGAGGATGTCAGTGACCGAA 59.474 55.000 20.43 2.34 0.00 4.30
4432 4460 1.135139 CGAGGATGTCAGTGACCGAAT 59.865 52.381 20.43 7.53 0.00 3.34
4433 4461 2.357952 CGAGGATGTCAGTGACCGAATA 59.642 50.000 20.43 1.55 0.00 1.75
4434 4462 3.549019 CGAGGATGTCAGTGACCGAATAG 60.549 52.174 20.43 4.83 0.00 1.73
4436 4464 2.693591 GGATGTCAGTGACCGAATAGGA 59.306 50.000 20.43 0.00 45.00 2.94
4437 4465 3.243569 GGATGTCAGTGACCGAATAGGAG 60.244 52.174 20.43 0.00 45.00 3.69
4438 4466 3.081710 TGTCAGTGACCGAATAGGAGA 57.918 47.619 20.43 0.00 45.00 3.71
4439 4467 3.017442 TGTCAGTGACCGAATAGGAGAG 58.983 50.000 20.43 0.00 45.00 3.20
4440 4468 2.359531 GTCAGTGACCGAATAGGAGAGG 59.640 54.545 12.54 0.00 45.00 3.69
4441 4469 2.025226 TCAGTGACCGAATAGGAGAGGT 60.025 50.000 0.00 0.00 45.00 3.85
4442 4470 3.201487 TCAGTGACCGAATAGGAGAGGTA 59.799 47.826 0.00 0.00 45.00 3.08
4443 4471 3.952323 CAGTGACCGAATAGGAGAGGTAA 59.048 47.826 0.00 0.00 45.00 2.85
4444 4472 4.036971 CAGTGACCGAATAGGAGAGGTAAG 59.963 50.000 0.00 0.00 45.00 2.34
4445 4473 4.079901 AGTGACCGAATAGGAGAGGTAAGA 60.080 45.833 0.00 0.00 45.00 2.10
4446 4474 4.643784 GTGACCGAATAGGAGAGGTAAGAA 59.356 45.833 0.00 0.00 45.00 2.52
4447 4475 5.126707 GTGACCGAATAGGAGAGGTAAGAAA 59.873 44.000 0.00 0.00 45.00 2.52
4448 4476 5.718130 TGACCGAATAGGAGAGGTAAGAAAA 59.282 40.000 0.00 0.00 45.00 2.29
4449 4477 6.211986 TGACCGAATAGGAGAGGTAAGAAAAA 59.788 38.462 0.00 0.00 45.00 1.94
4467 4495 3.327600 AAAAAGGTTACCCGACCGG 57.672 52.632 0.00 0.00 44.62 5.28
4468 4496 0.764271 AAAAAGGTTACCCGACCGGA 59.236 50.000 9.46 0.00 44.62 5.14
4469 4497 0.986527 AAAAGGTTACCCGACCGGAT 59.013 50.000 9.46 0.00 44.62 4.18
4470 4498 0.538584 AAAGGTTACCCGACCGGATC 59.461 55.000 9.46 0.32 44.62 3.36
4471 4499 1.332889 AAGGTTACCCGACCGGATCC 61.333 60.000 9.46 0.00 44.62 3.36
4472 4500 2.800541 GGTTACCCGACCGGATCCC 61.801 68.421 9.46 0.78 37.50 3.85
4473 4501 1.759692 GTTACCCGACCGGATCCCT 60.760 63.158 9.46 0.00 37.50 4.20
4474 4502 1.002017 TTACCCGACCGGATCCCTT 59.998 57.895 9.46 0.00 37.50 3.95
4475 4503 0.261402 TTACCCGACCGGATCCCTTA 59.739 55.000 9.46 0.00 37.50 2.69
4476 4504 0.484212 TACCCGACCGGATCCCTTAT 59.516 55.000 9.46 0.00 37.50 1.73
4477 4505 0.484212 ACCCGACCGGATCCCTTATA 59.516 55.000 9.46 0.00 37.50 0.98
4478 4506 1.078324 ACCCGACCGGATCCCTTATAT 59.922 52.381 9.46 0.00 37.50 0.86
4479 4507 1.755380 CCCGACCGGATCCCTTATATC 59.245 57.143 9.46 0.00 37.50 1.63
4480 4508 2.453521 CCGACCGGATCCCTTATATCA 58.546 52.381 9.46 0.00 37.50 2.15
4481 4509 3.031736 CCGACCGGATCCCTTATATCAT 58.968 50.000 9.46 0.00 37.50 2.45
4482 4510 3.068307 CCGACCGGATCCCTTATATCATC 59.932 52.174 9.46 0.00 37.50 2.92
4483 4511 3.068307 CGACCGGATCCCTTATATCATCC 59.932 52.174 9.46 0.00 32.75 3.51
4484 4512 3.385115 ACCGGATCCCTTATATCATCCC 58.615 50.000 9.46 0.00 32.47 3.85
4485 4513 3.014110 ACCGGATCCCTTATATCATCCCT 59.986 47.826 9.46 0.00 32.47 4.20
4486 4514 4.234458 ACCGGATCCCTTATATCATCCCTA 59.766 45.833 9.46 0.00 32.47 3.53
4487 4515 5.102609 ACCGGATCCCTTATATCATCCCTAT 60.103 44.000 9.46 0.00 32.47 2.57
4488 4516 6.105740 ACCGGATCCCTTATATCATCCCTATA 59.894 42.308 9.46 0.00 32.47 1.31
4489 4517 6.437793 CCGGATCCCTTATATCATCCCTATAC 59.562 46.154 6.06 0.00 32.47 1.47
4490 4518 6.151312 CGGATCCCTTATATCATCCCTATACG 59.849 46.154 6.06 0.00 32.47 3.06
4491 4519 7.011382 GGATCCCTTATATCATCCCTATACGT 58.989 42.308 0.00 0.00 30.17 3.57
4492 4520 7.177041 GGATCCCTTATATCATCCCTATACGTC 59.823 44.444 0.00 0.00 30.17 4.34
4493 4521 7.222180 TCCCTTATATCATCCCTATACGTCT 57.778 40.000 0.00 0.00 0.00 4.18
4494 4522 7.061054 TCCCTTATATCATCCCTATACGTCTG 58.939 42.308 0.00 0.00 0.00 3.51
4495 4523 6.265649 CCCTTATATCATCCCTATACGTCTGG 59.734 46.154 0.00 0.00 0.00 3.86
4496 4524 6.265649 CCTTATATCATCCCTATACGTCTGGG 59.734 46.154 12.60 12.60 42.20 4.45
4497 4525 3.544698 ATCATCCCTATACGTCTGGGT 57.455 47.619 16.68 5.46 41.58 4.51
4498 4526 3.323774 TCATCCCTATACGTCTGGGTT 57.676 47.619 16.68 8.62 41.58 4.11
4499 4527 2.963101 TCATCCCTATACGTCTGGGTTG 59.037 50.000 18.08 18.08 41.58 3.77
4500 4528 2.537633 TCCCTATACGTCTGGGTTGT 57.462 50.000 16.68 0.00 41.58 3.32
4501 4529 2.381911 TCCCTATACGTCTGGGTTGTC 58.618 52.381 16.68 0.00 41.58 3.18
4502 4530 1.411612 CCCTATACGTCTGGGTTGTCC 59.588 57.143 11.07 0.00 36.32 4.02
4503 4531 1.066605 CCTATACGTCTGGGTTGTCCG 59.933 57.143 0.00 0.00 38.76 4.79
4504 4532 0.457035 TATACGTCTGGGTTGTCCGC 59.543 55.000 0.00 0.00 38.76 5.54
4505 4533 2.552585 ATACGTCTGGGTTGTCCGCG 62.553 60.000 0.00 0.00 38.76 6.46
4506 4534 4.351938 CGTCTGGGTTGTCCGCGA 62.352 66.667 8.23 0.00 38.76 5.87
4507 4535 2.029964 GTCTGGGTTGTCCGCGAA 59.970 61.111 8.23 0.00 38.76 4.70
4508 4536 2.029964 TCTGGGTTGTCCGCGAAC 59.970 61.111 8.23 0.00 38.76 3.95
4509 4537 3.047877 CTGGGTTGTCCGCGAACC 61.048 66.667 17.41 17.41 42.00 3.62
4512 4540 2.741211 GGTTGTCCGCGAACCCTC 60.741 66.667 15.38 0.00 37.49 4.30
4513 4541 2.029964 GTTGTCCGCGAACCCTCA 59.970 61.111 8.23 0.00 0.00 3.86
4514 4542 1.375523 GTTGTCCGCGAACCCTCAT 60.376 57.895 8.23 0.00 0.00 2.90
4515 4543 0.108520 GTTGTCCGCGAACCCTCATA 60.109 55.000 8.23 0.00 0.00 2.15
4516 4544 0.828022 TTGTCCGCGAACCCTCATAT 59.172 50.000 8.23 0.00 0.00 1.78
4517 4545 0.828022 TGTCCGCGAACCCTCATATT 59.172 50.000 8.23 0.00 0.00 1.28
4518 4546 1.217882 GTCCGCGAACCCTCATATTG 58.782 55.000 8.23 0.00 0.00 1.90
4519 4547 1.116308 TCCGCGAACCCTCATATTGA 58.884 50.000 8.23 0.00 0.00 2.57
4520 4548 1.068588 TCCGCGAACCCTCATATTGAG 59.931 52.381 8.23 0.00 43.91 3.02
4537 4565 8.927411 TCATATTGAGATCAAATGTAGTGAGGA 58.073 33.333 0.00 0.00 39.55 3.71
4538 4566 9.722184 CATATTGAGATCAAATGTAGTGAGGAT 57.278 33.333 0.00 0.00 39.55 3.24
4541 4569 6.739112 TGAGATCAAATGTAGTGAGGATACG 58.261 40.000 0.00 0.00 46.39 3.06
4542 4570 6.546034 TGAGATCAAATGTAGTGAGGATACGA 59.454 38.462 0.00 0.00 46.39 3.43
4543 4571 6.976088 AGATCAAATGTAGTGAGGATACGAG 58.024 40.000 0.00 0.00 46.39 4.18
4544 4572 5.515797 TCAAATGTAGTGAGGATACGAGG 57.484 43.478 0.00 0.00 46.39 4.63
4545 4573 4.341235 TCAAATGTAGTGAGGATACGAGGG 59.659 45.833 0.00 0.00 46.39 4.30
4546 4574 1.688772 TGTAGTGAGGATACGAGGGC 58.311 55.000 0.00 0.00 46.39 5.19
4547 4575 1.214673 TGTAGTGAGGATACGAGGGCT 59.785 52.381 0.00 0.00 46.39 5.19
4548 4576 1.881324 GTAGTGAGGATACGAGGGCTC 59.119 57.143 0.00 0.00 46.39 4.70
4573 4601 2.202440 CGACCGAACGCGTCTGAT 60.202 61.111 14.44 0.00 35.23 2.90
4574 4602 2.215604 CGACCGAACGCGTCTGATC 61.216 63.158 14.44 5.19 35.23 2.92
4575 4603 1.154093 GACCGAACGCGTCTGATCA 60.154 57.895 14.44 0.00 35.23 2.92
4576 4604 1.134530 GACCGAACGCGTCTGATCAG 61.135 60.000 14.44 17.07 35.23 2.90
4577 4605 1.154016 CCGAACGCGTCTGATCAGT 60.154 57.895 21.92 1.50 35.23 3.41
4578 4606 1.134530 CCGAACGCGTCTGATCAGTC 61.135 60.000 21.92 15.64 35.23 3.51
4579 4607 1.134530 CGAACGCGTCTGATCAGTCC 61.135 60.000 21.92 12.81 0.00 3.85
4580 4608 1.134530 GAACGCGTCTGATCAGTCCG 61.135 60.000 21.92 23.06 0.00 4.79
4581 4609 2.951745 CGCGTCTGATCAGTCCGC 60.952 66.667 32.99 32.99 42.12 5.54
4582 4610 2.583593 GCGTCTGATCAGTCCGCC 60.584 66.667 32.88 22.36 40.85 6.13
4583 4611 2.885113 CGTCTGATCAGTCCGCCA 59.115 61.111 21.92 0.00 0.00 5.69
4584 4612 1.439228 CGTCTGATCAGTCCGCCAT 59.561 57.895 21.92 0.00 0.00 4.40
4585 4613 0.873312 CGTCTGATCAGTCCGCCATG 60.873 60.000 21.92 3.79 0.00 3.66
4586 4614 0.176680 GTCTGATCAGTCCGCCATGT 59.823 55.000 21.92 0.00 0.00 3.21
4587 4615 1.409064 GTCTGATCAGTCCGCCATGTA 59.591 52.381 21.92 0.00 0.00 2.29
4588 4616 1.683385 TCTGATCAGTCCGCCATGTAG 59.317 52.381 21.92 0.00 0.00 2.74
4589 4617 0.752658 TGATCAGTCCGCCATGTAGG 59.247 55.000 0.00 0.00 41.84 3.18
4590 4618 1.040646 GATCAGTCCGCCATGTAGGA 58.959 55.000 2.60 2.60 41.22 2.94
4591 4619 1.620819 GATCAGTCCGCCATGTAGGAT 59.379 52.381 9.26 0.00 41.22 3.24
4592 4620 0.752658 TCAGTCCGCCATGTAGGATG 59.247 55.000 9.26 8.79 41.22 3.51
4593 4621 0.882042 CAGTCCGCCATGTAGGATGC 60.882 60.000 9.26 0.00 41.22 3.91
4594 4622 1.956170 GTCCGCCATGTAGGATGCG 60.956 63.158 9.26 7.16 46.14 4.73
4596 4624 3.349006 CGCCATGTAGGATGCGGC 61.349 66.667 4.15 0.00 43.08 6.53
4597 4625 2.980233 GCCATGTAGGATGCGGCC 60.980 66.667 0.00 0.00 41.22 6.13
4598 4626 2.281761 CCATGTAGGATGCGGCCC 60.282 66.667 0.00 0.00 41.22 5.80
4599 4627 2.510411 CATGTAGGATGCGGCCCA 59.490 61.111 0.00 0.00 0.00 5.36
4600 4628 1.893808 CATGTAGGATGCGGCCCAC 60.894 63.158 0.00 0.00 0.00 4.61
4601 4629 3.120086 ATGTAGGATGCGGCCCACC 62.120 63.158 0.00 1.28 0.00 4.61
4602 4630 4.564110 GTAGGATGCGGCCCACCC 62.564 72.222 0.00 0.00 0.00 4.61
4612 4640 3.728373 GCCCACCCGGACCATCTT 61.728 66.667 0.73 0.00 0.00 2.40
4613 4641 3.087065 CCCACCCGGACCATCTTT 58.913 61.111 0.73 0.00 0.00 2.52
4614 4642 1.382629 CCCACCCGGACCATCTTTT 59.617 57.895 0.73 0.00 0.00 2.27
4615 4643 0.679960 CCCACCCGGACCATCTTTTC 60.680 60.000 0.73 0.00 0.00 2.29
4616 4644 0.328258 CCACCCGGACCATCTTTTCT 59.672 55.000 0.73 0.00 0.00 2.52
4617 4645 1.679032 CCACCCGGACCATCTTTTCTC 60.679 57.143 0.73 0.00 0.00 2.87
4618 4646 1.279271 CACCCGGACCATCTTTTCTCT 59.721 52.381 0.73 0.00 0.00 3.10
4619 4647 1.985895 ACCCGGACCATCTTTTCTCTT 59.014 47.619 0.73 0.00 0.00 2.85
4620 4648 2.375509 ACCCGGACCATCTTTTCTCTTT 59.624 45.455 0.73 0.00 0.00 2.52
4621 4649 3.010420 CCCGGACCATCTTTTCTCTTTC 58.990 50.000 0.73 0.00 0.00 2.62
4622 4650 3.307762 CCCGGACCATCTTTTCTCTTTCT 60.308 47.826 0.73 0.00 0.00 2.52
4623 4651 4.327680 CCGGACCATCTTTTCTCTTTCTT 58.672 43.478 0.00 0.00 0.00 2.52
4624 4652 4.762251 CCGGACCATCTTTTCTCTTTCTTT 59.238 41.667 0.00 0.00 0.00 2.52
4625 4653 5.938125 CCGGACCATCTTTTCTCTTTCTTTA 59.062 40.000 0.00 0.00 0.00 1.85
4626 4654 6.599638 CCGGACCATCTTTTCTCTTTCTTTAT 59.400 38.462 0.00 0.00 0.00 1.40
4627 4655 7.121315 CCGGACCATCTTTTCTCTTTCTTTATT 59.879 37.037 0.00 0.00 0.00 1.40
4628 4656 8.178313 CGGACCATCTTTTCTCTTTCTTTATTC 58.822 37.037 0.00 0.00 0.00 1.75
4629 4657 9.237187 GGACCATCTTTTCTCTTTCTTTATTCT 57.763 33.333 0.00 0.00 0.00 2.40
4649 4677 9.853177 TTATTCTTTCTTCTCTTCTTTTCACCT 57.147 29.630 0.00 0.00 0.00 4.00
4650 4678 7.793927 TTCTTTCTTCTCTTCTTTTCACCTC 57.206 36.000 0.00 0.00 0.00 3.85
4651 4679 6.292150 TCTTTCTTCTCTTCTTTTCACCTCC 58.708 40.000 0.00 0.00 0.00 4.30
4652 4680 5.630415 TTCTTCTCTTCTTTTCACCTCCA 57.370 39.130 0.00 0.00 0.00 3.86
4653 4681 4.962155 TCTTCTCTTCTTTTCACCTCCAC 58.038 43.478 0.00 0.00 0.00 4.02
4654 4682 3.771577 TCTCTTCTTTTCACCTCCACC 57.228 47.619 0.00 0.00 0.00 4.61
4655 4683 3.045634 TCTCTTCTTTTCACCTCCACCA 58.954 45.455 0.00 0.00 0.00 4.17
4656 4684 3.458118 TCTCTTCTTTTCACCTCCACCAA 59.542 43.478 0.00 0.00 0.00 3.67
4657 4685 4.104738 TCTCTTCTTTTCACCTCCACCAAT 59.895 41.667 0.00 0.00 0.00 3.16
4658 4686 4.398319 TCTTCTTTTCACCTCCACCAATC 58.602 43.478 0.00 0.00 0.00 2.67
4659 4687 3.874383 TCTTTTCACCTCCACCAATCA 57.126 42.857 0.00 0.00 0.00 2.57
4660 4688 3.486383 TCTTTTCACCTCCACCAATCAC 58.514 45.455 0.00 0.00 0.00 3.06
4661 4689 3.117701 TCTTTTCACCTCCACCAATCACA 60.118 43.478 0.00 0.00 0.00 3.58
4662 4690 3.524095 TTTCACCTCCACCAATCACAT 57.476 42.857 0.00 0.00 0.00 3.21
4663 4691 2.495155 TCACCTCCACCAATCACATG 57.505 50.000 0.00 0.00 0.00 3.21
4664 4692 0.813184 CACCTCCACCAATCACATGC 59.187 55.000 0.00 0.00 0.00 4.06
4665 4693 0.405198 ACCTCCACCAATCACATGCA 59.595 50.000 0.00 0.00 0.00 3.96
4666 4694 1.203038 ACCTCCACCAATCACATGCAA 60.203 47.619 0.00 0.00 0.00 4.08
4667 4695 1.475280 CCTCCACCAATCACATGCAAG 59.525 52.381 0.00 0.00 0.00 4.01
4668 4696 2.165167 CTCCACCAATCACATGCAAGT 58.835 47.619 0.00 0.00 0.00 3.16
4669 4697 1.887854 TCCACCAATCACATGCAAGTG 59.112 47.619 15.79 15.79 40.85 3.16
4688 4716 8.597167 TGCAAGTGAGCATATATATAAGGAAGT 58.403 33.333 0.00 0.00 40.11 3.01
4697 4725 9.530633 GCATATATATAAGGAAGTAAACGAGGG 57.469 37.037 0.00 0.00 0.00 4.30
4699 4727 9.779951 ATATATATAAGGAAGTAAACGAGGGGT 57.220 33.333 0.00 0.00 0.00 4.95
4701 4729 9.779951 ATATATAAGGAAGTAAACGAGGGGTAT 57.220 33.333 0.00 0.00 0.00 2.73
4703 4731 7.919385 ATAAGGAAGTAAACGAGGGGTATAA 57.081 36.000 0.00 0.00 0.00 0.98
4704 4732 5.604758 AGGAAGTAAACGAGGGGTATAAC 57.395 43.478 0.00 0.00 0.00 1.89
4705 4733 5.275630 AGGAAGTAAACGAGGGGTATAACT 58.724 41.667 0.00 0.00 0.00 2.24
4706 4734 5.128335 AGGAAGTAAACGAGGGGTATAACTG 59.872 44.000 0.00 0.00 0.00 3.16
4707 4735 4.397481 AGTAAACGAGGGGTATAACTGC 57.603 45.455 0.00 0.00 0.00 4.40
4708 4736 3.770933 AGTAAACGAGGGGTATAACTGCA 59.229 43.478 0.00 0.00 0.00 4.41
4709 4737 3.926058 AAACGAGGGGTATAACTGCAT 57.074 42.857 0.00 0.00 0.00 3.96
4710 4738 2.910688 ACGAGGGGTATAACTGCATG 57.089 50.000 0.00 0.00 0.00 4.06
4711 4739 1.416401 ACGAGGGGTATAACTGCATGG 59.584 52.381 0.00 0.00 0.00 3.66
4712 4740 1.691976 CGAGGGGTATAACTGCATGGA 59.308 52.381 0.00 0.00 0.00 3.41
4713 4741 2.104111 CGAGGGGTATAACTGCATGGAA 59.896 50.000 0.00 0.00 0.00 3.53
4714 4742 3.744660 GAGGGGTATAACTGCATGGAAG 58.255 50.000 0.00 0.00 0.00 3.46
4715 4743 2.443255 AGGGGTATAACTGCATGGAAGG 59.557 50.000 0.00 0.00 0.00 3.46
4716 4744 2.441750 GGGGTATAACTGCATGGAAGGA 59.558 50.000 0.00 0.00 0.00 3.36
4717 4745 3.074538 GGGGTATAACTGCATGGAAGGAT 59.925 47.826 0.00 0.00 0.00 3.24
4718 4746 4.288626 GGGGTATAACTGCATGGAAGGATA 59.711 45.833 0.00 0.00 0.00 2.59
4719 4747 5.222048 GGGGTATAACTGCATGGAAGGATAA 60.222 44.000 0.00 0.00 0.00 1.75
4720 4748 6.303839 GGGTATAACTGCATGGAAGGATAAA 58.696 40.000 0.00 0.00 0.00 1.40
4721 4749 6.948309 GGGTATAACTGCATGGAAGGATAAAT 59.052 38.462 0.00 0.00 0.00 1.40
4722 4750 8.107095 GGGTATAACTGCATGGAAGGATAAATA 58.893 37.037 0.00 0.00 0.00 1.40
4723 4751 9.167311 GGTATAACTGCATGGAAGGATAAATAG 57.833 37.037 0.00 0.00 0.00 1.73
4724 4752 9.167311 GTATAACTGCATGGAAGGATAAATAGG 57.833 37.037 0.00 0.00 0.00 2.57
4725 4753 4.990526 ACTGCATGGAAGGATAAATAGGG 58.009 43.478 0.00 0.00 0.00 3.53
4726 4754 4.202609 ACTGCATGGAAGGATAAATAGGGG 60.203 45.833 0.00 0.00 0.00 4.79
4727 4755 3.092301 GCATGGAAGGATAAATAGGGGC 58.908 50.000 0.00 0.00 0.00 5.80
4728 4756 3.701664 CATGGAAGGATAAATAGGGGCC 58.298 50.000 0.00 0.00 0.00 5.80
4729 4757 2.070573 TGGAAGGATAAATAGGGGCCC 58.929 52.381 17.12 17.12 0.00 5.80
4730 4758 2.359243 GGAAGGATAAATAGGGGCCCT 58.641 52.381 31.38 31.38 37.71 5.19
4731 4759 2.722458 GGAAGGATAAATAGGGGCCCTT 59.278 50.000 33.98 18.75 36.78 3.95
4732 4760 3.142217 GGAAGGATAAATAGGGGCCCTTT 59.858 47.826 33.98 22.67 34.48 3.11
4733 4761 3.903530 AGGATAAATAGGGGCCCTTTG 57.096 47.619 33.98 0.00 34.61 2.77
4734 4762 3.139330 AGGATAAATAGGGGCCCTTTGT 58.861 45.455 33.98 21.42 34.61 2.83
4735 4763 3.117131 AGGATAAATAGGGGCCCTTTGTG 60.117 47.826 33.98 0.00 34.61 3.33
4736 4764 2.838637 TAAATAGGGGCCCTTTGTGG 57.161 50.000 33.98 0.00 34.61 4.17
4751 4779 6.095432 CCTTTGTGGGACAATATTTGTTCA 57.905 37.500 1.40 0.00 45.52 3.18
4752 4780 6.158598 CCTTTGTGGGACAATATTTGTTCAG 58.841 40.000 1.40 0.00 45.52 3.02
4753 4781 6.239289 CCTTTGTGGGACAATATTTGTTCAGT 60.239 38.462 1.40 0.00 45.52 3.41
4754 4782 5.703978 TGTGGGACAATATTTGTTCAGTG 57.296 39.130 1.40 0.00 45.52 3.66
4755 4783 5.136828 TGTGGGACAATATTTGTTCAGTGT 58.863 37.500 1.40 0.00 45.52 3.55
4756 4784 5.009510 TGTGGGACAATATTTGTTCAGTGTG 59.990 40.000 1.40 0.00 45.52 3.82
4757 4785 4.522405 TGGGACAATATTTGTTCAGTGTGG 59.478 41.667 1.40 0.00 45.52 4.17
4758 4786 4.522789 GGGACAATATTTGTTCAGTGTGGT 59.477 41.667 1.40 0.00 45.52 4.16
4759 4787 5.010617 GGGACAATATTTGTTCAGTGTGGTT 59.989 40.000 1.40 0.00 45.52 3.67
4760 4788 5.920273 GGACAATATTTGTTCAGTGTGGTTG 59.080 40.000 0.00 0.00 45.52 3.77
4761 4789 6.460953 GGACAATATTTGTTCAGTGTGGTTGT 60.461 38.462 0.00 0.00 45.52 3.32
4762 4790 7.255312 GGACAATATTTGTTCAGTGTGGTTGTA 60.255 37.037 0.00 0.00 45.52 2.41
4763 4791 7.648142 ACAATATTTGTTCAGTGTGGTTGTAG 58.352 34.615 0.00 0.00 42.22 2.74
4764 4792 7.500892 ACAATATTTGTTCAGTGTGGTTGTAGA 59.499 33.333 0.00 0.00 42.22 2.59
4765 4793 7.672983 ATATTTGTTCAGTGTGGTTGTAGAG 57.327 36.000 0.00 0.00 0.00 2.43
4766 4794 3.469008 TGTTCAGTGTGGTTGTAGAGG 57.531 47.619 0.00 0.00 0.00 3.69
4767 4795 2.143925 GTTCAGTGTGGTTGTAGAGGC 58.856 52.381 0.00 0.00 0.00 4.70
4768 4796 1.717032 TCAGTGTGGTTGTAGAGGCT 58.283 50.000 0.00 0.00 0.00 4.58
4769 4797 1.618837 TCAGTGTGGTTGTAGAGGCTC 59.381 52.381 6.34 6.34 0.00 4.70
4770 4798 1.620819 CAGTGTGGTTGTAGAGGCTCT 59.379 52.381 22.48 22.48 0.00 4.09
4771 4799 2.826128 CAGTGTGGTTGTAGAGGCTCTA 59.174 50.000 20.11 20.11 0.00 2.43
4772 4800 3.258372 CAGTGTGGTTGTAGAGGCTCTAA 59.742 47.826 25.07 10.68 29.58 2.10
4773 4801 3.258622 AGTGTGGTTGTAGAGGCTCTAAC 59.741 47.826 25.07 21.08 29.58 2.34
4774 4802 3.258622 GTGTGGTTGTAGAGGCTCTAACT 59.741 47.826 25.07 2.25 29.58 2.24
4775 4803 4.461781 GTGTGGTTGTAGAGGCTCTAACTA 59.538 45.833 25.07 17.35 29.58 2.24
4776 4804 4.705507 TGTGGTTGTAGAGGCTCTAACTAG 59.294 45.833 25.07 0.00 29.58 2.57
4777 4805 3.700038 TGGTTGTAGAGGCTCTAACTAGC 59.300 47.826 25.07 21.60 41.99 3.42
4778 4806 3.700038 GGTTGTAGAGGCTCTAACTAGCA 59.300 47.826 25.07 15.51 44.64 3.49
4779 4807 4.342665 GGTTGTAGAGGCTCTAACTAGCAT 59.657 45.833 25.07 0.00 44.64 3.79
4780 4808 5.535406 GGTTGTAGAGGCTCTAACTAGCATA 59.465 44.000 25.07 0.00 44.64 3.14
4781 4809 6.294286 GGTTGTAGAGGCTCTAACTAGCATAG 60.294 46.154 25.07 0.00 44.64 2.23
4790 4818 4.870305 CTAGCATAGTAGCCCGCG 57.130 61.111 0.00 0.00 32.85 6.46
4791 4819 1.444553 CTAGCATAGTAGCCCGCGC 60.445 63.158 0.00 0.00 32.85 6.86
4792 4820 2.142357 CTAGCATAGTAGCCCGCGCA 62.142 60.000 8.75 0.00 33.20 6.09
4793 4821 1.740332 TAGCATAGTAGCCCGCGCAA 61.740 55.000 8.75 0.00 37.52 4.85
4794 4822 1.961277 GCATAGTAGCCCGCGCAAT 60.961 57.895 8.75 0.00 37.52 3.56
4795 4823 1.862123 CATAGTAGCCCGCGCAATG 59.138 57.895 8.75 0.00 37.52 2.82
4796 4824 1.961277 ATAGTAGCCCGCGCAATGC 60.961 57.895 8.75 6.43 37.52 3.56
4797 4825 2.658679 ATAGTAGCCCGCGCAATGCA 62.659 55.000 8.75 0.00 46.97 3.96
4798 4826 4.536687 GTAGCCCGCGCAATGCAC 62.537 66.667 8.75 0.00 46.97 4.57
4806 4834 2.811747 CGCAATGCACGTCGGGTA 60.812 61.111 5.91 0.00 0.00 3.69
4807 4835 2.384309 CGCAATGCACGTCGGGTAA 61.384 57.895 5.91 0.00 0.00 2.85
4808 4836 1.133869 GCAATGCACGTCGGGTAAC 59.866 57.895 0.00 0.00 0.00 2.50
4809 4837 1.570347 GCAATGCACGTCGGGTAACA 61.570 55.000 0.00 0.00 39.74 2.41
4810 4838 1.083489 CAATGCACGTCGGGTAACAT 58.917 50.000 0.00 0.00 39.74 2.71
4811 4839 1.466950 CAATGCACGTCGGGTAACATT 59.533 47.619 0.00 0.00 35.89 2.71
4812 4840 1.816074 ATGCACGTCGGGTAACATTT 58.184 45.000 0.00 0.00 39.74 2.32
4813 4841 1.595466 TGCACGTCGGGTAACATTTT 58.405 45.000 0.00 0.00 39.74 1.82
4814 4842 1.948145 TGCACGTCGGGTAACATTTTT 59.052 42.857 0.00 0.00 39.74 1.94
4815 4843 3.136763 TGCACGTCGGGTAACATTTTTA 58.863 40.909 0.00 0.00 39.74 1.52
4816 4844 3.562973 TGCACGTCGGGTAACATTTTTAA 59.437 39.130 0.00 0.00 39.74 1.52
4817 4845 4.215827 TGCACGTCGGGTAACATTTTTAAT 59.784 37.500 0.00 0.00 39.74 1.40
4818 4846 4.555747 GCACGTCGGGTAACATTTTTAATG 59.444 41.667 0.00 0.00 39.74 1.90
4819 4847 5.691815 CACGTCGGGTAACATTTTTAATGT 58.308 37.500 0.00 0.00 39.74 2.71
4820 4848 5.791480 CACGTCGGGTAACATTTTTAATGTC 59.209 40.000 5.59 0.00 39.74 3.06
4821 4849 5.702209 ACGTCGGGTAACATTTTTAATGTCT 59.298 36.000 5.59 0.69 39.74 3.41
4822 4850 6.205270 ACGTCGGGTAACATTTTTAATGTCTT 59.795 34.615 5.59 0.00 39.74 3.01
4823 4851 6.739550 CGTCGGGTAACATTTTTAATGTCTTC 59.260 38.462 5.59 1.00 39.74 2.87
4824 4852 7.571613 CGTCGGGTAACATTTTTAATGTCTTCA 60.572 37.037 5.59 0.00 39.74 3.02
4825 4853 8.077386 GTCGGGTAACATTTTTAATGTCTTCAA 58.923 33.333 5.59 0.00 39.74 2.69
4826 4854 8.630917 TCGGGTAACATTTTTAATGTCTTCAAA 58.369 29.630 5.59 0.00 39.74 2.69
4827 4855 9.418045 CGGGTAACATTTTTAATGTCTTCAAAT 57.582 29.630 5.59 0.00 39.74 2.32
4837 4865 9.598517 TTTTAATGTCTTCAAATTCTTTGCAGT 57.401 25.926 0.00 0.00 40.43 4.40
4839 4867 9.677567 TTAATGTCTTCAAATTCTTTGCAGTAC 57.322 29.630 0.00 0.00 40.43 2.73
4840 4868 6.691754 TGTCTTCAAATTCTTTGCAGTACA 57.308 33.333 0.00 1.87 40.43 2.90
4841 4869 7.094508 TGTCTTCAAATTCTTTGCAGTACAA 57.905 32.000 0.00 0.00 40.43 2.41
4842 4870 7.195646 TGTCTTCAAATTCTTTGCAGTACAAG 58.804 34.615 0.00 0.00 40.06 3.16
4843 4871 7.148086 TGTCTTCAAATTCTTTGCAGTACAAGT 60.148 33.333 0.00 0.00 40.06 3.16
4844 4872 8.342634 GTCTTCAAATTCTTTGCAGTACAAGTA 58.657 33.333 0.00 0.00 40.06 2.24
4845 4873 9.066892 TCTTCAAATTCTTTGCAGTACAAGTAT 57.933 29.630 0.00 0.00 40.06 2.12
4846 4874 9.683069 CTTCAAATTCTTTGCAGTACAAGTATT 57.317 29.630 0.00 0.00 40.06 1.89
4882 4910 4.822685 TGGCATGCCAAGAATAACAATT 57.177 36.364 36.95 0.00 44.12 2.32
4883 4911 4.757594 TGGCATGCCAAGAATAACAATTC 58.242 39.130 36.95 4.66 44.12 2.17
4884 4912 4.222366 TGGCATGCCAAGAATAACAATTCA 59.778 37.500 36.95 7.62 44.12 2.57
4885 4913 4.567959 GGCATGCCAAGAATAACAATTCAC 59.432 41.667 32.08 0.00 35.81 3.18
4886 4914 5.170021 GCATGCCAAGAATAACAATTCACA 58.830 37.500 6.36 0.00 33.16 3.58
4887 4915 5.290158 GCATGCCAAGAATAACAATTCACAG 59.710 40.000 6.36 0.00 33.16 3.66
4888 4916 6.392354 CATGCCAAGAATAACAATTCACAGT 58.608 36.000 1.35 0.00 33.16 3.55
4889 4917 7.537715 CATGCCAAGAATAACAATTCACAGTA 58.462 34.615 1.35 0.00 33.16 2.74
4890 4918 6.908825 TGCCAAGAATAACAATTCACAGTAC 58.091 36.000 1.35 0.00 33.16 2.73
4891 4919 6.488344 TGCCAAGAATAACAATTCACAGTACA 59.512 34.615 0.00 0.00 33.16 2.90
4892 4920 7.013750 TGCCAAGAATAACAATTCACAGTACAA 59.986 33.333 0.00 0.00 33.16 2.41
4893 4921 8.028938 GCCAAGAATAACAATTCACAGTACAAT 58.971 33.333 0.00 0.00 33.16 2.71
4894 4922 9.912634 CCAAGAATAACAATTCACAGTACAATT 57.087 29.630 0.00 0.00 33.16 2.32
4896 4924 9.912634 AAGAATAACAATTCACAGTACAATTGG 57.087 29.630 10.83 0.00 42.13 3.16
4897 4925 9.295825 AGAATAACAATTCACAGTACAATTGGA 57.704 29.630 10.83 0.00 42.13 3.53
4898 4926 9.559958 GAATAACAATTCACAGTACAATTGGAG 57.440 33.333 10.83 0.00 42.13 3.86
4899 4927 6.959639 AACAATTCACAGTACAATTGGAGT 57.040 33.333 10.83 0.11 42.13 3.85
4900 4928 6.317789 ACAATTCACAGTACAATTGGAGTG 57.682 37.500 21.82 21.82 42.13 3.51
4901 4929 5.827797 ACAATTCACAGTACAATTGGAGTGT 59.172 36.000 23.13 23.13 42.13 3.55
4902 4930 6.995686 ACAATTCACAGTACAATTGGAGTGTA 59.004 34.615 27.08 15.63 42.13 2.90
4903 4931 7.500892 ACAATTCACAGTACAATTGGAGTGTAA 59.499 33.333 27.08 20.76 42.13 2.41
4904 4932 6.854496 TTCACAGTACAATTGGAGTGTAAC 57.146 37.500 27.08 6.20 33.40 2.50
4905 4933 5.919755 TCACAGTACAATTGGAGTGTAACA 58.080 37.500 27.08 13.66 41.43 2.41
4906 4934 6.530120 TCACAGTACAATTGGAGTGTAACAT 58.470 36.000 27.08 5.37 41.43 2.71
4907 4935 7.672240 TCACAGTACAATTGGAGTGTAACATA 58.328 34.615 27.08 10.61 41.43 2.29
4908 4936 8.318412 TCACAGTACAATTGGAGTGTAACATAT 58.682 33.333 27.08 3.98 41.43 1.78
4909 4937 8.946085 CACAGTACAATTGGAGTGTAACATATT 58.054 33.333 27.08 3.28 41.43 1.28
4928 4956 8.353423 ACATATTAAGTATTCCATTCCATGCC 57.647 34.615 0.00 0.00 0.00 4.40
4929 4957 7.949565 ACATATTAAGTATTCCATTCCATGCCA 59.050 33.333 0.00 0.00 0.00 4.92
4930 4958 6.655078 ATTAAGTATTCCATTCCATGCCAC 57.345 37.500 0.00 0.00 0.00 5.01
4931 4959 3.668141 AGTATTCCATTCCATGCCACA 57.332 42.857 0.00 0.00 0.00 4.17
4932 4960 3.290710 AGTATTCCATTCCATGCCACAC 58.709 45.455 0.00 0.00 0.00 3.82
4933 4961 1.105457 ATTCCATTCCATGCCACACG 58.895 50.000 0.00 0.00 0.00 4.49
4934 4962 1.594194 TTCCATTCCATGCCACACGC 61.594 55.000 0.00 0.00 38.31 5.34
4946 4974 4.804608 TGCCACACGCATTATTATGTAC 57.195 40.909 0.00 0.00 44.64 2.90
4947 4975 4.447290 TGCCACACGCATTATTATGTACT 58.553 39.130 0.00 0.00 44.64 2.73
4948 4976 5.602628 TGCCACACGCATTATTATGTACTA 58.397 37.500 0.00 0.00 44.64 1.82
4949 4977 6.227522 TGCCACACGCATTATTATGTACTAT 58.772 36.000 0.00 0.00 44.64 2.12
4950 4978 7.379750 TGCCACACGCATTATTATGTACTATA 58.620 34.615 0.00 0.00 44.64 1.31
4951 4979 7.329962 TGCCACACGCATTATTATGTACTATAC 59.670 37.037 0.00 0.00 44.64 1.47
4952 4980 7.329962 GCCACACGCATTATTATGTACTATACA 59.670 37.037 0.00 0.00 39.36 2.29
4985 5013 9.183368 AGTACTGTTAAAGTAGGTACATACTCC 57.817 37.037 19.67 9.42 42.15 3.85
4986 5014 7.415592 ACTGTTAAAGTAGGTACATACTCCC 57.584 40.000 19.67 9.11 37.36 4.30
4987 5015 7.187676 ACTGTTAAAGTAGGTACATACTCCCT 58.812 38.462 19.67 10.48 37.36 4.20
4988 5016 7.341512 ACTGTTAAAGTAGGTACATACTCCCTC 59.658 40.741 19.67 11.68 37.36 4.30
4989 5017 6.608808 TGTTAAAGTAGGTACATACTCCCTCC 59.391 42.308 19.67 8.51 34.90 4.30
4990 5018 3.899612 AGTAGGTACATACTCCCTCCC 57.100 52.381 14.25 0.00 29.89 4.30
4991 5019 3.415040 AGTAGGTACATACTCCCTCCCT 58.585 50.000 14.25 0.00 29.89 4.20
4992 5020 3.398629 AGTAGGTACATACTCCCTCCCTC 59.601 52.174 14.25 0.00 29.89 4.30
4993 5021 2.224077 AGGTACATACTCCCTCCCTCA 58.776 52.381 0.00 0.00 0.00 3.86
4994 5022 2.590611 AGGTACATACTCCCTCCCTCAA 59.409 50.000 0.00 0.00 0.00 3.02
4995 5023 3.013648 AGGTACATACTCCCTCCCTCAAA 59.986 47.826 0.00 0.00 0.00 2.69
4996 5024 3.778629 GGTACATACTCCCTCCCTCAAAA 59.221 47.826 0.00 0.00 0.00 2.44
4997 5025 4.412528 GGTACATACTCCCTCCCTCAAAAT 59.587 45.833 0.00 0.00 0.00 1.82
4998 5026 5.605488 GGTACATACTCCCTCCCTCAAAATA 59.395 44.000 0.00 0.00 0.00 1.40
4999 5027 6.100714 GGTACATACTCCCTCCCTCAAAATAA 59.899 42.308 0.00 0.00 0.00 1.40
5000 5028 6.652205 ACATACTCCCTCCCTCAAAATAAA 57.348 37.500 0.00 0.00 0.00 1.40
5001 5029 7.226059 ACATACTCCCTCCCTCAAAATAAAT 57.774 36.000 0.00 0.00 0.00 1.40
5002 5030 7.062957 ACATACTCCCTCCCTCAAAATAAATG 58.937 38.462 0.00 0.00 0.00 2.32
5003 5031 5.536497 ACTCCCTCCCTCAAAATAAATGT 57.464 39.130 0.00 0.00 0.00 2.71
5004 5032 5.510430 ACTCCCTCCCTCAAAATAAATGTC 58.490 41.667 0.00 0.00 0.00 3.06
5005 5033 5.254032 ACTCCCTCCCTCAAAATAAATGTCT 59.746 40.000 0.00 0.00 0.00 3.41
5006 5034 6.152638 TCCCTCCCTCAAAATAAATGTCTT 57.847 37.500 0.00 0.00 0.00 3.01
5007 5035 5.951747 TCCCTCCCTCAAAATAAATGTCTTG 59.048 40.000 0.00 0.00 0.00 3.02
5008 5036 5.951747 CCCTCCCTCAAAATAAATGTCTTGA 59.048 40.000 0.00 0.00 0.00 3.02
5009 5037 6.127619 CCCTCCCTCAAAATAAATGTCTTGAC 60.128 42.308 0.00 0.00 0.00 3.18
5010 5038 6.127619 CCTCCCTCAAAATAAATGTCTTGACC 60.128 42.308 0.00 0.00 0.00 4.02
5011 5039 6.552008 TCCCTCAAAATAAATGTCTTGACCT 58.448 36.000 0.00 0.00 0.00 3.85
5012 5040 7.010160 TCCCTCAAAATAAATGTCTTGACCTT 58.990 34.615 0.00 0.00 0.00 3.50
5013 5041 8.167392 TCCCTCAAAATAAATGTCTTGACCTTA 58.833 33.333 0.00 0.00 0.00 2.69
5014 5042 8.802267 CCCTCAAAATAAATGTCTTGACCTTAA 58.198 33.333 0.00 0.00 0.00 1.85
5063 5091 8.934023 ATAAAGTTGAGACACTTATTTTGGGA 57.066 30.769 0.00 0.00 35.87 4.37
5064 5092 6.635030 AAGTTGAGACACTTATTTTGGGAC 57.365 37.500 0.00 0.00 35.10 4.46
5065 5093 4.755123 AGTTGAGACACTTATTTTGGGACG 59.245 41.667 0.00 0.00 0.00 4.79
5066 5094 3.670625 TGAGACACTTATTTTGGGACGG 58.329 45.455 0.00 0.00 0.00 4.79
5067 5095 3.325425 TGAGACACTTATTTTGGGACGGA 59.675 43.478 0.00 0.00 0.00 4.69
5068 5096 3.933332 GAGACACTTATTTTGGGACGGAG 59.067 47.826 0.00 0.00 0.00 4.63
5069 5097 3.007635 GACACTTATTTTGGGACGGAGG 58.992 50.000 0.00 0.00 0.00 4.30
5070 5098 2.640826 ACACTTATTTTGGGACGGAGGA 59.359 45.455 0.00 0.00 0.00 3.71
5071 5099 3.073356 ACACTTATTTTGGGACGGAGGAA 59.927 43.478 0.00 0.00 0.00 3.36
5072 5100 3.689649 CACTTATTTTGGGACGGAGGAAG 59.310 47.826 0.00 0.00 0.00 3.46
5073 5101 3.329814 ACTTATTTTGGGACGGAGGAAGT 59.670 43.478 0.00 0.00 0.00 3.01
5074 5102 4.533311 ACTTATTTTGGGACGGAGGAAGTA 59.467 41.667 0.00 0.00 0.00 2.24
5075 5103 5.191124 ACTTATTTTGGGACGGAGGAAGTAT 59.809 40.000 0.00 0.00 0.00 2.12
5076 5104 6.384886 ACTTATTTTGGGACGGAGGAAGTATA 59.615 38.462 0.00 0.00 0.00 1.47
5077 5105 4.476628 TTTTGGGACGGAGGAAGTATAC 57.523 45.455 0.00 0.00 0.00 1.47
5078 5106 1.683943 TGGGACGGAGGAAGTATACG 58.316 55.000 0.00 0.00 0.00 3.06
5079 5107 0.313357 GGGACGGAGGAAGTATACGC 59.687 60.000 0.00 0.00 0.00 4.42
5080 5108 0.040603 GGACGGAGGAAGTATACGCG 60.041 60.000 3.53 3.53 0.00 6.01
5081 5109 0.940126 GACGGAGGAAGTATACGCGA 59.060 55.000 15.93 0.00 0.00 5.87
5082 5110 0.942962 ACGGAGGAAGTATACGCGAG 59.057 55.000 15.93 0.00 0.00 5.03
5094 5122 3.251817 ACGCGAGTGAATGATACGG 57.748 52.632 15.93 0.00 46.97 4.02
5095 5123 0.736636 ACGCGAGTGAATGATACGGA 59.263 50.000 15.93 0.00 46.97 4.69
5096 5124 1.337071 ACGCGAGTGAATGATACGGAT 59.663 47.619 15.93 0.00 46.97 4.18
5097 5125 1.979469 CGCGAGTGAATGATACGGATC 59.021 52.381 0.00 0.00 0.00 3.36
5098 5126 2.604614 CGCGAGTGAATGATACGGATCA 60.605 50.000 13.92 13.92 46.13 2.92
5109 5137 5.337578 TGATACGGATCATGAACACTTGA 57.662 39.130 6.12 0.00 37.15 3.02
5110 5138 5.917462 TGATACGGATCATGAACACTTGAT 58.083 37.500 6.12 0.00 37.15 2.57
5111 5139 5.985530 TGATACGGATCATGAACACTTGATC 59.014 40.000 6.12 13.79 44.84 2.92
5112 5140 3.190079 ACGGATCATGAACACTTGATCG 58.810 45.455 0.00 13.17 45.96 3.69
5113 5141 3.119137 ACGGATCATGAACACTTGATCGA 60.119 43.478 0.00 0.00 45.96 3.59
5114 5142 4.053983 CGGATCATGAACACTTGATCGAT 58.946 43.478 0.00 0.00 45.96 3.59
5115 5143 4.149571 CGGATCATGAACACTTGATCGATC 59.850 45.833 18.72 18.72 45.96 3.69
5116 5144 5.052481 GGATCATGAACACTTGATCGATCA 58.948 41.667 23.99 23.99 45.96 2.92
5117 5145 5.177142 GGATCATGAACACTTGATCGATCAG 59.823 44.000 25.95 21.26 45.96 2.90
5118 5146 4.436332 TCATGAACACTTGATCGATCAGG 58.564 43.478 29.73 29.73 38.19 3.86
5119 5147 3.961480 TGAACACTTGATCGATCAGGT 57.039 42.857 30.96 30.96 46.36 4.00
5120 5148 5.127031 TCATGAACACTTGATCGATCAGGTA 59.873 40.000 34.23 23.03 44.04 3.08
5121 5149 5.400066 TGAACACTTGATCGATCAGGTAA 57.600 39.130 34.23 20.85 44.04 2.85
5122 5150 5.789521 TGAACACTTGATCGATCAGGTAAA 58.210 37.500 34.23 20.56 44.04 2.01
5123 5151 5.637810 TGAACACTTGATCGATCAGGTAAAC 59.362 40.000 34.23 26.77 44.04 2.01
5124 5152 5.147330 ACACTTGATCGATCAGGTAAACA 57.853 39.130 34.23 16.21 44.04 2.83
5125 5153 5.171476 ACACTTGATCGATCAGGTAAACAG 58.829 41.667 34.23 25.45 44.04 3.16
5126 5154 4.033358 CACTTGATCGATCAGGTAAACAGC 59.967 45.833 34.23 4.30 44.04 4.40
5127 5155 4.081420 ACTTGATCGATCAGGTAAACAGCT 60.081 41.667 34.01 13.03 44.04 4.24
5128 5156 5.127194 ACTTGATCGATCAGGTAAACAGCTA 59.873 40.000 34.01 13.30 44.04 3.32
5129 5157 5.592104 TGATCGATCAGGTAAACAGCTAA 57.408 39.130 23.99 0.00 32.11 3.09
5130 5158 5.972935 TGATCGATCAGGTAAACAGCTAAA 58.027 37.500 23.99 0.00 32.11 1.85
5131 5159 5.810587 TGATCGATCAGGTAAACAGCTAAAC 59.189 40.000 23.99 0.00 32.11 2.01
5132 5160 5.142061 TCGATCAGGTAAACAGCTAAACA 57.858 39.130 0.00 0.00 0.00 2.83
5133 5161 5.543714 TCGATCAGGTAAACAGCTAAACAA 58.456 37.500 0.00 0.00 0.00 2.83
5134 5162 5.407387 TCGATCAGGTAAACAGCTAAACAAC 59.593 40.000 0.00 0.00 0.00 3.32
5135 5163 5.390567 CGATCAGGTAAACAGCTAAACAACC 60.391 44.000 0.00 0.00 0.00 3.77
5136 5164 5.043737 TCAGGTAAACAGCTAAACAACCT 57.956 39.130 0.00 0.00 36.31 3.50
5137 5165 5.061179 TCAGGTAAACAGCTAAACAACCTC 58.939 41.667 4.46 0.00 33.67 3.85
5138 5166 4.819630 CAGGTAAACAGCTAAACAACCTCA 59.180 41.667 4.46 0.00 33.67 3.86
5139 5167 5.049405 CAGGTAAACAGCTAAACAACCTCAG 60.049 44.000 4.46 0.00 33.67 3.35
5140 5168 3.990318 AAACAGCTAAACAACCTCAGC 57.010 42.857 0.00 0.00 0.00 4.26
5141 5169 2.638480 ACAGCTAAACAACCTCAGCA 57.362 45.000 0.00 0.00 36.47 4.41
5142 5170 2.930950 ACAGCTAAACAACCTCAGCAA 58.069 42.857 0.00 0.00 36.47 3.91
5143 5171 3.490348 ACAGCTAAACAACCTCAGCAAT 58.510 40.909 0.00 0.00 36.47 3.56
5144 5172 3.503748 ACAGCTAAACAACCTCAGCAATC 59.496 43.478 0.00 0.00 36.47 2.67
5145 5173 3.503363 CAGCTAAACAACCTCAGCAATCA 59.497 43.478 0.00 0.00 36.47 2.57
5146 5174 3.755378 AGCTAAACAACCTCAGCAATCAG 59.245 43.478 0.00 0.00 36.47 2.90
5147 5175 3.503748 GCTAAACAACCTCAGCAATCAGT 59.496 43.478 0.00 0.00 34.13 3.41
5148 5176 3.996150 AAACAACCTCAGCAATCAGTG 57.004 42.857 0.00 0.00 0.00 3.66
5149 5177 2.645838 ACAACCTCAGCAATCAGTGT 57.354 45.000 0.00 0.00 0.00 3.55
5150 5178 2.224606 ACAACCTCAGCAATCAGTGTG 58.775 47.619 0.00 0.00 0.00 3.82
5151 5179 1.068748 CAACCTCAGCAATCAGTGTGC 60.069 52.381 0.00 0.00 42.55 4.57
5152 5180 0.109153 ACCTCAGCAATCAGTGTGCA 59.891 50.000 8.29 0.00 44.74 4.57
5153 5181 0.803117 CCTCAGCAATCAGTGTGCAG 59.197 55.000 8.29 0.69 44.74 4.41
5154 5182 1.520494 CTCAGCAATCAGTGTGCAGT 58.480 50.000 8.29 0.00 44.74 4.40
5155 5183 1.197036 CTCAGCAATCAGTGTGCAGTG 59.803 52.381 8.29 0.80 44.74 3.66
5156 5184 0.386858 CAGCAATCAGTGTGCAGTGC 60.387 55.000 8.58 8.58 44.74 4.40
5157 5185 0.820482 AGCAATCAGTGTGCAGTGCA 60.820 50.000 15.37 15.37 44.74 4.57
5170 5198 4.486125 TGCAGTGCACCATAAGATAAGA 57.514 40.909 15.37 0.00 31.71 2.10
5171 5199 4.842574 TGCAGTGCACCATAAGATAAGAA 58.157 39.130 15.37 0.00 31.71 2.52
5172 5200 5.439721 TGCAGTGCACCATAAGATAAGAAT 58.560 37.500 15.37 0.00 31.71 2.40
5173 5201 5.887598 TGCAGTGCACCATAAGATAAGAATT 59.112 36.000 15.37 0.00 31.71 2.17
5174 5202 7.053498 TGCAGTGCACCATAAGATAAGAATTA 58.947 34.615 15.37 0.00 31.71 1.40
5175 5203 7.555914 TGCAGTGCACCATAAGATAAGAATTAA 59.444 33.333 15.37 0.00 29.97 1.40
5176 5204 8.072567 GCAGTGCACCATAAGATAAGAATTAAG 58.927 37.037 14.63 0.00 32.17 1.85
5177 5205 8.072567 CAGTGCACCATAAGATAAGAATTAAGC 58.927 37.037 14.63 0.00 32.17 3.09
5178 5206 7.995488 AGTGCACCATAAGATAAGAATTAAGCT 59.005 33.333 14.63 0.00 32.17 3.74
5179 5207 9.273016 GTGCACCATAAGATAAGAATTAAGCTA 57.727 33.333 5.22 0.00 32.17 3.32
5180 5208 9.845740 TGCACCATAAGATAAGAATTAAGCTAA 57.154 29.630 0.00 0.00 32.17 3.09
5187 5215 8.792830 AAGATAAGAATTAAGCTAAGCACACA 57.207 30.769 0.00 0.00 32.17 3.72
5188 5216 8.202745 AGATAAGAATTAAGCTAAGCACACAC 57.797 34.615 0.00 0.00 32.17 3.82
5189 5217 5.629079 AAGAATTAAGCTAAGCACACACC 57.371 39.130 0.00 0.00 0.00 4.16
5190 5218 4.651778 AGAATTAAGCTAAGCACACACCA 58.348 39.130 0.00 0.00 0.00 4.17
5191 5219 5.256474 AGAATTAAGCTAAGCACACACCAT 58.744 37.500 0.00 0.00 0.00 3.55
5192 5220 6.414732 AGAATTAAGCTAAGCACACACCATA 58.585 36.000 0.00 0.00 0.00 2.74
5193 5221 7.056635 AGAATTAAGCTAAGCACACACCATAT 58.943 34.615 0.00 0.00 0.00 1.78
5194 5222 6.867662 ATTAAGCTAAGCACACACCATATC 57.132 37.500 0.00 0.00 0.00 1.63
5195 5223 4.494091 AAGCTAAGCACACACCATATCT 57.506 40.909 0.00 0.00 0.00 1.98
5196 5224 5.614324 AAGCTAAGCACACACCATATCTA 57.386 39.130 0.00 0.00 0.00 1.98
5197 5225 5.815233 AGCTAAGCACACACCATATCTAT 57.185 39.130 0.00 0.00 0.00 1.98
5198 5226 6.918067 AGCTAAGCACACACCATATCTATA 57.082 37.500 0.00 0.00 0.00 1.31
5199 5227 7.487822 AGCTAAGCACACACCATATCTATAT 57.512 36.000 0.00 0.00 0.00 0.86
5200 5228 7.551585 AGCTAAGCACACACCATATCTATATC 58.448 38.462 0.00 0.00 0.00 1.63
5201 5229 7.398618 AGCTAAGCACACACCATATCTATATCT 59.601 37.037 0.00 0.00 0.00 1.98
5202 5230 8.687242 GCTAAGCACACACCATATCTATATCTA 58.313 37.037 0.00 0.00 0.00 1.98
<
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.299013 GGTAGCCGATCATGGTGATGTA 59.701 50.000 0.00 0.00 37.20 2.29
1 2 1.070758 GGTAGCCGATCATGGTGATGT 59.929 52.381 0.00 0.00 37.20 3.06
2 3 1.345741 AGGTAGCCGATCATGGTGATG 59.654 52.381 0.00 0.00 37.20 3.07
3 4 1.620819 GAGGTAGCCGATCATGGTGAT 59.379 52.381 0.00 0.00 40.34 3.06
4 5 1.040646 GAGGTAGCCGATCATGGTGA 58.959 55.000 0.00 0.00 0.00 4.02
5 6 0.319040 CGAGGTAGCCGATCATGGTG 60.319 60.000 0.00 0.00 0.00 4.17
6 7 1.464376 CCGAGGTAGCCGATCATGGT 61.464 60.000 0.00 0.00 0.00 3.55
7 8 1.290324 CCGAGGTAGCCGATCATGG 59.710 63.158 0.00 0.00 0.00 3.66
8 9 1.373497 GCCGAGGTAGCCGATCATG 60.373 63.158 4.67 0.00 0.00 3.07
9 10 2.920645 CGCCGAGGTAGCCGATCAT 61.921 63.158 4.67 0.00 0.00 2.45
10 11 3.592814 CGCCGAGGTAGCCGATCA 61.593 66.667 4.67 0.00 0.00 2.92
11 12 3.135056 AACGCCGAGGTAGCCGATC 62.135 63.158 0.00 0.00 0.00 3.69
12 13 3.145551 AACGCCGAGGTAGCCGAT 61.146 61.111 0.00 0.00 0.00 4.18
13 14 4.124351 CAACGCCGAGGTAGCCGA 62.124 66.667 0.00 0.00 0.00 5.54
14 15 4.124351 TCAACGCCGAGGTAGCCG 62.124 66.667 0.00 0.00 0.00 5.52
15 16 2.508663 GTCAACGCCGAGGTAGCC 60.509 66.667 0.00 0.00 0.00 3.93
16 17 0.739813 AATGTCAACGCCGAGGTAGC 60.740 55.000 0.00 0.00 0.00 3.58
17 18 2.572191 TAATGTCAACGCCGAGGTAG 57.428 50.000 0.00 0.00 0.00 3.18
18 19 3.191669 CATTAATGTCAACGCCGAGGTA 58.808 45.455 7.32 0.00 0.00 3.08
19 20 2.006888 CATTAATGTCAACGCCGAGGT 58.993 47.619 7.32 0.00 0.00 3.85
20 21 1.330521 CCATTAATGTCAACGCCGAGG 59.669 52.381 14.25 0.00 0.00 4.63
21 22 1.268032 GCCATTAATGTCAACGCCGAG 60.268 52.381 14.25 0.00 0.00 4.63
22 23 0.730265 GCCATTAATGTCAACGCCGA 59.270 50.000 14.25 0.00 0.00 5.54
23 24 0.732571 AGCCATTAATGTCAACGCCG 59.267 50.000 14.25 0.00 0.00 6.46
24 25 2.286184 CGTAGCCATTAATGTCAACGCC 60.286 50.000 14.25 0.00 0.00 5.68
25 26 2.350498 ACGTAGCCATTAATGTCAACGC 59.650 45.455 22.84 15.56 31.53 4.84
26 27 3.863424 AGACGTAGCCATTAATGTCAACG 59.137 43.478 21.98 21.98 33.30 4.10
27 28 7.148787 GCTATAGACGTAGCCATTAATGTCAAC 60.149 40.741 14.25 7.72 40.92 3.18
28 29 6.866770 GCTATAGACGTAGCCATTAATGTCAA 59.133 38.462 14.25 0.00 40.92 3.18
29 30 6.015772 TGCTATAGACGTAGCCATTAATGTCA 60.016 38.462 14.25 0.00 45.07 3.58
30 31 6.387465 TGCTATAGACGTAGCCATTAATGTC 58.613 40.000 14.25 1.07 45.07 3.06
31 32 6.340962 TGCTATAGACGTAGCCATTAATGT 57.659 37.500 14.25 0.00 45.07 2.71
32 33 6.868864 AGTTGCTATAGACGTAGCCATTAATG 59.131 38.462 8.58 8.58 45.07 1.90
33 34 6.994221 AGTTGCTATAGACGTAGCCATTAAT 58.006 36.000 3.21 0.00 45.07 1.40
34 35 6.040054 TGAGTTGCTATAGACGTAGCCATTAA 59.960 38.462 3.21 0.00 45.07 1.40
35 36 5.533528 TGAGTTGCTATAGACGTAGCCATTA 59.466 40.000 3.21 0.00 45.07 1.90
36 37 4.341235 TGAGTTGCTATAGACGTAGCCATT 59.659 41.667 3.21 0.00 45.07 3.16
37 38 3.889538 TGAGTTGCTATAGACGTAGCCAT 59.110 43.478 3.21 0.00 45.07 4.40
38 39 3.284617 TGAGTTGCTATAGACGTAGCCA 58.715 45.455 3.21 0.00 45.07 4.75
39 40 3.984508 TGAGTTGCTATAGACGTAGCC 57.015 47.619 3.21 0.00 45.07 3.93
40 41 4.152526 CGATGAGTTGCTATAGACGTAGC 58.847 47.826 3.21 0.98 45.71 3.58
41 42 4.713806 CCGATGAGTTGCTATAGACGTAG 58.286 47.826 3.21 0.00 0.00 3.51
42 43 3.058432 GCCGATGAGTTGCTATAGACGTA 60.058 47.826 3.21 0.00 0.00 3.57
43 44 2.287668 GCCGATGAGTTGCTATAGACGT 60.288 50.000 3.21 0.00 0.00 4.34
44 45 2.287608 TGCCGATGAGTTGCTATAGACG 60.288 50.000 3.21 0.00 0.00 4.18
45 46 3.371102 TGCCGATGAGTTGCTATAGAC 57.629 47.619 3.21 0.00 0.00 2.59
46 47 3.132111 TGTTGCCGATGAGTTGCTATAGA 59.868 43.478 3.21 0.00 0.00 1.98
47 48 3.457234 TGTTGCCGATGAGTTGCTATAG 58.543 45.455 0.00 0.00 0.00 1.31
48 49 3.535280 TGTTGCCGATGAGTTGCTATA 57.465 42.857 0.00 0.00 0.00 1.31
49 50 2.401583 TGTTGCCGATGAGTTGCTAT 57.598 45.000 0.00 0.00 0.00 2.97
50 51 1.804151 GTTGTTGCCGATGAGTTGCTA 59.196 47.619 0.00 0.00 0.00 3.49
51 52 0.593128 GTTGTTGCCGATGAGTTGCT 59.407 50.000 0.00 0.00 0.00 3.91
52 53 0.593128 AGTTGTTGCCGATGAGTTGC 59.407 50.000 0.00 0.00 0.00 4.17
53 54 1.197721 GGAGTTGTTGCCGATGAGTTG 59.802 52.381 0.00 0.00 0.00 3.16
54 55 1.202758 TGGAGTTGTTGCCGATGAGTT 60.203 47.619 0.00 0.00 0.00 3.01
55 56 0.396435 TGGAGTTGTTGCCGATGAGT 59.604 50.000 0.00 0.00 0.00 3.41
56 57 1.081892 CTGGAGTTGTTGCCGATGAG 58.918 55.000 0.00 0.00 0.00 2.90
57 58 0.396435 ACTGGAGTTGTTGCCGATGA 59.604 50.000 0.00 0.00 0.00 2.92
58 59 0.798776 GACTGGAGTTGTTGCCGATG 59.201 55.000 0.00 0.00 0.00 3.84
59 60 0.396435 TGACTGGAGTTGTTGCCGAT 59.604 50.000 0.00 0.00 0.00 4.18
60 61 0.179234 TTGACTGGAGTTGTTGCCGA 59.821 50.000 0.00 0.00 0.00 5.54
61 62 0.307760 GTTGACTGGAGTTGTTGCCG 59.692 55.000 0.00 0.00 0.00 5.69
62 63 1.334869 CTGTTGACTGGAGTTGTTGCC 59.665 52.381 0.00 0.00 0.00 4.52
63 64 1.268743 GCTGTTGACTGGAGTTGTTGC 60.269 52.381 0.00 0.00 0.00 4.17
64 65 1.003545 CGCTGTTGACTGGAGTTGTTG 60.004 52.381 0.00 0.00 0.00 3.33
65 66 1.299541 CGCTGTTGACTGGAGTTGTT 58.700 50.000 0.00 0.00 0.00 2.83
66 67 0.178068 ACGCTGTTGACTGGAGTTGT 59.822 50.000 0.00 0.00 0.00 3.32
67 68 0.861837 GACGCTGTTGACTGGAGTTG 59.138 55.000 0.00 0.00 0.00 3.16
68 69 0.249911 GGACGCTGTTGACTGGAGTT 60.250 55.000 0.00 0.00 0.00 3.01
69 70 1.367840 GGACGCTGTTGACTGGAGT 59.632 57.895 0.00 0.00 0.00 3.85
70 71 1.734477 CGGACGCTGTTGACTGGAG 60.734 63.158 0.00 0.00 0.00 3.86
71 72 2.338620 CGGACGCTGTTGACTGGA 59.661 61.111 0.00 0.00 0.00 3.86
72 73 3.414700 GCGGACGCTGTTGACTGG 61.415 66.667 9.76 0.00 38.26 4.00
73 74 3.767230 CGCGGACGCTGTTGACTG 61.767 66.667 15.11 0.00 39.32 3.51
74 75 4.280494 ACGCGGACGCTGTTGACT 62.280 61.111 12.47 0.00 45.53 3.41
75 76 3.764049 GACGCGGACGCTGTTGAC 61.764 66.667 12.47 0.00 45.53 3.18
82 83 4.450122 TAGTGACGACGCGGACGC 62.450 66.667 23.10 17.09 45.53 5.19
84 85 2.576317 GCTAGTGACGACGCGGAC 60.576 66.667 12.47 2.84 0.00 4.79
85 86 4.156622 CGCTAGTGACGACGCGGA 62.157 66.667 12.47 0.00 41.72 5.54
88 89 2.576317 GGACGCTAGTGACGACGC 60.576 66.667 10.99 0.00 0.00 5.19
89 90 1.511464 GTGGACGCTAGTGACGACG 60.511 63.158 10.99 0.00 0.00 5.12
90 91 1.511464 CGTGGACGCTAGTGACGAC 60.511 63.158 10.99 10.42 35.82 4.34
91 92 2.865308 CGTGGACGCTAGTGACGA 59.135 61.111 10.99 0.00 35.82 4.20
108 109 4.008933 AGTCACAGCGGGAGTGGC 62.009 66.667 0.00 0.00 41.73 5.01
109 110 2.047844 CAGTCACAGCGGGAGTGG 60.048 66.667 7.49 0.00 37.58 4.00
110 111 2.740055 GCAGTCACAGCGGGAGTG 60.740 66.667 10.18 10.18 38.46 3.51
117 118 4.767255 CCCTCCCGCAGTCACAGC 62.767 72.222 0.00 0.00 0.00 4.40
118 119 1.903877 ATTCCCTCCCGCAGTCACAG 61.904 60.000 0.00 0.00 0.00 3.66
119 120 0.616395 TATTCCCTCCCGCAGTCACA 60.616 55.000 0.00 0.00 0.00 3.58
120 121 0.105039 CTATTCCCTCCCGCAGTCAC 59.895 60.000 0.00 0.00 0.00 3.67
121 122 0.032515 TCTATTCCCTCCCGCAGTCA 60.033 55.000 0.00 0.00 0.00 3.41
122 123 0.676736 CTCTATTCCCTCCCGCAGTC 59.323 60.000 0.00 0.00 0.00 3.51
123 124 0.261991 TCTCTATTCCCTCCCGCAGT 59.738 55.000 0.00 0.00 0.00 4.40
124 125 1.342819 CTTCTCTATTCCCTCCCGCAG 59.657 57.143 0.00 0.00 0.00 5.18
125 126 1.414158 CTTCTCTATTCCCTCCCGCA 58.586 55.000 0.00 0.00 0.00 5.69
126 127 0.682292 CCTTCTCTATTCCCTCCCGC 59.318 60.000 0.00 0.00 0.00 6.13
127 128 0.682292 GCCTTCTCTATTCCCTCCCG 59.318 60.000 0.00 0.00 0.00 5.14
128 129 1.696884 CTGCCTTCTCTATTCCCTCCC 59.303 57.143 0.00 0.00 0.00 4.30
129 130 1.696884 CCTGCCTTCTCTATTCCCTCC 59.303 57.143 0.00 0.00 0.00 4.30
130 131 2.683768 TCCTGCCTTCTCTATTCCCTC 58.316 52.381 0.00 0.00 0.00 4.30
131 132 2.877154 TCCTGCCTTCTCTATTCCCT 57.123 50.000 0.00 0.00 0.00 4.20
132 133 2.105649 CCTTCCTGCCTTCTCTATTCCC 59.894 54.545 0.00 0.00 0.00 3.97
133 134 2.486370 GCCTTCCTGCCTTCTCTATTCC 60.486 54.545 0.00 0.00 0.00 3.01
134 135 2.171448 TGCCTTCCTGCCTTCTCTATTC 59.829 50.000 0.00 0.00 0.00 1.75
135 136 2.092699 GTGCCTTCCTGCCTTCTCTATT 60.093 50.000 0.00 0.00 0.00 1.73
136 137 1.488393 GTGCCTTCCTGCCTTCTCTAT 59.512 52.381 0.00 0.00 0.00 1.98
137 138 0.905357 GTGCCTTCCTGCCTTCTCTA 59.095 55.000 0.00 0.00 0.00 2.43
138 139 1.682257 GTGCCTTCCTGCCTTCTCT 59.318 57.895 0.00 0.00 0.00 3.10
139 140 1.377856 GGTGCCTTCCTGCCTTCTC 60.378 63.158 0.00 0.00 0.00 2.87
140 141 2.134630 CTGGTGCCTTCCTGCCTTCT 62.135 60.000 0.00 0.00 0.00 2.85
141 142 1.676967 CTGGTGCCTTCCTGCCTTC 60.677 63.158 0.00 0.00 0.00 3.46
142 143 1.719063 TTCTGGTGCCTTCCTGCCTT 61.719 55.000 0.00 0.00 0.00 4.35
143 144 2.134630 CTTCTGGTGCCTTCCTGCCT 62.135 60.000 0.00 0.00 0.00 4.75
144 145 1.676967 CTTCTGGTGCCTTCCTGCC 60.677 63.158 0.00 0.00 0.00 4.85
145 146 1.676967 CCTTCTGGTGCCTTCCTGC 60.677 63.158 0.00 0.00 0.00 4.85
146 147 1.001641 CCCTTCTGGTGCCTTCCTG 60.002 63.158 0.00 0.00 0.00 3.86
147 148 2.234296 CCCCTTCTGGTGCCTTCCT 61.234 63.158 0.00 0.00 0.00 3.36
148 149 2.231380 TCCCCTTCTGGTGCCTTCC 61.231 63.158 0.00 0.00 0.00 3.46
149 150 1.002011 GTCCCCTTCTGGTGCCTTC 60.002 63.158 0.00 0.00 0.00 3.46
150 151 2.895424 CGTCCCCTTCTGGTGCCTT 61.895 63.158 0.00 0.00 0.00 4.35
151 152 3.322466 CGTCCCCTTCTGGTGCCT 61.322 66.667 0.00 0.00 0.00 4.75
153 154 4.329545 TGCGTCCCCTTCTGGTGC 62.330 66.667 0.00 0.00 0.00 5.01
154 155 1.541310 TACTGCGTCCCCTTCTGGTG 61.541 60.000 0.00 0.00 0.00 4.17
155 156 0.834687 TTACTGCGTCCCCTTCTGGT 60.835 55.000 0.00 0.00 0.00 4.00
156 157 0.391263 GTTACTGCGTCCCCTTCTGG 60.391 60.000 0.00 0.00 0.00 3.86
157 158 0.391263 GGTTACTGCGTCCCCTTCTG 60.391 60.000 0.00 0.00 0.00 3.02
158 159 1.885163 CGGTTACTGCGTCCCCTTCT 61.885 60.000 0.00 0.00 0.00 2.85
159 160 1.447314 CGGTTACTGCGTCCCCTTC 60.447 63.158 0.00 0.00 0.00 3.46
160 161 2.660802 CGGTTACTGCGTCCCCTT 59.339 61.111 0.00 0.00 0.00 3.95
161 162 4.078516 GCGGTTACTGCGTCCCCT 62.079 66.667 0.00 0.00 0.00 4.79
164 165 2.624437 CTAGGGCGGTTACTGCGTCC 62.624 65.000 10.25 6.72 0.00 4.79
165 166 1.226888 CTAGGGCGGTTACTGCGTC 60.227 63.158 10.25 5.15 0.00 5.19
166 167 2.718073 CCTAGGGCGGTTACTGCGT 61.718 63.158 10.25 2.57 0.00 5.24
167 168 2.106332 CCTAGGGCGGTTACTGCG 59.894 66.667 10.25 0.00 0.00 5.18
168 169 1.153429 CACCTAGGGCGGTTACTGC 60.153 63.158 14.81 7.78 34.29 4.40
169 170 1.520666 CCACCTAGGGCGGTTACTG 59.479 63.158 14.81 0.00 34.29 2.74
170 171 2.364780 GCCACCTAGGGCGGTTACT 61.365 63.158 14.81 0.00 45.40 2.24
171 172 2.188731 GCCACCTAGGGCGGTTAC 59.811 66.667 14.81 0.00 45.40 2.50
178 179 2.768344 ATGGGTCGCCACCTAGGG 60.768 66.667 14.81 1.73 43.22 3.53
179 180 2.032860 CTGATGGGTCGCCACCTAGG 62.033 65.000 7.41 7.41 43.22 3.02
180 181 1.043116 TCTGATGGGTCGCCACCTAG 61.043 60.000 0.00 0.00 43.22 3.02
181 182 1.001120 TCTGATGGGTCGCCACCTA 59.999 57.895 0.00 0.00 43.22 3.08
182 183 2.284625 TCTGATGGGTCGCCACCT 60.285 61.111 0.00 0.00 43.22 4.00
183 184 2.187946 CTCTGATGGGTCGCCACC 59.812 66.667 0.00 0.00 42.90 4.61
184 185 1.153549 GTCTCTGATGGGTCGCCAC 60.154 63.158 0.00 0.00 0.00 5.01
185 186 2.710902 CGTCTCTGATGGGTCGCCA 61.711 63.158 0.00 0.00 0.00 5.69
186 187 2.105128 CGTCTCTGATGGGTCGCC 59.895 66.667 0.00 0.00 0.00 5.54
187 188 2.583593 GCGTCTCTGATGGGTCGC 60.584 66.667 0.00 0.00 37.17 5.19
188 189 1.226802 CTGCGTCTCTGATGGGTCG 60.227 63.158 0.00 0.00 0.00 4.79
189 190 0.247736 AACTGCGTCTCTGATGGGTC 59.752 55.000 0.00 0.00 0.00 4.46
190 191 0.036952 CAACTGCGTCTCTGATGGGT 60.037 55.000 0.00 0.00 0.00 4.51
191 192 0.247460 TCAACTGCGTCTCTGATGGG 59.753 55.000 0.00 0.00 0.00 4.00
192 193 1.931841 CATCAACTGCGTCTCTGATGG 59.068 52.381 10.15 0.00 40.87 3.51
193 194 2.884827 TCATCAACTGCGTCTCTGATG 58.115 47.619 11.22 11.22 44.24 3.07
194 195 3.455327 CATCATCAACTGCGTCTCTGAT 58.545 45.455 0.00 0.00 0.00 2.90
195 196 2.417787 CCATCATCAACTGCGTCTCTGA 60.418 50.000 0.00 0.00 0.00 3.27
196 197 1.931841 CCATCATCAACTGCGTCTCTG 59.068 52.381 0.00 0.00 0.00 3.35
197 198 1.741732 GCCATCATCAACTGCGTCTCT 60.742 52.381 0.00 0.00 0.00 3.10
198 199 0.654683 GCCATCATCAACTGCGTCTC 59.345 55.000 0.00 0.00 0.00 3.36
199 200 1.086067 CGCCATCATCAACTGCGTCT 61.086 55.000 0.00 0.00 40.33 4.18
200 201 1.349627 CGCCATCATCAACTGCGTC 59.650 57.895 0.00 0.00 40.33 5.19
201 202 3.489731 CGCCATCATCAACTGCGT 58.510 55.556 0.00 0.00 40.33 5.24
203 204 1.430632 CCACGCCATCATCAACTGC 59.569 57.895 0.00 0.00 0.00 4.40
204 205 1.430632 GCCACGCCATCATCAACTG 59.569 57.895 0.00 0.00 0.00 3.16
205 206 2.108514 CGCCACGCCATCATCAACT 61.109 57.895 0.00 0.00 0.00 3.16
206 207 2.404789 CGCCACGCCATCATCAAC 59.595 61.111 0.00 0.00 0.00 3.18
207 208 2.823593 CCGCCACGCCATCATCAA 60.824 61.111 0.00 0.00 0.00 2.57
208 209 3.738429 CTCCGCCACGCCATCATCA 62.738 63.158 0.00 0.00 0.00 3.07
209 210 2.923426 TTCTCCGCCACGCCATCATC 62.923 60.000 0.00 0.00 0.00 2.92
210 211 2.930385 CTTCTCCGCCACGCCATCAT 62.930 60.000 0.00 0.00 0.00 2.45
211 212 3.664025 CTTCTCCGCCACGCCATCA 62.664 63.158 0.00 0.00 0.00 3.07
212 213 2.892425 CTTCTCCGCCACGCCATC 60.892 66.667 0.00 0.00 0.00 3.51
213 214 3.390521 TCTTCTCCGCCACGCCAT 61.391 61.111 0.00 0.00 0.00 4.40
214 215 4.373116 GTCTTCTCCGCCACGCCA 62.373 66.667 0.00 0.00 0.00 5.69
216 217 4.415332 TCGTCTTCTCCGCCACGC 62.415 66.667 0.00 0.00 32.21 5.34
217 218 2.504244 GTCGTCTTCTCCGCCACG 60.504 66.667 0.00 0.00 0.00 4.94
218 219 2.504244 CGTCGTCTTCTCCGCCAC 60.504 66.667 0.00 0.00 0.00 5.01
219 220 3.744719 CCGTCGTCTTCTCCGCCA 61.745 66.667 0.00 0.00 0.00 5.69
220 221 4.493747 CCCGTCGTCTTCTCCGCC 62.494 72.222 0.00 0.00 0.00 6.13
221 222 3.398353 CTCCCGTCGTCTTCTCCGC 62.398 68.421 0.00 0.00 0.00 5.54
222 223 2.792599 CTCCCGTCGTCTTCTCCG 59.207 66.667 0.00 0.00 0.00 4.63
223 224 2.341101 TGCTCCCGTCGTCTTCTCC 61.341 63.158 0.00 0.00 0.00 3.71
224 225 1.153997 GTGCTCCCGTCGTCTTCTC 60.154 63.158 0.00 0.00 0.00 2.87
225 226 1.461091 TTGTGCTCCCGTCGTCTTCT 61.461 55.000 0.00 0.00 0.00 2.85
226 227 1.006571 TTGTGCTCCCGTCGTCTTC 60.007 57.895 0.00 0.00 0.00 2.87
227 228 1.006102 CTTGTGCTCCCGTCGTCTT 60.006 57.895 0.00 0.00 0.00 3.01
228 229 1.867919 CTCTTGTGCTCCCGTCGTCT 61.868 60.000 0.00 0.00 0.00 4.18
229 230 1.444553 CTCTTGTGCTCCCGTCGTC 60.445 63.158 0.00 0.00 0.00 4.20
230 231 1.745320 AACTCTTGTGCTCCCGTCGT 61.745 55.000 0.00 0.00 0.00 4.34
231 232 0.600255 AAACTCTTGTGCTCCCGTCG 60.600 55.000 0.00 0.00 0.00 5.12
232 233 2.450609 TAAACTCTTGTGCTCCCGTC 57.549 50.000 0.00 0.00 0.00 4.79
233 234 2.922740 TTAAACTCTTGTGCTCCCGT 57.077 45.000 0.00 0.00 0.00 5.28
234 235 4.215399 TGAATTTAAACTCTTGTGCTCCCG 59.785 41.667 0.00 0.00 0.00 5.14
235 236 5.241728 ACTGAATTTAAACTCTTGTGCTCCC 59.758 40.000 0.00 0.00 0.00 4.30
236 237 6.319141 ACTGAATTTAAACTCTTGTGCTCC 57.681 37.500 0.00 0.00 0.00 4.70
237 238 6.074005 CGACTGAATTTAAACTCTTGTGCTC 58.926 40.000 0.00 0.00 0.00 4.26
238 239 5.560953 GCGACTGAATTTAAACTCTTGTGCT 60.561 40.000 0.00 0.00 0.00 4.40
239 240 4.613031 GCGACTGAATTTAAACTCTTGTGC 59.387 41.667 0.00 1.87 0.00 4.57
240 241 5.147162 GGCGACTGAATTTAAACTCTTGTG 58.853 41.667 0.00 0.00 0.00 3.33
241 242 4.819630 TGGCGACTGAATTTAAACTCTTGT 59.180 37.500 0.00 0.00 0.00 3.16
242 243 5.356882 TGGCGACTGAATTTAAACTCTTG 57.643 39.130 0.00 0.00 0.00 3.02
243 244 5.163854 CGATGGCGACTGAATTTAAACTCTT 60.164 40.000 0.00 0.00 40.82 2.85
244 245 4.330074 CGATGGCGACTGAATTTAAACTCT 59.670 41.667 0.00 0.00 40.82 3.24
245 246 4.092968 ACGATGGCGACTGAATTTAAACTC 59.907 41.667 0.00 0.00 41.64 3.01
246 247 4.000988 ACGATGGCGACTGAATTTAAACT 58.999 39.130 0.00 0.00 41.64 2.66
247 248 4.331962 GACGATGGCGACTGAATTTAAAC 58.668 43.478 0.00 0.00 41.64 2.01
248 249 3.372822 GGACGATGGCGACTGAATTTAAA 59.627 43.478 0.00 0.00 41.64 1.52
249 250 2.933906 GGACGATGGCGACTGAATTTAA 59.066 45.455 0.00 0.00 41.64 1.52
250 251 2.093921 TGGACGATGGCGACTGAATTTA 60.094 45.455 0.00 0.00 41.64 1.40
251 252 1.338674 TGGACGATGGCGACTGAATTT 60.339 47.619 0.00 0.00 41.64 1.82
252 253 0.249120 TGGACGATGGCGACTGAATT 59.751 50.000 0.00 0.00 41.64 2.17
253 254 0.460284 GTGGACGATGGCGACTGAAT 60.460 55.000 0.00 0.00 41.64 2.57
254 255 1.080093 GTGGACGATGGCGACTGAA 60.080 57.895 0.00 0.00 41.64 3.02
255 256 1.532604 AAGTGGACGATGGCGACTGA 61.533 55.000 0.00 0.00 41.64 3.41
256 257 1.078759 GAAGTGGACGATGGCGACTG 61.079 60.000 0.00 0.00 41.64 3.51
257 258 1.215647 GAAGTGGACGATGGCGACT 59.784 57.895 0.00 0.00 41.64 4.18
258 259 1.080093 TGAAGTGGACGATGGCGAC 60.080 57.895 0.00 0.00 41.64 5.19
259 260 1.080093 GTGAAGTGGACGATGGCGA 60.080 57.895 0.00 0.00 41.64 5.54
260 261 1.078759 GAGTGAAGTGGACGATGGCG 61.079 60.000 0.00 0.00 44.79 5.69
261 262 0.741221 GGAGTGAAGTGGACGATGGC 60.741 60.000 0.00 0.00 0.00 4.40
262 263 0.108138 GGGAGTGAAGTGGACGATGG 60.108 60.000 0.00 0.00 0.00 3.51
263 264 0.458543 CGGGAGTGAAGTGGACGATG 60.459 60.000 0.00 0.00 0.00 3.84
264 265 1.890894 CGGGAGTGAAGTGGACGAT 59.109 57.895 0.00 0.00 0.00 3.73
265 266 2.927580 GCGGGAGTGAAGTGGACGA 61.928 63.158 0.00 0.00 0.00 4.20
266 267 1.592400 TAGCGGGAGTGAAGTGGACG 61.592 60.000 0.00 0.00 0.00 4.79
267 268 0.108756 GTAGCGGGAGTGAAGTGGAC 60.109 60.000 0.00 0.00 0.00 4.02
268 269 1.592400 CGTAGCGGGAGTGAAGTGGA 61.592 60.000 0.00 0.00 0.00 4.02
269 270 1.153823 CGTAGCGGGAGTGAAGTGG 60.154 63.158 0.00 0.00 0.00 4.00
270 271 0.456312 GTCGTAGCGGGAGTGAAGTG 60.456 60.000 0.00 0.00 0.00 3.16
271 272 0.608582 AGTCGTAGCGGGAGTGAAGT 60.609 55.000 0.00 0.00 0.00 3.01
272 273 0.179161 CAGTCGTAGCGGGAGTGAAG 60.179 60.000 4.19 0.00 37.07 3.02
273 274 0.607217 TCAGTCGTAGCGGGAGTGAA 60.607 55.000 8.99 0.00 40.05 3.18
274 275 1.002990 TCAGTCGTAGCGGGAGTGA 60.003 57.895 7.77 7.77 40.56 3.41
275 276 1.429825 CTCAGTCGTAGCGGGAGTG 59.570 63.158 3.92 3.92 36.42 3.51
276 277 1.749638 CCTCAGTCGTAGCGGGAGT 60.750 63.158 0.00 0.00 0.00 3.85
277 278 2.482333 CCCTCAGTCGTAGCGGGAG 61.482 68.421 0.00 0.00 37.05 4.30
278 279 2.439701 CCCTCAGTCGTAGCGGGA 60.440 66.667 0.00 0.00 37.05 5.14
279 280 3.528370 CCCCTCAGTCGTAGCGGG 61.528 72.222 0.00 0.00 34.62 6.13
280 281 1.601419 TTTCCCCTCAGTCGTAGCGG 61.601 60.000 0.00 0.00 0.00 5.52
281 282 0.460311 ATTTCCCCTCAGTCGTAGCG 59.540 55.000 0.00 0.00 0.00 4.26
282 283 1.207329 ACATTTCCCCTCAGTCGTAGC 59.793 52.381 0.00 0.00 0.00 3.58
283 284 3.611766 AACATTTCCCCTCAGTCGTAG 57.388 47.619 0.00 0.00 0.00 3.51
284 285 4.346730 TCTAACATTTCCCCTCAGTCGTA 58.653 43.478 0.00 0.00 0.00 3.43
285 286 3.170717 TCTAACATTTCCCCTCAGTCGT 58.829 45.455 0.00 0.00 0.00 4.34
286 287 3.887621 TCTAACATTTCCCCTCAGTCG 57.112 47.619 0.00 0.00 0.00 4.18
287 288 5.167303 ACTTCTAACATTTCCCCTCAGTC 57.833 43.478 0.00 0.00 0.00 3.51
288 289 6.893020 ATACTTCTAACATTTCCCCTCAGT 57.107 37.500 0.00 0.00 0.00 3.41
289 290 9.853177 AATTATACTTCTAACATTTCCCCTCAG 57.147 33.333 0.00 0.00 0.00 3.35
327 328 9.753674 CAATCCTATCTCTAACTCCTAATCTCT 57.246 37.037 0.00 0.00 0.00 3.10
328 329 8.966868 CCAATCCTATCTCTAACTCCTAATCTC 58.033 40.741 0.00 0.00 0.00 2.75
329 330 8.461033 ACCAATCCTATCTCTAACTCCTAATCT 58.539 37.037 0.00 0.00 0.00 2.40
330 331 8.658840 ACCAATCCTATCTCTAACTCCTAATC 57.341 38.462 0.00 0.00 0.00 1.75
331 332 9.453830 AAACCAATCCTATCTCTAACTCCTAAT 57.546 33.333 0.00 0.00 0.00 1.73
332 333 8.855804 AAACCAATCCTATCTCTAACTCCTAA 57.144 34.615 0.00 0.00 0.00 2.69
333 334 9.947189 TTAAACCAATCCTATCTCTAACTCCTA 57.053 33.333 0.00 0.00 0.00 2.94
334 335 8.855804 TTAAACCAATCCTATCTCTAACTCCT 57.144 34.615 0.00 0.00 0.00 3.69
335 336 9.327628 GTTTAAACCAATCCTATCTCTAACTCC 57.672 37.037 7.12 0.00 0.00 3.85
354 355 5.334337 GGGACAAGTCGTACATGGTTTAAAC 60.334 44.000 9.98 9.98 0.00 2.01
355 356 4.756135 GGGACAAGTCGTACATGGTTTAAA 59.244 41.667 0.00 0.00 0.00 1.52
356 357 4.317488 GGGACAAGTCGTACATGGTTTAA 58.683 43.478 0.00 0.00 0.00 1.52
357 358 3.306919 GGGGACAAGTCGTACATGGTTTA 60.307 47.826 0.00 0.00 0.00 2.01
358 359 2.551504 GGGGACAAGTCGTACATGGTTT 60.552 50.000 0.00 0.00 0.00 3.27
359 360 1.002773 GGGGACAAGTCGTACATGGTT 59.997 52.381 0.00 0.00 0.00 3.67
360 361 0.611714 GGGGACAAGTCGTACATGGT 59.388 55.000 0.00 0.00 0.00 3.55
361 362 0.902531 AGGGGACAAGTCGTACATGG 59.097 55.000 0.00 0.00 0.00 3.66
362 363 2.758979 AGTAGGGGACAAGTCGTACATG 59.241 50.000 0.00 0.00 0.00 3.21
363 364 3.022406 GAGTAGGGGACAAGTCGTACAT 58.978 50.000 0.00 0.00 0.00 2.29
364 365 2.440409 GAGTAGGGGACAAGTCGTACA 58.560 52.381 0.00 0.00 0.00 2.90
365 366 1.747924 GGAGTAGGGGACAAGTCGTAC 59.252 57.143 0.00 0.00 0.00 3.67
366 367 1.355381 TGGAGTAGGGGACAAGTCGTA 59.645 52.381 0.00 0.00 0.00 3.43
367 368 0.113776 TGGAGTAGGGGACAAGTCGT 59.886 55.000 0.00 0.00 0.00 4.34
368 369 1.263356 TTGGAGTAGGGGACAAGTCG 58.737 55.000 0.00 0.00 0.00 4.18
369 370 3.519913 AGATTTGGAGTAGGGGACAAGTC 59.480 47.826 0.00 0.00 32.01 3.01
370 371 3.519913 GAGATTTGGAGTAGGGGACAAGT 59.480 47.826 0.00 0.00 0.00 3.16
371 372 3.777522 AGAGATTTGGAGTAGGGGACAAG 59.222 47.826 0.00 0.00 0.00 3.16
372 373 3.803340 AGAGATTTGGAGTAGGGGACAA 58.197 45.455 0.00 0.00 0.00 3.18
373 374 3.491766 AGAGATTTGGAGTAGGGGACA 57.508 47.619 0.00 0.00 0.00 4.02
374 375 3.775316 TGAAGAGATTTGGAGTAGGGGAC 59.225 47.826 0.00 0.00 0.00 4.46
375 376 3.775316 GTGAAGAGATTTGGAGTAGGGGA 59.225 47.826 0.00 0.00 0.00 4.81
376 377 3.519510 TGTGAAGAGATTTGGAGTAGGGG 59.480 47.826 0.00 0.00 0.00 4.79
377 378 4.826274 TGTGAAGAGATTTGGAGTAGGG 57.174 45.455 0.00 0.00 0.00 3.53
378 379 7.989741 ACAATATGTGAAGAGATTTGGAGTAGG 59.010 37.037 0.00 0.00 0.00 3.18
379 380 8.954950 ACAATATGTGAAGAGATTTGGAGTAG 57.045 34.615 0.00 0.00 0.00 2.57
380 381 9.817809 GTACAATATGTGAAGAGATTTGGAGTA 57.182 33.333 0.00 0.00 0.00 2.59
381 382 8.543774 AGTACAATATGTGAAGAGATTTGGAGT 58.456 33.333 0.00 0.00 0.00 3.85
382 383 8.954950 AGTACAATATGTGAAGAGATTTGGAG 57.045 34.615 0.00 0.00 0.00 3.86
383 384 8.762645 AGAGTACAATATGTGAAGAGATTTGGA 58.237 33.333 0.00 0.00 0.00 3.53
384 385 8.954950 AGAGTACAATATGTGAAGAGATTTGG 57.045 34.615 0.00 0.00 0.00 3.28
401 402 9.475620 CAGGTGTGGGATATATATAGAGTACAA 57.524 37.037 0.00 0.00 0.00 2.41
402 403 8.059461 CCAGGTGTGGGATATATATAGAGTACA 58.941 40.741 0.00 0.00 40.67 2.90
403 404 8.466617 CCAGGTGTGGGATATATATAGAGTAC 57.533 42.308 0.00 0.00 40.67 2.73
419 420 0.692476 TTGATCTGACCCAGGTGTGG 59.308 55.000 0.00 0.00 44.56 4.17
420 421 2.795231 ATTGATCTGACCCAGGTGTG 57.205 50.000 0.00 0.00 31.51 3.82
421 422 5.428457 TGTTATATTGATCTGACCCAGGTGT 59.572 40.000 0.00 0.00 31.51 4.16
422 423 5.928976 TGTTATATTGATCTGACCCAGGTG 58.071 41.667 0.00 0.00 31.51 4.00
423 424 6.575244 TTGTTATATTGATCTGACCCAGGT 57.425 37.500 0.00 0.00 31.51 4.00
424 425 8.156820 TGTATTGTTATATTGATCTGACCCAGG 58.843 37.037 0.00 0.00 31.51 4.45
425 426 9.559732 TTGTATTGTTATATTGATCTGACCCAG 57.440 33.333 0.00 0.00 0.00 4.45
451 452 9.631257 TGTGGAAATTGTATGATGACTGAATAT 57.369 29.630 0.00 0.00 0.00 1.28
452 453 9.112725 CTGTGGAAATTGTATGATGACTGAATA 57.887 33.333 0.00 0.00 0.00 1.75
453 454 7.067859 CCTGTGGAAATTGTATGATGACTGAAT 59.932 37.037 0.00 0.00 0.00 2.57
454 455 6.375174 CCTGTGGAAATTGTATGATGACTGAA 59.625 38.462 0.00 0.00 0.00 3.02
455 456 5.882000 CCTGTGGAAATTGTATGATGACTGA 59.118 40.000 0.00 0.00 0.00 3.41
456 457 5.449588 GCCTGTGGAAATTGTATGATGACTG 60.450 44.000 0.00 0.00 0.00 3.51
457 458 4.641989 GCCTGTGGAAATTGTATGATGACT 59.358 41.667 0.00 0.00 0.00 3.41
458 459 4.496341 CGCCTGTGGAAATTGTATGATGAC 60.496 45.833 0.00 0.00 0.00 3.06
459 460 3.627123 CGCCTGTGGAAATTGTATGATGA 59.373 43.478 0.00 0.00 0.00 2.92
460 461 3.243168 CCGCCTGTGGAAATTGTATGATG 60.243 47.826 0.00 0.00 0.00 3.07
461 462 2.951642 CCGCCTGTGGAAATTGTATGAT 59.048 45.455 0.00 0.00 0.00 2.45
462 463 2.364632 CCGCCTGTGGAAATTGTATGA 58.635 47.619 0.00 0.00 0.00 2.15
463 464 1.202290 GCCGCCTGTGGAAATTGTATG 60.202 52.381 0.00 0.00 0.00 2.39
464 465 1.102978 GCCGCCTGTGGAAATTGTAT 58.897 50.000 0.00 0.00 0.00 2.29
465 466 0.037590 AGCCGCCTGTGGAAATTGTA 59.962 50.000 0.00 0.00 0.00 2.41
466 467 1.228552 AGCCGCCTGTGGAAATTGT 60.229 52.632 0.00 0.00 0.00 2.71
467 468 1.508088 GAGCCGCCTGTGGAAATTG 59.492 57.895 0.00 0.00 0.00 2.32
468 469 2.040544 CGAGCCGCCTGTGGAAATT 61.041 57.895 0.00 0.00 0.00 1.82
469 470 2.436646 CGAGCCGCCTGTGGAAAT 60.437 61.111 0.00 0.00 0.00 2.17
470 471 4.697756 CCGAGCCGCCTGTGGAAA 62.698 66.667 0.00 0.00 0.00 3.13
490 491 4.752879 TGTTGGCCTAGTCCGCGC 62.753 66.667 3.32 0.00 0.00 6.86
491 492 2.173669 CATGTTGGCCTAGTCCGCG 61.174 63.158 3.32 0.00 0.00 6.46
492 493 1.819632 CCATGTTGGCCTAGTCCGC 60.820 63.158 3.32 0.00 0.00 5.54
493 494 0.462047 GTCCATGTTGGCCTAGTCCG 60.462 60.000 3.32 0.00 37.47 4.79
494 495 0.618458 TGTCCATGTTGGCCTAGTCC 59.382 55.000 3.32 0.00 37.47 3.85
495 496 2.565841 GATGTCCATGTTGGCCTAGTC 58.434 52.381 3.32 0.00 37.47 2.59
496 497 1.134401 CGATGTCCATGTTGGCCTAGT 60.134 52.381 3.32 0.00 37.47 2.57
497 498 1.134401 ACGATGTCCATGTTGGCCTAG 60.134 52.381 3.32 0.00 37.47 3.02
498 499 0.908910 ACGATGTCCATGTTGGCCTA 59.091 50.000 3.32 0.00 37.47 3.93
499 500 0.677731 CACGATGTCCATGTTGGCCT 60.678 55.000 3.32 0.00 37.47 5.19
500 501 1.802636 CACGATGTCCATGTTGGCC 59.197 57.895 0.00 0.00 37.47 5.36
501 502 1.137404 GCACGATGTCCATGTTGGC 59.863 57.895 0.00 0.00 37.47 4.52
502 503 1.064505 GATGCACGATGTCCATGTTGG 59.935 52.381 0.00 0.00 39.43 3.77
503 504 1.738908 TGATGCACGATGTCCATGTTG 59.261 47.619 0.00 0.00 0.00 3.33